WO2020188602A1

WO2020188602A1 - Immunodominant protein based method for differentiating brucellosis-infected animals from vaccinated animals

Info

Publication number: WO2020188602A1
Application number: PCT/IN2020/050265
Authority: WO
Inventors: Girish K RADHAKRISHNAN
Original assignee: National Institute Of Animal Biotechnology
Priority date: 2019-03-21
Filing date: 2020-03-20
Publication date: 2020-09-24

Abstract

The present invention provides kits and devices for diagnosis of brucellosis and differentiation of infected animals from vaccinated animals. The invention represents an advancement in the field of immunoassay devices and kits. The proteins and peptide-based devices and kits disclosed in this invention have DIVA capabilities and can be used for differentiating Brucellosis-infected cattle from Brucella abortus S19-vaccinated cattle. Further, the devices and kits can be used for cost-effective, effective and efficient diagnosis of Brucellosis in a number of subjects with high sensitivity and specificity.

Description

IMMUNODOMINANT PROTEIN BASED METHOD FOR DIFFERENTIATING BRUCELLOSIS-INFECTED ANIMALS FROM VACCINATED ANIMALS

FIELD OF INVENTION

The present invention relates to the field of immunoassay devices, kits and methods. More specifically, the invention is directed towards proteins and peptides, devices, kits and methods for diagnosis of Brucellosis and differentiation of infected animals from animals vaccinated against Brucellosis.

BACKGROUND

Brucellosis is an infectious disease caused by bacteria of genus Brucella which affects humans as well as domestic and wild animals, leading to significant impact on public health and animal industry. Species belonging to genus Brucella infect a number of animal species, including cattle, sheep, goats, pigs, dogs and ruminant species such as camels, water buffaloes and yaks. Brucellosis is a serious veterinary and public health problem in many developing economies, such as India.

The Brucella species are classified based on their host and pathogenicity and many species have been recognized such as, B. melitensis (sheep and goats), B. abortus (cattle), B. suis (swine), B. canis (dogs), B. ovis (sheep), B. neotomae (wood rats), B. ceti (dolphins, porpoises and whales), B. pinnipedialis (seals), B. microti (common vole and foxes) and B. inopinata (infected human breast implant).

Prevention of brucellosis in humans is dependent on control of the disease in domestic livestock by mass vaccination. Though vaccination is a preferred method of preventing the outbreak of brucellosis in animals, the vaccines which are currently used suffers from many disadvantages such as:

• secretion of vaccine strain in milk and urine which are infectious to humans

• no long-term protection

• induction of abortion in vaccinated animals

• No capability to differentiate between infected and vaccinated animals (DIVA), if the vaccination is performed with the smooth strain of Brucella such as Brucella abortus S 19 vaccine.

Due to the above disadvantages, usage of vaccines has not been successful in management of brucellosis outbreak. In case of an outbreak of brucellosis, it is important to immediately segregate the animals which are infected to control the infection from spreading. Currently used diagnostic methods are not able to efficiently diagnose this infection. Further, currently used diagnostics are not able to differentiate between Brucella abortus S 19 vaccinated and naturally infected cattle (lacking DIVA capability). The discriminatory power is extremely important to understand whether the seropositivity of the animal is due to vaccination or natural infection. This also provides information on potential vaccine failures.

The inventors of the present invention have for the first time identified that DNA starvation/stationary phase protection (Dps) protein present in all the known species of Brucella can serve as an ideal candidate for developing novel sero-diagnostic assays for animal and human brucellosis. Consequently, the inventors have identified three immunogenic fragments of the Dps protein and have developed Dps protein and peptides-based immunoassay kits, methods and lateral flow devices that can efficiently detect brucellosis in animals and humans. The kits have the capability of differentiating between animals infected with natural/field strain of Brucella and from Brucella abortus S19 vaccinated ones.

The present invention thus overcomes the problems of the prior art to solve a long-standing problem of providing kits, devices and methods for efficient, specific and cost-effective diagnosis of Brucellosis with DIVA capability. Further, the present invention can be used for detection and separation of infected animals in case of a brucellosis outbreak so that the infection can be contained. The DIVA capable kits are also useful to identify brucellosis in Brucella abortus S 19 vaccinated cattle, which may occur due to vaccine failures. The DIVA capable brucellosis detection kits are necessary for brucellosis control programmes in any countries.

SUMMARY OF THE INVENTION

Technical Problem

Presently, there is no efficient way to differentiate between vaccinated and infected animals. Hence, the technical problem to be solved in this invention is to provide easy, efficient and cost effective means for differentiating Brucellosis-infected cattle from Brucella abortus-S 19- vaccinated ones.

The problem has been solved by adopting the following multidimensional approaches:

1. Identification of DNA starvation/stationary phase protection protein (Dps) (SEQ ID NO: 1) and immunogenic peptides of the Dps protein (SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7) which exhibit DIVA capabilities (the ability to differentiate between vaccinated and naturally infected animals).

2. Development of ELISA methods, immunoassay kits and lateral flow immunoassay devices based on Dps protein (SEQ ID NO: 1) and immunogenic fragments of Dps protein (SEQ ID NO:3, SEQ ID NO: 5 and SEQ ID NO:7).

Overview of the invention

The present invention pertains to Dps protein (SEQ ID NO: 1) and immunogenic fragments of the Dps protein (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants), immunoassay kits for detecting Dps protein (SEQ ID NO: 1) or its immunogenic fragments (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) or antibodies specific to SEQ ID NO:l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants in a biological sample, which can be used for differentiating Brucellosis-infected cattle from Brucella-S 19- vaccinated ones.

Embodiments of the invention comprises kits comprising a solid support immobilized with antigens selected from a group comprising SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants. Embodiment of the invention also include kits comprising a solid support immobilized with antibodies raised against Dps protein (SEQ ID NO: 1) or immunogenic fragments of Dps protein (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) for differentiating Brucellosis-infected cattle from Brucella abortus - S 19-vaccinated cattles.

Embodiments of the invention also provides for lateral flow immunoassay devices for detecting antibodies specific to SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants in a biological sample. Embodiment of the invention also comprises lateral flow immunoassay devices for detecting Dps protein (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) in a biological sample for differentiating Brucellosis-infected cattle from Brucella abortus-S 19-vaccinated cattles. BRIEF DESCRIPTION OF DRAWINGS

The features of the present disclosure will become fully apparent from the following description taken in conjunction with the accompanying figures. With the understanding that the figures depict only several embodiments in accordance with the disclosure and are not to be considered limiting of its scope, the disclosure will be described further through use of the accompanying figures.

Figure 1 depicts the array used for immunoprobing and identification of Dps protein. Probing of Brucella protein microarray with Healthy or Brucella-infected human serum sample. The red spots on the array probed with Healthy serum sample indicate positive controls. The antibodies formed against the immunodominant antigens of Brucella in the infected serum samples reacted with the corresponding antigens on the array and gave bright red spots. The spot intensity is proportional to the immunodominance of the antigen.

Figure 2 represents PCR amplification of Dps protein gene (NCBI ID: BMEI1980) from the chromosomal DNA of Brucella melitensis followed by its cloning in pET21a+ vector. 1 kb DNA ladder (Lane 1); the Dps gene was PCR amplified from the chromosomal DNA of Brucella melitensis (Lane 2) followed by its cloning in pET21a+ vector. Lane 3 shows pET21a+ vector harboring the Dps gene (pET-Dps) of Brucella melitensis. Lane 4 is confirmation of pET-Dps construct by restriction enzyme digestion. Lane 5 is blank and Lane 6 shows 100 bp DNA ladder.

Figure 3 depicts expression of HIS tagged Dps protein in E. coll followed by purification using Ni-NTA column. SDS PAGE analysis: Protein marker (Lane 1); lysate of uninduced E.coli BL21 cells harboring pET-Dps construct (Lane 2); IPTG induced Lysate of E.coli BL21 cell harboring pET-Dps (Lane 3); Purified HIS-Dps protein (Lane 4).

Figure 4 depicts confirmation of Dps protein by western analysis using anti-HIS tag antibody by western blotting analysis. Protein marker (Lanel); Uninduced (Lane 2); Induced (Lane 3) and Purified HIS-Dps (Lane 3). The blot was probed with anti-HIS antibody conjugated with HRP.

Figure 5 depicts expression of maltose binding protein (MBP)-tagged Dps protein in E. coll followed by purification using amylose column. SDS PAGE analysis: Protein marker (Lane 1); lysate of uninduced E.coli BL21 cells harboring pMAL-Dps construct (Lane 2); IPTG induced Lysate of E.coli BL21 cells harboring pMAL-Dps (Lane 3); Purified MBP-Dps protein (Lane 4).

Figure 6 depicts confirmation of Dps protein by western analysis using anti-MBP tag antibody by western analysis. Protein marker (Lanel); Uninduced (Lane 2); Induced (Lane 3) and Purified MBP-Dps (Lane 4). The blot was probed with anti-MBP antibody conjugated with HRP.

Figure 7 depicts the predicted secondary structure of Dps protein (SEQ ID NO: 1) and the location of peptides (SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7) in the Dps protein.

Figure 8 depicts immunoprobing of purified Dps protein with the brucellosis positive serum samples from cattle, Goat, Dog and Human and Brucella abortus S 19 vaccinated cattle. The brucellosis positive serum samples from both the animals and human reacted with the Dps protein on the polyvinylidene difluoride (PVDF) membrane. Serum sample from the Brucella abortus S 19 vaccinated cattle did not react with Dps protein indicating DIVA capability of this protein antigen.

Figure 9 depicts the results of the checkerboard titration analysis to determine the optimal Dps protein antigen concentration for the development of ELISA for detection of anti- Dps antibody in the biological samples. A two-fold serial dilution of Dps antigen was titrated against various dilutions of brucellosis positive (A) or negative (B) human serum samples. Optical Density (OD) values of 2.7 to 1.0 were obtained with various concentrations of Dps protein antigen. OD was negligible with the negative serum samples.

Figure 10 depicts the screening of bovine serum samples with Dps protein (SEQ ID NO: l)-based indirect ELISA (iELISA) showing DIVA capability. Dot plot with OD values (Black: +ve serum; Blue: -ve serum; Red: S 19 vaccinated serum). The Dps protein-based indirect ELISA exhibited DIVA capability as the OD for Brucella abortus S 19-vaccinated serum samples (red) were similar to that of negative control (blue). The presence of Brucella abortus S 19-vaccinated samples in the positive sera region may indicate the presence of brucellosis in the vaccinated cattle due to vaccine failure.

Figure 11 depicts comparison of reactivity and DIVA capabilities of Dps peptide-based indirect ELISA. (OD: Optical density). All the peptides showed reactivity with brucellosis positive serum samples (red). The peptides also exhibited DIVA capability as the OD for Brucella abortus S I 9- vaccinated serum samples (blue) were similar to that of negative control (green).

Figure 12 depicts screening of bovine samples with Dps peptide (SEQ ID NO: 3)-based indirect ELISA showing DIVA capability. Dot plot with OD values (Black: +ve serum; Blue: -ve serum; Red: S 19 vaccinated serum).

Figure 13 depicts screening of bovine samples with Dps peptide (SEQ ID NO: 5)-based indirect ELISA showing DIVA capability. Dot plot with OD values (Black: +ve serum; Blue: -ve serum; Red: S 19 vaccinated serum).

Figure 14 depicts screening of bovine samples with Dps peptide (SEQ ID NO:7)-based indirect ELISA showing DIVA capability. Dot plot with OD values (Black: +ve serum; Blue: -ve serum; Red: S 19 vaccinated serum).

Figure 15 depicts the results of the Checkerboard titration analysis to examine the detection of Dps peptide (SEQ ID NO:3) by the anti-SEQ ID NO:3 antibody- 1. A two fold serial dilution of anti-SEQ ID NO:3 antibody- 1 was titrated against various concentrations of Dps peptide (SEQ ID NO:3). Optical Density values of 1.0 to 0.1 were obtained with various concentrations of Dps peptide. OD was negligible with the negative serum samples (anti-rabbit serum).

Figure 16 depicts a schematic representation of Lateral Flow Assay design to detect anti-Dps antibody in the biological samples such as serum, blood, milk, urine and semen.

Figure 17 depicts the development of the lateral flow device with DIVA capability using the Dps protein. The LFA kits were tested with brucellosis positive or negative or Brucella abortus S 19 vaccinated serum samples. The LFA could detect brucellosis in cattle, goat, dog and human. The LFA did not give a Test Line with the negative serum samples from animals or humans. Similarly, the LFA did not give a Test Line with the serum samples from Brucella abortus S 19-vaccinated cattle, indicating the DIVA capability of this assay device.

Figure 18 depicts a schematic representation of the Lateral Flow Assay design to detect Dps antigen or fragments in the biological samples such as serum, blood, milk, urine and semen.

BRIEF DESCRIPTION OF SEQUENCES AND SEQUENCE LISTING

gtgcgatcgccatttgccggatcatgcaaaccaaacgaggataaaatgccgaagaagtcgatgcatgcaacccgcaacgatcttccct ccaataccaagacgacgatgatcgcgctgctcaacgagaatcttgccgcaacaatcgatcttgccctcatcaccaagcaggcgcactg gaacctcaagggaccgcaattcatcgccgtgcatgaaatgctcgatggtttccgcgcagaactcgacgaccatgtggacacgattgcc gaacgtgccgtgcagatcggcggaacggcctatggtacaacccaggtcgtggtgaaggaatccagactgaagccttacccgaccga catttatgccgtccacgaccatctggtggcactgatcgaacgctatggtgatgttgccaatctggtgcgcaaatcgatcaaggatgcag acgacgcgggtgacgacgacacggcagatattttcaccgccgcatcgcgcagcctcgacaaggcactctggttcctcgaagcgcat gtgcaggaaagcaattaa

Amino acid sequence of fragment 1 of Dps protein (SEQ ID NO: 3)

LVRKSIKDADDAGD

Nucleotide acid sequence of fragment 1 of Dps protein (SEQ ID NO: 4)

5’-CTGGTGCGCAAATCGATCAAGGATGCAGACGACGCGGGTGAC-3’

Amino acid sequence of fragment 2 of Dps protein (SEQ ID NO: 5)

KS MH ATRNDLPS NT

Nucleotide acid sequence of fragment 2 of Dps protein (SEQ ID NO: 6)

5’ - AAGTCGATGCATGCAACCCGCAACGATCTTCCCTCC AATACC-3’

Amino acid sequence o

: 7)

VVVKESRLKPYPTD

Nucleotide acid sequence of fragment 3 of Dps protein (SEQ ID NO: 8)

5’-GTCGTGGTGAAGGAATCCAGACTGAAGCCTTACCCGACCGAC-3’

DEFINITIONS

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods belong. Although any methods and compositions similar or equivalent to those described herein can also be used in the practice or testing of the methods and compositions, representative illustrative methods and compositions are now described.

Where a range of values is provided, it is understood that each intervening value between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within by the methods and compositions. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within by the methods and compositions, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the methods and compositions.

It is appreciated that certain features of the methods, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the methods and compositions, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. It is noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements or use of a "negative" limitation.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

The term“immunoassay kit” as used herein refers to an instrument capable of detecting the presence of antibodies specific to Dps protein (SEQ ID NO: 1) and immunogenic fragments of Dps (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) or the presence of Dps protein (SEQ ID NO: 1) or immunogenic fragments of Dps ( SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants), according to an immunological analysis method such as, but not limited to, ELISA.

The term“conservative variant” as used herein refers to proteins/peptides with amino acid substitutions that do not substantially decrease the efficacy of the Dps protein (SEQ ID NO: 1) or immunogenic fragments of Dps (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7).

Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another:

Amino acid substitution table

The terms“peptide” and“protein” as understood by a person skilled in the art are used interchangably throughout the specification.

The term“immobilized” as used herein refers to the association of the Dps protein (SEQ ID NO: 1) or immunogenic fragments of Dps protein (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) with a solid support material through covalent bond formation, ionic bond formation, hydrogen-bonding, dipole-dipole interaction or via Van der Waals interactions. The term also refers to the association of antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants with a solid material. The immobilization can be temporary or permanent.

The term“solid support” as used herein refers to any supporter surface suitable for performing an immunoassay. Examples of such solid supports, include, but are not limited to microtiter plates.

The term“antigen- antibody complex” as used herein refers to the complex formed by the immunological binding of Dps protein (SEQ ID NO: 1) or immunogenic fragments of Dps protein (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) to an antibody.

The term“antibody-antigen complex” as used herein refers to the complex formed by the immunological binding of antibodies raised against Dps protein (SEQ ID NO: l) or immunogenic fragments of Dps protein (SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) to Dps protein (SEQ ID NO: l or variants) or respective Dps peptides or variants.

The term“conjugated” as used herein refers to an antibody which is chemically conjugated with a colorimetric, chemiluminescent, fluorescent, enzyme or gold-nanoparticle marker/label for detection during an immunoassay.

The term“sample pad” as used herein refers to an element that can be used to receive a sample. The sample pad promotes the even and controlled distribution of the sample onto the conjugate pad. It may also control the rate at which liquid enters the conjugate pad, preventing flooding of the device.

The term“conjugate pad” as used herein refers to a membrane or other type of material that can comprise a labeled conjugated secondary antibody.

The term“lateral flow membrane” as used herein refers to a porous membrane strip which contains at least one antibody capture zone. The biological sample flows laterally through the test lateral flow membrane by capillary action, reacting with various reagents in the strip.

The term“absorbent pad” as used herein refers to distal end of the assay device which is in lateral flow contact with the lateral flow membrane and is located downstream of the detection zone with respect to the direction of capillary movement of the applied liquid sample. DETAILED DESCRIPTION OF THE INVENTION

The present invention discloses Dps protein and immunogenic peptides of Dps protein, immunoassay kits, devices and methods for detecting the presence of Dps protein or antibodies specific to Dps protein of Brucella species with DIVA capability. The invention can be used for cost-effective, effective and efficient diagnosis of Brucellosis and can also be used for differentiating Brucellosis-infected cattle from Brucella abortus S 19-vaccinated ones (DIVA capability).

For the first time, the inventors have identified that Dps protein present in different Brucella species can be used for diagnosis of Brucellosis in animals and humans. Further, the inventors have identified this antigen can be used for differentiating Brucellosis-infected cattle from Brucella abortus-S 19-vaccinated ones. The inventors have contemplated a unique approach by which they have developed immunoassay kits, methods and lateral flow immunoassay devices for cost-effective, effective and efficient diagnosis of Brucellosis in a number of subjects. Further, the devices can be used for differentiating Brucellosis-infected cattle from Brucella abortus S I 9- vaccinated ones.

The present invention represents an advancement over the existing methods for diagnosis of Brucellosis. The invention fulfills the ASSURED (affordable, sensitive, specific, user-friendly, rapid and robust, equipment-free and deliverable to end users) criteria outlined by the World Health Organization (WHO) for point of care devices for resource-constrained environments. The advances are characterized by the following features:

(a) Affordable: The immunoassay device and kit developed is highly inexpensive and can be afforded even by small-scale farmers or breeders in rural areas.

(b) Sensitive and Specific: The immunoassay kits and devices are highly sensitive and very specific to the detection of Dps protein and antibodies against the Dps protein.

(c) User friendly: The devices developed represent point of care solutions for diagnosis of Brucellosis. It can be used even by marginal and small farmers. The instructions for operating are simple to perform and require minimal to no training.

(d) Rapid and Robust: The test results can be immediately ascertained. Further, the device or kit does not require special storage equipment.

(e) Equipment Free: The devices do not require any sophisticated instrument for operation.

(f) Delivery to those who need it: The devices are extremely cost-effective, easy to transport and use. Hence, these devices can be easily delivered to the rural areas where there is a high requirement of the same.

The inventive approach used in the present invention has led to the development of devices and kits which would help the small and marginal farmers across the world. The DIVA capability is another unique feature of this invention where the immunoassay kits can differentiate vaccinated from the naturally infected cattle.

Before the devices, kits and methods of the present disclosure are described in greater detail, it is to be understood that the invention is not limited to particular embodiments and may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the devices, kits and compositions will be limited only by the appended claims.

Embodiments of the invention include proteins/immunogenic peptides, immunoassay kits, devices and methods of using the kits and devices to determine whether antibodies specific to Dps protein or immunogenic peptides of Dps protein (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) is present. As such, methods of the invention are methods of detecting the presence of antibodies in a biological sample, where the detection may be qualitative or quantitative.

In one embodiment, the invention provides a method for differentiating Brucellosis- infected animals from Brucella abortus S I 9- vaccinated animals, said method comprising detecting in a biological sample at least one protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, or antibodies against at least one protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof in an immunoassay, wherein detection of said protein or said antibodies indicates that the animal is infected and not vaccinated.

In another embodiment, the invention provides for the use of a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, conservative variants and combinations thereof for differentiating Brucellosis-infected animals from Brucella abortus S 19-vaccinated animals.

Embodiments of the invention also include immunoassay kits, devices and methods of using the kits and devices to determine whether Dps protein or immunogenic peptides of Dps protein (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) is present. The methods of the invention are methods of detecting the presence of Dps antigen in a biological sample, where the detection may be qualitative or quantitative.

In some embodiments, the methods include determining whether the antibodies or antigen are present in a biological sample above a detection threshold.

Embodiments of the invention include immunoassay kit which is able to form an antigen-antibody-antibody sandwich complex for detection of antibodies specific to the Dps antigen or immunogenic peptides of Dps antigen (SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants).

Embodiments of the invention also include immunoassay kits which is able to form an antibody-antigen-antibody sandwich complex for detection of Dps antigen or immunogenic fragments of Dps antigen (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants).

In one embodiment, a solid support is used for immobilizing the antigens (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants).

In another embodiment, a solid support is used for immobilizing the antibodies raised against the Dps antigen or an immunogenic motif (SEQ ID NO:3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) of Dps antigen.

In yet another embodiment, the solid support is a microtiter plate.

In another embodiment, the invention provides a method for differentiating Brucellosis- infected animals from Brucella abortus S I 9- vaccinated animals using a kit as described herein for detecting Dps antigen or immunogenic fragments of Dps antigen (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants), said method comprising: a. contacting a biological sample with immobilized primary antibodies on the solid support, wherein the primary antibodies are specific to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof and the primary antibodies form an antibody-antigen complex with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof; and

b. detecting the presence of antigens bound to the primary antibodies using conjugated secondary antibodies raised against a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, wherein the detection of said antigens indicates that the animal is infected and not vaccinated.

In another embodiment, the invention provides a method for differentiating Brucellosis- infected animals from vaccinated animals using a kit as described herein for detecting antibodies specific to Dps antigen or immunogenic fragments of Dps antigen (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants), said method comprising:

a. contacting a biological sample with the immobilized antigenic protein or peptides selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof on the solid support, wherein the immobilized antigenic proteins or peptides form an antigen- antibody complex with antibodies specific to said antigenic proteins or peptides; and

b. detecting the presence of antibodies bound to the antigenic protein or peptides using conjugated secondary antibodies selected from a group comprising IgG and protein A/G, wherein the detection of said antibodies indicates that the animal is infected and not vaccinated.

In another embodiment, the concentration of Dps antigen (SEQ ID NO: 1) or immunogenic fragments of Dps antigen (SEQ ID NOG, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) required in the solid support for the formation of the complex is in the range of 0.01 pg/mL to 10 pg/mL.

In another embodiment, the concentration of antibodies required in the solid support for the formation of the complex is in the range of 0.15 pg/mL to 10 pg/mL.

In another embodiment, 100 pL of the antigen was coated on the solid support for immobilizing the antigens.

In another embodiment, several free protein binding sites in the solid support are blocked with a blocking buffer in order to increase the sensitivity of the immunoassay kit.

In one embodiment, the blocking buffer contains Phosphate -buffered saline (PBS), 0.5% Tween^®20 and bovine serum albumin (BSA).

In another embodiment, the blocking buffer contains Phosphate -buffered saline (PBS), 0.5% Tween^®20 and ovalbumin.

In another embodiment, the blocking buffer contains Phosphate -buffered saline (PBS), 0.5% Tween^®20 and bovine gelatin.

In yet another embodiment, Bovine serum albumin (BSA), ovalbumin or bovine gelatin is present at a concentration in the range of 1-5 wt% in the blocking buffer.

In another embodiment, biological samples collected from subjects were diluted for detecting the presence of Dps protein.

In another embodiment, biological samples collected from subjects were diluted for detecting the presence of antibodies specific to Dps protein.

In one embodiment, the biological samples were diluted in the range from 1:50 to 1:500 dilution.

In another embodiment, the biological samples were diluted in the range from 1:50 to 1:200 dilution.

In another embodiment, the biological samples were diluted at 1: 100 dilution.

In another embodiment the biological sample of the present invention is selected from a group comprising serum sample, blood sample, urine sample, milk sample and semen sample.

In another embodiment, antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and/or SEQ ID NOG are conjugated with a radioactive isotope, enzymes, fluorogenic reporters and chemiluminescence markers are used as detectable markers for detection. In another embodiment, secondary antibodies (IgG) or Protein A/G conjugated with a radioactive isotope, enzymes, fluorogenic reporters and chemiluminescence markers are used as detectable markers for detection.

In another embodiment, horseradish peroxide is used as a detectable marker.

In another embodiment, conjugated secondary antibodies (IgG) or Protein A/G was diluted for formation of the antigen-antibody-antibody complex.

In another embodiment, the secondary antibodies (detection antibodies/detection markers) was diluted in blocking buffer at a range between 1 : 1000 to 1 : 10000 for the formation of the complex.

In another embodiment, the secondary antibodies (detection antibodies/detection markers) was diluted in blocking buffer at a range between 1 :2000 to 1 : 10000 for the formation of the complex.

In another embodiment, an enzyme substrate is added for detection of the formation of the complex.

In one embodiment, the enzyme substrate is TMB solution (3, 3', 5,5'- Tetramethylbenzidine) .

Aspects of the invention also include the development of a lateral flow immunoassay device.

Embodiments of the invention include application of a volume of a biological sample to a lateral flow assay device. The assay device is configured to receive a biological sample of interest at a sample receiving region (sample pad) and to provide for the lateral movement of the sample via wicking through a porous/bibulous material by capillary action to a detection region.

Examples of materials used in the device include, but are not limited to organic or inorganic polymers, and natural and synthetic polymers. More specific examples of suitable solid supports include, without limitation, glass fiber, cellulose, nylon, cross-linked dextran, various chromatographic papers and nitrocellulose.

The lateral flow assay devices utilize a sandwich antigen-antibody-antibody complex for detection of antibodies specific to the Dps protein antigen (SEQ ID NO: 1) or immunogenic fragments of Dps protein antigen (SEQ ID NOG, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants).

The lateral flow assay devices also utilize a sandwich antibody-antigen-antibody complex for detection of Dps protein antigen (SEQ ID NO: 1) or immunogenic fragments of Dps antigen (SEQ ID NOG, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) in a biological sample.

Numerous immunoassay formats are known in the art. Immunoassays involve contacting a biological sample containing or suspected of containing an antigen of interest with at least one antibody that specifically binds to the biomarker.

A signal is then generated indicative of the presence of complexes formed by the binding of antigens in the biological sample to the antibody (or other class of detection reagent). The signal is then related to the presence or amount of the antigen in the biological sample.

In one embodiment, the devices and methods known in the art can utilize labeled molecules in various sandwich, competitive, or non-competitive immunoassay formats to generate a signal that is related to the presence or amount of the antigen(s) of interest. Antibodies or other detection reagents may be immobilized onto a variety of solid supports for use in assays. Examples of suitable solid phases, include, but are not limited to nitrocellulose membranes, membrane filters, cellulose-based papers, beads (including polymeric, latex, and paramagnetic particles), glass, silicon wafers, microparticles, nanoparticles, PEG gels, SPOCC gels, and multiple-well plates.

Antibodies or other detection reagents may be bound to specific zones of assay devices either by conjugating directly to an assay device surface, or by indirect binding.

Biological assays require labels for detection. In one embodiment, the detection label used is gold nanoparticle.

In another embodiment, the detection label is selected from a group comprising radioactive isotopes, enzymes, fluorophore, chemiluminescence markers and the like.

In one embodiment, Dps protein (SEQ ID NO: 1 or conservative variants) is immobilized on the substrate in order to detect a plurality of different antibodies specific to the protein in a single assay.

In another embodiment, antibodies raised against an immunogenic motifs of Dps antigen (SEQ ID NOG, SEQ ID NOG, SEQ ID NOG and conservative variants) are immobilized on the substrate in order to detect Dps antigens in a single assay.

In another embodiment, the device comprises:

(a) a sample pad configured for receiving a sample;

(b) a conjugate pad comprising conjugated IgG or conjugated protein A/G, which is responsible for the uniform transfer of the conjugated secondary antibodies and test sample onto the membrane;

(c) a lateral flow membrane comprising a test line and a control line, wherein the test line comprises antigens comprising the amino acid sequence of SEQ ID NO: l, SEQ ID NOG, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants, and the control line comprises IgG or protein A/G or a known antigen such as lipopolysaccharide; and

(d) an absorbent pad placed at the distal end of the device.

In another embodiment, the device comprises:

(a) a sample pad configured for receiving a sample;

(b) a conjugate pad comprising conjugated antibodies raised against SEQ ID NO:

1, SEQ ID NOG, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants which is responsible for the uniform transfer of the conjugated antibodies and test sample onto the membrane;

(c) a lateral flow membrane comprising a test line and a control line, wherein the test line comprises antibodies raised against peptides selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NOG, SEQ ID NOG and conservative variants, and the control line comprises protein A/G; and

(d) an absorbent pad placed at the distal end of the device.

In yet another embodiment, the biological sample is added to the proximal end of the strip at the sample pad.

In another embodiment, the biological sample migrates through this region to the conjugate release pad, where the conjugated secondary antibodies have been immobilized. In another embodiment, conjugated antibodies (antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants) are conjugated with a radioactive isotope, enzymes, fluorogenic reporters and chemiluminescence markers is used as detectable markers is used for detection.

In another embodiment, secondary antibodies (IgG) or Protein A/G conjugated with a radioactive isotope, enzymes, fluorogenic reporters and chemiluminescence markers is used as detectable markers is used for detection.

In another embodiment, the concentration of conjugated secondary antibodies is in the range from 1 pg/mL to 30 pg/mL.

In another embodiment, the biological sample re-mobilizes the dried conjugate detection antibodies. The antibodies in the sample interacts with the conjugate as both migrate into the next zone of the strip, which is the reaction matrix.

In another embodiment, the reaction matrix containing the test line is a porous membrane, onto which the antigen, Dps protein or immunogenic peptides or variants has been immobilized. This antigen captures antibodies specific to this antigen.

In yet another embodiment, the antigen is present at the test line at a concentration in the range of 0.01-1 mg/mL.

In yet another embodiment, the antibodies are present at the test line at a concentration in the range of 0.1-2 mg/mL.

In another embodiment, the control line picks up free gold conjugated antibodies in order to confirm the test has operated correctly.

In yet another embodiment, the concentration of the secondary antibodies or Protein A/G on the positive control line is in the range from 0.1 mg/mL to 2 mg/mL.

In another embodiment, the presence of a visible signals on the test line for gives a conclusive determination of Brucellosis.

In yet another embodiment, the presence of visible signals on the test line with serum samples from naturally infected cattle can be used for differentiating Brucellosis-infected animals from Brucella abortus S 19-vaccinated ones. The test line will be absent with Brucella abortus S I 9- vaccinated serum samples.

In another embodiment, the device is placed into proper housings.

In another embodiment, the housing is configured to substantially enclose the lateral flow membrane, capture antigen, secondary antibodies and detectable markers, optionally in a disposable one-time use package.

In yet another embodiment, the housing is used to expose the sample pad, maintain proper alignment of the materials, and indicate positions of the test and control lines.

In a further embodiment, the housing is made out of a suitable material, preferably plastic.

EXAMPLES

The following examples particularly describe the manner in which the invention is to be performed. But the embodiments disclosed herein do not limit the scope of the invention in any manner.

Example 1: Identification of Dps protein

Serum was collected from Brucella infected cattle, goat, dogs and human (National Institute of Animal Biotechnology, Hyderabad, India). Similarly, serum was collected from animals (cattle) vaccinated with Brucella abortus strain 19 (S 19) from National Institute of Animal Biotechnology, Hyderabad, India.

Brucella full proteome array was immunoprobed with the serum collected. The immunoprobing array contains 3800 proteins of Brucella melitensis with positive and negative controls. The array used for immunoprobing is depicted in Figure 1.

Amongst a host of proteins, a DNA starvation/stationary phase protection (Dps) protein was identified from the immunoprobing experiments.

This protein was further studied for its capabilities for use as an agent for differentiating infected from vaccinated animals.

Example 2: Cloning, expression and purification of recombinant Dps protein

The Dps protein was analyzed and it was subsequently sequenced. The amino acid sequence of the Dps protein is represented by SEQ ID NO: l.

For production of protein, the polynucleotide sequence represented in SEQ ID NO: 2 encoding the Dps protein gene of Brucella melitensis was amplified using PCR. Thereafter, the amplified DNA was cloned in a pET21a+ vector.

Figure 2 represents PCR amplification of Dps gene from the chromosomal DNA of Brucella melitensis followed by its cloning in pET21a+ vector.

Escherichia coll was transformed with the recombinant pET21a+ vector. HIS -tagged Dps protein was expressed from Escherichia coli, which was purified using a Ni-NTA column. Dps protein was also expressed as a fusion protein with Maltose binding protein (MBP) tag, which results in better solubility and better purification.

Figure 3 depicts expression of HIS tagged Dps protein in E. coli followed by purification using Ni-NTA column.

A western analysis was conducted to confirm that the Dps protein has been expressed. Figure 4 depicts confirmation of Dps protein by western analysis using anti-HIS tag antibody.

Figure 5 depicts expression of maltose binding protein (MBP)-tagged Dps protein in E. coli which was followed by purification using amylose column. Figure 6 depicts confirmation of Dps protein by western analysis using anti-MBP tag antibody by western analysis.

Three immunogenic motifs of the protein were identified (SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7). These peptides were chemically synthesized with the SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7, respectively and antibodies were raised against SEQ ID NO: 3.

The predicted secondary structure of Dps protein (SEQ ID NO: 1) and the location of peptides (SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7) in the Dps protein is shown in Figure 7.

Example 3: Identification of DIVA capabilities of Dps protein

Dps protein (SEQ ID NO: l) and immunogenic peptides of the Dps protein (SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7) were investigated for its capabilities as an agent for differentiating Brucellosis-infected animals from Brucella abortus S 19-vaccinated ones.

Serum samples from Brucella infected cattle, goat, dog and human were collected. Serum samples were also collected from animals (cattle) vaccinated with Brucella abortus strain 19 (S 19). The serum samples were collected by National Institute of Animal Biotechnology, Hyderabad, India.

It was found that Dps protein (SEQ ID NO: 1) and the immunogenic peptides (SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7) reacts with serum collected from Brucella-infected animals and humans, except from serum collected from animals (cattle) vaccinated with Brucella abortus strain 19.

Thus, it was confirmed that the Dps protein and the immunogenic peptides react with antibodies against the natural/field Brucella strains. It was also confirmed that Dps and the immunogenic peptides are not able to react with Brucella abortus S 19 vaccine strain-induced antibodies.

Figure 8 depicts immunoprobing of purified Dps protein with the brucellosis positive serum samples from cattle, Goat, Dog and Human and Brucella abortus S 19 vaccinated cattle. The brucellosis positive serum samples from both the animals and human reacted with the Dps protein on the polyvinylidene difluoride (PVDF) membrane. Serum sample from the Brucella abortus S 19-vaccinated cattle did not react with Dps protein indicating DIVA capability of this protein antigen.

Example 4: Development of indirect ELISA kit based on Dps protein and immunogenic peptides

An indirect ELISA method and kit was developed using the Dps protein (SEQ ID NO: 1) and immunogenic peptides (SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7) for detecting antibodies specific to Dps protein.

The immunoassay kit developed by the inventors is able to form an antigen-antibody- antibody sandwich complex for detection of antibodies raised specific to Dps antigen or peptides (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7).

A solid support is used for immobilizing the Dps antigen or immunogenic peptides. Preferably, the solid support is a microtiter plate.

The concentration of antigen required in the solid support for the formation of the complex is in the range of 0.01 pg/mL to 10 pg/mL.

For immobilizing the antigen, 100 ng/mL of the antigen Dps protein or immunogenic fragments was diluted with IX PBS followed by adding 100 pl/well into the wells of microtiter plates for coating the antigen. The plates were covered with an adhesive plastic and incubated at 4°C overnight. Subsequently, the coating solution was aspirated out and the plates were washed three times with PBST (PBS with 0.05% Tween 20). The remaining drops were removed by patting the plate on a paper towel.

For evaluating human serum using Dps protein (SEQ ID NO: 1) or Dps peptides (SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7), the plates were blocked with 300 pi of blocking buffer containing PBS with 1-3% BSA.

There are several protein binding sites which are free in the solid support. In order to increase the sensitivity of the immunoassay kit, the free protein binding sites were blocked with a blocking buffer. The blocking buffer contains Phosphate-buffered saline (PBS) with 1-3% bovine serum albumin (BSA). Bovine serum albumin (BSA), ovalbumin or bovine gelatin may be present at a concentration in the range of 1-5 wt%. The blocking of the free protein binding sites improves the sensitivity of the assay by reducing background interference and improving the signal-to-noise ratio.

The plates were covered with an adhesive plastic and incubated for 1 hour at room temperature followed by washing the plates thrice with PBST (phosphate-buffered saline with Tween^® 20 detergent). Thereafter, 100 pi of human or bovine serum samples diluted in PBS containing 1% BSA was added followed by covering plates with an adhesive plastic and incubate for 2 hours at room temperature. The plates were washed five times with PBST.

100 mΐ of conjugated secondary antibody was added at the dilution of 1:5000 of anti- bovine or anti-human antibody in PBS with 1% BSA. The plates were washed five times with PBST.

50 mΐ of TMB solution (3,3’,5,5’-tetramethylbenzidine) was added to each well, incubated for 15-30 minutes and added equal volume of stopping solution (2 M H2SO4) and read the plates at the optical density at 450 nm.

The positivity of the serum samples was determined by the mean OD greater than the OD value, which is two standard deviations over the mean OD of the negative controls (Mythili et al., 2011).

The immunoassay kit and methods can also be used for differentiating Brucellosis- infected animals from Brucella abortus S I 9- vaccinated ones.

Example 5: Validation of immunoassay kit

To validate the working of the immunoassay kit and the methods, the antigen Dps protein and immunogenic peptides) at various concentration was used. Human serum samples from infected and healthy subjects were collected, and the above method was performed using anti-Human IgG conjugated with horseradish peroxidase (HRP) as the secondary antibody.

Figure 9 depicts the results of the checkerboard titration analysis to determine the optimal Dps antigen concentration for the development of ELISA for detection of anti-Dps antibody in the biological samples. A two fold serial dilution of Dps antigen was titrated against various dilutions of brucellosis positive (A) or negative (B) human serum samples. Optical Density (OD) values of 2.7 to 1.0 were obtained with various concentrations of Dps antigen. OD was negligible with the negative serum samples.

Thus, the immunoassay kit and methods can be used successfully for identifying subjects infected with Brucellosis.

Example 6: Comparison of the indirect ELISA with commercial LPS-based indirect ELISA and Rose Bengal plate test (RBPT)

The Dps-based indirect ELISA (iELISA) as developed in Example 4 was compared with commercial LPS-based iELISA and Rose Bengal plate test (RBPT). Among human sera samples, 26 sera samples were found positive by Dps based ELISA and 25 samples were positive by commercial iELISA whereas only 14 samples were found positive with RBPT.

A total of 195 samples was declared as negative by all the three tests. Both the indirect ELIS As had agreement with 25 samples. Out of 207 samples, which were negative with RBPT, 11 samples were positive by both the ELIS As. In case of one sample, there was a disagreement between the two ELIS As. The specificity and sensitivity estimates, and the likelihood estimates were calculated using a Bayesian model. The sensitivity and specificity estimate on comparison with the commercial LPS-based indirect ELISA were 86.28 -100 % and 97.19 - 99.99 % respectively (Table 1 and 2).

Table 1: Comparison of Dps protein-based indirect ELISA with RBPT (Rose Bengal Plate

Test) and commercial indirect ELISA using human serum samples.

Human sera (n = 211) were tested by each serological method

Table 2: Comparison of Dps protein based iELIS A with commercial iELISA using Bayesian model statistics

The estimates with 95% Cl are given.

The above results depict that the developed immunoassays are highly sensitive and specific.

Example 7: Evaluation of the DIVA capability of Dps protein (SEQ ID NO: l)-based indirect ELISA

The serum samples were collected from 21^st, 45^th and 90^th days post S19 vaccination and screened with the developed Dps protein indirect ELISA. A dot plot was made from the OD values of the known positive, negative and Brucella abortus S19-vaccinated serum samples. The cut-off was derived by calculating the mean OD of all the negative samples and the standard deviation from the mean value. Serum samples from Brucella abortus S19- vaccinated cattle showed OD similar to the OD of the negative controls (Figure 10).

The screening of bovine serum samples using the Dps-based ELISA indicated that the assay could differentiate vaccinated from naturally infected animals.

Example 8: Evaluation of the DIVA capability of Dps peptides (SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7)-based indirect ELISA using bovine serum samples

The indirect ELISA was performed as described before using the Dps peptides (SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7). Three peptides were evaluated for their reactivity and efficiency to differentiate vaccinated from naturally infected cattle. Ten serum samples of each Positive, Negative and Brucella abortus S19-vaccinated (45 days) cattle were used for the indirect ELISA (Figure 11). The indirect ELISA based on each peptide detected brucellosis in positive serum and did not show reactivity with negative serum or Brucella abortus SI 9- vaccinated serum samples. This indicates that the indirect ELISA based on SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 is having the capability to detect brucellosis and these peptide based indirect ELISA could differentiate vaccinated from naturally infected cattle. The peptide 2 (SEQ ID NO: 5) showed slightly higher reactivity compared to other two peptides.

Subsequently, the serum samples that were collected from 21^st, 45^th and 90^th days post Brucella abortus S 19 vaccination were screened with the Dps peptide-based indirect ELISA. A dot plot was made from the OD values of the known positive, negative and Brucella abortus S 19 vaccinated serum samples. The cut-off was derived by calculating the mean OD of all the negative samples and the standard deviation from the mean value. Serum samples from Brucella abortus S19 vaccinated cattle showed OD similar to the OD of the negative controls with indirect ELISA using Dps peptides (Figure 12, Figure 13 and Figure 14).

The screening of bovine serum samples using the Dps peptide-based indirect ELISA indicated that the assay could differentiate vaccinated from naturally infected animals (DIVA capability).

Example 9: Development of ELISA kit for detecting the presence of Dps protein in a sample

The inventors developed immunoassay methods and kits for detecting the presence of Dps protein (Dps protein) or Dps protein fragments in a sample.

The immunoassay kit developed by the inventors is able to form an antibody -antigen- antibody sandwich complex for detection of Dps antigen or immunogenic peptides of Dps antigen (SEQ ID NO:l, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO:7 and conservative variants).

A solid support is used for immobilizing the antibodies raised against SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 5 and SEQ ID NO: 7. Preferably, the solid support is a micro titer plate.

The concentration of antibody used in the solid support for the formation of the complex is in the range of 0.15 pg/mL to 10 pg/mL.

For immobilizing the antibody, 100 pL of the antibody are coated on the solid support and incubated for 2 hrs at room temperature. Alternatively, the solid support coated with antibody can be incubated at 4°C overnight.

To remove the coating solution of antigens, the solid support is washed multiple times with 200 pL PBS buffer.

There are several protein binding sites which are free in the solid support. In order to increase the sensitivity of the immunoassay kit, the free protein binding sites are blocked with a blocking buffer. The blocking buffer contains Phosphate-buffered saline (PBS), 0.5% Tween^®20 and bovine serum albumin (BSA), ovalbumin or bovine gelatin. Bovine serum albumin (BSA), ovalbumin or bovine gelatin is present at a concentration in the range of 1-5 wt%. The blocking of the free protein binding sites improves the sensitivity of the assay by reducing background interference and improving the signal-to-noise ratio.

In order to block the free protein binding sites, 200 pL of the blocking buffer is added to the solid support and the solid support is incubated for at least 1 hr at room temperature. Thereafter, the solid support is washed with PBS to prepare the immunoassay kit.

Example 10: Method for using the immunoassay kit

The immunoassay kit was used for detecting the Dps antigen (SEQ ID NO: l). 100 mΐ of anti-SEQ ID NO:3 antibodies was added to the solid support (microtiter plate) as capture antibody and incubated for 2 hrs at room temperature. The solid support was washed multiple times with PBST.

Thereafter, Dps antigen (SEQ ID NO: 1) was added to the microtiter plate, which formed a complex with anti-SEQ ID NO: 3 antibodies (as detection antibody).

This was followed by addition of anti-SEQ ID NO: 3 antibodies. Finally, for detecting this antibody-antigen-antibody complex, anti-rabbit-IgG-HRP conjugate was added as a secondary antibody for detecting the presence of Dps antigen.

The secondary antibody was diluted in blocking buffer at a range between 1: 1000 to 1: 10000 and added for the formation of the complex. The solid support was incubated for 1 hr at room temperature. The solid support was washed multiple times with PBS.

TMB solution (3,3',5,5'-Tetramethylbenzidine) was added to the solid support as a substrate for detection of the target primary antibodies. The solid support was incubation for 15-30 minutes and thereafter, 2M H2SO4 was added as a stopping solution.

The optical density at 450 nm was read to identify the successful formation of the antigen-antibody-antibody complex. It was noted that the optical density (OD) for positive samples was in the range of 0.1 to 1.

Figure 15 depicts the results of the Checkerboard titration analysis to examine the detection of Dps by the anti-Dps antibody- 1 (SEQ ID NO:3). A two fold serial dilution of anti- Dps antibody- 1 was titrated against various concentrations of Dps antigen. Optical Density values of 1.0 to 0.1 were obtained with various concentrations of Dps antigen. OD was negligible with the negative serum samples (rabbit serum).

Thus, the immunoassay kit and methods can be used successfully for identifying subjects infected with Brucellosis. The immunoassay kit and methods can also be used for differentiating Brucellosis-infected animals from Brucella abortus S 19-vaccinated ones.

Example 11: Development of Lateral Flow Assay device for detection of Dps protein in a sample

The inventors developed lateral flow immunoassay devices for detecting the presence of Dps protein.

For detecting the Dps protein, antibodies against three fragments (SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7) of the Dps protein are used.

The immunoassay devices developed by the inventors has been developed on the ability of the antibodies raised against SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7 to form an antibody-antigen-antibody sandwich complex with Dps antigen (SEQ ID NO: l).

The device comprises a sample pad configured for receiving a sample; a conjugate pad comprising conjugated antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof which is responsible for the uniform transfer of the conjugated secondary antibodies and test sample onto the membrane; a lateral flow membrane comprising a test line and a control line, wherein the test line comprises comprises antibodies raised against peptides selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO:7 and conservative variants thereof. The control line comprising protein A/G; and an absorbent pad placed at the distal end of the device.

The biological sample is added to the proximal end of the strip at the sample pad. The sample migrates through this region to the conjugate release pad, where the gold-conjugated antibodies raised against SEQ ID NO: 1,SEQ ID NO:3, SEQ ID NO: 5 or SEQ ID NO: 7 have been immobilized. The test line contains antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and/or SEQ ID NO: 7, which are used for detection. The concentration of gold-conjugated antibodies is in the range from 1 mg/mL to 30 mg/mL.

In other embodiments radioactive isotopes, enzymes, fluorogenic reporters and chemiluminescence markers are used as detectable markers.

The sample re-mobilizes the dried conjugate detection antibodies. The antibodies in the sample interacts with the conjugate as both migrate into the next zone of the strip, which is the reaction matrix.

This reaction matrix containing the test line is a porous membrane, onto which the antibodies raised against SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO:5 and/or SEQ ID NO:7 has been immobilized. These antibodies capture the Dps antigen. The antibodies are present at a concentration in the range of 0.1-2 mg/mL.

If the antigen is present in the biological sample, an antibody-antigen-antibody complex is formed, which can be conclusively determined by the presence of visual signals on the test lines.

The control line contains protein A/G which picks up free gold conjugated antibodies in order to confirm the test has operated correctly. The concentration of Protein A/G on the positive control line is in the range from 0.1 mg/mL to 2 mg/mL.

Excess reagents move past the capture lines and are entrapped in the wick or absorbent pad.

The presence of a visible signals on the test line for gives a conclusive determination of Brucellosis. Further, the the absence of visible signals on the test line with S 19 vaccinated serum can also be used for differentiating Brucellosis-infected cattle from Brucella abortus S 19-vaccinated ones.

Figure 18 depicts a schematic view of the lateral flow immunoassay strip of the present invention.

The membrane is placed into proper housings. The housing is configured to substantially enclose the lateral flow membrane, capture antigen, secondary antibodies and detectable markers, optionally in a disposable one-time use package. The housing is used to expose the sample pad, maintain proper alignment of the materials, and indicate positions of the test and control lines. The housing is made out of a suitable material, preferably plastic. Example 12: Development of Lateral Flow Assay device for differentiating infected from Brucella abortus S 19- vaccinated animals

The inventors developed lateral flow immunoassay devices for detecting the presence of antibodies specific to Dps protein.

The immunoassay devices developed by the inventors has been developed on the ability of the antigen (Dps protein) to form an antigen-antibody-antibody sandwich complex for detection of antibodies specific to the Dps antigen or immunogenic peptides of Dps (SEQ ID NO: l, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO:7 and conservative variants).

The device comprises a sample pad configured for receiving a sample; a conjugate pad comprising conjugated IgG or conjugated protein A/G, which is responsible for the uniform transfer of the conjugated secondary antibodies and test sample onto the membrane; a lateral flow membrane comprising a test line and a control line, wherein the test line comprises antigens comprising the amino acid sequence of SEQ ID NO:l, SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO:7 and conservative variants and the control line comprises IgG or protein A/G; and an absorbent pad placed at the distal end of the device.

The biological sample is added to the proximal end of the strip at the sample pad. The sample migrates through this region to the conjugate release pad, where the conjugated secondary antibodies have been immobilized. Gold-conjugated secondary antibodies (IgG) or gold-conjugated Protein A/G is used for detection. The concentration of gold-conjugated secondary antibodies is in the range from 1 pg/mL to 30 pg/mL.

This reaction matrix containing the test line is a porous membrane, onto which the antigen (Dps protein) has been immobilized. This antigen captures antibodies specific to this antigen in the serum samples. The antigen is present at a concentration in the range of 0.01-1 mg/mL.

The control line picks up free gold conjugated antibodies in order to confirm the test has operated correctly. The concentration of the secondary antibodies or Protein A/G on the positive control line is in the range from 0.1 mg/mL to 2 mg/mL.

The presence of a visible signals on the test line for gives a conclusive determination of Brucellosis. Further, the absence of visible signals on the test line with S 19 vaccinated cattle serum can also be used for differentiating Brucellosis-infected cattle from Brucella abortus S 19-vaccinated ones.

Figure 16 depicts a schematic view of the lateral flow immunoassay strip of the present invention.

The membrane is placed into proper housings. The housing is configured to substantially enclose the lateral flow membrane, capture antigen, secondary antibodies and detectable markers, optionally in a disposable one-time use package. The housing is used to expose the sample pad, maintain proper alignment of the materials, and indicate positions of the test and control lines. The housing is made out of a suitable material, preferably plastic. Example 13: Validation of Lateral Flow Assay Device

To validate the working of the lateral flow immunoassay device, serum samples from infected and vaccinated subjects (cattle, goat, dog and humans) were collected, and the device was used.

Figure 17 depicts the development of the lateral flow device with DIVA capability using the Dps protein. The LFA kits were tested with brucellosis positive or negative or S19 vaccinated serum samples. The LFA could detect brucellosis in cattle, goat, dog and human. The LFA did not give a Test Line with the negative serum samples from animals or humans. Similarly, the LFA did not give a Test Line with the serum samples from S 19 vaccinated cattle, indicating the DIVA capability of this assay device.

Thus, the devices can be used for successfully identifying subjects infected with Brucellosis and differentiating Brucellosis-infected animals from Brucella abortus S19- vaccinated ones.

Claims

The claims:

1. A protein for differentiating Brucellosis-infected animals from Brucella abortus S19- vaccinated animals, said protein comprising an amino acid sequence selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof.

2. A method of differentiating Brucellosis-infected animals from Brucella abortus S19- vaccinated animals, said method comprising detecting in a biological sample at least one protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, or antibodies against at least one protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof in an immunoassay, wherein detection of said protein or said antibodies indicates that the animal is infected and not vaccinated.

3. An immunoassay kit for differentiating Brucellosis-infected animals from Brucella abortus SI 9- vaccinated animals, comprising a solid support immobilized with primary antibodies raised against a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof.

4. An immunoassay kit for differentiating Brucellosis-infected animals from Brucella abortus S 19- vaccinated animals, comprising a solid support immobilized with a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof.

5. The immunoassay kit as claimed in claim 3 or claim 4, wherein the free protein binding sites on the solid support are blocked with a blocking buffer comprising a component selected from a group comprising bovine serum albumin, ovalbumin and bovine gelatin.

6. A method for differentiating Brucellosis-infected animals from Brucella abortus S19- vaccinated animals using a kit as claimed in claim 3, said method comprising:

a. contacting a biological sample with immobilized primary antibodies on the solid support, wherein the primary antibodies are specific to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof and the primary antibodies form an antibody-antigen complex with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof; and b. detecting the presence of antigens bound to the primary antibodies using conjugated secondary antibodies raised against a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, wherein the detection of said antigens indicates that the animal is infected and not vaccinated with Brucella abortus S19.

7. A method for differentiating Brucellosis-infected animals from Brucella abortus S19- vaccinated animals using a kit as claimed in claim 4, said method comprising:

a. contacting a biological sample with the immobilized antigenic protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof on the solid support, wherein the immobilized antigenic protein form an antigen- antibody complex with antibodies specific to said antigenic proteins; and b. detecting the presence of antibodies bound to the antigenic protein using conjugated secondary antibodies selected from a group comprising IgG and protein A/G, wherein the detection of said antibodies indicates that the animal is infected and not vaccinated with Brucella abortus S19 strain.

8. The method as claimed in claim 6 or claim 7, wherein the biological sample is diluted at a range from 1:50 to 1:500.

9. The method as claimed in claim 6 or claim 7, wherein the biological sample is selected from a group comprising serum sample, blood sample, urine sample, milk sample and semen sample.

10. The method as claimed in claim 6 or claim 7, wherein secondary antibodies are conjugated with a colorimetric, chemiluminescent, fluorescent, enzyme or gold- nanoparticle label.

11. A lateral flow immunoassay device for differentiating Brucellosis-infected animals from Brucella abortus S19-vaccinated animals, comprising:

a. a sample pad configured for receiving a biological sample;

b. a conjugate pad comprising conjugated antibodies raised against a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof;

c. a lateral flow membrane comprising a test line and a control line, wherein the test line comprises antibodies raised against a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, and the control line comprises protein A/G; and d. an absorbent pad.

12. A lateral flow immunoassay device for differentiating Brucellosis-infected animals from Brucella abortus S19-vaccinated animals, comprising:

a. a sample pad configured for receiving a biological sample;

b. a conjugate pad comprising conjugated IgG or conjugated protein A/G;

c. a lateral flow membrane comprising a test line and a control line, wherein the test line comprises antigens comprising the amino acid sequence selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and conservative variants thereof, and the control line comprises proteins selected from a group comprising IgG, protein A/G and lipopoly saccharides; and

d. an absorbent pad.

13. The lateral flow immunoassay device as claimed in claim 11 or claim 12, wherein the concentration of antigens at the test line is in the range of 0.01-1 mg/mL.

14. The lateral flow immunoassay device as claimed in claim 11 or claim 12, wherein the concentration of conjugated IgG or conjugated protein A/G in the conjugate pad is in the range of 1-30 pg/mL.

15. The lateral flow immunoassay device as claimed in claim 11 or claim 12, wherein the concentration of IgG or protein A/G at the control line is in the range of 0.1-2 mg/mL.

16. The lateral flow immunoassay device as claimed in claim 11 or claim 12, wherein IgG or protein A/G in the conjugate pad is conjugated with a colorimetric, chemiluminescent, fluorescent, enzyme or gold nanoparticle label.

17. The lateral flow immunoassay device as claimed in claim 11 or claim 12, wherein the lateral flow membrane is a nitrocellulose membrane.

18. The lateral flow immunoassay device as claimed in claim 11 or claim 12, further comprising a housing configured to enclose the sample pad, conjugate pad, lateral flow membrane and absorbent pad.

19. Use of a protein selected from a group comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, conservative variants and combinations thereof for differentiating Brucellosis-infected animals from Brucella abortus SI 9- vaccinated animals.