ES2389066A1 - Diva method for differentiating animals vaccinated against brucellosis - Google Patents

Abstract

DIVA method for identifying animals vaccinated against brucellosis. Strains of Brucella are described that have been O-antigen-modified in such a manner as to produce a new immunogenic epitope that is different from those produced by wild Brucella strains and that makes it possible, consequently, to differentiate vaccinated animals from unvaccinated infected animals.

Description

DIVA method of differentiation of vaccinated animals against brucellosis

OBJECT OF THE INVENTION

The invention is attached to the technical field of animal health, in particular the differentiation between animals infected by a bacterium of the Brucella genus of animals vaccinated against said bacterium.

STATE OF THE TECHNIQUE

Brucellosis is an endemic zoonosis in much of the world. It affects animal health and production, has an important impact on international trade in animals, as well as products derived from them (among others: milk, cheese, dairy products, etc.) and is the cause of brucellosis human Human disease is rarely fatal, but it is disabling, long lasting and can leave permanent sequelae. Its treatment is expensive, because it requires the combination of antibiotics for prolonged periods, with a risk of relapse. Brucellosis is produced by the bacteria of the genus Brucella, which includes several species. Among them, the so-called smooth species (or S "smooth") infect domestic animals such as ruminants and swine, in addition to wild mammals. These smooth species carry on their surface a characteristic antigen, the smooth-type lipopolysaccharide (LPS) (S-LPS), carrier of an acidic acid poles O (also called O antigen or O chain). Some mutants of these smooth species may lose the polysaccharide O on the surface (rough mutants) and, nevertheless, be able to synthesize precursors of the polysaccharide O that remain inside the bacteria.

There are no vaccines for human use, and brucellosis control is based on animal vaccination, with subsequent identification of infected animals and their elimination. The only sure evidence of Brucella infection is culture isolation, but given its technical difficulty, cost and risks, serological tests are the most common diagnostic tool. Animal vaccination is the most important pillar in the control and eradication of the disease. However, existing animal vaccines carry a smooth-type LPS and stimulate an immune response against the O chain very similar to that of the infection. This problem is very important, since it makes it difficult or impossible to distinguish vaccinated from infected animals when, for example, an epidemic outbreak occurs, since the diagnosis is based on the detection of antibodies against the O-chain of the smooth-type LPS. .

The only vaccines against brucellosis successfully used in animals are live attenuated vaccines. The two classic reference vaccines, B. abortus S19 in cattle and B. melitensis Rev1 in sheep and goats, have demonstrated their efficacy both in controlled experiments and in field use. However, they retain the O-chain of LPS, which is the immuno-dominant antigen in serological tests. Therefore, its use interferes with the diagnosis and makes it difficult to differentiate between vaccinated and infected animals.

So far, several strategies for using these vaccines have been used to minimize, not totally eliminate, the problem of differentiating between vaccinated animals and infected animals (Nicoletti P, Vaccination. Animal Brucellosis. CRC Press, Boca Raton, 1990; 283 -299; Blasco 1M, Prev Vet Med 1997: 31: 275-283), such as:

1) limit vaccination to young animals

2) use reduced vaccine doses in adults.

3) use the conjunctival route as a route for vaccination, instead of

the subcutaneous

These strategies are based on the observation that (1), animals that have not reached sexual maturity produce an antibody response to Brucella LPS of shorter duration than adults; (2), the lowest antigen load in a reduced dose; and (3), that the conjunctival route distributes the vaccine directly to the peri-exophageal lymph nodes and, in this way, the brucelas reach the target cells more quickly (lymph node dendritic cells). Although these strategies reduce the intensity and duration of antibodies against the LPS O chain, they do not completely solve the problem and, in addition, are inapplicable in most countries, or in geographic areas of extensive breeding, as they require marking systems and control of animals and veterinary services very efficient and expensive.

Diagnostic tests have also been investigated which, although using the S-LPS, the polysaccharide O or the native hapten (NH) as an antigen, are sensitive to the amount and affinity of the antibodies, usually greater in infection than in vaccination. However, none of the aforementioned technical solutions differentiate vaccinated animals from infected animals with 100% sensitivity and specificity in all vaccination strategies, particularly in adult vaccination (W091 / 06633, Nielsen K, Vet Microbiol 2002; 90 : 447-459; Moriyón, 1., et al., Vet Res 2004; 35: 1-38).

Finally, vaccine modifications have been investigated to nullify this problem. One of them is the rough mutant vaccines, devoid of the polysaccharide O attached to the rest of the LPS on the surface of the bacteria, but these are not sufficiently effective (W093 / 16728; Moriyón, 1., et al., Vet Res 2004; 35 : 138; González D, et al., PLoS.One 2008; 3: e2760.2008; Barrio, MB., Et al., Vaccine 2009; 27: 1741-1749).

Another possibility is the use of recombinant proteins, subcellular or DNA-based vaccines and / or vaccine vectors, but these induce less protection than that provided by live attenuated vaccines.

The last proposed approach has been the incorporation of the green fluorescent protein (GFP) by means of an expression plasmid in Brucella to the vaccine strain S19 (Chacón-Díaz C. et al., Vaccine 2011; 29 (3): 577-582) . The S19-GFP strain maintains the same biological properties as the reference in the murine model and the antibodies generated against this protein allow the discrimination of mice immunized with S 19-GFP, which have fluorescence, from those infected with S19, which They would not present it. However, experience shows that, in brucellosis, the anti-protein response is of a shorter duration than the response against the LPS O chain. Therefore, although there is a lack of experimentation with S 19-GFP in natural hosts (cows, in this case), the existing evidence indicates that the response against GFP will be transitory compared to the response against the LPS chain O. This is a clear disadvantage, since a response against only the O-chain of the LPS does not allow the differentiation of infected and vaccinated animals, and thus the problem remains unsolved. The O-chain of smooth brucelas carries the immuno-dominant epitopes that give the corresponding serological tests the best sensitivity, but it is also the cause of interference from vaccination with smooth vaccines in the diagnosis of brucellosis.

The O chain is a polysaccharide, specifically in Brucella it is a homopolymer of perosamine (4-amino-4,6-dideoxy-D-mannose), substituted by formyl groups in N position and that plays an essential role in its antigenic structure ( Bundle, DR. Et al., Infect Immun 1989; 57: 2829-2836).

The present invention underlies the manipulation of the O antigen to generate labeled strains that differ antigenically from wild virulent strains, since it has now been proven that at least one epitope characteristic of the labeled strains is generated, useful for differentiating antibodies directed against the vaccine (modified O chain), of those directed against the virulent strains (original O chain) and, therefore, the vaccinated animals of the infected. To alter the structure of the Brucella O chain, substituents other than the formyl group have been incorporated into the perosamine residues.

DESCRIPTION OF THE FIGURES

Figure 1. Demonstration of the modification of perosamine and the appearance of N-acetylperosamine in the O-chain of the BPS-acet LPS. Analysis by lH_ NMR of the O-PS of B.abortus (A) and of BAB-acet (B). Environment at 1 lH / ppm is observed

the signal corresponding to methyl group, around 2 lH / ppm the one corresponding to acetyl group, around 4 lH / ppm the one corresponding to perosamine and around 8 1H / ppm the corresponding one to formyl group.

Figure 2. The incorporation of acetyl groups into the BAB-acet O chain eliminates a typical B. abortus epitope. Reactivity of monoclonal antibodies against epitopes A (triangles), M (squares) and C (circles), against the LPS of BAB-parental (panel A), and against the LPS of BAB-aeet (panel B). Abscissa: dilution of the serum; Ordered: Absorbance measured as optical density (D.O.) at 405 nm.

Figure 3. The incorporation of acetyl groups into the B. abortus 2308 O chain generates a new or new immunogenic epitope (s). Reactivity against LPS of BAB-parental (A), BAB-aeet (B) and E. eolf 0157: H7 (C) of rabbit serum immunized with whole cells of absorbed and un absorbed BAB-aeet. Abcisas: Title; Ordered Ab United measured as D.O. at 405 nm.

Rabbit serum immunized with BAB-aeet: sm absorb (triangles); absorbed with BAB-parental (black circles); absorbed with BAB-parental and BABaeet (white circles) and negative control (rhombuses). Rabbit serum immunized with E. eolf 0157: H7 (squares).

Figure 4. Schematic representation of the construction of the BABAwadB mutant by mutagenesis by phase deletion PCR. The ORF to be removed is represented by a gray arrow (the striped rectangle represents the deleted codons); the intergenic regions above and below the ORF sequence are represented in black; the oligonucleotides used in mutagenesis are indicated as F1, R2, F3 and R4 (the complementary region between oligos R2 and F3 is represented with lighter stripes); rectangles filled with squares denote kanamycin resistance (KmR) and sucrose sensitivity cassette (sacBR).

GENERAL DESCRIPTION OF THE INVENTION

To solve the ongoing technical problem in the state of the art regarding the current impossibility of effectively distinguishing, without requiring a large sanitary or veterinary infrastructure, animals vaccinated against brucellosis of animals not vaccinated but affected by an outbreak of the disease , the inventors of the present invention have developed the technical solution detailed below.

Said technical embodiment involves different elements, applications and variants, but all of them underlie the same technical concept: to modify the O antigen of an LPS by replacing, in at least one existing Nformylperosamine residue, of a formyl group in position 4 -amino by an acyl group other than the formyl group, or by a sugar. Administration to vaccinated animals of this modified O antigen, either directly as part of a compound or composition, or as part of microorganisms that contain it and / or are capable of expressing it, allows its identification as vaccinated animals. This identification is possible both if the vaccine strain 1 provided that confers protection against brucellosis contains said modified O antigen, as if it does not contain it but together with said vaccine strain it is administered: a) either the compound or the composition containing it, b) either a strain that does not confer immunity against brucellosis, but that contains and / or expresses said modified O antigen and that serves, therefore, as a vaccination marker.

Following this unitary approach of the invention, an embodiment thereof consists of a gram-negative bacterium of the Erucella genus comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that at least one of the N-formylperosamine residues of said O antigen has been modified by replacing the 4-amino formyl group of perosamine, with an acyl group, other than the formyl group, or by a sugar, selected from the group comprising hexoses and pentoses.

More specifically, in said gram-negative bacterium, the acyl group other than the formyl group that replaces it in the N-formyl perosamine residues is selected from the group consisting of: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3-hydroxypropionyl, an S (+) 2-hydroxypropionyl group and an R (-) 2-hydroxypropionyl group; preferably the acyl group is an acetyl group.

As for the percentage of substitution, gram-negative bacteria are preferred where at least 20%, preferably at least 40% and more preferably at least 60% of the N-formylperosamine residues of the O antigen have been replaced by N-acylperosamine residues other than N-formylperosamine; preferably they have been replaced by N-acetylperosamines.

In another preferred embodiment of the invention, the gram-negative bacteria mentioned above further comprise a heterologous gene encoding: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; or

ii) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

In a specific embodiment, the gram-negative bacteria mentioned above comprise a heterologous gene encoding an N-acyltransferase capable of transferring an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group; preferably Naciltransferase is an N-acetyltransferase.

In a particular embodiment, the heterologous gene encoding said Nacethyltransferase comes from Eseheriehia eoli 0157: H7, Eseheriehia hermanii, Vibrio eholerae Hakata, Salmonella group N, Stenotrophomonas maltophila, Citrobaeter gillenii, Citrobaeter youngae, or Cauloeentbaeresee.

In a preferred embodiment the gram-negative bacterium of the genus Brucella which is used to carry out this invention is preferably Brucella melitensis Rev-l, Brucella abortus S19, or the Brucella BAB! 1wadB mutant.

In the present description all this set of bacteria of the genus Brucella comprising a modified O antigen as described above, are called bacteria of the invention.

The present invention also encompasses a product that consists of or comprises, a molecule that, in turn, comprises the LPS O antigen, or an NH, or a biosynthetic precursor thereof, or a fragment of any of the previous, characterized in that:

a) comes from a gram-negative bacterium with an O antigen comprising a homopolymer of N-formylperosamine; and where in at least one of the N-formylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by:

i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group ; more preferably the acyl group is an acetyl group; or by

ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising

a heteropolymer formed by residues i) N-formylperosamine and N-acylperosamine, where this N-acylperosamine is distinct from N-formylperosamine, or ii) N-formylperosamine and N-glycosylperosamine; preferably the

Heteropolymer is formed by residues N-formylperosamine and N-acetylperosamine, N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionine

N -formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is formed by N-formylperosamine and N-acetylperosamine residues.

A preferred product among those mentioned above is that where the molecule comprising the O antigen comes from a gram-negative bacterium of the Erucella genus of the invention.

A preferred embodiment of the invention consists of a product such as those mentioned above, where the molecule comprising the O antigen comes from a genetically modified bacterium, to which a heterologous gene encoding:

a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; preferably an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group ; more preferably the enzyme N-acyltransferase is an N-acetyltransferase; or

b) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the antigen perosamines or.

Said product has at least 20%, preferably at least 40% and more preferably, at least 60% of the O antigen residues, with a Nacilperosamine other than N-formylperosamine; preferably, Nacilperosamine is an N-acetylperosamine. In the present description, the set of products is generically referred to as the product of the invention.

The invention also describes a process for obtaining a product of the invention as defined above, said process comprising the steps:

a) cultivate, under appropriate conditions, a modified gram-negative bacterium

genetically by the introduction of a heterologous gene encoding i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; where the bacterium is preferably a bacterium of the invention; and b) isolate and / or purify said product of the invention.

A subject of the invention is also a method for obtaining antibodies, comprising:

a) immunize an animal with i) a bacterium of the invention, as defined above, or ii) a product of the invention, also as detailed more

above; and b) isolate and / or purify said antibodies. Object of the present invention are also the antibodies obtainable by the procedure indicated above.

Accordingly, a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that:

a) at least one of the N-formylperosamine residues of said O antigen has been modified by replacing at least one formyl group, in the 4-amino position of perosamine, by:

i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group , and more preferably the acyl group is an acetyl group; or by

ii) a sugar, selected from the group comprising hexoses and pentoses;

or

b) said antigen O comprises a heteropolymer formed by residues

i) N-formylperosamine and N-acylperosamine, where N-acylperosamine is

is different from N-formylperosamine, or

ii) N-formylperosamine and N-glycosylperosamine; preferably the

heteropolymer is made up of residues

N -formylperosamine and N-acetylperosamine,

N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine,

N-formylperosamine and 3-hydroxypropionylperosamine,

N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also

N -formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is formed by N-formylperosamine and N-acetylperosamine residues.

Preferably the antibodies described above are specific against an O antigen that comes from a bacterium of the invention. For the purposes of this description, the different antibodies described above are called antibodies of the invention.

The invention also relates to a bacterium of the invention, or a product of the invention, for use in medicine.

More specifically, the invention concerns the use of a bacterium of the invention,

or a product of the invention, in the manufacture of a medicament or a vaccine.

Specifically, the invention is about a bacterium of the invention, or a product of the invention, for use in the prevention of brucellosis.

Thus, the invention also comprises the use of a bacterium of the invention, or a product of the invention, in the manufacture of a medicament or a vaccine for the prevention of brucellosis.

The invention consists, in turn, of a medicament for the treatment of

Brucellosis, or a vaccine for the prevention of the occurrence of said disease comprising a bacterium of the invention, or a product of the invention.

Another preferred embodiment of the invention consists of a bacterium of the invention, or a product of the invention, or an antibody of the invention, for use in the diagnosis of brucellosis; preferably for the differentiation of animals infected by Erucella from animals vaccinated against Erucella.

Similarly, the invention also relates to the use of a bacterium of the invention, or a product of the invention, or an antibody of the invention, in the manufacture of a composition, reagent or kit, for the diagnosis of brucellosis; preferably for the differentiation of animals infected by Erucella from animals vaccinated against Erucella.

Another embodiment of the present invention, based on the same technical solution common to all embodiments included in the patent, is the use of a marker to differentiate Erucella infected animals from vaccinated animals against the Erucella, wherein said marker is selected between:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

c) a DNA or RNA molecule that encodes:

i) an N-acyltransferase capable of transferring an acyl group, other than

formyl group, at the 4-amino position of the perosamines of the O antigen; where

the acyl group is preferably selected from the group comprising a

acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3

hydroxypropionyl, an S (+) 2-hydroxypropionyl group, an R (-) 2 group

hydroxypropionyl; and more preferably the acyl group is an acetyl group; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of the above. For the purposes of this description, this set of different markers is

they call markers of the invention.

Along the same lines, the invention describes an in vitro diagnostic method for differentiating Erucella infected animals from vaccinated animals against Erucella, which comprises detecting the presence in an animal sample of a marker selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment thereof, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment thereof, from a bacterium of the invention;

e) a DNA or RNA molecule encoding: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; where he

acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of several of the above markers;

where the presence of at least one of said markers is indicative that said animal has been vaccinated against brucellosis.

In a preferred way of practicing the present invention the method described above is an immunoassay, preferably selected from an ELISA, a plaque agglutination test and a tube agglutination test.

The invention in relation to the above-mentioned method comprises the following steps: a) detecting the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or

of a fragment of any of the above, from a gram bacteria

Erucella negative, other than a bacterium of the invention; Y

b) detect the presence in the sample of specific antibodies against an antigen ° of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention.

The method of the invention, in a variant, further comprises an intermediate step between a) and b) in which the sample is contacted with a specific ligand to absorb the antibodies detected in a). Said probe or specific ligand to absorb the antibodies detected in a) is selected from the group consisting of:

a) a molecule comprising an antigen ° of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the genus Erucella, other than a bacterium of the invention; or

b) a gram-negative bacterium of the genus Erucella, distinct from a bacterium of the invention.

The invention, in relation to the diagnostic method, can be carried out in vivo to differentiate Erucella infected animals from vaccinated animals against Erucella. Said in vivo method, in accordance with the present invention, comprises:

a) intracutaneously inoculate the subject, preferably an animal, with a suitable dose, according to its species and weight, of

i) an N-acyltransferase capable of transferring to the 4-amino position of the

0 antigen perosamines, an acyl group, other than the formyl group; where

the acyl group is preferably selected from the group comprising a

acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3

hydroxypropionyl, a group S (+) 2-hydroxypro p ion i 1 o, a g ru po

R (-) 2-hydroxypropionyl, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or

from

ii) an N-glycosyltransferase capable of transferring a selected sugar

from the group comprising hexoses and pentoses, to the 4-amino position of the

O antigen perosamines; Y

b) or preserve the 110 of a delayed hypersensitivity skin reaction, preferably detectable by the formation of indurations or papules.

The invention also describes a diagnostic kit, to differentiate Erucella infected animals from vaccinated animals against Erucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the O antigen of a lipopolysaccharide or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, wherein said O antigen comes from a bacterium of the invention ;

b) an antibody of the invention;

c) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the O antigen, an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group , and more preferably the acyl group is an acetyl group, the N-acyltransferase enzyme being therefore an N-acetyltransferase;

d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y

e) a polynucleotide for amplifying a gene encoding an N-acyltransferase according to c) or an N-glycosyltransferase according to d); preferably a polynucleotide to amplify the wbdR gene of E. eolf 0157: H7; more preferably the polynucleotide sequence is SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, and SEQ.ID.NO. 12.

In a preferred embodiment of the invention, the kit comprises at least one

probe or ligand a) for specific antibodies selected from the group formed

by:

a) a bacterium of the invention; Y

b) a product of the invention.

The kit of the invention, in an alternative, further comprises at least one reagent selected from:

a) a molecule comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Erucella genus, other than a bacterium of the invention; or

b) a gram-negative bacterium of the genus Erucella, distinct from a bacterium of the invention.

Finally, the invention also describes a polynucleotide that comprises, or consists of, a sequence selected from: SEQ.ID.NO. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, or SEQ.ID.NO. 12. For the purposes of the present description the above-mentioned polynucleotides are called polynucleotides of the invention.

Related to this last aspect of the invention, this also refers to the polynucleotides of the invention for use in the diagnosis of brucellosis and related thereto, the use of the polynucleotides of the invention for the manufacture of a composition, a reagent or a kit for the diagnosis of brucellosis.

In another aspect, the invention also relates to a method of prevention and / or treatment of brucellosis in a subject, preferably an animal, which comprises the administration to said subject, preferably an animal, of a therapeutically effective amount of a bacterium of the invention.

DETAILED DESCRIPTION OF THE INVENTION

Brucella bacteria carrying modified O antigen

Therefore, in a first aspect the invention relates to a gram-negative bacterium of the genus Erucella comprising an antigen ° of an LPS, or of an NH,

or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing (0, LPS, NH antigen or biosynthetic precursors), characterized in that at least one of the N-formylperosamine residues of said 0 antigen, has been modified by the substitution of the formyl group, in the 4-amino position of the perosamma, by:

a) an acyl group other than the formyl group; or by b) a sugar, selected from the group comprising hexoses and pentoses.

For brevity, as already mentioned, we will also refer to this gram-negative bacterium of the genus Erucella as "bacteria of the invention".

In a particular embodiment the Erucella is a smooth Erucella. Smooth bacteria of the genus Erucella are those that comprise a smooth lipopolysaccharide (smooth LPS, LPS-S, or S-LPS) as a component of the outer membrane. This smooth lipopolysaccharide comprises 3 typical domains: lipid A, which allows the lipopolysaccharide to be anchored to the outer membrane of the bacteria; the oligosaccharide nucleus; and polysaccharide 0, also referred to as chain 0, antigen 0, or polymer O. In another embodiment, the Erucella is a rough Erucella mutant that does not have a ° chain attached to the rest of the LPS, but still has biosynthetic precursors thereof in its inside, like smooth bacteria.

The antigen ° is a polysaccharide which in Erucella essentially comprises an unbranched chain formed by a homopolymer of 4-formamido4,6-dideoxy-D-mannose residues (alternatively called N-formylperosamine), linked by links to [1-2].

The native hapten (or also NH) is another polysaccharide component of the brucelas, antigenically related to the LPS. Like the LPS, the native hapten of these bacteria comprises a homopolymer of Nformylperosamines structurally equivalent to the O antigen of the LPS, but not bound to the polysaccharide nucleus and there peptide A, which we will also call as the O antigen or one of its equivalent terms.

The term "biosynthetic precussor thereof" refers to any polysaccharide or oligosaccharide of free N-formylperosamine in the cytoplasm of a Brucella, or attached to its cellular envelope by means of a lipid of the bactoprenol type.

The bacterium of the invention can be any O-chain carrying bacterium of any species of the Brucella genus (smooth or rough) to which a modification has been made as defined in this description. Preferably, said Brucella is a B. melitensis or a B. abortus or a B. suis.

In one embodiment of the invention, the O-chain carrier Brucella is a vaccine strain of any of the mentioned species.

In a preferred embodiment of the invention the Brucella is B. melitensis Rev-1,

B. abortus S19, or B. abortus BAB! 1wadB.

The bacterium of the invention is characterized in that at least one of the N-formylperosamine residues of the O antigen of the LPS, NH, biosynthetic precursor thereof or of a fragment of any of the above, is modified, so that the formyl group in 4-amino position of perosamine is substituted: a) by an acyl group other than the formyl group; or b) by a sugar, which can be a hexose or a pentose.

In one embodiment, the hexose or pentose that replaces the formyl group may be or be selected from allose, altrose, glucose, mannose, gulp, galactose,

idosa, talosa, fructose, sorbose, abecuosa, ribose, arabinose, xylose, lyxose, ribulose, or

xylulose

The term "acyl group" refers to a group derived from oxoacid by elimination of at least one hydroxyl group. It is a structure component R-CO-O-, where R is an aliphatic chain with or without additional groups.

In a preferred embodiment of the invention, the acyl group has been selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and a R (-) 2-hydroxypropionyl group.

In a more preferred embodiment the acyl group is an acetyl group, so that the O antigen will comprise at least one N-acetylperosamine (4-acetamido-4,6-dideoxy-D-mannose) residue.

Thus, in one embodiment the O antigen of the LPS, of the NH, of the biosynthetic precursor thereof or of a fragment of any of the foregoing, comprises a heteropolymer formed by N-formylperosamine and N-acylperosamine residues, this being an N -acylperosamine other than Nformylperosamine, or alternatively by N-formylperosamine and Nglicosylperosamine residues. It preferably comprises a heteropolymer formed by residues:

N -formylperosamine and N-acetylperosamine;

N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine;

N-formylperosamine and 3-hydroxypropionylperosamine;

N-formylperosamine and S (+) 2-hydroxypropionylperosamine; or

N -formylperosamine and R (-) 2-hydroxypropionylperosamine.

In a more preferred embodiment the heteropolymer is formed by the alternation of residues N-formylperosamine and N-acetylperosamine.

The proportion of each of the residues can be varied according to the embodiments. In one embodiment, at least 20%, preferably at least 40% and more preferably at least 60% of the N-formylperosamine residues have been replaced by residues of the alternative N-acylperosamine. In a preferred embodiment, at least 20%, preferably at least 40% and more preferably at least 60% of the O antigen residues are N-acetylperosamines.

Likewise, the distribution of the two residues in the heteropolymer chain may vary, although it is preferable that the alternation of both residues be homogeneous along the chain.

The modified O antigen of the bacterium of the invention has at least one new immunogenic epitope, nonexistent in the field strains, and against which specific antibodies are generated. The bacterium of the invention is therefore antigenically labeled.

Accordingly, it is sufficient that the bacterium of the invention comprises an O antigen of an LPS, an NH or a biosynthetic precursor thereof, or a fragment of any of the foregoing, so that said, O antigen of an LPS, NH or a biosynthetic precursor thereof, or of a fragment of any of the foregoing, comprises at least one new immunogenic epitope that is not present in field brucellas. The terms "field", "wild" or "wild" refer interchangeably to strains originally obtained from natural hosts.

The presence of said immunogenic epitope capable of generating specific antibodies can be determined, for example, by assays:

-

extraction of LPS, NH, biosynthetic precursors thereof, or a fragment of any of the foregoing and characterization of the nuclear magnetic resonance O antigen O), as described in example 2;

-

an immunoassay to determine whether in animals immunized with the bacterium of the invention or with an extract comprising the modified O antigen,

generate specific antibodies against the modified O antigen, for example an agglutination or an ELISA, as described in example 4; and, optionally, an immunoassay to determine the elimination of any of the typical epitopes of the O antigen from field brucelas, as described in example 3.

As one skilled in the art will appreciate, the bacteria of the invention can be prepared by chemical modification methods, or also by genetic engineering techniques. In a preferred embodiment, the bacterium of the invention is obtained by genetic modification.

Thus, in one embodiment, the bacterium of the invention is also a bacterium which further comprises a heterologous gene encoding i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

The acyl group that said N-acyltransferase is capable of transferring, or the hexose or pentose that N-glycosyltransferase is capable of transferring, can be any of those previously mentioned in the description of the characteristics of the bacterium O antigen invention.

In one embodiment, the acyl group is selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2 group -hydroxypropionyl, and more preferably the acyl group is an acetyl group. In this case, the heterologous gene encoding N-acyltransferase can be obtained by cloning the gene of any field bacteria comprising said gene. Likewise, said gene may be a heterologous gene that encodes a variant of a mutated or modified N-acyltransferase, provided that this variant is capable of transferring the acyl group other than the formyl group to the 4-amino position of the O-antigen perosamines .

For the selection of a suitable heterologous gene, the following strategy can be followed:

i) perform a review of the bacteria (Table 2) that have an O antigen consisting of N-acylperosamine residues with a group in position N other than the formyl group characteristic of the O antigen of the smooth species of Erucella (a homopolymer of N-formylperosamine );

ii) identify the enzyme responsible for incorporating the different substitution of the formyl group in the 4-amino position; iii) cloning in an expression plasmid the DNA encoding said enzyme and introducing such plasmid into Erucella; and iv) analyze the structure and immunogenic properties of the LPS thus modified.

In a preferred embodiment said heterologous gene encodes an N-acetyltransferase or a variant thereof capable of transferring an acetyl group to the 4-amino position of perosamine. This heterologous gene can be, among others, the gene that encodes an N-acetyltransferase from Eseheriehia eoli 0157: H7, Eseheriehia hermanii, Vibrio eholerae Hakata, Salmonella group N, Stenotrophomonas maltophila, Citrobaeter gillenii, Citrobaeter youngae, oegaeus.

In one embodiment, the heterologous gene capable of transferring acetyl groups to the indicated position is, for example, the wbdR gene (NeBI; 16.12.2010; ID: 962088; locus tag: z3192; ORF in SEQ ID NO: 7); encoding the E. eoli N-acetyltransferase 0157: H7.

Generally, the heterologous gene encoding N-acyltransferase or Nglicosyltransferase will be part of and will be integrated into an expression cassette or transcriptional unit, which allows transcription and production of Naciltransferase or N-glycosyltransferase in the receiving Erucella of the heterologous gene, and that includes:

-

a regulatory-promoter region, functional in Erucella, which directs and regulates the transcription of the sequence encoding the N-acyltransferase or Nglicosyltransferase;

-

a signal sequence of transcription initiation;

-

the sequence encoding the N-acyltransferase or N-glycosyltransferase; Y

-

a signal sequence of transcription termination.

In one embodiment, the heterologous gene includes the polynucleotide sequence encoding N-acyltransferase or N-glycosyltransferase and also the rest of the elements that complete the transcriptional unit of the gene in the bacterium from which said heterologous gene is obtained and which regulate the transcription and expression of said Naciltransferase or N-glycosyltransferase in said bacterium.

However, all or part of these non-coding polynucleotide sequences could be replaced by others (for example, a promoter region determined by another promoter region different from the previous one can be replaced), or even sequences with additional functionality could be introduced. In any case, the resulting heterologous gene will allow the transcription and expression of N-acyltransferase or N-glycosyltransferase in the recipient Erucella of said heterologous gene.

The construction of expression cassettes that form the heterologous gene; its introduction into expression vectors suitable for the introduction and genetic transfer of heterologous genes in bacteria; as well as the introduction and transfer of said vector to Erucella bacteria can be carried out by conventional techniques of genetic engineering and genetic transfer known to the expert in this field (Sambrook et al., 2001, "Molecular cloning, to Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory Press, NY Vol 1-3 a).

An object of the invention is a method for obtaining a bacterium, which comprises transferring an expression vector, capable of expressing itself in Erucella, to a gram-negative bacterium of the Erucella genus, which comprises a heterologous gene encoding:

i) an N acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

In one embodiment the expression vector may be for example pYRI-6 (see Table 1).

The N-acyltransferase can be any N-acyltransferase according to the embodiments described for the bacterium of the invention. In a particular embodiment, it is an N-acetyltransferase with the amino acid sequence depicted in SEQ ID NO: 8, which is encoded by the nucleotide sequence depicted in SEQ ID NO: 7.

As already indicated, the bacterium of the invention can be particularly useful in DIVA systems, as a labeled vaccine strain. DIVA means "Differentiation of Infected from Vaccinated Animals", a term coined in 1999 by 1. T. van Oirschot (Central Veterinary Institute, N etherlands), which enables mass vaccination of a population of susceptible animals, without compromising the serological identification of convalescent individuals. This strategy requires the use of appropriate vaccines and specific diagnostic tests.

In another aspect, the invention also relates to a bacterium of the invention for use in medicine or as a medicament or vaccine; and also to the use of a bacterium of the invention in the preparation of a medicament or vaccine; and also to a medicament or vaccine comprising a bacterium of the invention.

In another aspect, the invention relates to a bacterium of the invention for the prevention and treatment of brucellosis, and more preferably for the prevention of brucellosis. In other words, the invention also relates to the use of a bacterium of the invention in the preparation of a medicament or vaccine for the prevention and treatment of brucellosis, more preferably for the prevention of brucellosis.

The invention also relates to a method for the prevention and / or treatment of brucellosis in a subject, preferably an animal, comprising the administration to said subject or animal of a therapeutically effective amount of a bacterium of the invention. A therapeutically effective amount, for the purposes of the present specification, should be interpreted as an amount capable of preventing the onset of the disease and / or of remitting the symptoms inherent in said disease in an infected subject or animal until its complete cure.

On the other hand, the bacterium of the invention can be useful in the complementary diagnostic methods and kits of a DIVA system, for example as probes or ligands for the binding, absorption and / or capture or blocking of specific antibodies against the antigen. Or characteristic of the bacteria of the invention, present in a biological sample of a subject or animal; or as a control reagent.

Therefore the invention also relates to the use of a bacterium of the invention in the preparation of a composition, reagent or diagnostic kit, preferably for the diagnosis of brucellosis, more preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella; or in other words, the use of a bacterium of the invention in the preparation of a composition, reagent or kit for DIVA diagnosis of brucellosis.

The invention also relates to a bacterium of the invention for diagnostic use, preferably for diagnosis of brucellosis, more preferred for the differentiation of Brucella infected animals from vaccinated animals against Brucella; or in other words, the bacterium of the invention for use in DIVA diagnosis of brucellosis.

Product comprising a modified O antigen

As is clear from what has been described above, a modified O antigen in the manner indicated may also be useful, for example, in vaccine compositions comprising cell fractions (subcellular vaccines) or as a reagent in methods and kits for diagnosis.

Therefore, in another aspect the invention relates to a product consisting of,

or comprising, a molecule comprising, in turn, the LPS O antigen, NH, a biosynthetic precursor thereof, or a fragment of any of the above, characterized in that:

a) comes from a gram-negative bacterium whose O antigen comprises a homopolymer of N-formylperosamines and where at least one of the N-formylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by :

i) an acyl group, other than the formyl group; or by

ii) a sugar, selected from the group comprising hexoses and pentoses;

or

b) comes from a gram-negative bacterium with an O antigen that comprises

a heteropolymer formed by residues i) N-formylperosamine and N-acylperosamine, where this N-acylperosamine is distinct from N-formylperosamine, or ii) N -formylperosamine and N-glycosylperosamine.

For brevity, as mentioned above, we will also refer to this product as "product of the invention"; and to said molecule comprising the O antigen as "molecule of the invention".

In one embodiment in which the substituent is an acyl group other than the formyl group, it is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+ ) 2-hydroxypropionyl and an R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group. In another embodiment in which the substituent of the formyl group is a hexose or pentose, the sugar is selected from alosa, altrosa, glucose, mannose, gulose, galactose, idosa, talose, fructose, sorbose, abecuous, ribose, arabinose, xylose, lyxose, ribulose, or xylulose.

In a preferred embodiment the heteropolymer of the antigen is formed by residues selected from:

N -formylperosamine and N-acetylperosamine,

N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine,

N-formylperosamine and 3-hydroxypropionylperosamine,

N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also

N -formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably, the heteropolymer consists of Nformylperosamine and N-acetylperosamine residues.

In one embodiment the product is a composition or mixture containing the molecule of the invention comprising said 0 antigen, for example an extract

or bacterial fraction comprising the LPS, NH, or biosynthetic precursors thereof, or a fragment of any of these. In one embodiment said composition or mixture is a medicament or a vaccine comprising the molecule of the invention.

In one embodiment the antigen ° of the molecule of the invention comes from

Erucella

In one embodiment the antigen ° of the molecule of the invention comes from a genetically modified bacterium, to which a heterologous gene encoding an N-acyltransferase or N-glycosyltransferase has been introduced as defined above in the description of the bacterium of the invention; preferably Naciltransferase is an N-acetyltransferase.

More preferably, said genetically modified bacterium is a bacterium of the invention.

The O antigen of the molecule of the invention can also come from a gram-negative bacterium other than Erucella and which, with the introduction of the heterologous gene encoding a suitable N-acyltransferase or N-glycosyltransferase, is capable of producing an LPS, a NH, biosynthetic precursors thereof, or a fragment of any of the foregoing, with an O antigen having the heteropolymeric structure already indicated. For example, the Yersinia enterocolitica serotype 0: 9 O antigen is essentially formed by a chain of a homopolymer of N-formylperosamines with a structure similar to that of the Erucella O antigen. From this bacterium it is possible to obtain the described heteropolymeric O antigen, also by introducing a heterologous gene encoding a suitable N-acyltransferase or N-glycosyltransferase, preferably a Nacethyltransferase.

On the other hand, as in the bacterium of the invention, the proportion of each of the residues in the O antigen of the molecule of the invention may vary according to embodiments. In an embodiment at least 20%, preferably at least 40% and more preferably at least 60% of the residues are Nacilperosamine other than N-formylperosamine. In a preferred embodiment, at least 20%, preferably at least 40% and more preferably at least 60% of the O antigen residues are N-acetylperosamine.

In a further aspect, the invention relates to a method for obtaining the product with the molecule of the invention, comprising:

a) cultivate, under appropriate conditions, a genetically modified gram-negative bacterium by introducing into the bacterium a heterologous gene that encodes

i) an N-acyltransferase capable of transferring an acyl group, other than

formyl group, at the 4-amino position of the perosamines of the O antigen; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and b) isolate and / or purify said product.

The characteristics and embodiments of N-acyltransferase and Nglycosyltransferase have been described previously in describing the bacteria of the invention.

Thus, in a preferred embodiment the gram-negative bacterium is preferably a bacterium of the invention (a genetically modified Brucella as described above).

The term "cultivate under suitable conditions" refers to that it is grown under conditions that allow the expression and production of the N-acyltransferase or Nglycosyltransferase encoded by the heterologous gene and under suitable conditions for this enzyme to act, thus forming the LPS, NH and biosynthetic precursors thereof, or a fragment of any of the foregoing, containing the modified ° antigen.

The characteristics of the heterologous gene and its different embodiments have been described previously.

On the other hand, the isolation and purification of the product can be carried out by conventional methods for the isolation and purification of LPS, NH, biosynthetic precursors thereof, or a fragment of any of the above, containing the commonly used antigen 0 in bacteriology. Some suitable methods for isolation and purification can be found in Aragón et al. (J Bacteriol1996; 178: 1070-1079).

The following aspects are also the subject of the invention:

* The product of the invention for use in medicine, particularly as

medication or vaccine; and, in other words, also the use of the product of the invention in the preparation of a medicament or a vaccine;

*

The product of the invention for the prevention and treatment of brucellosis, more preferably for the prevention of brucellosis; or in other words, the use of the product of the invention in the preparation of a medicament or vaccine for the prevention and treatment of brucellosis, more preferably for the prevention of brucellosis;

*

A method for the prevention and treatment of brucellosis in a subject or animal, comprising administering to said subject or animal a therapeutically effective amount of the product of the invention;

*

The use of the product of the invention in the preparation of a composition, reagent or diagnostic kit, preferably for the diagnosis of brucellosis; more preferably for the differentiation of animals infected by Erucella from animals vaccinated against Erucella; or in other words, the use of the product of the invention in the preparation of a composition, reagent or kit for DIVA diagnosis of brucellosis;

*

The product of the invention for diagnostic use; preferably for the diagnosis of brucellosis, more preferably for the differentiation of animals infected by Erucella from vaccinated animals against Erucella; or in other words, the product of the invention for use in the DIVA diagnosis of brucellosis;

*

The use of the product of the invention as an immunogen in the preparation of an immunogenic composition for the production of antibodies (specific against the antigen O characteristic of the bacterium, molecule or product of the invention).

Antibodies to the modified O antigen

The inoculation or immunization of an animal with the bacterium, molecule or product of the invention causes the formation of specific antibodies against the modified O antigen already described. These specific antibodies are antibodies that do not recognize, that is, they do not form antigen-antibody immune complexes with

the O antigen of field brucelas, constituted by the homopolymeric chain of

N -formylperosamines.

These antibodies can be used for example in methods and kits for diagnosis of brucellosis, for example in competition immunoassays of the ELISA type.

Therefore, in another aspect the invention also relates to a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that :

a) at least one of the N-formylperosamine residues of said O antigen, has

been modified by replacing at least one formyl group, in

4 amino position of perosamine, by:

i) an acyl group, other than the formyl group; or by

ii) a sugar, selected from the group comprising hexoses and

pentoses; or

b) said antigen O comprises a heteropolymer formed by residues

i) N-formylperosamine and N-acylperosamine, where N

Acylperosamine is different from N-formylperosamine, or

ii) N-formylperosamine and N-glycosylperosamine.

The characteristics of this modified O antigen, as well as some of the possible embodiments for the formyl and substituent glycosyl groups of the formyl group and its heteropolymeric structure have already been provided in the description of the bacterium and product of the invention.

In one embodiment, the formyl group substituent is an acyl group selected from the group comprising an acetyl group, a 3-deoxy-Lglycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2 hydroxypropionyl group, an R (-) group 2-hydroxypropionyl, and more preferably it is an acetyl group.

In one embodiment the O antigen comprises a heteropolymer formed by

residues selected from: N -formylperosamine and N-acetylperosamine, N formylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine and R ( -) 2-hydroxypropionylperosamine;

In an even more concrete embodiment, the heteropolymer consists of N-formylperosamine and N-acetylperosamine residues.

In one embodiment the antibody is specific for an O antigen that comes from a gram-negative bacterium of the genus Erucella, preferably from a bacterium of the invention.

They are also object of the invention: -a procedure for obtaining antibodies, comprising:

a) immunize an animal with: i) a bacterium of the invention, or ii) a product of the invention; Y

b) isolate and / or purify the antibodies; as well as -a antibody obtainable by this procedure.

The steps of immunization and obtaining of the antibody can be performed according to conventional methods and techniques for obtaining antibodies, techniques all known to those skilled in the art (Hay, FC and Westwood, OMR, 2002. Practical Immunology, 4rth edition, Blackwell Science Ltd ., Oxford. ISBN: 978-086542-961-1).

They are also a further object of the invention:

* The use of these antibodies in the preparation of a composition, reagent or diagnostic kit, preferably for the diagnosis of brucellosis, more preferably for the differentiation of animals infected by Erucella from animals vaccinated against Erucella; or in other words, the use of these antibodies in the preparation of a composition, reagent or kit for DIVA diagnosis of brucellosis; Y

* The antibodies described in this section for diagnostic use, preferably for diagnosis of brucellosis, more preferably for the differentiation of animals infected by Erucella from vaccinated animals against Erucella; or in other words, the antibodies described above for use in the DIVA diagnosis of brucellosis.

Methods, reagents and kits for diagnosis of brucellosis

The characteristic of the modified O chain of the bacterium and product of the invention of generating a new immunogenic epitope can be very useful and can be exploited as a marker in a system for DIVA diagnosis of brucellosis.

Thus, the invention relates in a further aspect to the use of a marker to differentiate Erucella infected animals from vaccinated animals against the Erucella, wherein said marker is selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

e) a DNA or RNA molecule that encodes

i) an N-acyltransferase capable of transferring an acyl group, other than

formyl group, at the 4-amino position of the perosamines of the O antigen; where

the acyl group is preferably selected from the group comprising a

acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y

e) a combination of the above.

For the purposes of the present description, as mentioned above, the aforementioned markers will hereinafter be referred to as markers of the invention.

The invention relates in another aspect to an in vitro diagnostic method, to differentiate Erucella infected animals from vaccinated animals against Erucella (animals vaccinated with a bacterium of the invention), which comprises detecting the presence in a sample of the animal of a bookmark selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, or of an NH, or of

a biosynthetic precursor thereof, or a fragment of any of them,

from a bacterium of the invention; e) a DNA or RNA molecule encoding: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or against ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of several of the above markers;

where the presence of one of said markers is indicative that said animal has

been vaccinated against brucellosis.

These 0 antigens, antibodies, N-acyltransferases, and N-glycosyltransferases have already been described in the previous sections; its characteristics and embodiments are applicable to the use of the marker and the diagnostic method now proposed.

The diagnostic method, hereinafter referred to as the DIVA method of the invention, can be performed on any biological sample of the animal. In particular it can be performed on any type of biological fluid; preferably on a sample of blood serum, whey or tears. In a more preferred embodiment the sample is blood serum.

The detection of the marker of the invention can be carried out by means of conventional biomarker detection techniques, selected according to the chemical characteristics of the chosen marker and the requirements of the specific application. Among others, immunoassay techniques, hybridization and DNA amplification techniques (eg PCR), and combinations thereof can be used.

In one embodiment, the DIVA diagnostic method is an immunoassay. An "immunoassay" refers to any analytical immunochemical technique that includes in some of its stages the formation of immune complexes, that is to say those resulting from the conjugation of antibodies and antigens, as quantification references of an analyte (substance present in the sample that is the object of analysis) determined. The analyte can be the antibody [eg, in our method the antibodies of the markers of the invention b) od)] or the antigen of the invention [eg, in our method the antigen ° of the marker a)] . More preferably, the immunoassay is an immunoassay for the detection of a specific antibody against the antigen ° from a bacterium of the invention.

Without limiting the scope of the invention, in one embodiment the immunoassay method is selected from an ELISA (direct, indirect or competitive), an agglutination test (eg a plate agglutination, for example, with antigen Rose Bengal), a tube agglutination, a complement fixation and a fluorescence polarization test). Rosa Bengal antigen immunoassay is a method that detects binding antibodies using inactivated Brucella cells, stained with Rose Bengal and suspended in an acidic buffer that potentiates algutination against Erucella's smooth LPS.

In a particular embodiment, the DIVA diagnostic method by immunoassay comprises the following steps:

a) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, from a gram-negative bacterium of the genus Erucella, other than a bacterium of the invention; Y

b) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, from a bacterium of the invention . For the purposes of the present description the term "fragment" means a part or partial sequence with antigenic capacity, obtained from an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof.

The objective of step a) is to identify the presence in the antibody sample against the distinctive epitopes of the natural, unmodified O antigen, of the LPS, of the NH, of biosynthetic precursors thereof, or of a fragment of any of the above, of the bacteria of the genus Erucella (homopolymeric chain of N-formylperosamines). For this purpose it can be used as a probe

or by binding any gram-negative bacteria of the genus Erucella whose antigen O keeps its immunogenic properties unchanged, eg a field Erucella. This probe or ligand would act as an antigen in the formation of the immune complex with the antibody. Any product containing a molecule comprising the O antigen (immunogenically unchanged) of the LPS, NH, a biosynthetic precursor thereof, or a fragment of any of them (e.g. a bacterial extract).

In one embodiment, for the detection of the antibodies in step b) a bacterium of the invention (preferably the one that was used as a vaccine strain in the vaccination campaign) is used as a probe or ligand, or a molecule of the invention comprising the O antigen from said bacterium of the invention. However, other probes or ligands may also be used that allow specific binding of these antibodies (eg a molecule, or a bacterium containing it, with the same heteropolymeric structure of N-formylperosamine and Nacilperosamine residues [or N- glycosylperosamine according to the embodiment] than the O antigen of the bacterium of the invention, for example an antigen from other gram-negative bacteria, or molecules obtained by chemical synthesis).

The probes or ligand s used in steps a) and b) can be either suspended or fixed to a substrate.

In a more particular embodiment, the immunoassay further comprises, at an intermediate stage between steps a) and b), contacting the sample with a specific ligand to absorb the antibodies detected in step a). This specific ligand can be for example a Field Brucella, or an O antigen of an LPS,

or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of these, from a field Brucella.

Immunoassay by double Rose Bengal.

In a simple embodiment, the immunoassay can be carried out using a double Rose Bengal. First, in stage a), the sample (eg a serum) is analyzed by the classic Bengal Rose, with bacteria of the same antigenic structure as the field strains. In case of a positive reaction, the sample is absorbed with smooth field brucelas (intermediate stage) and then in stage c), a second modified Bengal Rose is made with a suspension of a bacterium of the invention [the same which was used as a vaccine strain 1 complementary to the DIVA system (for example BABacet, which has an O antigen with acetylated residues)]. A positive reaction at this stage c) would indicate that the sample has antibodies against the new epitope formed, as the case may be, by N-acylperosamine (different from N-formylperosamine; eg N-acetylperosamine) or N -glycosylperosamine; and that, therefore, comes from a vaccinated animal. On the contrary, a negative reaction in this second test, but positive in the first one, would indicate an infection.

5 Although this double Rose Bengal requires the intermediate step of antibody absorption, it is an economical and easily performed procedure, and therefore affordable in areas of low sanitary / veterinary infrastructure.

Indirect ELISA immunoassay

In a typical embodiment, the immunoassay can be carried out by a double enzyme immunoassay. First, in step a), the sample (eg a serum) is analyzed by an indirect ELISA, with antigens of the same antigenic structure as the field strains. In case of positive reaction, the sample is absorbed with smooth field brucelas (intermediate stage); and then stage c),

A second enzyme immunoassay is carried out with plates covered with the bacterium or molecule of the invention [the same one that was used as a complementary vaccine strain of the DIVA system (for example BABacet, which has an O antigen with acetylated residues)]. A positive reaction at this stage c) would indicate that the sample has antibodies against the new epitope formed, as the case may be, by the

20 N-acylperosamine (other than N-formylperosamine; eg N-acetylperosamine) or by N-glycosylperosamine; and that, therefore, comes from a vaccinated animal. On the contrary, a negative reaction in this second trial, but positive in the first one, would indicate an infection.

25 Immunoassay by competition ELISA In a typical embodiment, the immunoassay can be carried out by means of a competition enzyme immunoassay. First, the sample (eg a serum) is incubated in ELISA plates covered with the bacterium or molecule of the invention [the same that was used as a complementary vaccine strain of the system

30 DIVA (for example BABacet, which has an O antigen with acetylated residues)] in the presence of an antibody, hence using the term "competition", against the new characteristic epitope (s) of the O antigen of the bacterium of the invention, previously labeled with an enZIma. A decrease in reactivity (or activity associated with the labeling enzyme) between the labeled antibody and the bacterium or molecule of the invention that covers the plaque indicates the presence (competition) in the serum of antibodies against the antigen of the invention and, consequently, it is interpreted as serum from a vaccinated animal.

Diagnostic method by delayed hypersensitivity skin reaction test

In a further aspect, the invention relates to an in vivo method of DIVA diagnosis of brucellosis in an animal, which comprises inoculating the animal intracutaneously with a suitable dose, according to its species and weight, of an N-acyltransferase or an N-glycosyltransferase (purified by cloning, this being the same N-acyltransferase or N-glycosyltransferase of the heterologous gene with which the bacterium of the invention used as a vaccine strain was modified) and observing the development of a delayed hypersensitivity skin reaction (detectable by the formation of indurations or papules).

Molecular PCR detection

In one embodiment, the DIVA method of the invention comprises detecting in the sample a DNA or RNA molecule that encodes an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group other than the formyl group ; or an N-glycosyltransferase capable of transferring to that same position a sugar selected from the group comprising hexoses and pentoses.

In a specific ralization in which the N-acyltransferase is the N-acetyltransferase encoded by the previously mentioned wbdR gene, the detection can be performed by hybridization and amplification, using for example one of the following initiator pairs:

Couple A Direct initiator, wbdR Fw iforward):

5 'ATGAATTTGTATGGTATTTTTGGT 3' (SEQ.ID.NO. 9), whose melting temperature (Tm) is 55.84 oC Reverse Initiator, wbdR Rv (reverse): 5 'TTAAATAGATGTTGGCGATCTT 3' (SEQ.ID.NO. 10), (Tm: 55.74 OC) PCR product size: 666 base pairs

Couple B Direct Initiator, wbdR Fw: 5 'TGATGTTTTGGCAGGAAAGA 3' (SEQ.ID.NO. 11), (Tm: 59.25 OC) Reverse Initiator, wbdR Rv: 5 'TGGATTTCCGCACACAGTTA 3' (SEQ.ID.NO. 12), (Tm: 60.11 OC)

A polynucleotide comprising, or consisting of, a sequence selected from SEQ.ID.NO. is also a further object of the invention. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3 SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11 AND SEQ.ID.NO. 12; as well as the use of any of said polynucleotides for the molecular diagnosis of brucellosis, particularly for DIVA diagnosis. Similarly, the invention also includes the use of any of the aforementioned polynucleotides in the manufacture of brucellosis diagnostic compositions, reagents or kits, particularly of the DIVA type.

In a further aspect, the invention relates to a diagnostic kit, to differentiate Erucella infected animals from vaccinated animals against the Erucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the O antigen of a lipopolysaccharide or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, wherein said O antigen comes from a bacterium, molecule or product of the invention;

b) an antibody of the invention c) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the O antigen, an acyl group, other than the formyl group; where he

acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, where, therefore, the enzyme N-acyltransferase a Nacethyltransferase;

d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y

e) a polynucleotide to amplify a gene encoding an N-acyltransferase according to c) or an N-glycosyltransferase according to d), preferably to amplify the wbdR gene of E. eoli 0157: H7; more preferably the polynucleotide sequence is selected from: SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11 and SEQ.ID.NO. 12.

These O antigens, antibodies, N-acyltransferases, and N-glycosyltransferases have already been described in the previous sections; its features and embodiments are applicable to the components of this kit.

In one embodiment, the kit comprises a probe or ligand for the specific antibodies as described in section a) selected from the group consisting of:

a) a bacterium of the invention; Y

b) a product of the invention.

However, it could alternatively include other probes or ligands, for example a genetically modified Yersinia, or a molecule or product comprising the O antigen of a genetically modified Yersinia, with a heterologous gene encoding an N-acyltransferase or an N-glycosyltransferase according to It has been defined previously.

In another embodiment, the kit further comprises at least one reagent selected from: a) a molecule comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the

above, from a gram-negative bacterium of the genus Erucella, other than a bacterium of the invention; or b) a gram-negative bacterium of the genus Erucella, other than a bacterium of the invention. 5 In both cases the O antigen is the characteristic O antigen of field brucelas, formed by a homopolymer of N-formylperosamines.

EXAMPLES

10 Some concrete examples of embodiments of the invention are described below, as well as experimental tests, which do not in any case limit the invention.

In all cases of using kits described below in the 15 examples, the experiments were performed following the instructions of the manufacturers of the respective kits.

Example 1. Construction of Brucella strains carrying the gene (wbdR) of an acetyl transferase.

20 Bacterial strains and plasmids. The relevant characteristics of the bacterial strains and plasmids used are presented in Table 1.

Table 1 Strains and Plasmids

Strain / Plasmid Relevant characteristics Reference / Origin

Brucella abortus

BAB-parental

Spontaneous mutant N alR of

B.abortus 2308, which retains

the antigenic characteristics of

the original field strain

BAB-acet

BAB-parental expressing the

wbdR (acetyltransferase) gene from

E. coli 0157: H7; present a

O chain formed by waste

of N-formylperosamine and N

acetylperosamine

BAB ~ wadB

Mutant in the core of the LPS;

S-LPS; attenuated in cells

dendritic and mice

BAB ~ wadB-acet

Mutant in the core of the LPS;

S-LPS; expresses the wbdR gene

(acetyltransferase) from E. coli

0157: H7

S19

Vaccine strain used in

cattle

S19 -pYRI-6

Strain S 19; expresses the wbdR gene

(acetyltransferase) from E. coli

0157: H7

Revl

Vaccine reference strain for

B. melitensis

Revl-pYRI-6

Strain Rev 1; expresses the wbdR gene

(acetyltransferase) from E. coli

0157: H7

(Sangari and Aguero, Microb. Pathog. 1991; 11: 443-446

Invention

Invention

Invention

(Nicoletti, P.L. 1990. Vaccination, p. 283-299. In K.H. Nielsen and J.R. Duncan (ed.), Animal Brucellosis, CRC Press, Boca Raton) Invention

(Elberg and Faunce, J. Bacteriol. 1957;

73: 211-217). Invention

Table 1 Strains and Plasmids (Continued)

Strain / Plasmid Relevant characteristics Reference / Origin

E. coli

E. coli 0157: H7

S 17-lApir

Top10F '

One shot OMNIMAXTM

Enterohemorrhagic E. coli

Conjugate strain with plasmid RP4 inserted in chromosome F '{lacIq, Tn10 (TetR)} mcrA

~ (mrr-hsdRMS-mcrBC)

<D80lacZ ~ M15 ~ lacX74 recA1 araD 139 ~ (ara leu) 7697 galU galK rpsL (StrR) endA1 nupG F '{proABlacIqlacZ ~ M15Tn10

(TetR) ~ (ccdAB) mcrA ~ (mrr hsdRMS-mcrBC) <D

80 (lacZ) ~ M15 ~ (lacZYA argF) U16gendA1recA1supE44t hi1gyrA96relA1 tonApa nD

Spanish Type Crops Collection (CECT 4783) (Simon et al., Nature Biotechnology 1983; 1: 784-791)

Invitrogen; Elbow C303003

Invitrogen; Elbow 12535029

Table 1 Strains and Plasmids (Continued)

Strain / Plasmid Relevant characteristics Reference / Origin

Plasmids

pDONR221

pRH001

pYRI-5

pYRI-6

Cloning vector; contains

Invitrogen; Elbow 12535029

the attP regions that enable

BP reaction (system

Gateway)

Derived from pMR1 OKmR; CmR;

(HaHez et al., Appl. Environ.

contains the attR regions that

Microbiol 2007; 73: l375

enable the LR reaction

1379)

(Gateway system)

Fragment of 727-bp

Invention

PCR amplified to

from the DNA of E. coli

0157: H7 containing the ORF

complete wbdR along with the

attB sites, cloned in the vector

pDONR221

Fragment attL1-attL2 of

Invention

plasmid pYRI-5 cloned in the

attR1-attR2 sites of pRH001

pYRI-1 Plasmid containing the invention deletion of the wadB allele

pYRI-2 Plasmid obtained by Invention subcloning of pYRI-1 in the suicide plasmid pJQK

The bacteria were grown in tripticase-soy broth (TSB, BioMérieux) or in TSB plates with 1.5% bacteriological agar (TSA, Pronadisa). If necessary, for example when injecting bacteria carrying plasmid pYRI-6, the culture media were supplemented with 50) .lg / mL kanamycin (Km) or 20) .lg / mL chloramphenicol (Cm) or 25) .lg / mL nalidixic acid (Nal) or 1.5) .lg / mL polymyxin

(Pmx). The strains were preserved in vials with skim milk at -80 ° C (Scharlau).

DNA analysis Plasmid or chromosomal DNA was extracted using the Qiaprep spin Miniprep kits (Qiagen GmbH, Hilden, Germany) and Ultraclean Microbial DNA Isolation Kit (Mo Bio Laboratories) respectively. If necessary, for example, when after visualizing an agarose gel PCR reaction, and once it has been verified that the product obtained is the expected size and that no other nonspecific PCR products have been generated in said reaction, it is necessary to recover from The agarose gel was the PCR product obtained (example: cloning of the PCR product in a plasmid), the DNA fragments were extracted from agarose gel using the Qiack Gel extraction kit (Qiagen). DNA sequencing was performed using the BigDye 3.1 kit and an Applied Biosystems sequencer model 3130XL Genetic Analyzer. All primers were synthesized by Sigma-Genosys Ud. (Haverhill, United Kingdom).

Construction of the BAB! 1wadB mutant.

The mutant in the ORF BAB1_0351 (wadB) was constructed by phase deletion, eliminating the region encoding the catalytic domain, using as a template the genomic DNA of B. abortus 2308 (Figure 4). The deletion was made maintaining the reading frame so that it did not have polar effects that altered the reading frame of adjacent genes. The primers used were designed from the sequence of B. abortus 2308 available in the NCBI database (lltíp: / hv \ yvv.ncbi.nlm.njh.goví as of 15.02.2011).

The mutant strain obtained was called BAB¿jwadB. For its construction, two primers called wadB-F1 (SEQ ID NO: 3) and wadB-R2 (SEQ ID NO: 4) were first synthesized and used to amplify a 296 bp fragment that included the codons included between base pairs 1 to 48 of the wadB gene, as well as the 152 bp located in front of the initiation codon of the wadB gene. In addition, two other primers called wadB-F3 (SEQ ID NO: 5) and wadB-R4 (SEQ ID NO: 6) were synthesized which were used to amplify a 274 bp fragment that included the codons between base pairs 196 239 of the coding region (CDS) of the wadB gene, and 139 bp after the stop codon of the wadB gene.

Both fragments obtained were ligated by superposition PCR using primers wadB-F1 (SEQ ID NO: 3) and wadB-R4 (SEQ ID NO: 6) for amplification and complementary regions of primers wadBR2 (SEQ ID NO: 4) and wadB-F3 (SEQ ID NO: 5) for overlay. The resulting fragment, which contains the deletion allele of the wadB gene, was cloned into the vector pCR2.1 (Invitrogen, Barcelona, Spain), giving rise to plasmid pYRI-1, which was subjected to a sequencing process to ensure maintenance of the reading frame and subsequently subcloned into the BamHI and XbaI positions of the suicide plasmid pJQK (Scupham and Triplett, Gene 1997; 202: 53-59). The resulting mutant plasmid (p YRI -2) was introduced by transformation into E. eoli S17.IA-pir (Simon et al .; Nature Bioteehonology 1983; 1: 784-791) and then transferred to the bacterial strain B. abortus 2308 by conjugation.

The exconjugants where the recombinant pnmera had occurred (integration of the suicide vector into the chromosome) were selected in tripticase-soy agar (TSA) plates with nalidixic acid (25¡.tg / mL) and kanamycin (50¡.tg / mL ). To favor the second recombination (excision of the suicide vector after allelic exchange), the bacteria were grown in the absence of kanamycin and were selected in TSA plates with 15% nalidixic acid and sucrose.

The resulting colonies were selected by PCR using the wadB-F1 (SEQ ID NO: 3) and wadB-R4 (SEQ ID NO: 6) primers, which amplify a 570 bp fragment in the mutant and a 1011 bp fragment in the parental strain. The generated mutation resulted in a 60% loss of the coding region of the wadB gene and an 88% loss of the glycosyltransferase domain. The mutant strain, as mentioned above, was named BAB! 1wadB.

The E. coli strain (0157: H7) containing the wbdR gene that codes for the acetyltransferase used in the present invention to modify Brucella strains is deposited in the Spanish Type Culture Collection, in the Paterna Science Park (Valencia , Spain), with the number CECT4783 (year 1996).

Construction of plasmid p YRI-6. The construction of YRI-6 p was performed using the "Gateway® Recombination Cloning Technology" system from Invitrogen. The wbdR attB Fw (SEQ ID NO: 1) and wbdR attB Rv (SEQ ID NO: 2) primers specific for wbdR (ORF z3192; SEQ ID NO: 7), which encodes the O-chain acetyltransferase in E. coli 0157: H7 (SEQ ID NO: 8), were designed according to the manufacturer's instructions and synthesized by Sigma-Genosys Ltd. (HaverhiH, United Kingdom). These primers were used to amplify the wbdR gene from the DNA of E. coli 0157: H7. Next, the PCR product was cloned into the vector pDONR221 by site-specific recombination to give rise to plasmid pYRI-5, and subsequently subcloned into pRH001 (Ha Hez et al., Appl Environ Microbiol 2007; 73: 1375-1379 ), to obtain plasmid pYRI-6, capable of replicating in Brucella.

Plasmid pYRI-6 was introduced in E. coli S17-1 Apir and transferred to B. abortus 2308, by conjugation, thus obtaining the modified bacteria BAB-acet. Plasmid-bearing conjugates were selected in the tripticase-soy culture medium with bacteriological agar (TSA) and supplemented with nalidixic acid (Nal) and chloramphenicol (Cm), as described in example 1 (TSA-Nal-Cm) , at 37 ° C. These markers and the results of Example 2 demonstrate the presence of the plasmid and its genes in the construct.

Similarly, a transfer of plasmid pYRI-6 to vaccine strains Rev1 and S19 and mutant BAB! 1wadB was performed, obtaining modified strains Rev1-pYRI-6, S 19-pYRI-6 and BAB! 1wadB-acet respectively .

Example 2. B. abortus 2308 gene carrier (wbdR) of an acetyltransferase expresses normal amounts of a smooth O-chain LPS containing N-acetylperosamine.

LPS extraction. The BAB-parental LPS was extracted using the phenol method: water described by Leong et al. (Leong D. et al., Infect Immun 1970; 1: 174-182) and adapted to Brucella by Aragón et al., J Bacteriol .,nineteen ninety six; 178: 1070-1079; Velasco et al., Infect Immun 2000; 68: 3210-3218). To obtain the BPS-acet LPS, the above-mentioned protocol was modified using 6 volumes of methanol and 1% methane 1 saturated with sodium acetate. For the extraction of LPS from E. coli 0157: H7, the method of SDS-proteinase K (Garin-Bastuji B. et al., Elin Microbiol 1990; 28: 2169-2174) was modified. The inactivated bacteria (0.5 g wet weight) were resuspended by ultrasound in a 2% SDS -62.5 mM Tris-HCl buffer (pH 6.8; 10 mL) and the mixture was incubated at 100 ° C for 10 min. with intermittent agitation. Once the mixture was brought to room temperature, proteinase K (150 µg / mL; Merck) was added and incubated for 3h at 55 ° C, and overnight at room temperature. The cell debris was removed by centrifugation (20,000 x g, 15 min, 4 ° C), and the supernatant was precipitated with 3 volumes of methanol and 1% methanol saturated with sodium acetate for 1 h at -20 ° e. The precipitate was resuspended in 10 mL of distilled water and precipitated again under the same conditions. The new precipitate was resuspended in 2-3 mL of 62.5 mM Tris-Hcl buffer (pH 6.8) by ultrasound, treated with DNase (Sigma-Aldrich) and RNAase (Mobio), both at a final concentration of 10 ¡.Tg / mL, at 37 ° C for 30 min and then with proteinase K at 55 ° C for 3h and one night at room temperature. Finally, the sample was precipitated using the conditions described above, settled (5,000 x g, 15 min, 4 ° C) and the solvent residues were evaporated with a stream of nitrogen.

NMR-H1 analysis. The spectra were performed at 25 and 70 ° C in a D20 solution using a Varian Innova 600 device and a photometer spectrum equipped with a 5 mm PFG-triple resonance probe. The chemical shift was recorded as ppm (data in parts per million) using as external control 3trimethylsilyl- (2,2,3,3-2H4) -propanoate sodium (TSP, DH 0.00). The data was processed using the computer program supplied by the commercial house. Previously, to obtain the BAB-acet O-chain from a purified LPS preparation, acid hydrolysis was performed in 10 mM acetate buffer at pH 4.5 in the presence of 1% SDS (Caroff et al., Carbohydr Res. 1988; 175: 273-282) for 2h at 100 ° C. The mixture was frightened and neutralized with a 0.2M NaOH solution, followed by centrifugation 5000 x g, 10 min, the recovered supernatant was precipitated with 5 volumes of ethanol at -20 ° C for 24

h. The mixture was then centrifuged at 5000 xg, 10 min, the precipitate was recovered and dialyzed for 3 cycles in acid methanol: distilled water (50:50 v / v) followed by 3 cycles in distilled water to remove the remains of SDS Finally, the sample (O chain) was recovered by centrifugation under the conditions mentioned above, resuspended in ultrapure water, filtered and its purity was evaluated by double gel diffusion.

Coagglutination It was performed following the technique described by (Díaz et al., Laboratory (Granada) 1980; 70: 509-525). The succinct saline baccrias were mixed with 10 µl of a suspension of staphylococci sensitized with serum from rabbits infected with smooth brucelas.

To verify if the heterologous expression of wbdR in Brucella was an alteration of the LPS synthesis process, it was extracted from BAB-acet and compared by SDS-PAGE and silver staining with that of BAB-parental. The yields obtained in each of the stages of the extraction and purification of the LPS from both BAB-acet and the parental strain were very similar, suggesting that there are no quantitative differences in the LPS synthesized by both. On the other hand, we did not observe differences in the coagglutination tests of BAB-parental and BABacet with serum-sensitized staphylococci from animals infected with smooth brucelas. This shows that the expression of wbdR in Brucella is compatible with the synthesis of a complete, smooth-type LPS, which is located on the bacterial surface.

Next, the LPS of BAB-acet and the parental strain were subjected to acid hydrolysis and the resulting polysaccharide was purified by chromatography and analyzed by 1 H-NMR. While the polysaccharide spectrum of the parental strain showed the signals described for the homopolymers of N-formylperosamine in bonds at (1,2) (Perry and Bundle, Advances in brucelosis research. Texas A & M. University Press, College station 1990 : 76-88), smaller signals from the oligosaccharide nucleus (González et al., PlosOne 2008; 3: e2760) (Figure 1), that of the BAB-acet polysaccharide showed all of these and an additional strong signal at 2 ppm. corresponds to a new acetyl group (Figure 1). The integration of the formyl signal at 8.2 ppm indicated that the perosamine of the parental strain is approximately 90% N-formylated. In contrast, the signals of acetyl at 2.0 ppm and of the formyl at 8.2 ppm of the spectrum of the BAB-acet polysaccharide showed a formulation of approximately 40%, with the N-acetyl group constituting the remaining approximately 60%.

These results demonstrate that the expression of wbdR in Brucella is compatible with the synthesis of a complete LPS, which is located on the bacterial surface without apparent quantitative changes and has a heteropolymeric O-chain of N-formyl and N-acetylperosamine.

Example 3. The presence of wbdR-dependent N-acetylperosamine in the O chain eliminates the typical A-epitope of the LPS-S of B. abortus.

Monoclonal antibodies. Monoclonal monoclonal antibodies against epitopes A, M and C used have been described in previous studies (Momeal et al., / Nfec. / Mmun 2003; 71: 3261-3271 González et al., PlosOne 2008 3: e2760).

EL / SA. It was performed in flat-bottom 96-well polystyrene plates (Thermo Scientific). The antigen used (LPS of BAB-parental, BAB-acet or E. coli 0157: H7) was adsorbed to the plate at a concentration of 2.5 µg / ml or 5 µg / ml in PBS. Incubation was performed at 4 ° C overnight. After several washes with PBS-Tween 20 (PBS-T), successive dilutions of the antibodies were added and incubated 5 hours at 37 ° C. The plates were then washed three times with PBST and, for the detection of the antigen-antibody complexes, a labeled anti-mouse Ig (conjugate Nordic Immunological Laboratories, Tilburg, Holland) conjugate was used

with peroxidase The development was carried out with 0.2 mM ABTS and 0.13 mM / H202 in citrate buffer solution for 15 to 30 min at room temperature, in the dark and with stirring. The absorbance was measured at 405 nm.

To determine whether the presence of the acetyl group alters the epitopes A and C characteristic of B. abortus, we analyzed by ELISA the reactivity of specific monoclonal anti-A [5 N-formylperosamines linked to (1-2)], anti-C [ (3 or 4 N-formylperosamines bonded together (to 1-2)] yanti-M [(to 1-2) -Nformylperosamine- (to 1-3) -N-formylperosamine- (to 1-2)]. It can be seen in Figure 2, the presence of the acetyl group reduces the reaction of the anti-A monoclonal, but not that of the anti-C monoclonal (the reactivity with the anti-M monoclonal introduced as a negative control was negative). that epitope A requires five or more consecutive N-formylperosamines bound together (at 1-2), while epitope C is associated with four or less consecutive N-formylperosamines bound together (at 1-2) (which could include a link (to 1-3) to a greater or lesser extent, depending on the degree of overlap. Therefore, the acetylation generated eliminates the number of five N-formylperosamines in bond (to 1-2), but respects four or less. Therefore, these results not only demonstrate the disappearance of the epitope A typical of B. abortus, but also indicate that N-acetylperosamine has not been concentrated in a section of chain 0, but has been distributed homogeneously, otherwise, the epitope A. would remain.

Example 4. The presence of wbdR-dependent N-acetylperosamine in the O-chain of the B. abortus LPS generates new epitopes.

Preparation of rabbit immunoserums and absorptions. The animals were housed in suitable cages, with water and food ad libitum. Two 2.5 kg New-Zealand White female rabbits were used. Immunization was performed by intravenously injecting 1 ml of a suspension of phenol-inactivated BAB-acet bacteria, lyophilized and resuspended in saline at a concentration of 1 mg / mL. . At 2 and 4 days, two doses similar to the previous ones were administered intraperitoneally. Three weeks after the last immunization, the serum was extracted and the animals were slaughtered. The maintenance and slaughter of the animals was carried out following the Spanish (RD 1201/2005) and European regulations (directive 86/609 / EEC) in force under the supervision of the Ethical Committee of the Animal Maintenance Service of the Institution. To absorb the antibodies against B. abortus 2308 (BAB-parental), the rabbit immunoserum was contacted with a suspension of these phenol-inactivated bacteria at a rate of 1 mg bacteria / 10 mg of serum. The mixture was incubated at room temperature for 4 h with timely stirring, centrifuged at 13200 rpm for 10 min (Eppendorf 5415R centrifuge) and the supernatant recovered. The same procedure was repeated with this supernatant once more, and the resulting final supernatant was considered free of antibodies against B. abortus 2308. For the absorption of antibodies against BAB-aeet the same procedure was followed, but using bacteria of BAB-aeet inactivated with phenol.

Coagglutination It was performed following the technique described by (Díaz et al., Laboratory (Granada) 1980; 70: 509-525). Bacteria resuspended in saline were mixed with 10 µL of a suspension of staphylococci sensitized with rabbit serum immunized with BAB-aeet and absorbed with whole BABparental cells.

EL / SA. It was performed in flat-bottom 96-well polystyrene plates (Thermo Scientific). The antigen used (LPS of BAB-parental, BAB-aeet or E. eoli 0157: H7) was adsorbed to the plate at a concentration of 2.5 µg / ml or 5 µg / ml in PBS. Incubation was performed at 4 ° C overnight. After several washes with PBS-Tween 20 (PBS-T), successive dilutions of the sera were added and incubated 5 hours at 37 ° C. The plates were then washed three times with PBST and, for the detection of antigen-antibody complexes, a goat anti-rabbit conjugate (Nordic Immunological Laboratories, Tilburg, Holland) labeled with peroxidase was used. The development was performed with 0.2 mM ABTS and 0.13 mM / H20 2 in citrate buffer solution for 15 to 30 min at room temperature, in the dark and with stirring. The absorbance was measured at 405 nm.

To analyze whether the incorporation of acetyl groups into the Brucella O chain generated a new or new epitopes, rabbits were immunized with whole BAB-aeet cells inactivated with phenol. As can be seen in Figure 3, panels A and B, the serum showed a lower reactivity in an ELISA with the LPS of BAB-parental than with the homologous LPS carrying N-formylated and N-acetylated perosamine, which suggests existence of a new epitope or epitopes (s) related to the second type of substituents. To prove it, the serum was absorbed with BAB-parental and we repeated the test. This absorption eliminated reactivity with the BABparental LPS, but not with the BAB-aeet LPS.

To ratify the existence of specific antibodies of the structure containing N-acetylperosamine, a new ELISA was performed comparing the reactivity of a rabbit serum immunized with E. eolf 0157: H7, and of sera from rabbits immunized with absorbed BAB-aeet and without absorbing, against the LPS of E. eolf 0157: H7, whose O chain has acetylated perosamine.

The results (Figure 3, panel C) showed that serum against BAB-aeet absorbed with BAB-parental reacts with LPS of E. eolf 0157: H7 and that this reactivity disappears after absorbing with BAB-aeet cells, which confirms that BAB-aeet has an immunogenic epitope associated with N-acetylperosamine. Furthermore, this result demonstrates that it is possible to develop a serological test to identify vaccinated animals by detecting antibodies against the N-acetylperosamine-associated epitopes present in the labeled vaccines (see Example 5).

Example 5. Epitopes generated by N-acetylperosamine do not stimulate antibodies that react in diagnostic tests of brucellosis.

Coagglutination and ELISA were carried out as in example 4 above.

According to the presentation of the LPS-S, there are two types of diagnostic tests for brucellosis: those that use purified LPS-S and those that use smooth phase bruce suspensions. The first prototype is the ELISA with LPS-S of B. abortus; that of the second the Bengal Rose test. The reaction involves antibodies of the IgG, IgM and IgA classes.

The results of Example 4 with an ELISA with BPS-parental LPS-S (Figure 3, panel A) and the specific immunoserum (absorbed immunoserum) of the epitopes associated with N-acetylperosamine demonstrate that these epitopes do not generate detectable antibodies in the tests of the first type. To verify that they do not do it in the second type, we perform the Bengal Rose test by mixing 30 μl of the immunoabsorbed serum or without absorbing with 15 μl of the commercial antigen (Veterinary Laboratories Agency, New Haw Addlestone, UK) and this mixture was incubated with orbital shaking for 8 minutes. After this time, the test was read. The result with the serum containing only the antibodies against the epitope (s) generated by the N-acetylperosamine was negative. Therefore, these results, together with those of Example 3, demonstrate that N-acetylperosamine generates a specific immune marker absent from normal Brucella strains.

Example 6. Labeling with N-acetylperosamine of the O chain of the classical vaccines of B. melitensis and B. abortus, as well as other strains.

Coagglutination and ELISA were carried out as in example 4 above.

Considering that B. melitensis Rev 1 and B. abortus S19 are the best vaccines to immunize sheep and goats against brucellosis, the ° chain of these strains was modified. For this, the plasmid pYRI-6 carrying wbdR in strain Rev 1 and in S 19 was introduced by conjugation. The resulting Rev 1-acet construct was examined by co-agglutination with the immunoserbe against BAB-acet absorbed with B. abortus 2308 While Rev loS19 did not co-agglutinate, Rev 1-acet and S 19-acet did, which demonstrates the presence on its surface of the epitope derived from Nacetylperosamine. The same results were obtained when we introduced plasmid pYRI-6 into the BAB! 1wadB mutant (which retains the 0 chain, and is a potential candidate as a vaccine against B. abortus 2308 infection). In it, the introduction of the plasmid generated epitope derived from the N-acetylperosamine necessary to coagglutinate with the immunoserver against BAB-acet absorbed with B. abortus 2308. These results demonstrate that the acetylation of wbdR-mediated perosamine serves to antigenically mark the Vaccines against Brucella.

Table ". Bacterms whose Cadf'im üestá t'ousútuid.fl retal Q pareialmcllte by fE'SlclllOsde but: =; amirl: whose snhsÜül: tion N-acll 2" ;;; di.:=;t1nta to the fi group) rmi1o).

C, U-iKferl <; tiGl: "de lo:., RC: iildno!> D.e. peroo;.; Amilm

E: nla: ee: yes

Or: ulforAzúcal'es BacteJ: Í13: mac1ón Grupo N-aó.l {lJfOpc: ruón] adú: loHz3:! E / Refen: .ncia

r ~; brio c.iJ-O} err.7i ~: 07'6

v ÓwleJ "ae () 1 Og; o.wa

v cholerae 1875

r ~. ch "smell" ae H3k ~ t-t?

v dwlerae () 144 EschwChi'H coli 0157

E. heJTnaf? Nfl.J

SaTmcmeüa Gn: mp N

L

S (+) 2-ÍlldroXlpropionil

D

3-deoxi-L-glú :: ew

t.etmnil

D

3-h: í.d: mx:, pfo} JlQml

D

aceril

L

R (-} 2 · file: üpmpimúl

D

acetyl

D

acetyl

D

acetyl

~: i. (one)

G. (1,2)

or: (1)

~: i. (1,1)

1: 1 (1,2)

or: (1)}

G. (l.3Y

<Á. (1,2) .. or; (l))

[3: 202: 3]

G (]; ',

aÓ: 3) 4

(Komlo et al., I'v1icwbmL

1996: 142: 2879-2885)

(lsshibet aL Eur. 1. B: item item 1995; 219.:583-588)

(KomID et al., Biochem.L

199.1; 292: 531-535)

(k, hib N aL, M: i <:: rohi,) Lumffiuwt1991; 36: 110112 (5)

n. ·, - ',

(Sano etl'lL "11icrübioUml11lJllo1. 1996: 40: 735-741) (Perry & Bundle AdvélllCeS in B11.lceHo5Ís Res.eazch. C. Jilege St1lticm. TeXilS.A & M C'niversiíy Prc ~ s1990: p: 76-g8)

n. ·, - ',

(Peny t '?: Bundle, Adva.nces; in Brncdloú <i Re ;;; earch. College Stat: icll. Texas.ft ...... ~ MUnlyers;: ity Pre'ili199D: p: 76-88 ) (peny & Bundle. Advallces 1n Bmcel.1os;! s Rese1l: fch. College StatioH. Tex, and.;. A & MUl1lVenity Prc% 199D; p: 76-88)

Table 2 (CoutíuUllrítm): Bacteria whose chain O is total eOIEhttHda n parcmlmente by r <: 'sidnos de pero - :; nmma euya 5uhst1t.Nuctón Nacíl e :; disturbs the fbnmlú group).

.... ....... '~

S-; t @ Y? Ot ~ ·· Cfph {t. ~ Nona¡ ;. D: "<t ~ clli f1 {12} l1 (l, J) + (Perry & Bundle, Adv>.> .. m: e ~ in Bmcellmi. ~ Research. InailaJ2: fJ.i! (/: [11 ] Col1ege Station. Tesas.A&M Univcf) '; ity PressI990: p: 76 - &&)

Citrobacter gl! Fe ~ 'úi D acetü (; l. (U), (Li.pin5ki. Et <11., EUL J. B: iochem. 1001: 269: 93-99) 09a.9b Citrobacter}; · C1? In.gae D acetH (J- (l.2). :) (OVchUillikova et aL Carbohydr. Res. 2004; 339: 88109 (1,3),! 3 (13) 884) Cr <! F} oImcre¡ 'd.ese-ünocidll <lcetil d: esCOl "lo-cidü Posi.ble (AV,' l" "llm & Smlt, Micnibiology2001 .: 147: 1451-1460)

CT'f.'Sce} rrus ·, ;;

[•. '... T> •. 'T)' I., NnCC 'AT' ('C "p

+. pr <:: s elKta; -, rm "encm ..;. gives in t: ': l ~ llce)'; perosllmma <! pé" I "OSa1llina; I-loved '! lte t:': ll him. gunos. StlOUP0f> ~ ce> ~ a "e K.:. but not enclave" .... :: (eny & Bu.ndk 1990b: Sano et al., 1996)]. "Noenenbcé" s pe1'mami.nll11 pé "fOsrunina. 'S610 exists "evid.em: gC" 1l.etlc2., 110 haye;, tl1d: íü ;, e ~ tnKtJJ <"ales.

Claims (34)

l. A gram-negative bacterium of the genus Brucella comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, characterized in that at least one of the residues N -formylperosamine of said O antigen has been modified by replacing the 4-amino formyl group of perosamine with: a) an acyl group, other than the formyl group, or by b) a sugar, selected from the group comprising hexoses and pentoses.

2.

A gram-negative bacterium according to claim 1, wherein the acyl group is selected from the group comprising: an acetyl group, a 3-deoxy-Lglycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group and a R (-) 2-hydroxypropionyl group; preferably the acyl group is an acetyl group.

3.

A gram-negative bacterium according to claim 2, wherein at least 20%, preferably at least 40% and more preferably at least 60% of the N-formylperosamine residues of the O antigen have been replaced by distinct N-acylperosamine residues of N-formylperosamine; preferably they have been replaced by N-acetylperosamines.

Four.

A gram-negative bacterium according to claims 1-3, further comprising a heterologous gene encoding: a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; or

b) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the antigen perosamines or. 5. A gram-negative bacterium according to claim 4, wherein the Naciltransferase is capable of transferring an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3 hydroxypropionyl, an S (+) 2-hydroxypropionyl group, and an R (-) 2 group hydroxypropionyl; preferably N-acyltransferase is an N-acetyltransferase.

6.

A gram-negative bacterium according to claim 5, wherein the Nacethyltransferase is an N-acetyltransferase from Escherichia coli 0157: H7,

7.

A gram-negative bacterium according to claims I to 6, wherein said bacterium is a Brucella melitensis Rev-I, Brucella abortus S 19, or the mutant of Brucella BABf'1wadB.

8.

A product comprising, a molecule that, in turn, comprises the LPS O antigen, or an NH, or a biosynthetic precursor thereof, or a fragment of any of the foregoing, characterized in that:

Escherichia

hermanii, Vibrio cholerae Hakata, Salmonella group N,

Stenotrophomonas

maltophila, Citrobacter Gillenii, Citrobacter youngae, or

Caulobacter crescentus.

a) comes from a gram-negative bacterium with an O antigen comprising a homopolymer of N-formylperosamine; and where at least one of the Nformylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by: i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group ; more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising a heteropolymer formed by residues selected from: i) N-formylperosamine and N-acylperosamine where this N-acylperosamine is different from N-formylperosamine, or ii) N-formylperosamine and N-glycosylperosamine; preferably the heteropolymer is formed by residues selected from: N -formylperosamine and N-acetylperosamine, N-formylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues. 9. A product consisting of a molecule comprising the LPS O antigen, or an NH, or a biosynthetic precursor thereof, or a fragment of any of the foregoing, characterized in that: a) comes from a gram-negative bacterium with an O antigen comprising a homopolymer of N-formylperosamine; and where in at least one of the N-formylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by: i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group ; more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising a heteropolymer consisting of residues selected from: i) N-formylperosamine and N-acylperosamine, where this Nacilperosamine is different from N-formylperosamine, or ii) N-formylperosamine and N-glycosylperosamine; preferably the heteropolymer is formed by residues selected from: N -formylperosamine and N-acetylperosamine, N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues.

10.

A product according to any of claims 8 or 9, wherein the molecule comprising the O antigen comes from a gram-negative bacterium of the Brucella genus according to claims I to 7.

eleven.

A product according to claims 8 to 10, wherein the molecule comprising the O antigen comes from a genetically modified bacterium, to which a heterologous gene encoding:

a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; preferably an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group ; more preferably N-acyltransferase is an N-acetyltransferase; or b) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the antigen perosamines or.

12.

A product according to claims 8 to 11, wherein at least 20%, preferably at least 40% and more preferably, at least 60% of the O antigen residues, are an N-acylperosamine other than N-formylperosamine; preferably N-acylperosamine is an N-acetylperosamine.

13.

A process for obtaining a product according to claims 8 to 12 comprising:

a) cultivate, under appropriate conditions, a genetically modified gram-negative bacterium by introducing a heterologous gene that encodes i) an N-acyltransferase capable of transferring an acyl group, other than forrnyl group, at the 4-amino position of the perosamines of the O antigen; or ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; where the gram-negative bacterium is preferably a Brucella according to the claims 1 to 7; and b) isolate and / or purify said product. 14. A method for obtaining antibodies, comprising: a) immunizing an animal with: i) a gram-negative bacterium according to claims 1 to 7, or ii) a product according to claims 8 to 12; Y b) isolate and / or purify said antibodies. 15. A specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that a) at least one of the N-forrnylperosamine residues of said O antigen has been modified by replacing at least one formyl group, in the 4-amino position of perosamine, by: i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group , more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) said O antigen comprises a heteropolymer formed by residues selected from: i) N-formylperosamine and N-acylperosamine, where this Nacilperosamine is different from N-forrnylperosamine, or ii) N-formylperosamine and N-glycosylperosamine; Preferably the heteropolymer is formed by residues selected from: N -formylperosamine and N-acetylperosamine, N -formylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, N -formylperosamine and S (+) 2 or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues.

16.

Antibody according to claim 15, wherein the O antigen comes from a gram-negative bacterium of the genus Brucella according to claims 1 to 7.

17. An antibody obtainable by a method according to claim 14.

18.

A gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, for use in medicine.

19.

Use of a gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, in the manufacture of a medicament or a vaccine.

twenty.

A gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, for use, according to claim 19, in the prevention of brucellosis.

2l. Use, according to claim 19, of a gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, in the manufacture of a medicament or a vaccine for the prevention of brucellosis. 22. A medicament for the treatment of brucellosis, or a vaccine for the prevention of the occurrence of said disease comprising a gram bacteria negative according to claims 1 to 7, or a product according to claims 8 to 12.

2. 3.

A gram-negative bacterium according to claims 1 to 7, a product according to claims 8 to 12 or an antibody according to claims 15 to l7, for use in the diagnosis of brucellosis; preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella.

24.

Use of a gram-negative bacterium according to claims 1 to 7, a product according to claims 8 to 12 or an antibody according to claims 15 to 17, in the manufacture of a composition, reagent or kit, for the diagnosis of brucellosis; preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella.

25.

Use of a marker to differentiate Brucella infected animals from vaccinated animals against Brucella, where said marker is selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a gram-negative bacterium of the Brucella genus according to claims 1 to 7; b) a specific antibody against the O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus according to the claims 1 to 7; c) a DNA or RNA molecule that encodes: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-arnino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; or ii) an N-glycosyltransferase capable of transferring a selected sugar from the group comprising hexoses and pentoses, to the 4-amino position of the O antigen perosamines; d) a specific antibody against: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-arnino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group; or in front of ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y e) a combination of the above. 26. An in vitro diagnostic method to differentiate Brucella-infected animals from vaccinated animals against Brucella, which comprises detecting the presence in a sample of the animal of a marker selected from: a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment thereof, from a gram-negative bacterium of the Brucella genus according to claims 1 to 7; b) a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment thereof, from a gram-negative bacterium of the Brucella genus according to the claims 1 to 7; c) a DNA or RNA molecule that encodes i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2 group hydroxypropionyl, a R (-) 2-hydroxypropionyl group, and more preferably the group acyl is an acetyl group; or ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-arnino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; or in front of ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y e) a combination of several of the above markers; where the presence of at least one of said markers is indicative that said animal has been vaccinated against brucellosis.

27.

Method according to claim 26, characterized in that it is an immunoassay, preferably selected from an ELISA, a plaque agglutination test and a tube agglutination test.

28.

Method according to claims 26 or 27 comprising the following steps:

a) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus, other than a gram-negative bacterium of the Brucella genus according to claims 1 to 7; Y b) detect the presence in the sample of specific antibodies against a O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a gram-negative bacterium of the Brucella genus according to claims 1 to 7.

29.

Method according to claim 28, further comprising an intermediate step between a) and b) in which the sample is contacted with a specific ligand to absorb the antibodies detected in a).

30

A diagnostic kit, to differentiate Brucella infected animals from vaccinated animals against Brucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the O antigen of an LPS or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, wherein said O antigen comes from a gram-negative bacterium of the Brucella genus according to claims 1 to 7; b) an antibody according to claims 15 to 17; c) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the O antigen, an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y e) a polynucleotide for amplifying a gene encoding an N-acyltransferase according to c) or an N-glycosyltransferase according to d); preferably a polynucleotide to amplify the wbdR gene of E. coli 0157: H7; more preferably the polynucleotide sequence is SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. ll, and SEQ.ID.NO. 12. 3l. Kit according to claim 30, wherein the probe or ligand a) for the specific antibodies is selected from the group consisting of: a) a gram-negative bacterium of the Brucella genus according to claims 1 to 7; and b) a product according to claims 8 to 12. 32. A kit according to any of claims 30 to 31 further comprising at least one reagent selected from: a) a molecule comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus, other than a gram-negative bacterium of the genus Brucella according to claims 1 to 7; Y b) a gram-negative bacterium of the genus Brucella, other than a gram-negative bacterium of the genus Brucella according to claims 1 to 7.

33.

A polynucleotide comprising a sequence selected from: SEQ.ID.NO. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, or SEQ.ID.NO. 12.

3. 4.

A polynucleotide consisting of a sequence selected from: SEQ.ID.NO. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, and SEQ.ID.NO. 12.

35

A polynucleotide according to any of claims 33 or 34 for use in the diagnosis of brucellosis.

36.

Use of a polynucleotide according to any of claims 33 or 34 for the manufacture of a composition, a reagent or a kit for the diagnosis of brucellosis.