EP4519443A1 - Production de protéines d'intérêt dans une souche bactérienne non-sporulante - Google Patents

Production de protéines d'intérêt dans une souche bactérienne non-sporulante

Info

Publication number
EP4519443A1
EP4519443A1 EP23723456.2A EP23723456A EP4519443A1 EP 4519443 A1 EP4519443 A1 EP 4519443A1 EP 23723456 A EP23723456 A EP 23723456A EP 4519443 A1 EP4519443 A1 EP 4519443A1
Authority
EP
European Patent Office
Prior art keywords
sequence
bacterial strain
gene
interest
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23723456.2A
Other languages
German (de)
English (en)
Inventor
Leyla SLAMTI
Didier Lereclus
Michel Gohar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech
Universite Paris Saclay
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Original Assignee
Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech
Universite Paris Saclay
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech, Universite Paris Saclay, Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement filed Critical Institut des Sciences et Industries du Vivant et de lEnvironnement AgroParisTech
Publication of EP4519443A1 publication Critical patent/EP4519443A1/fr
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/075—Bacillus thuringiensis

Definitions

  • TITLE Production of proteins of interest in a non-sporulating bacterial strain
  • the present invention relates to a new system for producing proteins of interest composed of a non-sporulating bacterial strain of the Bacillus genus transformed with a plasmid containing an expression cassette of a protein of interest controlled by a strong promoter active in stationary phase.
  • the proteins of interest thus produced are contained in a bacterial sac made up of the bacterial membrane or anchored to the surface of the bacteria.
  • Rosano et al. in “Recombinant protein expression in Escherichia coli: advances and challenges”, Front. Microbiol., April 17, 2014, https://doi.org/10.3389/fmicb.2014.00172, indicate that only a few strains of E. coli are capable of producing toxic proteins, but the level of production of these proteins is low.
  • a solution could be provided by secreting the protein outside the bacterial cell or into the periplasm, using different promoters.
  • a bacterial system for producing proteins of interest that is simple to implement and with a high yield is therefore necessary, in particular for the production of proteins of interest that can be toxic.
  • Bacillus thuringiensis is a spore-forming Gram-positive bacterium that produces large quantities of insecticidal proteins (Cry and Cyt proteins).
  • Bacillus thuringiensis genes Bt are no longer expressed as spoOA, sigE or sigF, or when their product is no longer functional following a mutation, the bacteria is unable to enter sporulation and remains stuck in stationary phase.
  • a consequence of inactivation of sporulation genes is the cessation of bacterial multiplication, the bacteria are therefore non-viable.
  • the inventors have shown that a non-sporulating Bt strain leads to the formation of bacterial bags. Surprisingly, they also showed that, in such non-sporulating strains, the production of proteins of interest can be obtained by placing the gene of interest under the control of a promoter specifically activated during the stationary phase. Thus, the protein of interest is produced during the stationary phase and remains encapsulated in the bacterial sacs. The inventors have also shown that these proteins are produced in large quantities and that their location in the bacterial bags protects them from degradation and greatly facilitates their recovery and purification. According to a particular embodiment, it is also possible to express the proteins of interest so that they anchor on the surface of bacterial cells.
  • This new system therefore makes it possible to produce proteins of interest, in particular proteins that are unstable or toxic for the producing bacterial cell, the latter being non-sporulating and non-viable.
  • the present invention relates to a non-sporulating bacterial strain of the Bacillus genus which contains a recombinant plasmid comprising an expression cassette composed of:
  • the bacterial strain is chosen from the strains of Bacillus thuringiensis, Bacillus cereus, Bacillus weihenstephanensis, and more preferably it is a strain of Bacillus thuringiensis.
  • Bacillus subtilis, Bacillus megaterium, Bacillus brevis strains can also be used provided they are previously transformed to express the papR and plcR genes activating the PpapR and PplcR promoters respectively and/or to express the npnR and nprX genes activating the PnprA promoter .
  • any gene essential for sporulation such as the genes involved in the expression of the transcriptional regulator SpoOA responsible for the initiation of sporulation or in the expression of the sporulation sigma factors SigE, SigF, SigH and SigK; preferably, the inactivated gene is spoOA or sigE. Inactivation of these genes can be achieved by interruption or modification of the coding sequence, or by deletion of all or part of the gene.
  • the deletion is obtained by double crossing-over between adjacent regions located upstream and downstream of the gene, using plasmids whose replication is temperature sensitive, for example pRN5101 plasmids (Lereclus et al., Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology (NY) 10: 418-421,1992) or pMAD (Arnaud et al., New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70: 6887-6891,2004), and using the protocols described in these articles.
  • pRN5101 plasmids Lereclus et al., Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology (NY) 10: 418-421,1992) or pMAD (Arnaud et
  • the deletion of the spoOA gene (designated AspoOA) has a very early effect, as soon as the bacteria enter the stationary phase, preventing the bacteria from engaging in the sporulation process (Lereclus et al., Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Biotechnology (NY) 13: 67-71, 1995).
  • the deletion of the sigE gene (designated AsigE) has a later effect, blocking the progression of the sporulation process (Bravo et al., Analysis of crylAa expression in sigE and sigK mutants of Bacillus thuringiensis. Mol Gen Genet 250: 734-741, 1996). In both cases, the bacteria no longer multiplies, dies and contains almost only the protein of interest.
  • the strain used is Bt kurstaki HD-73 AspoOA or Bt 407 AsigE.
  • the recombinant plasmids which can be used according to the invention conventionally comprise an origin of replication and at least one selection system consisting of one or more genes allowing the selection of transformed bacteria, for example antibiotic resistance genes.
  • Any plasmid, preferably with a high copy number, adapted to the bacterial host used can be used.
  • the appropriate plasmids according to the invention are plasmids allowing expression in bacteria of the Bacillus genus.
  • the plasmids used are those exhibiting strong segregational and/or structural stability.
  • segregational stability means that the plasmid is not lost over generations; in other words, it is maintained stably in the bacterial cell and is transmitted to daughter cells.
  • the segregational stability of the pHT1030 plasmid has been demonstrated (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7:35-46). This stability is due to the presence of the spbA gene which is also present in the plasmids derived from pHT1030, such as pHT3101, pHT304, pHT315 and pHT370 (Arantes et al., 1991.
  • Structural stability is defined as non-intramolecular recombination of the plasmid.
  • the structural stability of the pHT1030 plasmid and its derivatives is demonstrated by the fact that they can carry large fragments of exogenous DNA (> 10 kb) without undergoing molecular rearrangements (Lereclus et al., 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60: 211-217).
  • the expression cassette inserted into said plasmid contains at least one strong promoter and the sequence of a gene encoding a protein of interest.
  • a strong promoter is a promoter allowing strong transcription of the gene(s) it controls.
  • A420 absorbance at 420 nm
  • V volume of the crude extract in pL
  • the strong promoter is regulated by a regulator chosen from PlcR and NprR.
  • the strong promoters are preferentially chosen from PpapR (SEQ. ID. No. 1), PpIcB (SEQ. ID. No. 2), PnprA (SEQ. ID. No. 3) and PnprR (SEQ. ID. No. 4) .
  • the strong promoter is regulated by a regulator chosen from CodY, AbrB and SinR and even more preferably the strong promoter is chosen from PoppA (SEQ. ID. No. 5), PnppC (SEQ . ID. No. 6), PinhAl (SEQ. ID. No. 7) and Pco / Y (SEQ. ID. No. 8).
  • the regulator is CodY and the strong promoter is PoppA or PnppC.
  • the expression cassette according to the invention may further comprise:
  • an mRNA stabilizing sequence positioned downstream of the promoter and upstream of the sequence of the gene encoding the heterologous protein; preferably, it is STAB-SD of sequence SEQ ID No. 9; preferably, the STAB-SD sequence is downstream of the transcription +1 and at a position between approximately 100 and 500 nucleotides upstream of the ribosomal binding site (called RBS for Ribosome Binding Site), preferably between 100 and 300 nucleotides and more preferably between 100 and 150 nucleotides; and or
  • TcrylAc a terminator sequence of the crylAc gene, designated TcrylAc, for example a sequence presenting at least 90% identity with SEQ ID No. 10, preferably, it is SEQ ID No. 10; this sequence is cloned downstream of the gene encoding the protein of interest.
  • protein of interest is meant an endogenous protein or a protein which is not naturally expressed by the bacterial strain according to the invention, also called heterologous protein.
  • the protein of interest is a cytotoxic protein naturally expressed by a strain of the Bacillus genus or a protein of industrial interest such as enzymes, such as proteases, lipases, amylases; hormones; antigens, for example, usable as immunogens, peptides or proteins for therapeutic use; the protein of interest can thus find application in the field of crop protection, vector control, commercial production of enzymes and the pharmaceutical industry, in particular for the production of vaccines.
  • the expression cassette according to the invention leads to the expression then to the accumulation of proteins of interest in bacterial bags or to their anchoring on the surface of the bacteria. Its use is particularly suitable for the production of proteins that are unstable or toxic for the producing strain.
  • the construction of the expression cassette according to the invention and its incorporation into a plasmid are carried out by molecular biology techniques well known to those skilled in the art as illustrated in the experimental part.
  • the plasmid according to the invention can be introduced into the host bacteria according to techniques known to those skilled in the art; in particular, the transformation of the host bacteria can be carried out by electroporation (Lereclus et al., 1989) or by heterogramic conjugation (Tieu-Cuot et al., 1987).
  • the expression cassette containing the gene of interest can also be introduced onto the bacterial chromosome or onto a resident plasmid by homologous recombination (Lereclus et al., 1992).
  • the present invention also relates to a process for producing a protein of interest comprising the steps of: a- preparation of the bacterial strain according to the invention; b- culture of said bacterial strain in stationary phase; and c- optionally, purification of said protein of interest.
  • Purification of the protein of interest can be carried out by centrifugation; in addition, the methods of exclusion chromatography, ion exchange chromatography or even affinity chromatography can be implemented.
  • a gene coding for an export protein domain such as a signal peptide
  • anchor such as LysM (SEQ. ID No. 11), SLH (SEQ ID No. 12) or LPXTG (Navarre et al., Microbiol Mol Biol Rev 63(1):174-229.DOI: 10.1128, 1999)
  • proteins on the surface of the bacteria is cloned in cis of the gene encoding the protein of interest.
  • the expression cassette according to the invention can comprise:
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;
  • the strain used is a bacterium of the genus Bacillus l spoOA, preferably Bt AspoOA, more preferably Bt HD73 AspoOA, and the expression cassette comprises:
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • a strong promoter active in stationary phase chosen from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;
  • the strain used is a bacterium of the Bacillus AsigE genus, preferably Bt AsigE, more preferably Bt 407 AsigE and the expression cassette comprises:
  • the protein of interest produced is an insecticidal protein from B. thuringiensis.
  • proteins can be used as a biopesticide in preparations conventionally containing the free insecticidal protein in crystal form and bacterial spores, to combat crop pests as well as disease vectors such as mosquitoes.
  • these may be proteins of the Cry family (crystal proteins) or proteins of the Cyt family (cytolytic insecticidal toxins) or Vip3 proteins (toxins active against lepidopteran insects) and more preferably proteins of the Cry family.
  • the non-sporulation of the bacteria gives the invention the advantage of not disseminating the spores in the environment.
  • the protein of interest produced may be an enzyme of industrial (proteases, lipases, amylases, etc.) or medical interest.
  • the encapsulation of this protein in the bacterial sac facilitates its recovery and purification, and therefore reduces production costs.
  • the protein of interest produced can be a whole protein or a protein fragment which can serve as an antigen, for example proteins from microorganisms (viruses, bacteria, fungi) or parasites.
  • the protein or its fragment may be anchored to the surface of the bacterial sac.
  • This embodiment is of marked interest for the preparation of vaccines.
  • the present invention provides a bacterial platform which can be advantageously exploited for the production of proteins of interest to multiple fields such as crop protection, vector control, commercial production of enzymes and the pharmaceutical industry.
  • this technology has a low cost and excellent yield allowing mass production.
  • FIG 1 A, strain HD73 wt; B, strain HD73 AspoOA.
  • FIG 3 Measurement of R-galactosidase activity in HD73 wt bacteria carrying the Pp/cB-STAB-SD-/ocZ transcriptional fusion (black curve) or the PpIcB-lacZ transcriptional fusion (gray curve).
  • FIG 4 Measurement of R-galactosidase activity in HD73 AspoOA bacteria carrying the PpopR-STAB-SD-/ocZ transcriptional fusion (gray curve) or the PoppA-STAB-SD-lacZ transcriptional fusion (black curve).
  • FIG 5 Measurement of R-galactosidase activity in 407 ksigE bacteria carrying the transcriptional fusion Pco/Z-STAB-SD-ZocZ-TermCrylAc (black curve) or the transcriptional fusion Pco/Z-STAB-SD-ZocZ ( gray curve).
  • FIG 6 Measurement of fluorescence at different culture times, in HD73 wt (gray) and HD73 AspoOA (black) bacteria carrying the PpopR-STAB-SD-g/p-TermCrylAc transcriptional fusion.
  • FIG 7 Production of toxins of interest under the control of the PoppA and PpapR promoters associated with the stabilizing elements STAB-SD and TermCrylAc.
  • M molecular weight marker.
  • the asporulating strains correspond to the Bt HD73 wt strain in which the spoOA gene has been deleted (Bt HD73 AspoOA) or to the Bt 407 wt strain in which the sigE gene has been deleted (Bt 407 AsigE).
  • Bt HD73 AspoOA Bt HD73 AspoOA
  • Bt 407 AsigE Bt 407 AsigE
  • the spoOA and sigE genes were deleted by double crossing over using the pMAD plasmid and the protocol described by Arnaud et al. (Arnaud et al., 2004).
  • the culture corresponding to the Bt HD73 wt strain consists almost exclusively of spores ( Figure 1A). On the other hand, no spores are visible in the case of the Bt HD73 AspoOA mutant ( Figure 1B).
  • the Bt HD73 spoOA mutant shows the formation of bacterial sacs (light gray in Figure 1B).
  • the Bt 407 AsigE strain does not form any spores and is composed of bacterial sacs ( Figure 2).
  • the Bt HD73 wt and spoOA strains were cultured in HCT YEG liquid medium at 30°C for 72 h before being examined under a microscope.
  • This medium is composed of HCT medium (0.7% casein hydrolyzate, 0.5% tryptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% citrate ferric ammonium, 0.018% CaCl2 4H2O at pH 7.2) supplemented with 0.3% glucose and 0.05% yeast extract.
  • the Bt 407 AsigE strain was cultured in HCT YEG liquid medium at room temperature for 96 h before being examined under a microscope.
  • the inventors added the RNA stabilizing sequence STAB-SD between the PpicB promoter and the lacZ reporter gene on the plasmid pHT304-18Z-PplcB to generate the plasmid pHT304-18-PplcB-STAB-SD-lacZ.
  • the STAB-SD RNA stabilizing sequence was first cloned between the XbaI and BamHI restriction sites of the pHT304-18 vector. Then, the PpicB promoter was cloned upstream between the Pstl and XbaI restriction sites.
  • the Bt HD73 wt strain was transformed with the plasmids pHT304-18Z-PplcB and pHT304-18—PplcB-STAB-SD-lacZ then cultured in LB medium at 30°C.
  • the LB (Luria Bertani) culture medium is a complex medium classically used for culturing bacterial strains. It is composed of tryptone, 10 g/L; yeast extract, 5 g/L; NaCI, 10 g/L. The components are solubilized in 800 mL of deionized water, the pH is then adjusted to 7.0 and the volume is made up to 1 L. The medium is sterilized by autoclaving at 121 9 C for 15 minutes. tO corresponds to the start of the transition phase between the exponential phase and the stationary phase of growth.
  • the DNA fragments corresponding to the promoter sequences of genes expressed in stationary phase PoppA or PpapR followed by the STAB-SD sequence were synthesized and cloned into the vector pHT315.
  • the lacZ reporter gene was cloned downstream of these sequences.
  • the vectors were introduced into Bt HD73 spoOA cells. tO corresponds to the start of the transition phase between the exponential phase and the stationary phase of growth.
  • the bacterial strains were cultured in HCT YEG medium at 30°C.
  • crylAc The sequence corresponding to the terminator of the crylAc gene was cloned downstream of the transcriptional fusion between the promoter of a gene expressed in stationary phase (PcalY) and the lacZ reporter gene on the plasmid pHT304.18Z to generate the plasmid pPcalY-STAB- SD-/ocZ-
  • TermCrylAc This vector was introduced into Bt 407 AsigE cells. tO corresponds to the start of the transition phase between the exponential phase and the stationary phase of growth.
  • the bacterial strains were cultured in LB medium at 30°C.
  • the Bt HD73 wt and Bt HD73 AspoOA strains were transformed with the plasmid pHT315 carrying the transcriptional fusion PpapR-STAB-SD-g/p-TermCrylAc in order to measure the activity of this transcriptional fusion in the AspoOA genetic context and to compare it to the activity of the wt strain ( Figure 6).
  • the plasmid was constructed as follows. The DNA fragment corresponding to the PpapR promoter sequence followed by the STAB-SD and TermCrylAC sequences was synthesized and cloned into the pHT315 vector. The gfp reporter gene was cloned downstream of this sequence. tO corresponds to the start of the transition phase between the exponential phase and the stationary phase of growth.
  • the bacterial strains were cultured in HCT YEG medium at 30°C.
  • PpapR, STAB-SD sequence and TermCrylAc sequence is functional in the HD73 spoOA strain.
  • the measurement of the fluorescence produced by the HD73 AspoOA and HD73 wt strains shows that the expression of the gfp gene is stronger in the AspoOA genetic context than in the wild context.
  • This medium is composed of 0.7% casein hydrolyzate, 0.5% peptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% ferric ammonium citrate, 0.018% CaCl2 4H2O, at pH 7.2 supplemented with 0.3% Glucidex and 0.05% yeast extract.
  • SEQ ID No. 8 PcalY Promoter region of the calY gene from Bacillus thuringiensis.
  • the +1 of transcription is indicated in bold.
  • the promoters' -10 boxes are underlined with a thin line.
  • the -35 boxes are underlined with 2 lines.
  • the DNA sequence recognized by PlcR (PlcR box) of the PpapR and PpIcB promoters is underlined with a thick line.
  • SEQ ID No. 12 Sequence containing 3 SLH domains as described by Fedhila et al., 2006, Mol. Microbiol. 62:339-355. doi: 10.1111/j.1365-2958.2006.05362.x.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention se rapporte à un nouveau système de production de protéines d'intérêt composée d'une souche bactérienne non-sporulante du genre Bacillus transformée avec un plasmide contenant une cassette d'expression d'une protéine d'intérêt contrôlée par un promoteur fort actif en phase en stationnaire. Les protéines d'intérêt ainsi produites sont présentes dans un sac bactérien ou ancrées à la surface de la bactérie.

Description

DESCRIPTION
TITRE : Production de protéines d'intérêt dans une souche bactérienne non-sporulante
La présente invention se rapporte à un nouveau système de production de protéines d'intérêt composée d'une souche bactérienne non-sporulante du genre Bacillus transformée avec un plasmide contenant une cassette d'expression d'une protéine d'intérêt contrôlée par un promoteur fort actif en phase en stationnaire. Les protéines d'intérêt ainsi produites sont contenues dans un sac bactérien constitué de la membrane bactérienne ou ancrées à la surface de la bactérie.
L'utilisation de bactéries recombinantes pour produire des protéines d'intérêt, telles que l'insuline et l'hormone de croissance, est connue de longue date et a été largement mise en oeuvre, mais elle a aussi montré ses limites. En effet, les bactéries sont incapables de produire des protéines ayant une structure complexe comme les anticorps ou les facteurs de coagulation sanguine. Pour être stables et actives in vivo et donc efficaces chez l'homme, ces protéines doivent subir de multiples modifications post-traductionnelles.
Il arrive également que des protéines hétérologues d'intérêt soient toxiques pour la cellule bactérienne les produisant. Vincent Ecochard et al., dans « Techniques et stratégies en biologie moléculaire », master professionnel, octobre 2011, http://www.m2p-egpr.ups- tlse.fr/Documents%20archives/Cours/Cours%20partie%202.pdf, détaillent les solutions qui peuvent être apportées pour produire de telles protéines dans un système bactérien. Néanmoins, il n'est pas simple d'identifier la meilleure solution par rapport à la protéine à produire. Les Auteurs concluent en effet que la dernière solution et le meilleur recours est d'utiliser un système de traduction in vitro.
Rosano et al., dans « Recombinant protein expression in Escherichia coli: advances and challenges », Front. Microbiol., 17 April 2014, https://doi.org/10.3389/fmicb.2014.00172, indiquent que seules quelques souches d'E. coli sont capables de produire des protéines toxiques, mais le niveau de production de ces protéines est faible. Une solution pourrait être apportée en sécrétant la protéine à l'extérieur de la cellule bactérienne ou dans le périplasme, en utilisant différents promoteurs.
Un système bactérien de production de protéines d'intérêt simple à mettre en oeuvre et avec un rendement important est donc nécessaire, en particulier pour la production de protéines d'intérêt pouvant être toxiques.
Bacillus thuringiensis (Bt) est une bactérie Gram-positive sporulante qui produit d'importantes quantités de protéines insecticides (protéines Cry et Cyt). Lorsque certains gènes de sporulation de Bt ne sont plus exprimés comme spoOA, sigE ou sigF, ou lorsque leur produit n'est plus fonctionnel à la suite d'une mutation, la bactérie est incapable d'entrer en sporulation et reste bloquée en phase stationnaire. Une conséquence de l'inactivation des gènes de sporulation est l'arrêt de la multiplication bactérienne, les bactéries sont donc non viables.
Les Inventeurs ont montré qu'une souche de Bt non-sporulante conduit à la formation de sacs bactériens. De façon surprenante, ils ont aussi montré que, dans de telles souches non sporulantes, la production de protéines d'intérêt peut être obtenue en plaçant le gène d'intérêt sous contrôle d'un promoteur spécifiquement activé pendant la phase stationnaire. Ainsi, la protéine d'intérêt est produite pendant la phase stationnaire et reste encapsulée dans les sacs bactériens. Les Inventeurs ont également montré que ces protéines sont produites en grande quantité et que leur localisation dans les sacs bactériens les protège de la dégradation et facilite grandement leur récupération et leur purification. Selon un mode de réalisation particulier, il est également possible d'exprimer les protéines d'intérêt de façon à ce qu'elles s'ancrent à la surface des cellules bactériennes.
Ce nouveau système permet dès lors de produire des protéines d'intérêt, en particulier des protéines instables ou toxiques pour la cellule bactérienne productrice, celle-ci étant non sporulante et non viable.
Ainsi, la présente invention se rapporte à une souche bactérienne du genre Bacillus non-sporulante qui contient un plasmide recombinant comprenant une cassette d'expression composée :
(i) d'un promoteur fort actif en phase en stationnaire et régulé par un régulateur choisi parmi CodY, AbrB, SinR, PlcR et NprR ; et
(ii) de la séquence d'un gène codant une protéine d'intérêt.
Préférentiellement, la souche bactérienne est choisie parmi les souches de Bacillus thuringiensis, Bacillus cereus, Bacillus weihenstephanensis, et plus préférentiellement il s'agit d'une souche de Bacillus thuringiensis. Les souches Bacillus subtilis, Bacillus megaterium, Bacillus brevis, peuvent aussi être utilisées sous réserve d'être préalablement transformées pour exprimer les gènes papR et plcR activant respectivement les promoteurs PpapR et PplcR et/ou pour exprimer les gènes npnR et nprX activant le promoteur PnprA.
De façon préférée, les souches bactériennes utilisées sont les souches Bt kurstaki HD-73 ou Bt 407. Selon l'invention, la souche bactérienne est une souche non sporulante. En effet, les souches non sporulantes sont avantageuses en ce qu'elles ne présentent pas de lyse cellulaire, ainsi, les protéines d'intérêt produites sont conservées dans la bactérie productrice et protégées de la dégradation par les protéases extracellulaires. Afin de supprimer l'activité de sporulation d'une souche du genre Bacillus, il est possible d'inactiver tout gène essentiel à la sporulation comme les gènes impliqués dans l'expression du régulateur transcriptionnel SpoOA responsable de l'initiation de la sporulation ou dans l'expression des facteurs sigma de sporulation SigE, SigF, SigH et SigK ; de préférence, le gène inactivé est spoOA ou sigE. L'inactivation de ces gènes peut être obtenue par interruption ou modification de la séquence codante, ou par délétion de tout ou partie du gène. La délétion est obtenue par double crossing- over entre les régions adjacentes situées en amont et aval du gène, en utilisant des plasmides dont la réplication est thermosensible, par exemple les plasmides pRN5101 (Lereclus et al., Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology (NY) 10: 418-421,1992) ou pMAD (Arnaud et al., New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70: 6887- 6891,2004), et en utilisant les protocoles décrits dans ces articles. La délétion du gène spoOA (désignée AspoOA) a un effet très précoce, dès l'entrée des bactéries en phase stationnaire, empêchant notamment les bactéries de s'engager dans le processus de sporulation (Lereclus et al., Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Biotechnology (N Y) 13: 67-71, 1995). La délétion du gène sigE (désignée AsigE) a un effet plus tardif, bloquant la progression du processus de sporulation (Bravo et al., Analysis of crylAa expression in sigE and sigK mutants of Bacillus thuringiensis. Mol Gen Genet 250: 734-741, 1996). Dans les deux cas, la bactérie ne se multiplie plus, meurt et contient presque uniquement la protéine d'intérêt.
De façon préférée, la souche utilisée est Bt kurstaki HD-73 AspoOA ou Bt 407 AsigE.
Les plasmides recombinants utilisables selon l'invention comprennent classiquement une origine de réplication et au moins un système de sélection consistant en un ou plusieurs gènes permettant la sélection des bactéries transformées, par exemple des gènes de résistance aux antibiotiques. Tout plasmide, de préférence à haut nombre de copies, adapté à l'hôte bactérien utilisé peut être mis en oeuvre.
Les plasmides appropriés selon l'invention sont des plasmides permettant une expression dans les bactéries du genre Bacillus.
De préférence, les plasmides utilisés sont ceux présentant une forte stabilité ségrégationnelle et/ou structurale.
La notion de stabilité ségrégationnelle signifie que le plasmide n'est pas perdu au cours des générations ; en d'autres termes, il se maintient de façon stable dans la cellule bactérienne et est transmis aux cellules filles. La stabilité ségrégationnelle du plasmide pHT1030 a été démontrée (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46). Cette stabilité est due à la présence du gène spbA qui est aussi présent dans les plasmides dérivés du pHT1030, tels que pHT3101, pHT304, pHT315 et pHT370 (Arantes et al., 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108: 115-119). La stabilité ségrégationnelle du plasmide pBC16 et de ses dérivés a aussi été déterminée (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46).
La stabilité structurale se définit comme une non recombinaison intramoléculaire du plasmide. La stabilité structurale du plasmide pHT1030 et de ses dérivés est démontrée par le fait qu'ils peuvent porter des fragments d'ADN exogène de grande taille (> 10 kb) sans subir de remaniements moléculaires (Lereclus étal., 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60: 211-217).
De préférence, il s'agit de plasmides à haut nombre de copies notamment dérivés du plasmide pHT1030, tels que pH3101, pHT304, pHT315 et pHT370, de préférence pH315, ou dérivés du plasmide pBC16, du pE194 ou du pC194 ou de plasmides à bas nombre de copies comme le pHT73, plasmide résident de la souche Bt kurstaki HD-73 ou le pBMB299, plasmide résident de la souche Bt kurstaki HD1.
Selon l'invention, la cassette d'expression insérée dans ledit plasmide contient au moins un promoteur fort et la séquence d'un gène codant une protéine d'intérêt.
Un promoteur fort est un promoteur permettant une transcription forte du ou des gène(s) qu'il contrôle. Le promoteur fort peut provenir de la cellule hôte utilisée pour l'expression de la protéine d'intérêt ; il peut aussi s'agir d'un promoteur exogène. Les promoteurs forts sont préférentiellement des promoteurs activés en début de phase stationnaire et qui restent fonctionnels pendant une grande partie de cet état physiologique. De façon courante, l'expression des promoteurs est évaluée avec l'activité de la R-galactosidase (AS, en unités/mg de protéine) selon le calcul décrit dans Perchât et al. ("A cell-cell communication system regulates protease production during sporulation in bacteria of the Bacillus cereus group", Molecular Biology, Vol. 82, 3, p. 619-633, 2011) : AS = (A42o x 1500000) / (T x V x C).
A420 : absorbance à 420 nm
T : temps de réaction en min
V : volume de l'extrait brut en pL
C : concentration en protéines en pg/mL
En utilisant cette formule, un promoteur est considéré comme fortement exprimé lorsque l'AS est supérieure à 500 U/mg prot. Selon un premier mode de réalisation de l'invention, le promoteur fort est régulé par un régulateur choisi parmi PlcR et NprR. Les promoteurs forts sont préférentiellement choisis parmi PpapR (SEQ. ID. N°l), PpIcB (SEQ. ID. N°2), PnprA (SEQ. ID. N°3) et PnprR (SEQ. ID. N°4).
Selon un second mode de réalisation de l'invention, le promoteur fort est régulé par un régulateur choisi parmi CodY, AbrB et SinR et encore plus préférentiellement le promoteur fort est choisi parmi PoppA (SEQ. ID. N°5), PnppC (SEQ. ID. N°6), PinhAl (SEQ. ID. N°7) et Pco/Y (SEQ. ID. N°8).
De façon préférée, le régulateur est CodY et le promoteur fort est PoppA ou PnppC.
La cassette d'expression selon l'invention peut en outre comprendre :
- une séquence stabilisatrice de l'ARNm positionnée en aval du promoteur et en amont de la séquence du gène codant la protéine hétérologue ; de préférence, il s'agit de STAB-SD de séquence SEQ ID N°9 ; de préférence, la séquence STAB-SD est en aval du +1 de transcription et à une position comprise entre environ 100 et 500 nucléotides en amont du site de liaison ribosomique (dit RBS pour Ribosome Binding Site), préférentiellement entre 100 et 300 nucléotides et plus préférentiellement entre 100 et 150 nucléotides ; et/ou
- une séquence terminatrice du gène crylAc, désignée, TcrylAc, par exemple de séquence présentant au moins 90% d'identité avec la SEQ ID N°10, de préférence, il s'agit de la SEQ ID N°10 ; cette séquence est clonée en aval du gène codant la protéine d'intérêt.
Le choix de ces séquences ne doit toutefois pas être considéré comme limitant du fait qu'il est à la portée de l'homme du métier de substituer ces séquences par des séquences aux fonctions équivalentes.
On entend par protéine d'intérêt, une protéine endogène ou une protéine qui n'est pas naturellement exprimée par la souche bactérienne selon l'invention, aussi désignée protéine hétérologue. De préférence, la protéine d'intérêt est une protéine cytotoxique naturellement exprimée par une souche du genre Bacillus ou une protéine d'intérêt industriel comme des enzymes, telles que protéases, lipases, amylases ; des hormones ; des antigènes, par exemple, utilisables comme immunogènes, des peptides ou des protéines à usage thérapeutique ; la protéine d'intérêt peut ainsi trouver application dans le domaine de la protection des cultures, la lutte antivectorielle, la production commerciale d'enzymes et l'industrie pharmaceutique, en particulier pour la production de vaccins.
La cassette d'expression selon l'invention conduit à l'expression puis à l'accumulation de protéines d'intérêt dans des sacs bactériens ou à leur ancrage à la surface de la bactérie. Son utilisation est particulièrement appropriée à la production de protéines instables ou toxiques pour la souche productrice. La construction de la cassette d'expression selon l'invention et son incorporation dans un plasmide sont réalisées par les techniques de biologie moléculaire bien connues de l'homme du métier tel qu'illustré dans la partie expérimentale.
Le plasmide selon l'invention peut être introduit dans la bactérie hôte selon les techniques connues de l'homme du métier ; en particulier, la transformation de la bactérie hôte peut être réalisée par électroporation (Lereclus et al., 1989) ou par conjugaison hétérogramique (Tieu-Cuot et al., 1987). La cassette d'expression contenant le gène d'intérêt peut aussi être introduite sur le chromosome bactérien ou sur un plasmide résident par recombinaison homologue (Lereclus et al., 1992).
La présente invention se rapporte aussi à un procédé de production d'une protéine d'intérêt comprenant les étapes de : a- préparation de la souche bactérienne selon l'invention ; b- culture de ladite souche bactérienne en phase stationnaire ; et c- optionnellement, purification de ladite protéine d'intérêt.
La culture de la souche bactérienne est réalisée sur un milieu de culture contenant au moins une source d'azote et de glucose en des concentrations appropriées à une température comprise de préférence entre 25 et 35°C, de manière préférentielle la température est de l'ordre de 30°C ; par exemple, le milieu de culture est le milieu LB.
La purification de la protéine d'intérêt peut être réalisée par centrifugation ; en complément, les méthodes de chromatographie d'exclusion, de chromatographie en échange d'ions ou encore de chromatographie d'affinité peuvent être mises en oeuvre.
Selon un mode de réalisation particulier, un gène codant pour un domaine protéique d'export (tel qu'un peptide signal) ou d'ancrage (tel que LysM (SEQ. ID N°ll), SLH (SEQ ID N°12) ou LPXTG (Navarre et al., Microbiol Mol Biol Rev 63(1):174-229.DOI: 10.1128, 1999)) des protéines à la surface des bactéries est cloné en cis du gène codant la protéine d'intérêt.
Ainsi, la cassette d'expression selon l'invention peut comprendre :
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl et PcalY et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et optionnellement une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et/ou la séquence terminatrice du gène crylAc, TcrylAc ; ou (i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl et PcalY et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et une séquence stabilisatrice de l'ARNm, de préférence STAB-SD ; ou
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl et PcalY et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et la séquence terminatrice du gène crylAc, TcrylAc ; ou encore
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl et PcalY et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et la séquence terminatrice du gène crylAc, TcrylAc.
Selon des modes de réalisation particuliers, la souche utilisée est une bactérie du genre Bacillus l spoOA, de préférence Bt AspoOA, encore préférentiellement Bt HD73 AspoOA, et la cassette d'expression comprend :
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PoppA, PnprR, PnppC et PnprA et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et optionnellement une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et/ou la séquence terminatrice du gène crylAc, TcrylAc ; ou
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PoppA, PnprR, PnppC et PnprA et préférentiellement choisi parmi PoppA et PnppC ; (ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et une séquence stabilisatrice de l'ARNm, de préférence STAB-SD ; ou
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PoppA, PnprR, PnppC et PnprA et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et la séquence terminatrice du gène crylAc, TcrylAc ; ou encore
(i) un promoteur fort actif en phase en stationnaire choisi parmi PpapR, PpIcB, PoppA, PnprR, PnppC et PnprA et préférentiellement choisi parmi PoppA et PnppC ;
(ii) optionnellement la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et la séquence terminatrice du gène crylAc, TcrylAc.
Selon d'autres modes de réalisation particuliers, la souche utilisée est une bactérie du genre Bacillus AsigE, de préférence Bt AsigE, encore préférentiellement Bt 407 AsigE et la cassette d'expression comprend :
(i) un promoteur fort actif en phase en stationnaire choisi parmi PcalY et PinhAl ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et optionnellement une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et/ou la séquence terminatrice du gène crylAc, TcrylAc ; ou
(i) un promoteur fort actif en phase en stationnaire choisi parmi PcalY et PinhAl ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt, de préférence STAB-SD ; et une séquence stabilisatrice de l'ARNm ; ou
(i) un promoteur fort actif en phase en stationnaire choisi parmi PcalY et PinhAl ;
(ii) optionnellement, la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et la séquence terminatrice du gène crylAc, TcrylAc ; ou encore
(i) un promoteur fort actif en phase en stationnaire choisi parmi PcalY et PinhAl ;
(ii) optionnellement la séquence d'un gène codant pour une protéine d'export ou d'ancrage ;
(iii) la séquence d'un gène codant une protéine d'intérêt ; et une séquence stabilisatrice de l'ARNm, de préférence STAB-SD, et la séquence terminatrice du gène crylAc, TcrylAc.
Selon un mode de réalisation particulier, la protéine d'intérêt produite est une protéine insecticide de B. thuringiensis.
Il est connu que de telles protéines peuvent être utilisées en tant que biopesticide dans des préparations contenant classiquement la protéine insecticide libre sous forme de cristal et des spores bactériennes, pour lutter contre les ravageurs de cultures ainsi que contre les vecteurs de maladie tels que les moustiques. En particulier, il pourra s'agir des protéines de la famille Cry (protéines du cristal) ou des protéines de la famille Cyt (toxines insecticides cytolytiques) ou des protéines Vip3 (toxines actives contre les insectes lépidoptères) et plus préférentiellement les protéines de la famille Cry.
Après leur expression, elles sont protégées de la dégradation par la membrane bactérienne qui constitue l'enveloppe du sac bactérien. De plus, la non-sporulation de la bactérie confère à l'invention l'avantage de ne pas disséminer les spores dans l'environnement.
Selon un autre mode de réalisation, la protéine d'intérêt produite peut être un enzyme d'intérêt industriel (protéases, lipases, amylases...) ou médical. L'encapsulation de cette protéine dans le sac bactérien facilite sa récupération et sa purification, et réduit donc les coûts de production.
Selon un troisième mode de réalisation, la protéine d'intérêt produite peut être une protéine entière ou un fragment de protéine pouvant servir d'antigène, par exemple des protéines de microorganismes (virus, bactéries, champignon) ou de parasites.
Dans ce mode de réalisation, il peut être avantageux que la protéine ou son fragment soit ancré à la surface du sac bactérien. Ce mode de réalisation présente un intérêt marqué pour la préparation de vaccins. Ainsi la présente invention propose une plateforme bactérienne qui peut être avantageusement exploitée pour la production de protéines intéressant de multiples domaines tels que la protection des cultures, la lutte antivectorielle, la production commerciale d'enzymes et l'industrie pharmaceutique. En outre, cette technologie a un faible coût et un excellent rendement permettant une production en masse.
FIGURES
[Fig 1] A, souche HD73 wt ; B, souche HD73 AspoOA.
[Fig 2] souche 407 AsigE
[Fig 3] Mesure de l'activité R-galactosidase dans les bactéries HD73 wt portant la fusion transcriptionnelle Pp/cB-STAB-SD-/ocZ (courbe noire) ou la fusion trancriptionelle PpIcB-lacZ (courbe grise).
[Fig 4] Mesure de l'activité R-galactosidase dans des bactéries HD73 AspoOA portant la fusion transcriptionnelle PpopR-STAB-SD-/ocZ (courbe grise) ou la fusion trancriptionelle PoppA-STAB-SD- lacZ (courbe noire).
[Fig 5] Mesure de l'activité R-galactosidase dans des bactéries 407 ksigE portant la fusion transcriptionnelle Pco/Z-STAB-SD-ZocZ-TermCrylAc (courbe noire) ou la fusion trancriptionnelle Pco/Z-STAB-SD-ZocZ (courbe grise).
[Fig 6] Mesure de la fluorescence à différents temps de culture, dans des bactéries HD73 wt (gris) et HD73 AspoOA (noir) portant la fusion transcriptionnelle PpopR-STAB-SD-g/p-TermCrylAc.
[Fig 7] Production de toxines d'intérêt sous le contrôle des promoteurs PoppA et PpapR associés aux éléments stabilisateurs STAB-SD et TermCrylAc. Observation microscopique d'une souche HD73 AspoOA transformée avec un plasmide portant les fusions transcriptionnelles PoppA-STAB- SD-toxl-TermCrylAc et PpopR-STAB-SD-tox2-TermCrylAc (A) ou d'une souche HD73 AspoOA ne contenant pas le plasmide décrit ci-dessus (B). Electrophorèse en gel de polyacrylamide-SDS de la souche produisant les toxines d'intérêt (C). M, marqueur de poids moléculaire.
EXEMPLES
1. Effet de la création d'un phénotype non sporulant sur la formation de sacs bactériens
Les souches asporulantes correspondent à la souche Bt HD73 wt dans laquelle le gène spoOA a été délété (Bt HD73 AspoOA) ou à la souche Bt 407 wt dans laquelle le gène sigE a été délété (Bt 407 AsigE). Pour ces deux souches, les gènes spoOA et sigE ont été délétés par double crossing over en utilisant le plasmide pMAD et le protocole décrit par Arnaud et coll. (Arnaud et al., 2004).
La culture correspondant à la souche Bt HD73 wt est constituée presque exclusivement de spores (Figure IA). En revanche, aucune spore n'est visible dans le cas du mutant Bt HD73 AspoOA (Figure IB). Le mutant Bt HD73 spoOA montre la formation de sacs bactériens (gris clair sur la Figure IB). De même, contrairement à la souche Bt 407 wt, la souche Bt 407 AsigE ne forme aucune spore et est composée de sacs bactériens (Figure 2). Les souches Bt HD73 wt et spoOA ont été cultivées en milieu liquide HCT YEG à 30°C pendant 72h avant d'être examinées au microscope. Ce milieu est composé du milieu HCT (0,7% hydrolysat de caséine, 0,5% tryptone, 0.68% KH2PO4, 0,012% MgSO4 7H2O, 0,00022% MnSO4 4H2O, 0,0014% ZnSO4 7H2O, 0,008% citrate d'ammonium ferrique, 0,018% CaCl2 4H2O à pH 7,2) supplémenté de 0,3% de glucose et de 0,05% d'extrait de levure.
La souche Bt 407 AsigE a été cultivée en milieu liquide HCT YEG à température ambiante pendant 96h avant d'être examinées au microscope.
2. Effet de la séquence stabilisatrice STAB-SD sur l'activité promotrice d'un gène de phase stationnaire
Les Inventeurs ont ajouté la séquence stabilisatrice d'ARN STAB-SD entre le promoteur PpicB et le gène rapporteur lacZ sur le plasmide pHT304-18Z-PplcB pour générer le plasmide pHT304-18- PplcB-STAB-SD-lacZ. La séquence stabilisatrice d'ARN STAB-SD a tout d'abord été clonée entre les sites de restriction Xbal et BamHI du vecteur pHT304-18. Puis, le promoteur PpicB a été cloné en amont entre les sites de restriction Pstl et Xbal.
La souche Bt HD73 wt a été transformée avec les plasmides pHT304-18Z-PplcB et pHT304-18— PplcB-STAB-SD-lacZ puis cultivée en milieu LB à 30°C.
Le milieu de culture LB (Luria Bertani) est un milieu complexe classiquement utilisé pour la mise en culture des souches bactériennes, il est composé de tryptone, 10 g/L ; extrait de levure, 5 g/L ; NaCI, 10 g/L. Les composants sont solubilisés dans 800 mL d'eau déminéralisée, le pH est ensuite ajusté à 7,0 et le volume est complété à 1 L. Le milieu est stérilisé par autoclavage à 1219C pendant 15 minutes. tO correspond au début de la phase de transition entre la phase exponentielle et la phase stationnaire de croissance.
Ainsi, l'activité de PpicB, promoteur actif en phase stationnaire, a été comparée en présence et en absence de STAB-SD.
Les résultats de la figure 3 montrent que le promoteur PpicB est actif dans les deux constructions vectorielles : en présence et en absence de STAB-SD. La présence de STAB-SD augmente l'expression de la p-galactosidase.
3. Activité de promoteurs de phase stationnaire dans le mutant AspoOA
Les fragments d'ADN correspondant aux séquence des promoteurs de gènes exprimés en phase stationnaire PoppA ou PpapR suivies de la séquence STAB-SD ont été synthétisés et clonés dans le vecteur pHT315. Le gène rapporteur lacZ a été cloné en aval de ces séquences. Les vecteurs ont été introduits dans des cellules Bt HD73 spoOA. tO correspond au début de la phase de transition entre la phase exponentielle et la phase stationnaire de croissance.
Les souches bactériennes ont été cultivées en milieu HCT YEG à 30°C.
L'activité R-galactosidase de ces souches a été mesurée au cours de leur croissance et montre une forte activité de ces promoteurs aux temps indiqués sur la figure 4, et une activité plus importante pour le promoteur PoppA à partir de tO.
4. Effet de la sé stabilisatrice sur I' d'un gène de stationnaire
La séquence correspondant au terminateur du gène crylAc a été clonée en aval de la fusion transcriptionnelle entre le promoteur d'un gène exprimé en phase stationnaire (PcalY) et le gène rapporteur lacZ sur le plasmide pHT304.18Z pour générer le plasmide pPcalY-STAB-SD-/ocZ-
TermCrylAc. Ce vecteur a été introduit dans des cellules Bt 407 AsigE. tO correspond au début de la phase de transition entre la phase exponentielle et la phase stationnaire de croissance.
Les souches bactériennes ont été cultivées en milieu LB à 30°C.
L'activité R-galactosidase de cette souche a été mesurée et comparée à celle d'une souche portant le même vecteur à l'exception de la séquence TermCrylAc. Les résultats montrent que les deux plasmides permettent l'expression de la R-galactosidase, la fusion portant la séquence TermCrylAc conduit à une expression plus forte que celle ne la portant pas (Figure 5).
5. Effet de l'association des éléments géné sur I'
Les souches Bt HD73 wt et Bt HD73 AspoOA ont été transformées avec le plasmide pHT315 portant la fusion transcriptionnelle PpapR-STAB-SD-g/p-TermCrylAc afin de mesurer l'activité de cette fusion transcriptionnelle dans le contexte génétique AspoOA et de la comparer à l'activité de la souche wt (Figure 6).
Le plasmide a été construit de la façon suivante. Le fragment d'ADN correspondant à la séquence du promoteur PpapR suivie des séquences STAB-SD et TermCrylAC a été synthétisé et cloné dans le vecteur pHT315. Le gène rapporteur gfp a été cloné en aval de cette séquence. tO correspond au début de la phase de transition entre la phase exponentielle et la phase stationnaire de croissance.
Les souches bactériennes ont été cultivées en milieu HCT YEG à 30°C.
Les résultats montrent que l'association des différents éléments génétiques (plasmide, promoteur
PpapR, séquence STAB-SD et séquence TermCrylAc) est fonctionnelle dans la souche HD73 spoOA.
De plus, la mesure de la fluorescence produite par les souches HD73 AspoOA et HD73 wt montre que l'expression du gène gfp est plus forte dans le contexte génétique AspoOA que dans le contexte sauvage.
6. Effet de l'association des éléments génétiques sur la production de protéines insecticides
Une souche HD73 spoOA a été transformée avec un plasmide portant les fusions transcriptionnelles PoppA-STAB-SD-crylAh-TermCrylAc et PpopR-STAB-SD-crylCo-TermCrylAc. La production des toxines d'intérêt CrylAb et CrylCa correspondant aux gènes crylAb et crylCa, respectivement, a été vérifiée au microscope à contraste de phase et par électrophorèse en gel de polyacrylamide-SDS (Figure 7). Les bactéries ont été cultivées en milieu PEP YEGx à 30°C et récoltées 48h post-inoculation. Ce milieu est composé de 0,7% hydrolysat de caséine, 0,5% peptone, 0.68% KH2PO4, 0,012% MgSO4 7H2O, 0,00022% MnSO4 4H2O, 0,0014% ZnSO4 7H2O, 0,008% citrate d'ammonium ferrique, 0,018% CaCl2 4H2O, à pH 7,2 supplémenté de 0,3% glucidex et 0,05% d'extrait de levure.
Les résultats montrent la production des toxines sous forme de cristal dans les sacs bactériens HD73
AspoOA portant PoppA-STAB-SD-crylAh-TermCrylAc et PpopR-STAB-SD-crylCo-TermCrylAc (Figure 7 A) tandis qu'une souche HD73 spoOA ne contenant pas le plasmide décrit ci-dessus présente des sacs bactériens sans cristaux (Figure 7 B). De plus, l'électrophorèse en gel de polyacrylamide-SDS montre que les toxines d'intérêt représentent la majorité des protéines des sacs bactériens (Figure 7 C).
SEQUENCES
SEQ ID n°l - PpapR Région promotrice du gène papR de Bacillus thuringiensis
CTAGAACCATGAATTAAAAGAATCACTTATAAAAAAAATGAAGAAATAAAAAAGACATAAAGAACAAATA
TGCATAATTGCATAAAGTCTGGATAATTTTTCATGATATATTTAAAGAAAAAATGCGG
SEQ ID n°2 - PpIcB Région promotrice du gène pIcB de Bacillus thuringiensis
AGCATGTGTATGCTTTACTCTTTTTTTACATTAGTTTAGACAAGCCTTAATAATAGTTTATTAAAATGAAAGT
GTATTCATTCATTATATTCACTGTGTATAAAGTTATAATGATATGAACATTTGCATATTTTAATTTAGTGATA
GAAATTTCGTGAAAGGTGGGATATTCTAGTCATAGGTTAACCGGACGACATCATAGGATCCTAACAAAATG
TTTACAATAATTCAATTATAAAATGGAGG
SEQ ID n°3 - PnprA Région promotrice du gène nprA de Bacillus thuringiensis
TTTTTTCAATATTTGTTCCTCAAAATTCTACAAAACTTGAGAAATAAATTAATTGAATTTTTAGTATATTAATA
GTGGAAACATAATGCTAATATGAAACTACTCTTTTTCAAAAAAATTTTTATTAGGGGGAAGGTTCATG
SEQ ID n°4 - PnprR Région promotrice du gène nprR de Bacillus thuringiensis
GAAGTGAAGTCAAGAGAGAAAAAAATGAAATTATGCATATTTTTTAGAAAATTTATATTTATCAATTTATAT
TTCTCCGAATTTTATGTATTATTAGAGTAATGGGGTAATGAGAATGGAGG
SEQ ID n°5 - PoppA Région promotrice du gène oppA de Bacillus thuringiensis
CTAGACCGTCAAAATATTACTAGAATTATTATACTATAAAAGCTATAATAAGTACTAGGATTAATTTTTTGAA
AATTATACGCAATTAAAGGTCTGATTTTAAGATGATGGTAGCAATGTTAATGTATCCCTTTACGAAAAATTT
AAAATATAAATATTTTATTAAAAATTTTAACAAAAAAACAAAAAACTATAIIG Ç ATTGTTATATTATATGT
ATAATGAAAATTGTAGAAACTTGGAGATTATTCTTTCAATTCTACTTTTTAACAAGTGAGGGTACAGGAAGT
GCAATTAGGGGAGG
SEQ ID n°6 - PnppC Région promotrice du gène nppC de Bacillus thuringiensis
ATTCCACTTTTATATAAAAAGATTTTTGAATATTTTTTCAACTTACCCTTGTCAAACATTGTCAATTTATATTA
AAATAACAACATACAAAATATTTAGTCTTTTCAGAAAAGATGGAGGGATAGCCATG
SEQ ID n°7 - PinhAl Région promotrice du gène inhAlde Bacillus thuringiensis
AATTGTGATATATTCGTATGCTAACTATGAAATTTTTACAAATATATTAAAAATATTACATGATATGACTAAA
TATTGAAAAAATATTGAATTTTTAATAAAATTCAATTTGTAATACATATTATTTATTAGGGGAGGAAATATG
GGATG
SEQ ID N°8 - PcalY Région promotrice du gène calY de Bacillus thuringiensis.
AAGCAAGACTAGTAATATTTATACGAGTGTGAGGGAACGTTAGCCCTCACCTCTTTGTTTTTCTTTTTTCTTA
TAGTATTAAATGATTTGAGTGTGAAAAAAGTTATAAATTATCATTGTTTTTTTCTGAAAAGTCTAAATGATAT
TGAGAAATAAAAATAACTGAAAATATTAATAAATATGTGTTGTGTTTATATAGGGTTGTTCGTTATAATGAA
CATAAGGTTTTTAAAAAAGAACACATATTAGCTAAGCTAATATAGTTTTCTTTACATCTCTTATTGAAAAATA
AGTGATAAAAATATAAAAAAAAGCTAGGGGGAATTGATT Le + 1 de transcription est indiqué en caractère gras. Les boîtes -10 des promoteurs sont soulignées d'un trait fin. Les boîtes -35 sont soulignées de 2 traits. La séquence d'ADN reconnue par PlcR (boîte PlcR) des promoteurs PpapR et PpIcB est soulignée d'un trait épais.
SEQ ID N°9 - STAB-SD Bacillus thuringiensis gaaaggaggg atgcc
SEQ ID N°10 - TcrylAc - Bacillus thuringiensis aaactcaggt ttaaatatcg ttttcaaatc aattgtccaa gagcagcatt acaaatagat aagtaatttg ttgtaatgaa aaacggacat cacctccatt gaaacggagt gatgtccgtt ttactatgtt attttctagt aatacatatg tatagagcaa cttaatcaag cagagatatt ttcacctatc gatgaaaata tctctgcttt ttcttttttt at
SEQ ID N°ll Séquence contenant 2 domaines LysM tels que décrits par Shao et al., 2009, Microb Cell Fact 8, 48. doi:10.1186/1475-2859-8-48.
ATGATTCAAATTGTAACGGTTCGTAGCGGTGATAGCGTATATAGCTTGGCATCAAAATATGGATCAACACC TGACGAAATAGTAAAAGACAATGGACTAAATCCCGCTGAAACGCTCGTTGTTGGTCAGGCACTTATCGTTA ATACGAAAGGAAATAATTATTATGTACAGCCTGGTGACAGCCTCTATCGGATTTCTCAAACATATAATGTCC CCCTCGCTAGTTTAGCTAAAGTTAATAATTTATCTTTAAAATCTATTCTCCATGTCGGACAACAATTATATGT ACCAAAAGGCACA
SEQ ID N° 12 : Séquence contenant 3 domaines SLH tels que décrits par Fedhila et al., 2006, Mol. Microbiol. 62: 339-355. doi: 10.1111/j.1365-2958.2006.05362.x.
GAAGATGAGAAAACAGAAGTGGTAGAATTTAAAGATGTACCAAAGGGACATTGGTCAGAAGAAGCAATT
AATTACTTAGCGAAAGAAAAATTATTTATAGGCTATGGAAATGGTGAATTTGGATTTGGTGATAACATTACT
CGTGGACAAGTAGCACTTCTAATACAAAGATATTTAAAATTAGAAAATAATCTAGAACAAAAAACGGCATT TACAGATACGAAAGGAAATATGTATGAAACGGCTATTGATGCAGTGGTTCAAGCTGGAATTATGACAGGC TATGGAAATGGTATGTTCCGTCCGGATGGAGTATTAACTCGATATGAAATGTCAGTAGTACTACAAAGAGT ATTTCAGTTAAAAGAAAATGAAAATAGTGCAGAGAATTTTAAAGATGTACCAAATGGCCATTGGGCGAAA GGATATGTGAAAGCTTTAGTGGATAATAAAATATCAAAAGGCGACGGGGAAGGGAATTTTTTAGGAGATA ATTTCGTAACACGTGAACAATACGCACAGTTTTTGTATAATGCAATAAAGAAA

Claims

REVENDICATIONS
1. Souche bactérienne du genre Bacillus non sporulante contenant un plasmide recombinant comprenant une cassette d'expression composée :
(i) d'un promoteur fort actif en phase en stationnaire et régulé par un régulateur choisi parmi CodY, AbrB, SinR, PlcR et NprR ;
(ii) de la séquence d'un gène codant une protéine d'intérêt.
2. Souche bactérienne selon la revendication 1, caractérisée en ce que ledit promoteur fort est choisi parmi PoppA, PnppC, PinhAl, PcalY, PpapR, PpIcB, PnprR et PnprA, de préférence, ledit promoteur fort est choisi parmi PoppA ou PnppC.
3. Souche bactérienne selon la revendication 1 ou la revendication 2, caractérisée en ce le gène de sporulation choisi parmi spoOA et sigE est inactivé par interruption ou modification de la séquence ou par délétion de tout ou partie du gène.
4. Souche bactérienne selon l'une quelconque des revendications 1 à 3, caractérisée en ce que :
(i) ladite souche est mutée dans le gène spoOA ; et
(ii) ledit promoteur fort est choisi parmi PpapR, PnprA, PnprR, PpIcB, PoppA et PnppC.
5. Souche bactérienne selon l'une quelconque des revendications 1 à 3, caractérisée en ce que :
(i) ladite souche est mutée dans le gène sigE ; et
(ii) ledit promoteur fort est choisi parmi PinhAl et PcalY.
6. Souche bactérienne selon l'une quelconque des revendications 1 à 5, caractérisée en ce que ladite cassette d'expression comprend en outre une séquence stabilisatrice de l'ARNm et/ou une séquence terminatrice du gène crylAc.
7. Souche bactérienne selon la revendication 6, caractérisée en ce que la séquence stabilisatrice de l'ARNm est la séquence STAB-SD.
8. Souche bactérienne selon les revendications 1 à 1 , caractérisée en ce que ledit plasmide est un plasmide choisi parmi pHT304, pHT315 et pHT370 pHT73, pBC16, du pE194, du pC194 et pBM299.
9. Souche bactérienne selon l'une quelconque des revendications 1 à 8, caractérisée en ce que ladite cassette d'expression comprend en outre les séquences codant pour une séquence d'ancrage ou d'export de protéines.
10. Souche bactérienne selon la revendication 1, caractérisée en ce qu'elle est une souche de
Bacillus thuringiensis.
11. Procédé de production d'une protéine d'intérêt comprenant les étapes de : a- préparation de la souche bactérienne selon l'une quelconque des revendications 1 à 10 ; b- culture de ladite souche bactérienne en phase stationnaire ; et c- optionnellement, purification de ladite protéine d'intérêt.
EP23723456.2A 2022-05-02 2023-04-26 Production de protéines d'intérêt dans une souche bactérienne non-sporulante Pending EP4519443A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2204132A FR3135093B1 (fr) 2022-05-02 2022-05-02 Production de protéines d’intérêt dans une souche bactérienne non-sporulante
PCT/EP2023/061003 WO2023213653A1 (fr) 2022-05-02 2023-04-26 Production de protéines d'intérêt dans une souche bactérienne non-sporulante

Publications (1)

Publication Number Publication Date
EP4519443A1 true EP4519443A1 (fr) 2025-03-12

Family

ID=83280339

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23723456.2A Pending EP4519443A1 (fr) 2022-05-02 2023-04-26 Production de protéines d'intérêt dans une souche bactérienne non-sporulante

Country Status (5)

Country Link
US (1) US20250297209A1 (fr)
EP (1) EP4519443A1 (fr)
CN (1) CN119095969A (fr)
FR (1) FR3135093B1 (fr)
WO (1) WO2023213653A1 (fr)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111148524A (zh) * 2017-05-23 2020-05-12 马萨诸塞大学 经纯化的抗蠕虫组合物及相关方法

Also Published As

Publication number Publication date
CN119095969A (zh) 2024-12-06
FR3135093A1 (fr) 2023-11-03
US20250297209A1 (en) 2025-09-25
WO2023213653A1 (fr) 2023-11-09
FR3135093B1 (fr) 2026-01-02

Similar Documents

Publication Publication Date Title
EP0331470B1 (fr) Gène hybride de Bacillus thuringiensis, plasmide, et pseudomonas fluorescens transformée
JP2565696B2 (ja) バシラス・チューリンゲンシス毒素のホスト範囲を変更する方法
WO1994025612A2 (fr) Sequences de nucleotides pour le controle de l'expression de sequences d'adn dans un hote cellulaire
DE68923215T2 (de) Hybrid-Pestizide.
Sanchis et al. Construction of new insecticidal Bacillus thuringiensis recombinant strains by using the sporulation non-dependent expression system of cryIIIA and a site specific recombination vector
JPH07501323A (ja) 新規な鞘翅類活性バシラスチューリンゲンシス単離体及び鞘翅類活性毒素をコードする遺伝子
EP0295156B1 (fr) Séquences de nucléotides codant pour des polypeptides dotés d'une activité larvicide vis-à-vis de lépidoptères
WO2023213653A1 (fr) Production de protéines d'intérêt dans une souche bactérienne non-sporulante
CA2113829C (fr) Nouveau type de replicon gram-positif - construction de vecteurs recombinants le contenant
FR2740472A1 (fr) Nouvelles souches de bacillus thuringiensis et composition pesticide les contenant
US10704059B2 (en) Suppression of resistance in insects to bacillus thuringiensis cry toxins that do not require the cadherin receptor
HUT73739A (en) Integrative dna segment compraising gene encoding insecticidal protein
EP0325400B1 (fr) Gène d'hybride de bacillus thuringiensis, plasmide et pseudomonas fluorescens transformé
EP4519288A1 (fr) Système d'expression bactérien de protéines hétérologues
FR2643646A1 (fr) Expression de sequences de nucleotides codant pour des vesicules a gaz
EP3405565A1 (fr) Souche bacterienne genetiquement modifiee produisant de la kurstakine dans le milieu de culture
US6051556A (en) Hybrid pesticidal toxins
JP2026047132A (ja) 枯草菌での殺虫タンパク質の製造方法
EP4673457A1 (fr) Bactéries génétiquement modifiées comprenant un systeme d'expression orthogonal invasif
WO2024107843A1 (fr) Systèmes actifs dynamiques achromosomiques stabilisés et leurs utilisations
CN104745603B (zh) 使用不需要钙黏着蛋白受体的毒素遏制昆虫对苏云金芽孢杆菌cry毒素的抗性
FR2639959A1 (fr) Bacteries recombinantes toxiques vis-a-vis des larves de dipteres et leur utilisation pour l'elaboration de compositions larvicides
FR2629097A1 (fr) Sequence d'adn comprenant la partie fonctionnelle du locus sacu de b. subtilis, vecteurs contenant la sequence correspondante, et leur utilisation dans des procedes de production de proteines

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20241002

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)