EP4395829A1 - Compounds and methods for skipping exon 44 in duchenne muscular dystrophy - Google Patents
Compounds and methods for skipping exon 44 in duchenne muscular dystrophyInfo
- Publication number
- EP4395829A1 EP4395829A1 EP22777539.2A EP22777539A EP4395829A1 EP 4395829 A1 EP4395829 A1 EP 4395829A1 EP 22777539 A EP22777539 A EP 22777539A EP 4395829 A1 EP4395829 A1 EP 4395829A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- compound
- side chain
- amino acid
- independently
- ccpp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
- A61K47/6455—Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/64—Cyclic peptides containing only normal peptide links
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3233—Morpholino-type ring
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3513—Protein; Peptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
Definitions
- DMD Duchenne Muscular Dystrophy
- DMD is a genetic disorder characterized by progressive muscle degeneration and weakness due to alterations of the protein dystrophin. Genetic modifications in DMD, the gene that encodes dystrophin, cause DMD. These genetic modifications shift the reading frame of DMD leading to a nonfunctional truncated DMD protein.
- One method for treating DMD patients entails delivering to a patient a compound which restores the reading frame of DMD.
- Antisense compounds can restore the reading frame of DMD by skipping an internal exon associated with the shift in the reading frame of DMD that leads to the nonfunctional truncated DMD protein. Exon skipping produces dystrophin proteins which retain functionality that is lost in the disease state.
- a significant problem with the use of antisense oligonucleotide therapeutics is their limited ability to gain access to the intracellular compartment when administered systemically.
- Intracellular delivery of antisense compounds can be facilitated by using of carrier systems such as polymers, cationic liposomes or by chemical modification of the construct, for example by the covalent attachment of cholesterol molecules.
- carrier systems such as polymers, cationic liposomes or by chemical modification of the construct, for example by the covalent attachment of cholesterol molecules.
- intracellular delivery efficiency remains low and there remains a need for improved delivery systems to increase the potency of these antisense compounds.
- the nucleic acids are antisense compounds (AC).
- the antisense compounds target exon 44 in a subject with Duchenne muscular dystrophy (DMD).
- DMD Duchenne muscular dystrophy
- the disclosure relates to compounds comprising: (a) a cell penetrating peptide (CPP) sequence (e.g., cyclic peptide); and (b) an antisense compound (AC) that is complementary to a target sequence comprising at least a portion of exon 44 of DMD gene in a pre-mRNA sequence.
- CPP cell penetrating peptide
- AC an antisense compound
- the AC is complementary to a target sequence comprising at least a portion of exon 44 of DMD gene in a pre-mRNA sequence, at least a portion of an intronic sequence flanking exon 44 of DMD gene in a pre-mRNA sequence, or both.
- hybridization of the AC with the target sequence alters the splicing pattern of the DMD pre-mRNA to restore the reading frame and enable production of a functional dystrophin protein.
- the AC comprises at least one modified nucleotide or nucleic acid selected from a phosphorothioate (PS) nucleotide, a phosphorodiamidate morpholino (PMO) nucleotide, a locked nucleic acid (LNA), a peptide nucleic acid (PNA), a nucleotide comprising a 2’-O-methyl (2’-OMe) modified backbone, a 2’O-methoxy-ethyl (2’-MOE) nucleotide, a 2',4' constrained ethyl (cEt) nucleotide, and a 2'-deoxy-2'-fluoro-beta-D-arabinonucleic acid (2'F-ANA).
- PS phosphorothioate
- PMO phosphorodiamidate morpholino
- LNA locked nucleic acid
- PNA peptide nucleic acid
- a nucleotide comprising a 2’
- FIG. 3 shows examples of endosomal escape vehicle (EEV) design using a representative CPP. It is understood that the CPP can include any of the CPP disclosed herein.
- FIG. 4A shows a schematic of preparation of EEV-PMO-MDX-23-1.
- FIG. 4B is a RT- PCR analysis that shows that, in comparison to mice treated with PMO-MDX-23-1, mice treated with EEV-PMO-MDX-23-1 produced dystrophin lacking the internal exon, exon 23.
- FIG.4C shows dystrophin exon skipping products in various treated muscle groups after administration of PMO-MDX-23-1 and EEV-PMO-MDX-23-1.
- FIGS.5A-5D show the percentage of exon skipping in MDX mice in the quadriceps (FIG. 5A), tibialis anterior (TA) (FIG.5B), diaphragm (FIG. 5C), and heart (FIG.5D) after delivery of PMO-MDX-23-1 or EEV-PMO-MDX-23-1.
- FIGS.6A-6D show the percentage of exon 23 splicing in MDX mice in the tibialis anterior (TA) (FIG. 6A), quadriceps (FIG.6B), diaphragm (FIG. 6C), and heart (FIG.6D) after delivery of EEV-PMO-MDX-23-1.
- FIGS. 7A-7D show the amount of exon 23 corrected dystrophin detected by Western Blot in the quadriceps (FIG. 7A), tibialis anterior (TA) (FIG. 7B), diaphragm (FIG. 7C), and heart (FIG. 7D) after delivery of PMO-MDX-23-1 or EEV-PMO-MDX-23-1.
- FIGS. 7A-7D show the amount of exon 23 corrected dystrophin detected by Western Blot in the quadriceps (FIG. 7A), tibialis anterior (TA) (FIG. 7B), diaphragm (FIG. 7C), and heart (FIG. 7D) after delivery of PMO-MDX-23-1 or EEV-PMO-MDX-23-1.
- FIGS. 12A-12D show exon 23 skipping after repeat doses (20 mg/kg) of EEV-PMO- MDX-23-2 in the D2-mdx model.
- FIG. 12A heart
- FIG. 12B diaphragm
- FIG. 12C tibialis anterior
- FIG.12D triceps
- FIGS. 13A-13C D2-mdx mice showed normalized serum creatine kinase (CK) levels (FIG. 12A) and significant improvement in muscle function (FIGS.
- CK creatine kinase
- FIGS. 18A-18D show creatine kinase activity in D2 MDX mice pre-dosing (FIG. 18A), and at 4 weeks (FIG. 18B), 8 weeks (FIG.18C) and 12 weeks (FIG. 18D) post-dosing.
- FIG. 27 Shows that EEV-PMO-DMD44-1 has an extended circulating half-life when administered to non-human primates (NHP).
- FIG. 28 shows that a single dose of EEV-PMO-DMD44-1 resulted in meaningful levels of exon skipping in both skeletal muscles and the heart of NHP 7 days post 1 hour IV infusion at 30 mg/kg.
- FIGs. 29A-29C depict exon skipping in the heart (FIG.
- the re-spliced target protein increases target protein function by about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, about 100%, about 150%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, about 500%, or more, compared to the function of the target protein produced by splicing, inclusive of all values and ranges therebetween.
- the EP can be coupled to the AC and the cCPP. Coupling between the EP, AC, cCPP, or combinations thereof, may be non-covalent or covalent.
- the EP can be attached through a peptide bond to the N-terminus of the cCPP.
- the EP can be attached through a peptide bond to the C- terminus of the cCPP.
- the EP can be attached to the cCPP through a side chain of an amino acid in the cCPP.
- the EP can be attached to the cCPP through a side chain of a lysine which can be conjugated to the side chain of a glutamine in the cCPP.
- the EP can be conjugated to the 5’ or 3’ end of an AC.
- exocyclic Peptides can comprise from 2 to 10 amino acid residues e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residues, inclusive of all ranges and values therebetween.
- the EP can comprise 6 to 9 amino acid residues.
- the EP can comprise from 4 to 8 amino acid residues.
- Each amino acid in the exocyclic peptide may be a natural or non-natural amino acid.
- non-natural amino acid refers to an organic compound that is a congener of a natural amino acid in that it has a structure similar to a natural amino acid so that it mimics the structure and reactivity of a natural amino acid.
- the EP can comprise at least two, at least three or at least four or more lysine residues.
- the EP can comprise 2, 3, or 4 lysine residues.
- the amino group on the side chain of each lysine residue can be substituted with a protecting group, including, for example, trifluoroacetyl (-COCF 3 ), allyloxycarbonyl (Alloc), 1-(4,4-dimethyl-2,6-dioxocyclohexylidene)ethyl (Dde), or (4,4- dimethyl-2,6-dioxocyclohex-1-ylidene-3)-methylbutyl (ivDde) group.
- a protecting group including, for example, trifluoroacetyl (-COCF 3 ), allyloxycarbonyl (Alloc), 1-(4,4-dimethyl-2,6-dioxocyclohexylidene)ethyl (Dde), or (4,4- dimethyl-2
- the amino group on the side chain of each lysine residue can be substituted with a trifluoroacetyl (-COCF3) group.
- the protecting group can be included to enable amide conjugation.
- the protecting group can be removed after the EP is conjugated to a cCPP.
- the EP can comprise at least 2 amino acid residues with a hydrophobic side chain.
- the amino acid residue with a hydrophobic side chain can be selected from valine, proline, alanine, leucine, isoleucine, and methionine.
- the amino acid residue with a hydrophobic side chain can be valine or proline.
- the amino acids in the EP can have D or L stereochemistry.
- the EP can comprise KK, KR, RR, KKK, KGK, KBK, KBR, KRK, KRR, RKK, RRR, KKKK, KKRK, KRKK, KRRK, RKKR, RRRR, KGKK, KKGK, KKKKK, KKKRK, KBKBK, KKKRKV, PKKKRKV, PGKKRKV, PKGKRKV, PKKGRKV, PKKKGKV, PKKKRGV or PKKKRKG.
- the EP can consist of PKKKRKV, RR, RRR, RHR, RBR, RBRBR, RBHBR, or HBRBH, wherein B is beta-alanine.
- the amino acids in the EP can have D or L stereochemistry.
- the EP can comprise an amino acid sequence identified in the art as a nuclear localization sequence (NLS).
- the EP can consist of an amino acid sequence identified in the art as a nuclear localization sequence (NLS).
- the EP can comprise an NLS comprising the amino acid sequence PKKKRKV.
- the EP can consist of an NLS comprising the amino acid sequence PKKKRKV.
- the cell penetrating peptide can comprise 6 to 20 amino acid residues.
- the cell penetrating peptide can be a cyclic cell penetrating peptide (cCPP).
- the cCPP is capable of penetrating a cell membrane.
- An exocyclic peptide (EP) can be conjugated to the cCPP, and the resulting construct can be referred to as an endosomal escape vehicle (EEV).
- EEV endosomal escape vehicle
- the cCPP can direct an ACto penetrate the membrane of a cell.
- the cCPP can deliver the AC to the cytosol of the cell.
- Suitable amino acids include, but are not limited to, alanine, allosoleucine, arginine, citrulline, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, napthylalanine, phenylalanine, proline, pyroglutamic acid, serine, threonine, tryptophan, tyrosine, valine, a derivative thereof, or combinations thereof.
- amino acids include, but are not limited to, alanine, allosoleucine, arginine, citrulline, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, napthylalanine, phenylalanine, proline, pyroglutamic acid, serine, thre
- the cCPP can comprise 4 to 20 amino acids, wherein: (i) at least one amino acid has a side chain comprising a guanidine group, or a protonated form thereof; (ii) at least one amino acid has no side chain or a side chain comprising , or a protonated form thereof ; and (iii) at least two amino acids independently have a side chain comprising an aromatic or heteroaromatic group. [0068] At least two amino acids can have no side chain or a side chain comprising or a protonated form thereof.
- the cCPP can comprise from 6 to 20 amino acid residues which form the cCPP, wherein: (i) at least one amino acid can be glycine, E-alanine, or 4-aminobutyric acid residues; (ii) at least one amino acid can have a side chain comprising an aryl or heteroaryl group; and (iii) at least one amino acid has a side chain comprising a guanidine group, or a protonated form thereof.
- the cCPP can comprise (i) 2 glycine, E-alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 3 glycine, E-alanine, 4- aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 4 glycine, E- alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 5 glycine, E-alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 6 glycine, E-alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 6 glycine residues.
- the cCPP can comprise (i) 3, 4, or 5 glycine residues.
- the cCPP can comprise (i) 3 or 4 glycine residues.
- the cCPP can comprise (i) 2 or 3 glycine residues.
- the cCPP can comprise (i) 1 or 2 glycine residues.
- the cCPP can comprise (i) 3, 4, 5, or 6 glycine, E-alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 3 glycine, E-alanine, 4-aminobutyric acid residues, or combinations thereof.
- the cCPP can comprise (i) 3 or 4 glycine residues [0077] In embodiments, none of the glycine, E-alanine, or 4-aminobutyric acid residues in the cCPP are contiguous. Two or three glycine, E-alanine, 4-or aminobutyric acid residues can be contiguous. Two glycine, E-alanine, or 4-aminobutyric acid residues can be contiguous. [0078] In embodiments, none of the glycine residues in the cCPP are contiguous. Each glycine residues in the cCPP can be separated by an amino acid residue that cannot be glycine.
- the cCPP can comprise (ii) 2, 3, 4, 5 or 6 amino acid residues independently having a side chain comprising an aromatic or heteroaromatic group.
- the cCPP can comprise (ii) 2 amino acid residues independently having a side chain comprising an aromatic or heteroaromatic group.
- the cCPP can comprise (ii) 3 amino acid residues independently having a side chain comprising an aromatic or heteroaromatic group.
- the cCPP can comprise (ii) 4 amino acid residues independently having a side chain comprising an aromatic or heteroaromatic group.
- the cCPP can comprise (ii) 2 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 3 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 4 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 5 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 6 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 2, 3, or 4 amino acid residues independently having a side chain comprising an aromatic group.
- the cCPP can comprise (ii) 2 or 3 amino acid residues independently having a side chain comprising an aromatic group.
- the aromatic group can be a 6- to 14-membered aryl.
- Aryl can be phenyl, naphthyl or anthracenyl, each of which is optionally substituted.
- Aryl can be phenyl or naphthyl, each of which is optionally substituted.
- the heteroaromatic group can be a 6- to 14-membered heteroaryl having 1, 2, or 3 heteroatoms selected from N, O, and S.
- Heteroaryl can be pyridyl, quinolyl, or isoquinolyl.
- the amino acid residue having a side chain comprising an aromatic or heteroaromatic group can each independently be bis(homonaphthylalanine), homonaphthylalanine, naphthylalanine, phenylglycine, bis(homophenylalanine), homophenylalanine, phenylalanine, tryptophan, 3-(3-benzothienyl)-alanine, 3-(2-quinolyl)-alanine, O-benzylserine, 3-(4- (benzyloxy)phenyl)-alanine, S-(4-methylbenzyl)cysteine, N-(naphthalen-2-yl)glutamine, 3-(1,1'- biphenyl-4-yl)-alanine, 3-(3-benzothienyl)-alanine or tyrosine, each of which is optionally substituted with one or more substituents.
- the optional substituent can be any atom or group which does not significantly reduce (e.g., by more than 50%) the cytosolic delivery efficiency of the cCPP, e.g., compared to an otherwise identical sequence which does not have the substituent.
- the optional substituent can be a hydrophobic substituent or a hydrophilic substituent.
- the optional substituent can be a hydrophobic substituent.
- the substituent can increase the solvent-accessible surface area (as defined herein) of the hydrophobic amino acid.
- the cCPP can comprise a residue of tyrosine, phenylalanine, 1-naphthylalanine, 2- naphthylalanine, tryptophan, 3-benzothienylalanine, 4-phenylphenylalanine, 3,4- difluorophenylalanine, 4-trifluoromethylphenylalanine, 2,3,4,5,6-pentafluorophenylalanine, homophenylalanine, ⁇ -homophenylalanine, 4-tert-butyl-phenylalanine, 4-pyridinylalanine, 3- pyridinylalanine, 4-methylphenylalanine, 4-fluorophenylalanine, 4-chlorophenylalanine, 3-(9- anthryl)-alanine.
- R 1a , R 1b , and R 1c can each be independently selected from phenyl, naphthyl, or anthracenyl.
- R 1a , R 1b , and R 1c can each be independently phenyl or naphthyl.
- R 1a , R 1b , and R 1c can each be independently selected pyridyl, quinolyl, or isoquinolyl.
- Each n’ can independently be 1 or 2.
- Each n’ can be 1.
- Each n’ can be 2.
- At least one n’ can be 0.
- At least one n’ can be 1.
- At least one n’ can be 2.
- At least one n’ can be 3.
- At least one n’ can be 4.
- At least one n’ can be 5.
- the cCPP of Formula (II) can have the structure of Formula (II-1): wherein R 1a , R 1b , R 1c , R 2a , R 2b , R 2c , R 2d , AA SC , n’ and n” are as defined herein.
- the cCPP of Formula (II) can have the structure of Formula (IIa): wherein R 1a , R 1b , R 1c , R 2a , R 2b , R 2c , R 2d , AA SC and n’ are as defined herein.
- the cCPP of formula (II) can have the structure of Formula (IIb): wherein R 2a , R 2b , AA SC , and n’ are as defined herein. [0166]
- the cCPP can have the structure of Formula (IIb): ( ), or a protonated form thereof, wherein: AA SC and n’ are as defined herein.
- the cCPP of Formula (IIa) has one of the following structures:
- the cCPP can have the structure of Formula (III): wherein: AA SC is an amino acid side chain; R 1a , R 1b , and R 1c are each independently a 6- to 14-membered aryl or a 6- to 14- membered heteroaryl; R 2a and R 2c are each independently H, or a protonated form thereof; R 2b and R 2d are each independently guanidine or a protonated form thereof; each n” is independently an integer from 1 to 3; each n’ is independently an integer from 1 to 5; and each p’ is independently an integer from 0 to 5.
- the AC described herein can be coupled to an AA SC .
- a linker can couple the AC to AA SC .
- R 1 , R 2 , and R 3 can each independently be H or an amino acid residue having a side chain comprising an aromatic group; at least one of R 1 , R 2 , and R 3 is an aromatic or heteroaromatic side chain of an amino acid; R 4 and R 6 are independently H or an amino acid side chain; AA SC is an amino acid side chain; q is 1, 2, 3 or 4; each m is independently an integer 0, 1, 2, or 3, each n is independently an integer 0, 1, 2, or 3, and Y is [0188]
- the cCPP of Formula (D) can have the structure of Formula (D-IV): [0189]
- the linker can comprise: (i) one or more D or L amino acids, each of which is optionally substituted; (ii) optionally substituted alkylene; (iii) optionally substituted alkenylene; (iv) optionally substituted alkynylene; (v) optionally substituted carbocyclyl; (vi) optionally substituted heterocyclyl; (vii) one or more -(R 1- J-R 2 ) z ”- subunits, wherein each of R 1 and R 2 , at each instance, are independently selected from alkylene, alkenylene, alkynylene, carbocyclyl, and heterocyclyl, each J is independently C, NR 3 , -NR 3 C(O)-, S, and O, wherein R 3 is independently selected from H, alkyl, alkenyl, alkynyl, carbocyclyl, and heterocyclyl, each of which is optionally substituted, and z” is an integer from 1 to 50; (viii)
- the linker can comprise one or more D or L amino acids and/or -(R 1- J-R 2 ) z ”-, wherein each of R 1 and R 2 , at each instance, are independently alkylene, each J is independently C, NR 3 , - NR 3 C(O)-, S, and O, wherein R 4 is independently selected from H and alkyl, and z” is an integer from 1 to 50; or combinations thereof.
- the linker can further comprise a functional group (FG) capable of reacting through click chemistry.
- FG can be an azide or alkyne, and a triazole is formed when the AC is conjugated to the linker.
- the linker can comprise (i) a ⁇ alanine residue and lusine residue;(ii)-(J-R 1 ) z ”; or (iii) a combination thereof.
- Each R 1 can independently be alkylene, alkenylene, alkynylene, carbocyclyl, or heterocyclyl, each J is independently C, NR 3 , -NR 3 C(O)-, S, or O, wherein R 3 is H, alkyl, alkenyl, alkynyl, carbocyclyl, or heterocyclyl, each of which is optionally substituted, and z” can be an integer from 1 to 50.
- Each R 1 can be alkylene and each J can be O.
- the linker can also incorporate a cleavage site, including a disulfide [NH 2 - (CH 2 O) n -S-S-(CH 2 O) n -COOH], or caspase-cleavage site (Val-Cit-PABC).
- the hydrocarbon can be a residue of glycine or beta-alanine.
- the linker can be bivalent and link the cCPP to an AC.
- the linker can be bivalent and link the cCPP to an exocyclic peptide (EP).
- the linker can be trivalent and link the cCPP to an AC and to an EP.
- the linker can be a bivalent or trivalent C 1 -C 50 alkylene, wherein 1-25 methylene groups are optionally and independently replaced by -N(H)-, -N(C 1 -C 4 alkyl)-, -N(cycloalkyl)-, -O-, - C(O)-, -C(O)O-, -S-, -S(O)-, -S(O) 2 -, -S(O) 2 N(C 1 -C 4 alkyl)-, -S(O) 2 N(cycloalkyl)-, -N(H)C(O)-, - N(C 1 -C 4 alkyl)C(O)-, -N(cycloalkyl)C(O)-, -C(O)N(H)-, -C(O)N(C 1 -C 4 alkyl), - C(O)N(cycloalkyl), aryl
- the linker can be a bivalent or trivalent C 1 -C 50 alkylene, wherein 1-25 methylene groups are optionally and independently replaced by -N(H)-, -O-, -C(O)N(H)-, or a combination thereof.
- the AC can be coupled to the glutamic acid of the cyclic peptide, which converts the glutamic acid to glutamine.
- the linker (L) can couple the AC to the glutamine/glutamic acid of the cyclic peptide.
- a linker (L) is covalently bound to the backbone of the AC.
- Each AA can independently be selected from glycine, E-alanine, 4-aminobutyric acid, 5-aminopentanoic acid, and 6-aminohexanoic acid.
- the cCPP can be attached to the AC through a linker (“L”).
- the linker can be conjugated to the AC through a bonding group (“M”).
- the linker can have the structure: wherein: x is an integer from 1-10; y is an integer from 1- 5; z is an integer from 1-10; each AA is independently an amino acid residue; * is the point of attachment to the AA SC , and AA SC is side chain of an amino acid residue of the cCPP; and M is a bonding group defined herein.
- the linker can have the structure: wherein: x’ is an integer from 1-23; y is an integer from 1-5; z’ is an integer from 1-23; * is the point of attachment to the AA SC , and AA SC is a side chain of an amino acid residue of the cCPP; and M is a bonding group defined herein. [0212]
- the linker can have the structure: wherein: x’ is an integer from 1-23; y is an integer from 1-5; and z’ is an integer from 1- 23; * is the point of attachment to the AA SC , and AA SC is a side chain of an amino acid residue of the cCPP.
- x can be an integer from 1-10, e.g.,1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, inclusive of all ranges and subranges therebetween.
- x’ can be an integer from 1-23, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23, inclusive of all ranges and subranges therebetween.
- x’ can be an integer from 5-15.
- x’ can be an integer from 9-13.
- x’ can be an integer from 1-5.
- x’ can be 1.
- y can be an integer from 1-5, e.g., 1, 2, 3, 4, or 5, inclusive of all ranges and subranges therebetween. y can be an integer from 2-5.
- the linker or M (wherein M is part of the linker) can be covalently bound to AC at any suitable location on the AC.
- the linker or M (wherein M is part of the linker) can be covalently bound to the 3' end of the AC or the 5' end of the AC.
- the linker or M (wherein M is part of the linker) can be covalently bound to the backbone of an AC.
- the linker can be bound to the side chain of aspartic acid, glutamic acid, glutamine, asparagine, or lysine, or a modified side chain of glutamine or asparagine (e.g., a reduced side chain having an amino group), on the cCPP.
- the linker can be bound to the side chain of lysine on the cCPP.
- the linker can have a structure: wherein M is a group that conjugates L to an AC; AA s is a side chain or terminus of an amino acid on the cCPP; each AAx is independently an amino acid residue; o is an integer from 0 to 10; and p is an integer from 0 to 5.
- the linker can have a structure: wherein M is a group that conjugates L to an AC; AAs is a side chain or terminus of an amino acid on the cCPP; each AAx is independently an amino acid residue; o is an integer from 0 to 10; and p is an integer from 0 to 5.
- M can comprise an alkylene, alkenylene, alkynylene, carbocyclyl, or heterocyclyl, each of which is optionally substituted. M can be selected from:
- AAs include aspartic acid, glutamic acid, glutamine, asparagine, or lysine, or a modified side chain of glutamine or asparagine (e.g., a reduced side chain having an amino group).
- AA s can be an AA SC as defined herein.
- Each AA x is independently a natural or non-natural amino acid.
- One or more AA x can be a natural amino acid.
- One or more AA x can be a non-natural amino acid.
- One or more AA x can be a E-amino acid.
- the E-amino acid can be E-alanine.
- o can be an integer from 0 to 10, e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. o can be 0, 1, 2, or 3. o can be 0. o can be 1. o can be 2. o can be 3. [0230] p can be 0 to 5, e.g., 0, 1, 2, 3, 4, or 5. p can be 0. p can be 1. p can be 2. p can be 3. p can be 4. p can be 5. [0231]
- the linker can have the structure:
- the linker can have the structure: wherein each of M, AA s , o, p, q, r and z” can be as defined herein.
- z can be an integer from 1 to 50, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, inclusive of all ranges and values therebetween.
- z can be an integer from 5-20.
- z can be an integer from 10-15.
- the linker can have the structure: wherein: M, AAs and o are as defined herein.
- Other non-limiting examples of suitable linkers include:
- M and AAs are as defined herein.
- M is
- R 1 is alkylene, cycloalkyl, or wherein t’ is 0 to 10 wherein each R is independently an alkyl, alkenyl, alkynyl, carbocyclyl, or O heterocyclyl, wherein R 1 is , and t’ is 2.
- the linker can have the structure: , wherein AA s is as defined herein, and m’ is 0-10. [0240] The linker can be of the formula:
- the linker can be of the formula: wherein “base” corresponds to a nucleobase at the 3’ end of a phosphorodiamidate morpholino oligomer. [0242] The linker can be of the formula: wherein “base” corresponds to a nucleobase at the 3’ end of a phosphorodiamidate morpholino oligomer. [0243] The linker can be of the formula:
- the linker can be of the formula: wherein “base” corresponds to a nucleobase at the 3’ end of a cargo phosphorodiamidate morpholino oligomer. [0245] The linker can be of the formula: [0246] The linker can be covalently bound to a cargo at any suitable location on the AC. The linker is covalently bound to the 3' end of cargo or the 5' end of an AC. The linker can be covalently bound to the backbone of an AC.
- the linker can be bound to the side chain of aspartic acid, glutamic acid, glutamine, asparagine, or lysine, or a modified side chain of glutamine or asparagine (e.g., a reduced side chain having an amino group), on the cCPP.
- the linker can be bound to the side chain of lysine on the cCPP.
- cCPP-linker conjugates [0248]
- the cCPP can be conjugated to a linker defined herein.
- the linker can be conjugated to an AA SC of the cCPP as defined herein.
- the linker can comprise a -(OCH 2 CH 2 ) z ’- subunit (e.g., as a spacer), wherein z’ is an integer from 1 to 23, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23. “- (OCH 2 CH 2 ) z ’ is also referred to as PEG.
- the cCPP-linker conjugate can have a structure selected from Table 4: Table 4: cCPP-linker conjugates [0250]
- the linker can comprise a -(OCH 2 CH 2 ) z ’- subunit, wherein z’ is an integer from 1 to 23, and a peptide subunit.
- the peptide subunit can comprise from 2 to 10 amino acids.
- the cCPP- linker conjugate can have a structure selected from Table 5: Table 5: Endosomal Escape Vehicle (cCPP-linker conjugate) [0251]
- the cCPP-linker conjugate can be Ac-PKKKRKV-K(cyclo[Ff ⁇ GrGrQ])-PEG12-K(N3)- NH 2 .
- EEVs comprising a cyclic cell penetrating peptide (cCPP), linker and exocyclic peptide (EP) are provided.
- An EEV can comprise the structure of Formula (B):
- R 1 , R 2 , and R 3 are each independently H or an aromatic or heteroaromatic side chain of an amino acid; R 4 and R 6 are independently H or an amino acid side chain; EP is an exocyclic peptide as defined herein; each m is independently an integer from 0-3; n is an integer from 0-2; x’ is an integer from 1-20; y is an integer from 1-5; q is 1-4; and z’ is an integer from 1-23.
- R 1 , R 2 , R 3 , R 4 , R 6 , EP, m, q, y, x’, z’ are as described herein.
- n can be 0.
- n can be 1.
- the EEV can comprise the structure of Formula (B-a) or (B-b):
- the EEV can comprises the structure of Formula (B-c): or a protonated form thereof, wherein EP, R 1 , R 2 , R 3 , R 4 , m and z’ are as defined above in Formula (B).
- the EEV can comprises the structure of Formula (B-c): or a protonated form thereof, wherein EP, R 1 , R 2 , R 3 , R 4 , and m are as defined above in Formula (B); AA is an amino acid as defined herein; M is as defined herein; n is an integer from 0-2; x is an integer from 1-10; y is an integer from 1-5; and z is an integer from 1-10. [0257] Thehe EEV can have the structure of Formula (B-1), (B-2), (B-3), or (B-4):
- the EEV can comprise Formula (B) and can have the structure: Ac-PKKKRKV-AEEA- K(cyclo[FGFGRGRQ])-PEG12-OH or Ac-PKKKRKV-AEEA-K(cyclo[GfFGrGrQ])-PEG12-OH.
- the EEV can comprise a cCPP of formula: [0260]
- the EEV can comprise formula: Ac-PKKKRKV-miniPEG2-Lys(cyclo(FfFGRGRQ)- miniPEG2-K(N3).
- the EEV can be: [0262] The EEV can be: Ac-PKKKRKV-K(cyclo(Ff-Nal-GrGrQ)-PEG 12 -K(N 3 )-NH 2 . [0263] The EEV can be [0264] The EEV can be Ac-P-K(Tfa)-K(Tfa)-K(Tfa)-R-K(Tfa)-V-AEEA-K(cyclo(Ff-Nal- GrGrQ)-PEG 12 -OH or Ac-P-K(Tfa)-K(Tfa)-K(Tfa)-R-K(Tfa)-V-AEEA-K(cyclo(FGFGRGRQ)- PEG 12 -OH. [0265] The EEV can be
- the EEV can be Ac-PKKKRKV-miniPEG-K(cyclo(Ff-Nal-GrGrQ)-PEG12-OH. [0267] The EEV can be [0268] The EEV can be
- the EEV can be [0270] The EEV can be [0271] The EEV can be [0272] The EEV can be [0273] The EEV can be:
- the EEV can be [0275]
- the EEV can be
- the EEV can be [0277]
- the EEV can be
- the EEV can be selected from [0279]
- the EEV can be selected from: wherein b is beta-alanine, and the exocyclic sequence can be D or L stereochemistry.
- compounds comprising a cyclic peptide and an AC have improved cytosolic uptake efficiency compared to compounds comprising an AC alone. Cytosolic uptake efficiency can be measured by comparing the cytosolic delivery efficiency of the compound comprising the cyclic peptide and the AC to the cytosolic delivery efficiency of an AC alone.
- Antisense Compound [0285]
- the compounds disclosed herein comprise a CPP (e.g., cyclic peptide) conjugated to an antisense compound (AC).
- the AC comprises an antisense oligonucleotide directed to a target polynucleotide.
- antisense oligonucleotide or simply “antisense” is meant to include oligonucleotides that are complementary to a targeted polynucleotide sequence.
- Antisense oligonucleotides are single strands of DNA or RNA that are complementary to a chosen sequence, e.g., a target gene mRNA.
- the antisense oligonucleotides may modulate one or more aspects of protein transcription, translation, and expression.
- the antisense oligonucleotide is directed to a target sequence within a target pre-mRNA modulates one or more aspects of pre-mRNA splicing.
- modulation of splicing refers to altering the processing of a pre-mRNA transcript such that the spliced mRNA molecule contains either a different combination of exons as a result of exon skipping or exon inclusion, a deletion in one or more exons, or the deletion or addition of a sequence not normally found in the spliced mRNA (e.g., an intron sequence).
- the skipped exon itself does not comprise a sequence mutation, but a neighboring exon comprises a mutation leading to a frameshift mutation or a nonsense mutation.
- antisense oligonucleotides hybridization to a target sequence within a target pre-mRNA prevents inclusion of an exon sequence in the mature mRNA molecule.
- antisense oligonucleotides hybridization to a target sequence within a target pre-mRNA results in preferential expression of a wild type target protein isomer.
- antisense oligonucleotides hybridization to a target sequence within a target pre- mRNA results in expression of a re-spliced target protein comprising an active fragment of a wild type target protein.
- the antisense mechanism functions via hybridization of an antisense oligonucleotide compound with a target nucleic acid.
- the antisense oligonucleotide hybridizing to its target sequence suppresses expression of the target protein.
- hybridization of the antisense oligonucleotide to its target sequence suppresses expression of one or more wild type target protein isomers.
- hybridization of the antisense oligonucleotide to its target sequence upregulates expression of the target protein. In embodiments, hybridization of the antisense oligonucleotide to its target sequence increases expression of one or more wild type target protein isomers.
- the antisense compound can inhibit gene expression by binding to a complementary mRNA. Binding to the target mRNA can lead to inhibition of gene expression either by preventing translation of complementary mRNA strands by sterically blocking RNA binding proteins involved in translation or by leading to degradation of the target mRNA.
- Antisense DNA can be used to target a specific, complementary (coding or non-coding) RNA.
- antisense constructs have also been described that inhibit and can be used to treat a variety of abnormal cellular proliferations, e.g., cancer (U. S. Patent 5,747,470; U. S. Patent 5,591,317 and U. S. Patent 5,783,683).
- antisense oligonucleotides are known in the art and can be readily adapted to produce an antisense oligonucleotide that targets any polynucleotide sequence. Selection of antisense oligonucleotide sequences specific for a given target sequence is based upon analysis of the chosen target sequence and determination of secondary structure, Tm, binding energy, and relative stability. Antisense oligonucleotides may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell.
- the AC according to the disclosure comprises a nucleic acid sequence that is complementary to a sequence found within a target pre-mRNA sequence, for example, at sequence that includes at least a portion of an exon, at least a portion of an intron, or both.
- the use of these ACs provides a direct genetic approach that has the ability to modulate splicing of specific disease-causing genes.
- the principle behind antisense technology is that an antisense compound, which hybridizes to a target nucleic acid, modulates gene expression activities such as splicing or translation through one of a number of antisense mechanisms.
- the sequence-specificity of the AC makes this technique extremely attractive as a therapeutic to selectively modulate the splicing of pre-mRNA involved in the pathogenesis of any one of a variety of diseases.
- Antisense technology is an effective means for changing the expression of one or more specific gene products and can therefore prove to be useful in a number of therapeutic, diagnostic, and research applications.
- the compounds described herein may contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), D or E, or as (D) or (L).
- Antisense compounds include all such possible isomers, as well as their racemic and optically pure forms.
- Antisense compound hybridization site [0293] Antisense mechanisms rely on hybridization of the antisense compound to the target nucleic acid.
- the present disclosure provides antisense compounds that are complementary to a target nucleic acid.
- the target nucleic acid sequence is present in a pre-mRNA molecule.
- the target nucleic acid sequence is present in an exon of a pre-mRNA molecule.
- the target nucleic acid sequence is present in an intron of a pre-mRNA molecule.
- Pre-mRNA molecules are made in the nucleus and are processed before or during transport to the cytoplasm for translation. Processing of the pre-mRNAs includes addition of a 5 ⁇ methylated cap and an approximately 200-250 base poly(A) tail to the 3 ⁇ end of the transcript. The next step in mRNA processing is splicing of the pre-mRNA, which occurs in the maturation of 90-95% of mammalian mRNAs. Introns (or intervening sequences) are regions of a primary transcript (or the DNA encoding it) that are not included in the coding sequence of the mature mRNA. Exons are regions of a primary transcript that remain in the mature mRNA when it reaches the cytoplasm.
- Splice junctions are also referred to as splice sites with the 5 ⁇ side of the junction often called the "5 ⁇ splice site,”or” splice donor site” and the 3 ⁇ side called the “3 ⁇ splice site”or”spliceacceptorsite”.Insplicing,the3 ⁇ end of anupstreamexonisjoinedtothe5 ⁇ endof th e downstream exon.
- the unspliced RNA (or pre-mRNA) has an exon/intronjunctionatthe5 ⁇ endof anintronandanintron/exonjunctionat ⁇ the3 ⁇ endofanintron.
- theexons arecontiguousatwhatissometimes ⁇ referred to as the exon/exon junction or boundary in the mature mRNA.
- Cryptic splice sites are those which are less often used but may be used when the usual splice site is blocked or unavailable.
- Alternative splicing defined as the splicing together of different combinations of exons, often results in multiple mRNA transcripts from a single gene.
- Pre-mRNA splicing involves two sequential biochemical reactions. Both reactions involve the spliceosomal transesterification between RNA nucleotides.
- a. first reaction the 2'-OH of a specific branch-point nucleotide within an intron, which is defined during spliceosome assembly, performs a nucleophilic attack on the first nucleotide of the intron at the 5' splice site forming a lariat intermediate.
- the 3'-OH of the released 5' exon performs a nucleophilic attack at the last nucleotide of the intron at the 3' splice site thus joining the exons and releasing the intron lariat.
- the AC hybridizing to its target sequence upregulates expression of the target protein. In embodiments, the AC hybridizing to its target sequence increases expression of one or more wild type target protein isomers.
- the efficacy of the ACs of the present disclosure may be assessed by evaluating the antisense activity effected by their administration.
- the term "antisense activity" refers to any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. Such detection and or measuring may be direct or indirect.
- antisense activity is assessed by detecting and or measuring the amount of target protein. In embodiments, antisense activity is assessed by detecting and or measuring the amount of re-spliced target protein.
- modified sugars includes but is not limited to non-bicyclic substituted sugars, especially non-bicyclic 2'-substituted sugars having a 2'-F, 2'-OCH 3 or a 2'-O(CH 2 ) 2 -OCH 3 substituent group; and 4'-thio modified sugars.
- Sugars can also be replaced with sugar mimetic groups among others, for example, the furanose ring can be replaced with a morpholine ring.
- Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative patents and publications that teach the preparation of such modified sugars include, but are not limited to, U.S.
- nucleosides comprise bicyclic modified sugars (BNA's), including LNA (4'-(CH 2 )-O-2' bridge), 2'-thio-LNA (4'-(CH 2 )-S-2' bridge),, 2'-amino-LNA (4'-(CH 2 )-NR-2' bridge),, ENA (4'-(CH 2 )2-O-2' bridge), 4'-(CH 2 ) 3 -2' bridged BNA, 4'-(CH 2 CH(CH 3 ))-2' bridged BNA” cEt (4'-(CH(CH 3 )-O-2' bridge), and cMOE BNAs (4'-(CH(CH 2 OCH 3 )-O-2' bridge).
- BNA's bicyclic modified sugars
- Conjugate groups include without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
- the conjugate group is a polyethylene glycol (PEG), and the PEG is conjugated to either the AC or the cyclic peptide.
- bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
- bifunctional linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
- the nucleic acid sequence of exon 44 of DMD from 5’ to 3’ is: GGCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATGATATAAAGATAT TTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCCTGAG AATTGGGAACATGCTAAATACAAATGGTATCTTAAG (SEQ ID NO: 2).
- the sequence of exon 44 comprises 1, 2, 3, 4, or 5 nucleotides, or more, at the 5’ end of SEQ ID NO: 1.
- the sequence of exon 44 comprises 1, 2, 3, 4, or 5 nucleotides, or more, at the 5’ end of SEQ ID NO: 2.
- the AC comprises 18 consecutive nucleotides (e.g., the AC is an 18-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 18-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
- the AC comprises 20 consecutive nucleotides (e.g., the AC is an 20-mer) of SEQ ID NO: 1, wherein the first nucleotide of the 20-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
- the AC comprises 26 consecutive nucleotides (e.g., the AC is an 26-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 26-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
- the AC comprises 27 consecutive nucleotides (e.g., the AC is an 27-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 27-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
- the AC comprises 28 consecutive nucleotides (e.g., the AC is an 28-mer) of SEQ ID NO: 1, wherein the first nucleotide of the 28-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
- the AC comprises 28 consecutive nucleotides (e.g., the AC is an 28-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 28-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
- the AC comprises 29 consecutive nucleotides (e.g., the AC is an 29-mer) of SEQ ID NO: 1, wherein the first nucleotide of the 29-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
- the AC comprises 29 consecutive nucleotides (e.g., the AC is an 29-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 29-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
- the AC comprises 30 consecutive nucleotides (e.g., the AC is an 30-mer) of SEQ ID NO: 1, wherein the first nucleotide of the 30-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100,
- the AC comprises 30 consecutive nucleotides (e.g., the AC is an 30-mer) of SEQ ID NO: 2, wherein the first nucleotide of the 30-mer starts at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102
- the AC that binds to exon 44 of DMD is selected from any one of the nucleic acid sequences shown in Tables 6A-6M, the reverse complement thereof, or a sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity thereto.
- the AC binds to a sequence of exon 44 of DMD selected from any one of the nucleic acid sequences shown in Tables 6A-6M.
- the AC that binds to exon 44 of DMD is selected from any one of the nucleic acid sequences within Tables 6A-6M, the reverse complement thereof, or a sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity thereto.
- the AC that binds to exon 44 of DMD comprises one or more modified nucleic acids, one or more modified internucleotide linkages, or a combination thereof.
- the AC that binds to exon 44 comprises one or more morpholine rings, one or more phosphorodiamidate linkages, or a combination thereof.
- the AC that binds to exon 44 of DMD is an antisense phosphorodiamidate morpholino oligomer (PMO) with a sequence selected from any one of the nucleic acid sequences within Tables 6A-6M, the reverse complement thereof, or a sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity thereto.
- PMO antisense phosphorodiamidate morpholino oligomer
- the AC that binds to exon 44 of DMD is 5'- TGAAAACGCCGCCATTTCTCAACAG -3'. In embodiments, the AC that binds to exon 44 of DMD is 5'-ACTGTTCAGCTTCTGTTAGCCACTG -3'. In embodiments, the AC that binds to exon 44 of DMD comprises one or more modified nucleic acids, one or more modified internucleotide linkages, or a combination thereof. In embodiments, the AC that binds to exon 44 comprises one or more morpholine rings, one or more phosphorodiamidate linkages, or a combination thereof.
- the AC that binds to exon 44 of DMD is an antisense phosphorodiamidate morpholino oligomer (PMO) with a sequence that is 5'- TGAAAACGCCGCCATTTCTCAACAG -3'.
- the AC that binds to exon 44 of DMD is an antisense phosphorodiamidate morpholino oligomer (PMO) with a sequence that is 5'- ACTGTTCAGCTTCTGTTAGCCACTG -3'.
- any AC described herein including the AC in Tables 6A-6M, the reverse complement thereof, or a sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity thereto.
- nucleotide or nucleic acid selected from a phosphorothioate (PS) nucleotide, a phosphorodiamidate morpholino (PMO) nucleotide, a locked nucleic acid (LNA), a peptide nucleic acid (PNA), a nucleotide comprising a 2’-O-methyl (2’- OMe) modified backbone, a 2’O-methoxy-ethyl (2’-MOE) nucleotide, a 2',4' constrained ethyl (cEt) nucleotide, and a 2'-deoxy-2'-fluoro-beta-D-arabinonucleic acid (2'F-ANA).
- PS phosphorothioate
- PMO phosphorodiamidate morpholino
- LNA locked nucleic acid
- PNA peptide nucleic acid
- nucleotide comprising a 2’-O-methyl (2’-
- AC comprises at least one phosphorodiamidate morpholino (PMO) nucleotide.
- PMO phosphorodiamidate morpholino
- 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1,415, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 2,728, 29, 30 or more of the nucleoties are modified.
- each nucleotide in the AC is a phosphorodiamidate morpholino (PMO) nucleotide.
- the compound has the following the structure: wherein: CPP is a cyclic peptide described herein (also referred to as a cell penetrating peptide); L is a linker; B is each independently a nucleobase that is complementary to a base in the target sequence; and n is an integer from 1 to 50.
- An endosomal escape vehicle can comprise a cyclic cell penetrating peptide (cCPP), an exocyclic peptide (EP) and linker, and can be conjugated to an AC to form an EEV-conjugate comprising the structure of Formula (C):
- the EEV can be conjugated to an AC and the EEV-conjugate can comprise the structure of Formula (C-a) or (C-b): or a protonated form thereof, wherein EP, m and z are as defined above in Formula (C).
- the compounds comprise from 1 to 10 cyclic peptides and from 1 to 10 ACs. In embodiments, the compounds comprise from 1 to 10 cyclic peptides, from 1 to 10 ACs, or from 1 to 10 EPs. [0356] In embodiments, the compounds of the disclosure comprise any one of the following structures. The compounds below are illustrative only and any one of the cyclic peptides, linkers, and AC in any one of the structures below may be replaced with any one of the cyclic peptides, linkers, or ACs described herein.
- compounds comprising a cyclic peptide and an AC have improved cytosolic uptake efficiency compared to compounds comprising an AC alone.
- Cytosolic uptake efficiency can be measured by comparing the cytosolic delivery efficiency of the compound comprising the cyclic peptide and the AC to the cytosolic delivery efficiency of an AC alone.
- Relative cytosolic delivery efficiency is determined, by comparing (i) the amount of a cCPP of the invention internalized by a cell type (e.g., HeLa cells) to (ii) the amount of a control cCPP internalized by the same cell type.
- a cell type e.g., HeLa cells
- the cell type may be incubated in the presence of a cCPP for a specified period of time (e.g., 30 minutes, 1 hour, 2 hours, etc.) after which the amount of the cCPP internalized by the cell is quantified using methods known in the art, e.g., fluorescence microscopy.
- the re-spliced target protein may have one or more properties that are improved relative to the target protein. In embodiments, the re-spliced target protein may have one or more properties that are improved relative to a wild-type target protein. In embodiments, the enzymatic activity or stability may be enhanced by promoting different splicing of the target pre- mRNA. In embodiments, the re-spliced target protein may have a sequence identical or substantially similar to a wild-type target protein isomer having improved properties compared to another wild-type target protein isomer. [0370] In embodiments, one or more properties of the target protein are either not present (eliminated) or are reduced in the re-spliced target protein.
- the re-spliced target protein may comprise a substitution, deletion, and/or insertion at one or more (e.g., several) positions compared to a wild-type target protein.
- a method for altering the expression of a target gene in a subject in need thereof comprising administering a compound disclosed herein.
- the treatment results in the lowered expression of a target protein.
- the treatment results in the expression of a re-spliced target protein.
- the treatment results in the preferential expression of a wild-type target protein isomer.
- treatment according to the present disclosure results in decreased expression of a target protein in a subject by more than about 5%, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 100%, as compared to the average level of the target protein in the subject before the treatment or of one or more control individuals with similar disease without treatment.
- treatment according to the present disclosure results in increased expression of a re- spliced target protein in a subject by more than about 5%, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 100%, as compared to the average level of the target protein in the subject before the treatment or of one or more control individuals with similar disease without treatment.
- treatment according to the present disclosure results in increased or decreased expression of a wild type target protein isomer in a subject by more than about 5%, e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 100%, as compared to the average level of the target protein in the subject before the treatment or of one or more control individuals with similar disease without treatment [0378]
- the terms, “improve,” “increase,” “reduce,” “decrease,” and the like, as used herein, indicate values that are relative to a control.
- EP exocyclic peptide
- MP modulatory peptide
- the EP when conjugated to a cyclic peptide disclosed herein, may alter the tissue distribution and/or retention of the compound.
- the EP comprises at least one positively charged amino acid residue, e.g., at least one lysine residue and/or at least one arginine residue.
- Non-limiting examples of EP are described herein.
- Non-limiting examples of C 1 -C 12 alkyl include methyl, ethyl, n-propyl, i-propyl, sec-propyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, t-amyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n- dodecyl.
- an alkyl group can be optionally substituted.
- alkenyl refers to a straight or branched hydrocarbon chain radical having from two to forty carbon atoms and having one or more carbon-carbon double bonds. Each alkenyl group is attached to the rest of the molecule by a single bond. Alkenyl groups comprising any number of carbon atoms from 2 to 40 are included.
- alkyl group can be optionally substituted.
- alkenylene alkenylene chain or alkenylene group refers to a straight or branched divalent hydrocarbon chain radical, having from two to forty carbon atoms, and having one or more carbon-carbon double bonds.
- Non-limiting examples of C 2 -C 40 alkenylene include ethene, propene, butene, and the like. Unless stated otherwise specifically in the specification, an alkenylene chain can be optionally.
- splicing and “processing” refer to the modification of a pre- mRNA following transcription, in which introns are removed, and exons are joined. Splicing occurs in a series of reactions that are catalyzed by a large RNA-protein complex composed of five small nuclear ribonucleoproteins (snRNPs) referred to as a spliceosome. Within an intron, a 3' splice site, a 5' splice site, and a branch site are required for splicing. The RNA components of snRNPs interact with the intron and may be involved in catalysis
- the term “intron” refers to a. portion of a. pre-mRNA which, after splicing, is typically excluded from the mature mRNA.
- the "target pre-mRNA” is the pre-mRNA comprising the target sequence to which the AC hybridizes.
- the "target mRNA” is the mRNA sequence resulting from splicing of the target pre-mRNA sequence. In embodiments, the target mRNA does not encode a functional protein. In embodiments, the target mRNA retains one or more intron sequences.
- the term "gene” refers to a nucleic acid molecule having a nucleic acid sequence that encompasses a 5' promoter region associated with the expression of the gene product, and any intron and exon regions and 3' untranslated regions (“UTR”) associated with the expression of the gene product.
- the "target gene” of the present disclosure refers to the gene that encodes the target pre- mRNA.
- the "target protein” refers to the amino acid sequence encoded by the target mRNA. In embodiments, the target protein may not be a functional protein.
- "Wild type target protein” refers to a native, functional protein isomer produced by a wild type, normal, or unmutated version of the target gene. The wild type target protein also refers to the protein resulting from a target pre-mRNA that has been properly spliced.
- RNAscript refers an RNA molecule transcribed from DNA and includes, but is not limited to mRNA, mature mRNA, pre -mRNA, and partially processed RNA.
- a "re-spliced target protein”, as used herein, refers to the protein encoded by the mRNA resulting from the splicing of the target pre-mRNA to which the AC hybridizes. Re-spliced target protein may be identical to a wild type target protein, may be homologous to a wild type target protein, may be a functional variant of a wild type target protein, or may be an active fragment of a wild type target protein.
- a re-spliced target protein that shares at least one biological activity of wild type target protein is considered to be an active fragment of the wild type target protein.
- Activity can be any percentage of activity (i.e., more or less) of the full-length wild type target protein, including but not limited to, about 1% of the activity, about 2%, about 3%, about 4%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, about 200%, about 300%, about 400%, about 500%, or more (including all values and ranges inbetween these values) activity compared to the wild type target protein.
- the active fragment may retain at least a portion of one or more biological activities of wild type target protein.
- the active fragment may enhance one or more biological activities of wild type target protein.
- nucleoside means a glycosylamine comprising a nucleobase and a sugar. Nucleosides includes, but are not limited to, natural nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and/or sugar groups.
- a "natural nucleoside” or “unmodified nucleoside” is a nucleoside comprising a natural nucleobase and a natural sugar. Natural nucleosides include RNA and DNA nucleosides.
- nucleoside refers to a nucleoside having a phosphate group covalently linked to the sugar. Nucleotides may be modified with any of a variety of substituents.
- nucleobase refers to the base portion of a nucleoside or nucleotide. A nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.
- an oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).
- oligonucleotides are composed of natural and/or modified nucleobases, sugars and covalent internucleoside linkages, and may further include non-nucleic acid conjugates.
- internucleoside linkage refers to a covalent linkage between adjacent nucleosides.
- natural internucleotide linkage refers to a 3' to 5' phosphodiester linkage.
- a chimeric oligomeric compound will have modified nucleosides that can be in isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and or mimetic groups can comprise a chimeric oligomeric compound as described herein.
- the term "mixed-backbone antisense oligonucleotide” refers to an antisense oligonucleotide wherein at least one internucleoside linkage of the antisense oligonucleotide is different from at least one other internucleotide linkage of the antisense oligonucleotide.
- nucleobase complementary or otherwise do not disrupt hybridization e.g., universal bases.
- hybridization means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid).
- modulation can include perturbation of splice site selection during pre-mRNA processing.
- the terms “inhibit”, “inhibiting” or “inhibition” refer to a decrease in an activity, expression, function or other biological parameter and can include, but does not require complete ablation of the activity, expression, function or other biological parameter. Inhibition can include, for example, at least about a 10% reduction in the activity, response, condition, or disease as compared to a control. In embodiments, expression, activity or function of a gene or protein is decreased by a statistically significant amount.
- expression refers to all the functions and steps by which a gene's coded information is converted into structures present and operating in a cell.
- Such structures include, but are not limited to the products of transcription and translation.
- the term "2'-modified” or "2'-substituted” means a sugar comprising substituent at the 2' position other than H or OH.
- BNA's and monomers e.g., nucleosides and nucleotides
- 2'- substituents such as allyl, amino, azido, thio, O-ally
- the term “MOE” refers to a 2'-O-methoxyethyl substituent.
- the term “high-affinity modified nucleotide” refers to a nucleotide having at least one modified nucleobase, internucleoside linkage or sugar moiety, such that the modification increases the affinity of an antisense compound comprising the modified nucleotide to a target nucleic acid. High-affinity modifications include, but are not limited to, BNAs, LNAs and 2'-MOE.
- mimetic refers to groups that are substituted for a sugar, a nucleobase, and/ or internucleoside linkage in an AC. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
- Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino.
- Representative examples of a mimetic for a sugar- internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages.
- PNA peptide nucleic acids
- nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.
- bicyclic nucleoside refers to a nucleoside wherein the furanose portion of the nucleoside includes a bridge connecting two atoms on the furanose ring, thereby forming a bicyclic ring system.
- BN include, but are not limited to, a-L-LNA, p-D-LNA, ENA, Oxyamino BNA (2'-O-N(CH 3 )-CH 2 -4') and Aminooxy BN A (2'-N(CH 3 )-O-CH 2 -4').
- the term "4' to 2' bicyclic nucleoside” refers to a BNA wherin the bridge connecting two atoms of the furanose ring bridges the 4' carbon atom and the 2' carbon atom of the furanose ring, thereby forming a bicyclic ring system.
- a dosage unit refers to a form in which a pharmaceutical agent is provided.
- a dosage unit is a vial comprising lyophilized antisense oligonucleotide.
- a dosage unit is a vial comprising reconstituted antisense oligonucleotide.
- the linker/CPP is installed either on the 5’ end, or on the 3’ end of the oligonucleotide.
- Synthesis of oligonucleotide-peptide conjugate with PEG spacer As shown in FIG.2A and 2B, an oligonucleotide-peptide conjugate is synthesized without (FIG. 2A) and with (FIG. 2B) a PEG (polyethylene glycol) linker inserted between oligonucleotide moiety and peptide. “R” in the figure represents a palmitoyl group. Synthesis of oligonucleotide-peptide conjugate for various gene targets.
- PMO-MDX-23 was conjugated to an Endosomal Escape Vehicle (EEV) with a sequence: cyclo(Ff ⁇ RrRrQ)-PEG12-OH (EEV-1) to form an EEV-PMO conjugate (EEV-PMO- MDX-23).
- EEV-PMO- MDX-23 The PMO without the EEV is referred to as PMO-MDX-23.
- FIG.4A A schematic of preparation of EEV-PMO-MDX-23 is shown in FIG.4A.
- FIGS. 5A-5D show the effect of the following IV dosage regimens on exon skipping efficacy: 10 mpk or 30 mpk dosed once, 1 week. Notably, 30 mpk EEV-PMO-MDX-23 dosed once, 1 week, resulted in the highest percentage of exon skipping in all four tissues: quadriceps (FIG.
- FIG. 6A-6D show the percentage of exon 23 splice corr3eection (as determined by RT- PCR) in the tibialis anterior (FIG. 6A), quadriceps (FIG. 6B), diaphragm (FIG. 6C), and heart (FIG. 6D) after dosing with EEV-PMO-MDX-23 at 10 mpk twice per week, 10 mpk once per week, 10 mpk once per two week, and 30 mpk once per week.
- FIGS. 7A-7D show the amount of exon-23 corrected dystrophin detected by Western blot in the quadriceps (FIG. 7A), tibialis anterior (TA) (FIG. 7B), diaphragm (FIG. 7C), and heart (FIG. 7D) after delivery of PMO-MDX-23 or EEV-PMO-MDX-23.
- FIGS. 7A-7D show the amount of exon-23 corrected dystrophin detected by Western blot in the quadriceps (FIG. 7A), tibialis anterior (TA) (FIG. 7B), diaphragm (FIG. 7C), and heart (FIG. 7D) after delivery of PMO-MDX-23 or EEV-PMO-MDX-23.
- FIGS. 9A-9B show the dystrophin levels in MDX mice two weeks (FIG. 9A) and four weeks (FIG. 9B) after treatment with 30 mpk EEV-PMO-MDX-23 or 30 mpk PMO-MDX-23.
- FIG. 12A-12D show the D2-mdx mice exhibited broad dystrophin expression and restoration of muscle integrity in the heart (FIG. 12A), diaphragm (FIG.
- Example 4 Duration and repeated dose effect on D2MDX mice after EEV-PMO-MDX-23- 2 administration
- Tissues were harvested at 1, 2, 4 and 8 weeks to test for single dose duration effects and single dose range finding.
- D2/MDX mice were dosed with 40 mpk weekly for 4 weeks and sacrificed 1 week after the final dose to test for the repeated dose effect.
- Results Exon skipping was observed in all 4 tissues after a single dose (FIGs.14A-14D), as well as dystrophin production. Exon skipping peaked at 2 weeks post injection and was maintained for at least 8 weeks in skeletal muscle: FIG. 15A (triceps) and FIG. 15B (tibialis anterior). A drop in exon skipping was observed after 4 and 8 weeks in diaphragm (FIG. 15C) and heart (FIG. 15D).
- C4COT cyclooct-2-yn-1-O-(CH 2 )4- O-C(O).
- the dosages are listed in the Figures. Creatine kinase levels, grip strength and wire-hang time were determined every 4 weeks for a total of 4 times. [0517] Results: Hang time for EEV-PMO-MDX-23-2 80mpk Q2W treatment is a little higher than the rest of the groups by 2 weeks post first injection and continues to show statistically significant improvement that increases at both 4 and 8 weeks post first injection vs. the vehicle D2.mdx group (FIG. 17). After 12 weeks of treatment, EEV-PMO-MDX-23-280mpk Q2W was statistically indistinguishable from the WT animals (FIG.
- EEV-PMO-MDX-23-2 40pmk Q2W and EEV-PMO-MDX-23-315mpk Q2W treatment with a loading dose showed significantly higher wire hang times vs. the vehicle D2.mdx group starting at 8 weeks post first treatment and plateauing until 12 weeks of treatment where signs of phenotype improvement first become evident (FIG.17).
- Serum creatine kinase (CK) levels were determined at 4 time points: pre-dose, and at 4, 8 and 12 weeks.
- the reaction was monitored by LCMS (Q-TOF), using BEH C18 column (130 ⁇ , 1.7 ⁇ m, 2.1mm ⁇ 50 mm), buffer A: water (0.1% FA), buffer B: acetonitrile (0.1% FA), flow rate: 0.4 mL/min, starting with 2% buffer B and ramping up to 98% over 3.4 min.
- in situ deprotection of TFA-protected lysines was initiated by dilution of the reaction mixture with 0.2 M KCl (aq) pH 12 (36 mL).
- the reaction was monitored by LCMS (Q-TOF), using the analysis method noted above.
- the crude mixture was loaded directly onto a C18 reverse-phase column (Oligo clarity column, 150mm* 21.2 mm).
- the crude product was then purified using a gradient of 5-20% over 60 min using water with 0.1% FA and acetonitrile as solvents and a flow rate of 20 mL/min. Fractions containing the desired product were pooled, and the pH of the solution was adjusted to 7 using 0.5 M NaOH. The solution was frozen and lyophilized, affording white powder. Formate salts were exchanged with chloride by reconstitution of the cCPP-AC conjugate in 1M NaCl in water and repeated washes through a 3-kD MW-cutoff amicon tube (centrifuged at 3500 rpm for 20-40 min).
- EEV-PMO-DMD44-1 was determined to be 99% pure by RP- FA and 78% pure by CEX.
- the MW identified by QTOF-LCMS was 10850.95.
- Formulations were further assayed for their endotoxin amount, residual free peptide, FA content and pH.
- EEV-PMO-DMD44-2 was obtained with 70% yield. The purity and identity of each formulation was assessed by QTOF-LCMS.
- EEV-PMO-DMD44-2 was 99% pure by RP-FA and 78% pure by CEX.
- patient-derived myoblasts harboring an exon 45 deletion were treated with EEV-PMO-DMD44-1 , EEV-PMO- DMD44-2, and EEV-PMO-DMD44-3 at 1 ⁇ M, 3 ⁇ M, and 10 pM for 24 hours in PromoCell Skeletal Muscle Cell Growth Medium supplemented with 2% horse serum and 1% chick embryo extract. After 24 hours, the compound-containing growth medium was replaced with DMEM/2% horse serum and incubated for 5 days to promote myoblast fusion and differentiation into myotubes.
- DMDA45 exon 45 deletion
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Neurology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163239671P | 2021-09-01 | 2021-09-01 | |
| US202163239645P | 2021-09-01 | 2021-09-01 | |
| US202163290960P | 2021-12-17 | 2021-12-17 | |
| US202163292685P | 2021-12-22 | 2021-12-22 | |
| US202263298565P | 2022-01-11 | 2022-01-11 | |
| US202263268580P | 2022-02-25 | 2022-02-25 | |
| US202263268577P | 2022-02-25 | 2022-02-25 | |
| US202263362294P | 2022-03-31 | 2022-03-31 | |
| US202263362423P | 2022-04-04 | 2022-04-04 | |
| US202263337560P | 2022-05-02 | 2022-05-02 | |
| US202263354456P | 2022-06-22 | 2022-06-22 | |
| PCT/US2022/075691 WO2023034817A1 (en) | 2021-09-01 | 2022-08-30 | Compounds and methods for skipping exon 44 in duchenne muscular dystrophy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4395829A1 true EP4395829A1 (en) | 2024-07-10 |
Family
ID=83448049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22777539.2A Pending EP4395829A1 (en) | 2021-09-01 | 2022-08-30 | Compounds and methods for skipping exon 44 in duchenne muscular dystrophy |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20260098262A9 (enExample) |
| EP (1) | EP4395829A1 (enExample) |
| JP (1) | JP2024532464A (enExample) |
| KR (1) | KR20240082344A (enExample) |
| AU (1) | AU2022339769A1 (enExample) |
| CA (1) | CA3229661A1 (enExample) |
| IL (1) | IL311139A (enExample) |
| MX (1) | MX2024002640A (enExample) |
| WO (1) | WO2023034817A1 (enExample) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025038901A1 (en) * | 2023-08-17 | 2025-02-20 | Entrada Therapeutics, Inc. | Cyclic peptides for delivering therapeutics |
| WO2025072246A1 (en) * | 2023-09-26 | 2025-04-03 | Entrada Therapeutics, Inc. | Compounds and methods for skipping exon 50 in duchenne muscular dystrophy |
Family Cites Families (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| FR2567892B1 (fr) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons |
| US5453566A (en) | 1986-03-28 | 1995-09-26 | Calgene, Inc. | Antisense regulation of gene expression in plant/cells |
| GB8822492D0 (en) | 1988-09-24 | 1988-10-26 | Considine J | Apparatus for removing tumours from hollow organs of body |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| DE69034150T2 (de) | 1989-10-24 | 2005-08-25 | Isis Pharmaceuticals, Inc., Carlsbad | 2'-Modifizierte Oligonukleotide |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| ES2116977T3 (es) | 1990-05-11 | 1998-08-01 | Microprobe Corp | Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente. |
| US5789573A (en) | 1990-08-14 | 1998-08-04 | Isis Pharmaceuticals, Inc. | Antisense inhibition of ICAM-1, E-selectin, and CMV IE1/IE2 |
| EP0538194B1 (de) | 1991-10-17 | 1997-06-04 | Novartis AG | Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| FR2687679B1 (fr) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | Oligothionucleotides. |
| EP0577558A2 (de) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte |
| JPH08504559A (ja) | 1992-12-14 | 1996-05-14 | ハネウエル・インコーポレーテッド | 個別に制御される冗長巻線を有するモータシステム |
| IL108367A0 (en) | 1993-01-27 | 1994-04-12 | Hektoen Inst For Medical Resea | Antisense polynzcleotide inhibition of human growth factor-sensitive cancer cells |
| CA2159631A1 (en) | 1993-03-30 | 1994-10-13 | Sanofi | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| DE4311944A1 (de) | 1993-04-10 | 1994-10-13 | Degussa | Umhüllte Natriumpercarbonatpartikel, Verfahren zu deren Herstellung und sie enthaltende Wasch-, Reinigungs- und Bleichmittelzusammensetzungen |
| US5801154A (en) | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5591317A (en) | 1994-02-16 | 1997-01-07 | Pitts, Jr.; M. Michael | Electrostatic device for water treatment |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5783683A (en) | 1995-01-10 | 1998-07-21 | Genta Inc. | Antisense oligonucleotides which reduce expression of the FGFRI gene |
| US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
| US5747470A (en) | 1995-06-07 | 1998-05-05 | Gen-Probe Incorporated | Method for inhibiting cellular proliferation using antisense oligonucleotides to gp130 mRNA |
| US20080119427A1 (en) | 1996-06-06 | 2008-05-22 | Isis Pharmaceuticals, Inc. | Double Strand Compositions Comprising Differentially Modified Strands for Use in Gene Modulation |
| US5739119A (en) | 1996-11-15 | 1998-04-14 | Galli; Rachel L. | Antisense oligonucleotides specific for the muscarinic type 2 acetylcholine receptor MRNA |
| US6770748B2 (en) | 1997-03-07 | 2004-08-03 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogue |
| JP3756313B2 (ja) | 1997-03-07 | 2006-03-15 | 武 今西 | 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体 |
| US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
| JP4236812B2 (ja) | 1997-09-12 | 2009-03-11 | エクシコン エ/エス | オリゴヌクレオチド類似体 |
| US6043352A (en) | 1998-08-07 | 2000-03-28 | Isis Pharmaceuticals, Inc. | 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides |
| JP2002535247A (ja) | 1998-11-26 | 2002-10-22 | ペンタファルム アクチェンゲゼルシャフト | 輸送系複合体 |
| ES2234563T5 (es) | 1999-02-12 | 2018-01-17 | Daiichi Sankyo Company, Limited | Nuevos análogos de nucleósidos y oligonucleótidos |
| US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
| US7053207B2 (en) | 1999-05-04 | 2006-05-30 | Exiqon A/S | L-ribo-LNA analogues |
| US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
| JP4151751B2 (ja) | 1999-07-22 | 2008-09-17 | 第一三共株式会社 | 新規ビシクロヌクレオシド類縁体 |
| EP1235914A2 (en) | 1999-11-24 | 2002-09-04 | Joseph Rosenecker | Polypeptides comprising multimers of nuclear localization signals or of protein transduction domains and their use for transferring molecules into cells |
| US7034109B2 (en) | 2000-10-13 | 2006-04-25 | Christophe Bonny | Intracellular delivery of biological effectors |
| US7033597B2 (en) | 2000-10-13 | 2006-04-25 | Université de Lausanne | Intracellular delivery of biological effectors |
| US7569575B2 (en) | 2002-05-08 | 2009-08-04 | Santaris Pharma A/S | Synthesis of locked nucleic acid derivatives |
| US20040219565A1 (en) | 2002-10-21 | 2004-11-04 | Sakari Kauppinen | Oligonucleotides useful for detecting and analyzing nucleic acids of interest |
| WO2004041889A2 (en) | 2002-11-05 | 2004-05-21 | Isis Pharmaceuticals, Inc. | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
| EP1661905B9 (en) | 2003-08-28 | 2012-12-19 | IMANISHI, Takeshi | Novel artificial nucleic acids of n-o bond crosslinkage type |
| WO2007090071A2 (en) | 2006-01-27 | 2007-08-09 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
| JP6807831B2 (ja) * | 2014-05-21 | 2021-01-06 | エントラーダ セラピューティクス,インコーポレイテッド | 細胞膜透過性ペプチド、並びにこの作製方法及び使用方法 |
| GB201711809D0 (en) | 2017-07-21 | 2017-09-06 | Governors Of The Univ Of Alberta | Antisense oligonucleotide |
| EP4058032A4 (en) * | 2019-12-19 | 2024-01-10 | Entrada Therapeutics, Inc. | Compositions for delivery of antisense compounds |
| EP4314016A1 (en) * | 2021-03-31 | 2024-02-07 | Entrada Therapeutics, Inc. | Cyclic cell penetrating peptides |
-
2022
- 2022-08-30 MX MX2024002640A patent/MX2024002640A/es unknown
- 2022-08-30 AU AU2022339769A patent/AU2022339769A1/en active Pending
- 2022-08-30 KR KR1020247010933A patent/KR20240082344A/ko active Pending
- 2022-08-30 US US18/688,083 patent/US20260098262A9/en active Pending
- 2022-08-30 WO PCT/US2022/075691 patent/WO2023034817A1/en not_active Ceased
- 2022-08-30 JP JP2024513758A patent/JP2024532464A/ja active Pending
- 2022-08-30 EP EP22777539.2A patent/EP4395829A1/en active Pending
- 2022-08-30 CA CA3229661A patent/CA3229661A1/en active Pending
- 2022-08-30 IL IL311139A patent/IL311139A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| JP2024532464A (ja) | 2024-09-05 |
| AU2022339769A1 (en) | 2024-03-28 |
| WO2023034817A1 (en) | 2023-03-09 |
| WO2023034817A4 (en) | 2023-04-13 |
| MX2024002640A (es) | 2024-07-19 |
| US20260098262A9 (en) | 2026-04-09 |
| IL311139A (en) | 2024-04-01 |
| CA3229661A1 (en) | 2023-03-09 |
| US20250129365A1 (en) | 2025-04-24 |
| KR20240082344A (ko) | 2024-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240417429A1 (en) | Compositions and methods for skipping exon 45 in duchenne muscular dystrophy | |
| US20230020092A1 (en) | Compositions for delivery of antisense compounds | |
| US20240247259A1 (en) | Compositions and methods for modulating gene expression | |
| US12178855B2 (en) | Compositions and methods for facilitating delivery of synthetic nucleic acids to cells | |
| WO2022271818A1 (en) | Antisense compounds and methods for targeting cug repeats | |
| US20250051780A1 (en) | COMPOSITIONS AND METHODS FOR MODULATING mRNA SPLICING | |
| US20250129365A1 (en) | Compounds and methods for skipping exon 44 in duchenne muscular dystrophy | |
| WO2024073042A1 (en) | Ocular delivery of therapeutic agents | |
| WO2025072246A9 (en) | Compounds and methods for skipping exon 50 in duchenne muscular dystrophy | |
| US20250051393A1 (en) | Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity | |
| RU2848055C2 (ru) | Соединения и способы пропуска экзона 44 при мышечной дистрофии дюшенна | |
| CN117957022A (zh) | 用于靶向cug重复序列的反义化合物和方法 | |
| RU2847465C2 (ru) | Композиции и способы пропуска экзона 45 при мышечной дистрофии дюшенна | |
| US20250011774A1 (en) | Antisense compounds and methods for targeting cug repeats | |
| CN118215504A (zh) | 用于跳跃杜兴氏肌营养不良中的外显子44的化合物和方法 | |
| OA21931A (en) | Antisense compounds and methods for targeting CUG repeats. | |
| CN118284434A (zh) | 用于跳跃杜兴氏肌营养不良中的外显子45的组合物和方法 | |
| WO2025038901A1 (en) | Cyclic peptides for delivering therapeutics | |
| WO2025038902A2 (en) | Intracellular targeting of oligonucleotides | |
| KR20260056195A (ko) | 올리고뉴클레오타이드의 세포내 표적화 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20240328 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40108805 Country of ref document: HK |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Free format text: CASE NUMBER: APP_30502/2025 Effective date: 20250625 |