EP4196139A2 - Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms - Google Patents

Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms

Info

Publication number
EP4196139A2
EP4196139A2 EP21778590.6A EP21778590A EP4196139A2 EP 4196139 A2 EP4196139 A2 EP 4196139A2 EP 21778590 A EP21778590 A EP 21778590A EP 4196139 A2 EP4196139 A2 EP 4196139A2
Authority
EP
European Patent Office
Prior art keywords
bacterium
sting
immunostimulatory
immunostimulatory bacterium
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21778590.6A
Other languages
German (de)
English (en)
French (fr)
Inventor
Laura Hix GLICKMAN
Bret Nicholas PETERSON
Haixing Kehoe
Alexandre Charles Michel IANNELLO
Christopher D. Thanos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Actym Therapeutics Inc
Original Assignee
Actym Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US17/320,200 external-priority patent/US20220380720A1/en
Application filed by Actym Therapeutics Inc filed Critical Actym Therapeutics Inc
Publication of EP4196139A2 publication Critical patent/EP4196139A2/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1841—Transforming growth factor [TGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/191—Tumor necrosis factors [TNF], e.g. lymphotoxin [LT], i.e. TNF-beta
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2013—IL-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/208—IL-12
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2086—IL-13 to IL-16
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/12—Drugs for disorders of the metabolism for electrolyte homeostasis
    • A61P3/14—Drugs for disorders of the metabolism for electrolyte homeostasis for calcium homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255—Salmonella (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5434—IL-12
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C07K14/56—IFN-alpha
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C07K14/565—IFN-beta
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K16/1235—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Salmonella (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y201/00—Transferases transferring one-carbon groups (2.1)
    • C12Y201/01—Methyltransferases (2.1.1)
    • C12Y201/01045—Thymidylate synthase (2.1.1.45)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55522—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55522—Cytokines; Lymphokines; Interferons
    • A61K2039/55527—Interleukins
    • A61K2039/55533—IL-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag

Definitions

  • Patent Application Serial No.16/033,187 now allowed, filed on July 11, 2018 and published as U.S. Publication No. 2019/0017050 A1 on January 17, 2019, each entitled “ENGINEERED IMMUNOSTIMULATORY BACTERIAL STRAINS AND USES THEREOF.”
  • This application also is related to International Patent Application No. PCT/US2019/041489, filed on July 11, 2019, and published as WO 2020/014543, on January 16, 2020, entitled “ENGINEERED IMMUNOSTIMULATORY BACTERIAL STRAINS AND USES THEREOF.”
  • the immunostimulatory bacteria provided in each of these applications can be modified as described in this application, and such bacteria are incorporated by reference herein.
  • FIELD OF THE INVENTION Provided are attenuated immunostimulatory bacteria with genomes that are modified to, for example, reduce undesirable inflammatory responses and toxicity, and improve the anti-tumor activity and/or immunostimulatory activity by increasing resistance to complement inactivation, by reducing immune cell death, by promoting adaptive immunity, and by enhancing T-cell function.
  • the increase in colonization of phagocytic cells, for anti-cancer uses improves the delivery of encoded therapeutic products to the tumor microenvironment and to tumors, and permits, among other routes, systemic administration of the immunostimulatory bacteria.
  • the bacteria can colonize phagocytic cells, including in tissues colonized by pathogens.
  • immunostimulatory bacteria provided herein can be used to treat immune desert (immune-excluded) tumors, which have scarce or absent T-cell infiltration in the tumor microenvironment and tumors. These include tumors with stromal barriers.
  • the immunostimulatory bacteria provided herein can turn so-called “cold” tumors, which are resistant to or non-responsive to immunotherapy into “hot” tumors.
  • immunostimulatory bacteria include genome modifications described herein, such that they are TLR2/4/5 attenuated, such as by virtue of elimination of flagella, the msbB-/pagP- phenotype, as well as additional mutations, such as the elimination of curli fimbriae, and also other mutations, such as the ansB- phenotype. These bacteria can proliferate in vivo.
  • the payloads encoded in the plasmid(s) in the bacteria are those that are part of a cytosolic DNA/RNA sensor pathway that leads to expression of type I interferon (IFN).
  • IFN type I interferon
  • these products include gain-of- function mutations to render expression of type I IFN constitutive.
  • immunostimulatory bacteria also can encode a cytokine or cytokines, such as an IL-15, particularly as an IL-15/IL-15R alpha chain complex, and can encode tumor-associated antigens and/or bi-specific T-cell engager antibodies.
  • a cytokine or cytokines such as an IL-15, particularly as an IL-15/IL-15R alpha chain complex
  • tumor-associated antigens and/or bi-specific T-cell engager antibodies can be administered systemically.
  • immunostimulatory bacteria that can be used and/or formulated as vaccines for administration into tissues, such as by intramuscular injection, inhalation, and other such direct routes.
  • These bacteria are designed to be non-replicating in vivo, and, thus, comprise a nutritional auxotrophy, such as a thyA- so that they do not express active thymidylate synthase, and they encode the payload under control of a promoter recognized in the bacterium. If they are intended to deliver protein payloads to a vacciniated host, the encoded payloads include sequences or are designed so that they are translated in the bacterial host. If they are intended to deliver RNA, then the encoding nucleic acids are designed so that the bacterial ribosomes cannot translate them, but so that eukaryotic ribosomes can translate them.
  • a nutritional auxotrophy such as a thyA- so that they do not express active thymidylate synthase
  • the payloads of the vaccines include nucleic acid encoding the immunizing antigen or protein, such as an antigen from a viral or bacterial pathogen. Payloads also can include immunostimulatory proteins, such as a product, such as STING, particularly modified STING, that is part of a cytosolic DNA/RNA sensor pathway that leads to expression of type I interferon (IFN), and also, optionally, a cytokine, such as an IL-15, such as IL-15/IL-15R alpha chain complex.
  • the vaccines are formulated for a suitable route of administration, and include aerosols and emulsions, tablets, and powders.
  • immunostimulatory bacteria that contain genome modifications and a plasmid that encodes one or more therapeutic products, such as anti-cancer therapeutics or associated treatments.
  • the genome modifications result in immunostimulatory bacteria that accumulate in the tumor microenvironment and in tumor-resident immune cells, where they express the encoded therapeutic products.
  • the immunostimulatory bacteria provided herein encoded one or a plurality of complementary products that stimulate or induce or result in a robust anti-cancer response in the subject. Because of the similarity in the immune response between an anti-tumor response and an anti-viral response, immunostimulatory bacteria provided herein also can be used to treat infectious diseases.
  • the immunostimulatory bacteria can encode an anti-viral or anti-bacterial therapeutic, such as an inhibitor of a viral or bacterial product, or an inhibitor of the expression of a viral or bacterial product, or a viral or bacterial antigen.
  • an anti-viral or anti-bacterial therapeutic such as an inhibitor of a viral or bacterial product, or an inhibitor of the expression of a viral or bacterial product, or a viral or bacterial antigen.
  • chronic viral infections such as infections by hepatitis viruses, herpes viruses, varicella zoster virus (VZV), Epstein- Barr virus (EBV), human immunodeficiency virus (HIV), human T-cell leukemia virus (HTLV), Respiratory Syncytial Virus (RSV), measles virus, and other such viruses that chronically infect subjects.
  • the immunostimulatory bacteria also can be used for treatment of acute infections as well, such as initial infections with chronic influenza, P.
  • coronaviruses such as Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), Middle East Respiratory Syndrome coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2, which causes COVID-19).
  • SARS-CoV Severe Acute Respiratory Syndrome coronavirus
  • MERS-CoV Middle East Respiratory Syndrome coronavirus
  • SARS-CoV-2 Severe Acute Respiratory Syndrome coronavirus 2
  • Targeted pathogenic bacteria also include, for example, species of Escherichia, Staphylococcus, Pseudomonas, and Porphyromonas.
  • the immunostimulatory bacteria provided herein can encode an antigen or antigens from a pathogen, such as a viral antigen, and are used as a vaccine to prevent infection, or to treat existing infections.
  • Antigens include, but are not limited to, any that are known to those of skill in the art to elicit an immmunoprotective response or to ameliorate a disease resulting from the pathogen.
  • These immunostimulatory bacteria by virtue of the ability to accumulate in immune cells, such as antigen- presenting cells, can prime the T-cell response to a pathogen, such as a virus.
  • a pathogen such as a virus.
  • immunostimulatory bacteria include those that are deficient in asparaginase II, an enzyme that suppresses the function of T-cells. Any of the immunostimulatory bacteria described and provided herein can be used.
  • eliminating asparaginase II activity can be used to encode an antigen or combination of antigens.
  • the resulting bacteria promote an anti-pathogen, such as anti-viral, T-cell response.
  • an antigen such as from a pathogen, bacterial or viral or other
  • immune cells such as antigen-presenting cells
  • the immunostimulatory bacteria can encode a viral antigen, such as an antigen from an essential viral core protein shared among a family of viruses or across viral families.
  • an antigen from the nucleocapsid and/or non-structural M proteins that can enhance CD8 + T-cell responses to heavily conserved and less mutated core proteins, thereby providing broad pan-coronavirus protection, to provide effective vaccines and treatments.
  • Proteins and antigens from this corona virus and corona virus family that are used for immunization and/or treatment are known, and exemplary ones are described herein and known to those of skill in the art.
  • spike proteins, portions thereof, and modified spike proteins others proteins have been identified for this purpose. See, e.g., Cohen et al., (2021) Cell Reports Medicine 2:1000354.
  • the immunostimulatory bacteria can encode an anti-viral therapeutic or anti- bacterial therapeutic.
  • Such therapeutics include inhibitors of viral genes and proteins, such as proteins required for replication and/or packaging, or the immunostimulatory bacteria can encode a therapeutic that prevents binding or interaction of a virus with a receptor or receptors that facilitate or provide for viral entry into a target cell.
  • expression of the encoded therapeutic protein, such as the antigen or antigenic protein can be under the control of a prokaryotic promoter.
  • the protein can be expressed under control of a eukaryotic promoter.
  • the choice of promoter depends upon whether it is to be expressed in the bacterium, such as before administration as described herein for delivery of mRNA that is translated in the host, or the protein is to be expressed in the host cells, such as immune cells, after delivery.
  • the immunostimulatory bacteria provided herein include genome modifications, such as deletions, disruptions, and other alterations that result in inactive encoded product, such as changing the orientation of all or part of the gene, so that functional gene products are not expressed.
  • the immunostimulatory bacteria provided are those that are modified so that the resulting bacteria are msbB- /purI-.
  • the bacteria are msbB- and purI-, whereby the full length of at least the coding portion of the msbB and/or purI genes are/is deleted.
  • the genome of the bacteria also can be modified so that the bacteria lack flagella. This is effected in bacteria that normally express flagella.
  • the fliC and fljB genes in Salmonella, or equivalent genes in other species to fliC and fljB can be deleted or otherwise modified so that functional gene product is not expressed.
  • the bacteria also can be modified so that they are adenosine auxotrophs, and/or are msbB-/pagP-.
  • immunostimulatory bacteria and pharmaceutical compositions containing them where the bacteria do not express L-asparaginase II, whereby the bacteria are ansB-. Elimination of the encoded asparaginase activity improves or retains T-cell viability/activity.
  • Therapeutic bacteria such as inactivated or attenuated bacteria that are used as vaccines, can be improved by modifying the bacterial genome to eliminate asparaginase activity.
  • Exemplary of such vaccines is the BCG (Bacillus Calmette–Guérin) vaccine and related vaccines, which are used to immunize against tuberculosis.
  • the BCG vaccine is known to have variable effectiveness; eliminating the asparaginase can improve the effectiveness of such vaccine, because the endogenous bacterial asparaginase inhibits or reduces T-cell activity.
  • immunostimulatory bacteria that contain a plasmid encoding a therapeutic product, or combinations of therapeutic products, under control of a eukaryotic promoter.
  • the genomes of the bacteria can contain modifications, such as one, two, or more modifications, selected from among: a) deletion or disruption of all or of a sufficient portion of a gene or genes, whereby the bacterium has been modified to generate penta-acylated lipopolysaccharide (LPS), wherein: the genome of the immunostimulatory bacterium is modified by deletion or disruption of all or of a sufficient portion of a gene or genes, whereby the bacterium has been modified to generate penta-acylated lipopolysaccharide; and hexa-acylated lipopolysaccharide is substantially reduced, by at least 10-fold, compared to the wild-type bacterium, or is absent; b) deletion or disruption of all or of a sufficient portion of a gene or genes, whereby the bacterium has attenuated recognition by Toll-like Receptors (TLR) 2, TLR4, and/or TLR5; c) deletion or disruption of all or of a sufficient portion of a gene
  • the immunostimulatory bacteria contain modifications, including deletions, insertions, and replacements, of a), d), and f), or modifications c) and d), or modifications a), c), d), e), and f), or modifications a), c), d), e), f), and i), or modifications a), d), f), and i), or modifications c), d), and i), or modifications f) and i), or modifications a)-i), or modifications a), b), d), and f), or modifications a), b), c), and d), and other combinations of modifications a)-i).
  • Deletion or disruption includes any modification of a gene whereby active gene product is not expressed.
  • immunostimulatory bacteria whose genomes are modified by deletion or disruption, including by insertion, of all or of a sufficient portion of a gene or genes, whereby the bacteria have attenuated recognition by TLR2, TLR4, and TLR5.
  • Such bacteria have low toxicity and accumulate in/colonize the tumor microenvironment and tumor-resident myeloid cells, such as macrophages.
  • These bacteria contain plasmids that encode therapeutic products, particularly combinations of complementary products, such as a cytokine and a modified STING polypeptide, including gain-of-function/constitutively active STING proteins, STING chimeras, and chimeric STING proteins that include gain-of-function (GOF) mutations.
  • the cytokines include, for example, IL-15/IL-15R alpha chain complex (also referred to herein as IL-15R ⁇ /IL-15sc, or IL-15/IL-15R ⁇ , or IL-15 complex), or IL-15, or IL-12, or other anti-tumor immune stimulating cytokines or chemokines.
  • the bacteria can additionally encode other products, such as anti-tumor antibodies. Combinations of products are described and provided herein.
  • the combinations of products that stimulate or promote an anti-tumor response and/or deliver a therapeutic product are described throughout the disclosure herein, and they are delivered by the immunostimulatory bacteria whose genomes are modified so that the bacteria have low toxicity and effectively colonize tumors, the tumor microenvironment, and/or tumor-resident immune cells, such as macrophages.
  • Exemplary of such bacteria are those of species, such as Salmonella, Listeria, and E. coli, that are modified so that they do not have flagella, and are modified so that they contain lipopolysaccharide (LPS) with penta-acylated lipid A, such as by rendering the bacteria msbB-/pagP-.
  • LPS lipopolysaccharide
  • the bacteria additionally can be modified by elimination of curli fimbriae and/or have reduced or eliminated cellulose production and biofilm formation, such as by modifying the bacteria so that they are csgD-. It is shown herein that bacteria with these modifications have no maximum tolerated dose (MTD), and exhibit high tumor colonization.
  • the immunostimulatory bacteria also can comprise or further comprise deletion of or disruption of the genes encoding the flagella, whereby the bacterium is flagellin- (such as fliC-/fljB-) and does not produce flagella, wherein the wild-type bacterium has flagella.
  • the immunostimulatory bacteria can be auxotrophic for purines, such as auxotrophic for adenosine; or auxotrophic for adenosine, adenine, and/or ATP.
  • the immunostimulatory bacteria also can be purI-.
  • the immunostimulatory bacteria also can be pagP-.
  • the immunostimulatory bacteria also can be aspartate-semialdehyde dehydrogenase- (asd-), such as where the bacterium is asd- by virtue of disruption or deletion of all or a portion of the endogenous gene encoding aspartate-semialdehyde dehydrogenase (asd), whereby endogenous asd is not expressed.
  • the bacteria can encode aspartate-semialdehyde dehydrogenase (asd) on the plasmid under control of a bacterial promoter.
  • the immunostimulatory bacteria also can be msbB-, or can be pagP-/msbB-.
  • the immunostimulatory bacteria can be asd-, purI-, msbB-, flagellin- (fliC-/fljB-), and pagP-, or they can be asd-, csgD-, purI-, msbB-, flagellin- (such as fliC-/fljB-), and pagP-.
  • the immunostimulatory bacteria are ansB-, asd-, csgD-, purI-, msbB-, flagellin- (such as fliC-/fljB-), and pagP-.
  • immunostimulatory bacteria that contain a plasmid encoding a therapeutic product under control of a eukaryotic promoter, or that encode a plurality of products under control of a plurality of eukaryotic promoters, or under control of a single promoter.
  • the genome of the immunostimulatory bacteria is modified by deletion of a sufficient portion of a gene or genes, or by the disruption of a gene or genes, whereby the bacterium is one or more of ansB-, asd-, csgD-, purI-, msbB-, flagellin- (such as fliC-/fljB-), and pagP-.
  • the immunostimulatory bacteria provided herein also include those that have the genes lppA (lpp1) and/or lppB (lpp2), which encode major outer membrane lipoproteins Lpp1 (LppA) and Lpp2 (LppB), respectively, deleted or disrupted, to eliminate or substantially reduce expression of the encoded lipoprotein(s).
  • the immunostimulatory bacteria are lppA- and lppB-.
  • immunostimulatory bacteria that contain a plasmid encoding an anti-cancer therapeutic, or an anti-pathogen therapeutic, under control of eukaryotic regulatory sequences, and that are lppA- and lppB-.
  • the immunostimulatory bacteria can be ansB-, asd-, csgD-, purI-, msbB-, flagellin- (such as fliC-/fljB-), pagP-, lppA-, and/or lppB-.
  • the therapeutic product is an anti-cancer therapeutic or a therapeutic used in cancer therapy.
  • the encoded product(s) can be operably linked to nucleic acid encoding a secretion signal, whereby, when expressed, the therapeutic product is secreted, such as secreted from a tumor-resident immune cell.
  • a secretion signal such as secreted from a tumor-resident immune cell.
  • Any of the immunostimulatory bacteria also can have one or more genes or operons, involved in Salmonella pathogenicity island 1 (SPI-1) invasion, deleted or inactivated, whereby the immunostimulatory bacteria do not invade or infect epithelial cells.
  • SPI-1 Salmonella pathogenicity island 1
  • the one or more genes/operons are selected from among avrA, hilA, hilD, invA, invB, invC, invE, invF, invG, invH, invI, invJ, iacP, iagB, spaO, spaQ, spaR, spaS, orgA, orgB, orgC, prgH, prgI, prgJ, prgK, sicA, sicP, sipA, sipB, sipC, sipD, sirC, sopB, sopD, sopE, sopE2, sprB, and sptP.
  • the plasmid in the immunostimulatory bacteria can be present in low copy number or medium copy number.
  • the plasmid can contain a medium-to-low copy number origin of replication, such as a low copy number origin of replication. In some embodiments, the plasmid is present in higher copy number.
  • medium copy number is less than 150 or less than about 150, and more than 20 or about 20, or is between 20 or 25 and 150; and low copy number is less than 25, or less than 20, or less than about 25, or less than about 20 copies.
  • low to medium copy number is less than about 150 copies, or less than 150 copies; low copy number is less than about 25 copies, or less than 25 copies.
  • Encoded therapeutic products include nucleic acids and proteins.
  • the plasmid can encode two or more therapeutic products.
  • Exemplary products include, but are not limited to, a cytokine, a protein that constitutively induces a type I IFN, and a co- stimulatory receptor or ligand. Further exemplary combinations are described below.
  • the co-stimulatory molecule lacks all or a portion of the cytoplasmic domain for expression on an antigen-presenting cell (APC), whereby the truncated molecule is capable of constitutive immuno-stimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the antigen-presenting cell (APC), due to the deleted cytoplasmic domain or deleted portion thereof.
  • APC antigen-presenting cell
  • the encoded therapeutic products can be operatively linked to nucleic acid encoding regulatory sequences recognized by a eukaryotic host, such as, for example, secretion signals, to effect secretion from a cell comprising the bacterium or plasmid.
  • a eukaryotic host such as, for example, secretion signals
  • expression of each product can be under control of a separate promoter.
  • two or more products can be expressed under control of a single promoter, and each product is separated by nucleic acid encoding, for example, an internal ribosomal entry site (IRES), or a 2A peptide, to effect separate expression of each encoded therapeutic product.
  • IRS internal ribosomal entry site
  • Exemplary 2A peptides are T2A, F2A, E2A, or P2A, which can flank nucleic acids encoding the therapeutic products, to effect separate expression of the therapeutic products expressed under control of a single promoter.
  • the therapeutic products are expressed under control of a eukaryotic promoter, such as an RNA polymerase (RNAP) II promoter, or an RNA polymerase III promoter.
  • RNAP RNA polymerase
  • RNA polymerase II promoter that is a viral promoter, or a mammalian RNA polymerase II promoter, such as, but not limited to, as a cytomegalovirus (CMV) promoter, an SV40 promoter, an Epstein-Barr virus (EBV) promoter, a herpes virus promoter, an adenovirus promoter, an elongation factor-1 (EF-1) alpha promoter, a UBC promoter, a PGK promoter, a CAGG promoter, an adenovirus 2 or 5 late promoter, an EIF4A1 promoter, a CAG promoter, or a CD68 promoter.
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • EF-1 elongation factor-1
  • the plasmids further can include other eukaryotic regulatory sequences, such as terminators and/or promoters, selected from among SV40, human growth hormone (hGH), bovine growth hormone (bGH), MND (a synthetic promoter that contains the U3 region of a modified MoMuLV LTR with myeloproliferative sarcoma virus enhancer), chicken beta-globulin, and rbGlob (rabbit globulin) genes, to control expression of the therapeutic product(s).
  • Other regulatory sequences include a polyA tail, a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE), and a Hepatitis B virus Posttranscriptional Regulatory Element (HPRE).
  • WPRE Woodchuck Hepatitis Virus
  • HPRE Hepatitis B virus Posttranscriptional Regulatory Element
  • the encoded therapeutic products include any described herein and in the original claims, such as nucleic acid encoding a protein that is part of a cytosolic DNA/RNA sensor pathway that leads to expression of type I interferon (IFN), or a variant thereof.
  • Type I IFNs include interferon- ⁇ and interferon- ⁇ .
  • Variants include those that, when expressed in a subject, lead to constitutive expression of type I IFN. These include a gain-of-function (GOF) variant that does not require cytosolic nucleic acids, nucleotides, dinucleotides, or cyclic dinucleotides (CDNs) to result in expression of type I IFN.
  • GAF gain-of-function
  • Exemplary of these proteins is a protein selected from among STING, RIG-I, MDA-5, IRF-3, IRF-5, IRF-7, IRF-8, TRIM56, RIP1, Sec5, TRAF3, TRAF2, TRAF6, STAT1, LGP2, DDX3, DHX9, DDX1, DDX9, DDX21, DHX15, DHX33, DHX36, DDX60, and SNRNP200, and variants thereof that have increased activity, or that result in constitutive expression of type I interferon (IFN).
  • IFN type I interferon
  • Variants include a variant of STING, RIG-I, IRF-3, or MDA5, in which one or more serine (S) or threonine (T) residue(s) that is/are phosphorylated as a consequence of viral infection, is/are replaced with an aspartic acid (D) residue, whereby the resulting variant is a phosphomimetic that constitutively induces type I IFN, and any known to those of skill in the art and/or described herein.
  • Variants include, for example, those wherein the mutations are selected as follows: a) in STING, with reference to SEQ ID NOs: 305-309, one or more selected from among: S102P, V147L, V147M, N154S, V155M, G166E, C206Y, G207E, S102P/F279L, F279L, R281Q, R284G, R284S, R284M, R284K, R284T, R197A, D205A, R310A, R293A, T294A, E296A, R197A/D205A, S272A/Q273A, R310A/E316A, E316A, E316N, E316Q, S272A, R293A/T294A/E296A, D231A, R232A, K236A, Q273A, S358A/E360A/S366A, D231A/R232A/K236A/
  • the immunostimulatory bacteria also can encode an immunostimulatory protein that confers or contributes to an anti-tumor immune response in the tumor microenvironment.
  • immunostimulatory protein that confers or contributes to an anti-tumor immune response in the tumor microenvironment.
  • immunostimulatory proteins include, but are not limited to, a cytokine, a chemokine, or a co-stimulatory molecule.
  • IL-2 IL-2, IL-7, IL-12p70 (IL-12p40 + IL-12p35), IL-15, IL-36 gamma, IL-2 that has attenuated binding to IL-2Ra, IL-15/IL-15R alpha chain complex, IL-18, IL-21, IL-23, IL-2 that is modified so that it does not bind to IL-2Ra, CXCL9, CXCL10, CXCL11, interferon- ⁇ , interferon- ⁇ , interferon- ⁇ , CCL3, CCL4, CCL5, proteins that are involved in or that effect or potentiate the recruitment and/or persistence of T cells, CD40, CD40 ligand (CD40L), CD28, OX40, OX40 ligand (OX40L), 4-1BB, 4- 1BB ligand (4-1BBL), members of the B7-CD28 family, CD47 antagonists, an anti- IL-6 antibody or an IL-6
  • the co- stimulatory molecule selected from among CD40, CD40 ligand, CD28, OX40, OX40 ligand, 4-1BB, and 4-1BB ligand, can be truncated, such that the molecule lacks a cytoplasmic domain, or a portion thereof, for expression on an antigen-presenting cell (APC); and the truncated gene product is capable of constitutive immunostimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the antigen-presenting cell (APC), due to the deleted, or partially deleted, or truncated cytoplasmic domain, which eliminates the immunosuppressive reverse signaling.
  • APC antigen-presenting cell
  • TGF-beta polypeptide antagonists such as an anti-TGF-beta antibody or a fragment thereof, an anti-TGF- beta receptor antibody or a fragment thereof, a soluble TGF-beta antagonist polypeptide, or a TGF-beta binding decoy receptor.
  • the plasmids can encode a therapeutic antibody or antigen-binding fragment thereof, such as, for example, a Fab, Fab’, F(ab’)2, single-chain Fv (scFv), Fv, dsFv, nanobody, diabody fragment, or a single-chain antibody.
  • Examples include, but are not limited to, an antagonist of PD-1, PD-L1, CTLA-4, VEGF, VEGFR2, or IL-6.
  • the plasmids can encode complementary products whose expression results in enhanced anti-tumor or other activity.
  • a modified such as a constitutively active and/or chimeric STING protein described herein
  • a cytokine such as IL-15/IL-15R alpha chain complex (IL-15R ⁇ -IL-15sc)
  • the immunostimulatory bacteria provided herein can be used as a vaccine by encoding an antigen against which an immune response, or immunization, or immunoprotection is desired.
  • the immunostimulatory bacteria herein can be used to deliver RNA, such as mRNA or other forms, for use as a vaccine or for delivery of a therapeutic.
  • the bacteria contain a plasmid that encodes a product of interest, such as a therapeutic product, such as an antigen from a pathogen, under control of a bacterial or other prokaryotic promoter recognized by the bacterium.
  • the encoding nucleic acid cassette includes a regulatory sequence or other sequence that blocks or inhibits or prevents translation by bacterial ribosomes, but that permits, or provides for, or enhances translation by eukaryotic, such as those present in human cells, ribosomes.
  • the bacteria are modified so that they cannot grow or replicate in eukaryotes, such as by rendering the bacteria asd- which require DAP for growth in vitro, or ThyA-, which requires thymidine monophosphate precursors, for growth, but can be cultured in vitro so that they produce the encoded RNA.
  • a skilled person can inactivate the gene or product by modifying the endogenous gene, such as by deletions, insertions, replacements, transpositions, or any such modification so that active enzyme is not produced. See, SEQ ID NO: 464 for an exemplary ThyA gene from Salmonella, and SEQ ID NO:465 for the encoded protein.
  • RNA encoding protein and/or antigen for immunization
  • the encoding nucleic acid includes translation signals/sequences so that bacteria cannot translate the this RNA.
  • the resulting bacteria deliver the encoded RNA into the host phagocytic cells, where it is translated by host cell ribosomes.
  • Immunostimulatory bacteria that are ThyA- have genome modifications, such insertions, deletions, replacements, or other changes, that result in inactive or eliminate production of thymidylate synthase, which catalyzes the reductive methylation of dUMP to dTMP, a DNA biosynthesis precursor (precursor to dTTP).
  • ⁇ ThyA Auxotrophies for other nutrients and essential products can be introduced in place of or in addition to the asd inactivation/deletion.
  • Other deletions or inactivation of genes or gene products required for growth, such as genes that produce nutrients, can be used in place of or in addition to the asd, and include for example thyA (see, e.g., Loessner et al. (2006) FEBS Lett 265:81-88).
  • Elimination of expression or production or other attenuating mutations of the bacterial genome for production of such products results in release of encoded macromolecules upon bacterial cell death in vivo after administration.
  • Asd is an essential enzyme for bacterial cell wall synthesis
  • ThyA is an enzyme needed for DNA synthesis.
  • ⁇ ThyA are advantageous for in vivo delivery of plasmids to host cells, since the bacteria will not prematurely release their contents. Since the bacteria provided here infect or accumulate in myeloid cells, such as phagocytic cells, such as macrophate, dendritic cells, monocytes and neutrophils, which consume bacteria, the intact ⁇ ThyA bacteria, release the plasmid encoding the therapeutic product inside the targeted cells.
  • myeloid cells such as phagocytic cells, such as macrophate, dendritic cells, monocytes and neutrophils
  • the bacteria are genome-modified so that they are attenuated, such as the bacteria herein, where the response by toll-like receptors (TLR) 2, 4, and 5 is reduced, compared to bacteria without such genome modifications, and optionally, encode rck Rck (resistance to complement killing) to reduce inactivation by complement, and include modifications, as needed, so that they infect primarily or only phagocytic cells, such as tissue-resident macrophages. It is shown herein that genome modifications, such the combination of modifications that reduce responses by TLRs 2,4,5, are necessary for the production of type I IFN by human antigen-presenting cells.
  • bacteria that contain genome modifications, whereby the response by toll-like receptors (TLRs) 2, 4, and 5 is reduced, compared to the bacteria without the genome modifications.
  • TLRs toll-like receptors
  • Such modifications include those that result in penta-acylated LPS and elimination of flagella, such as the pagP-/msbB- bacteria that lack flagella, and also those that are deficient or do not produce or express asparaginase II, such as those that are ⁇ asn.
  • the bacteria also can comprise further genomic modifications such as one or more modifications whereby they are auxotrophic for a required nutrient or for a factor, so that they are unable to replicate in a eukaryotic host, but can replicate in vitro when supplied with the nutrient or factor, such auxotrophic for thymidine ( ⁇ ThyA), such as by genome modifications that render them unable to produce or express thymidylate synthase ( ⁇ ThyA), or Asd.
  • ⁇ ThyA auxotrophic for thymidine
  • ⁇ ThyA thymidylate synthase
  • the bacteria that are provided herein that combine some or all of these traits are used to express therapeutic products, including anti-cancer products, and antigens, depending upon their intended use.
  • the bacteria which accumulate in tumor-resident myeloid cells, encode anti-cancer therapeutics, such as products that result in stimulation of an immune response, and/or that result in inhibiting immunosuppression, or that encode a product that treats the tumor, and those that encode a combination of products that can act synergistically to treat cancer.
  • anti-cancer therapeutics such as products that result in stimulation of an immune response, and/or that result in inhibiting immunosuppression, or that encode a product that treats the tumor, and those that encode a combination of products that can act synergistically to treat cancer.
  • the bacteria provided herein that accumulate in or infect phagocytic cells also can be used for subjects that do not have cancer, such as, as vaccines by delivering or encoding an antigen, or delivering RNA.
  • the bacteria comprise a plasmid containing nucleic acid encoding a product, or comprise RNA encoding the product, where the product encoded by the nucleic acid or RNA is an antigenic sequence or sequences from a pathogenic virus, bacterium, parasite, or is a tumor antigen, whereby, upon expression of the encoded antigen in the host, the host develops an immune-protective response or immunizing response against the pathogenic virus, bacterium, parasite, or tumor antigen, or the encoded product is a therapeutic product; expression of the antigenic sequence(s) is/are under control of a prokaryotic promoter so that RNA encoding the antigen(s) is produced in the bacteria; nucleic acid encoding the antigen comprises regulatory sequences that inhibit or prevent translation of encoded RNA by bacterial ribosomes, but that does not inhibit or prevent translation of the encoded RNA by eukaryotic host ribosomes, whereby translation is de-coupled from transcription in the bacteria
  • the bacteria which are cultured in vitro to produce the RNA, upon administration, infect the phagocytes and deliver their contents, but they are not viable and/or do not replicate, thereby providing the RNA, such as mRNA, to the host cells, which translate the RNA to produce the encoded product, such as an immunogenic protein or antigen.
  • the RNA generally is mRNA, and also can be other forms of RNA, such as RNAi, or eRNA (circular RNA), and other therapeutic forms.
  • the immunostimulatory bacteria that are used for this purpose can include the plasmids, which encode the RNA, in high or higher (generally 150 or greater) copy numbers, to increase the amount of RNA delivered.
  • the mRNA can encode pathogen proteins, pathogen antigens, tumor-antigens, therapeutic products for treatment of tumors or infections, and combinations thereof.
  • the mRNA can be synthetic, such as those designed for immunization (see, e.g., US patent publication 20190351040, and others that describe mRNA for immunization or treatment).
  • the resulting bacteria are vaccines for therapy or immunization.
  • the payloads can include products that are adjuvants, that are immunostimulatory protein, that induce type I interferon (IFN) to activate T-cells in concert with the immunizing antigen/protein.
  • IFN type I interferon
  • the immunostimulatory bacteria provided herein contain a plasmid that encodes two or more therapeutic proteins selected from among: a) an immunostimulatory protein that confers or contributes to an anti-tumor immune response in the tumor microenvironment; b) one or more of a protein that is part of a cytosolic DNA/RNA sensor pathway that leads to expression of type I interferon (IFN), or a variant thereof that has increased activity to increase expression of type I IFN, or a variant thereof that results in constitutive expression of a type I IFN; and c) an anti-cancer antibody or antigen-binding portion thereof.
  • IFN type I interferon
  • the immunostimulatory protein can be a co-stimulatory molecule that is one that lacks a cytoplasmic domain or a sufficient portion thereof, for expression on an antigen- presenting cell (APC), whereby the truncated co-stimulatory molecule is capable of constitutive immunostimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the antigen presenting cell (APC).
  • APC antigen-presenting cell
  • the immunostimulatory bacteria encode at least two therapeutic products, selected from among a cytokine, a protein that constitutively induces a type I IFN, a co-stimulatory molecule, and an anti-cancer antibody or antigen-binding portion thereof, which can be under control of a single promoter.
  • expression of the nucleic acid encoding at least two or all of the products is under control of a single promoter, and the nucleic acid encoding each product is separated by nucleic acid encoding 2A polypeptides, whereby, upon translation, each product is separately expressed.
  • each product can be operatively linked to nucleic acid encoding a sequence that directs secretion of the expressed product from a cell.
  • immunostimulatory bacteria that encode two or more therapeutic products, wherein at least one product is selected from a), and at least one is selected from b), and a) is IL-2, IL-7, IL-12p70 (IL-12p40 + IL-12p35), IL-15, IL-23, IL-36 gamma, IL-2 that has attenuated binding to IL-2Ra, IL-15/IL-15R alpha chain complex (also referred to herein as IL-15/IL-15R ⁇ , IL-15 complex, or other variations), IL-18, IL-2 that is modified so that it does not bind to IL-2Ra, CXCL9, CXCL10, CXCL11, interferon- ⁇ , interferon- ⁇ , CCL3, CCL4, CCL5, proteins that are involved in or that effect or potentiate
  • TGF-beta inhibitory antibody a TGF-beta binding decoy receptor, an anti- IL6 antibody, or an IL-6 binding decoy receptor.
  • exemplary of combinations of encoded therapeutic products are any of the following combinations of therapeutic products: IL-2 and IL-12p70; IL-2 and IL-21; IL-2, IL-12p70, and a STING GOF variant; IL-2, IL-21, and a STING GOF variant; IL-2, IL-12p70, a STING GOF variant, and 4-1BBL (including 4-1BBL ⁇ cyt), where ⁇ cyt is a deleted cytoplasmic domain; IL-2, IL-21, a STING GOF variant, and 4- 1BBL (including 4-1BBL ⁇ cyt); IL-15/IL-15R ⁇ , and a STING GOF variant; IL-15/IL- 15R ⁇ , a STING GOF variant, and 4-1BBL
  • IL-15 and a STING gain-of-function variant include STING chimeras with a gain-of-function mutation or mutations, as provided herein, or IL-15R ⁇ -IL-15sc and a STING gain-of-function variant, including STING chimeras with a gain-of-function mutation or mutations.
  • BiTe® bi-specific T-cell engager
  • a BiTe® and a STING protein such as a modified GOF STING protein or a STING chimera, as described herein
  • a BiTe® and IL-15 include, for example, DLL3, EGFR, Her2, CEA, Mesothelin, PSMA, EpCAM, CD74, Folate Receptor, Nectin4, EphA2, CA-IX, B7H3, Siglec-15, Muc1, Lewis Y antigen, and other such tumor antigens
  • the BiTe® targets include, for example, DLL3, EGFR, Her2, CEA, Mesothelin, PSMA, EpCAM, CD74, Folate Receptor, Nectin4, EphA2, CA-IX, B7H3, Siglec-15, Muc1, Lewis Y antigen, and other such tumor antigens
  • compositions containing a tumor antigen(s) and a STING gain-of-function variant or STING chimera containing a tumor antigen(s) and a STING gain-of-function variant or STING chimera; a therapeutic composition of a tumor antigen(s) and IL-15; a therapeutic composition of a tumor antigen(s) and IL- 15R ⁇ -IL-15sc; a therapeutic composition of a tumor antigen(s), IL-15, and a STING gain-of-function variant or STING chimera; and a therapeutic composition of a tumor antigen(s), IL-15R ⁇ -IL-15sc, and a STING gain-of-function variant or STING chimera.
  • These products can be encoded in the immunostimulatory bacteria.
  • the tumor antigens can be any listed or described herein (for example, in Example 35), or known in the art. Combinations of products also include combinations of antigens and immune stimulating proteins.
  • the antigens can be tumor antigens, or they can be immunizing antigens, such as pathogenic antigens, where the pathogens include, for example, bacteria, protozoans, viruses, and prions, and other prion-like particles that cause diseases and disorders.
  • the antigens include any described or listed herein, or known in the art.
  • the combinations include, for example, combinations of one or more antigens and IFN ⁇ 2; one or more antigens and IFN- ⁇ ; one or more antigens, IFN ⁇ 2, and IFN- ⁇ ; one or more antigens and an IRF3 GOF variant with the mutation S396D; and one or more antigens, IFN ⁇ 2, and an IRF3 GOF variant with the mutation S396D.
  • IFN ⁇ 2 and an IRF3 GOF variant with the mutation S396D include, but are not limited to, the combination of IFN ⁇ 2 and an IRF3 GOF variant with the mutation S396D; IFN ⁇ 2 and IFN- ⁇ ; FLT-3L (FMS-like tyrosine kinase 3 ligand; see, e.g., SEQ ID NO:436); sialidase (see, e.g., SEQ ID NO:435); the IL-12 p35 subunit of IL-12p70 only; Azurin; a membrane anchored/tethered cytokine or molecule, such as, for example, IL-2, IL-12, IL-12p35, IL-21, IL-15, IL-15R ⁇ -IL-15sc, or FLT-3L; or a TLR8 agonist, such as, for example, where the TL38 agonist is polyU or polyU/G, a microRNA, or is miR-21.
  • modified non-human Stimulator of Interferon Genes (STING) proteins, and STING protein chimeras as well as delivery vehicles, including any described herein, pharmaceutical compositions, cells encoding or containing these STING proteins, and uses thereof, and methods of treatment of cancers.
  • the immunostimulatory bacteria provided herein encode the modified non-human STING proteins, non-human STING proteins, and STING chimeras, as described herein.
  • STING proteins that are encoded by the immunostimulatory bacteria are provided herein and described throughout. Provided herein are: 1.
  • Non-human STING proteins where the non-human STING protein is one that has lower NF- ⁇ B activation than the human STING protein, and, optionally, higher type I interferon activation activity compared to the wild-type (WT) human STING protein.
  • WT wild-type
  • These non-human STING proteins are modified to include a mutation or mutations so that they have increased activity, or act constitutively, in the absence of cytosolic nucleic acid signaling.
  • the mutations are typically amino acid mutations that occur in interferonopathies in humans, such as those described above for human STING.
  • the corresponding mutations are introduced into the non-human species STING proteins, where corresponding amino acid residues are identified by alignment.
  • the TRAF6 binding site in the C-terminal tail (CTT) of the STING protein is deleted, reducing NF- ⁇ B signaling activity.
  • modified STING proteins particularly human STING proteins, that are chimeras, in which the CTT (C-terminal tail) region in the STING protein from one species, such as human, is replaced with the CTT from a STING protein of another species that has lower NF- ⁇ B signaling activity and/or higher type I IFN signaling activity than human STING.
  • the TRAF6 binding site is optionally deleted in these chimeras.
  • the modified STING proteins also include the mutations as set forth throughout the disclosure herein.
  • delivery vehicles such as immunostimulatory bacteria, and any provided herein or known to those of skill in the art, including, for example, exosomes, nanoparticles, minicells, cells, liposomes, lysosomes, oncolytic viruses, and other viral vectors, that encode the modified STING proteins of any of 1-3.
  • delivery vehicles such as immunostimulatory bacteria, any provided herein or known to those of skill in the art, including, for example, exosomes, nanoparticles, minicells, cells, liposomes, lysosomes, oncolytic viruses, and other viral vectors, that encode unmodified STING from a non-human species whose STING protein has reduced NF- ⁇ B signaling activity compared to that of human STING, and optionally, increased type I interferon stimulating/signaling activity compared to that of human STING.
  • cells non-zygotes, if human
  • cells used for cell therapy such as T-cells and stem cells, and cells used to produce the STING proteins as described herein.
  • compositions that contain the STING proteins, or the delivery vehicles, or the cells, or combinations thereof.
  • Uses and methods of treatment of cancer and vaccination against pathogens or cancer by administering any the immunostimulatory bacteria as described herein are provided.
  • Assays and methods to assess NF- ⁇ B activity (signaling activity), and type I interferon stimulating activity or interferon- ⁇ stimulating activity of STING are described herein, and also, are known to those of skill in the art. Methods include those described, for example, in de Oliveira Mann et al.
  • the non-human STING proteins can be, but are not limited to, STING proteins from the following species: Colombian devil (Sarcophilus harrisii; SEQ ID NO:349), marmoset (Callithrix jacchus; SEQ ID NO:359), cattle (Bos taurus; SEQ ID NO:360), cat (Felis catus; SEQ ID NO:356), ostrich (Struthio camelus australis; SEQ ID NO:361), crested ibis (Nipponia nippon; SEQ ID NO:362), coelacanth (Latimeria chalumnae; SEQ ID NOs:363-364), boar (Sus scrofa; SEQ ID NO:365), bat (Rousettus aegyptiacus; SEQ ID NO:366), manatee (Trichechus manatus latirostris; SEQ ID NO:367), ghost shark (Callorhinchus milii; S
  • the immunostimulatory bacteria provided herein, by virtue of the ability to infect myeloid cells, such as tumor-resident and tissue-resident macrophages, and the ability to retain viability for at least a limited time, and/or to deliver plasmids that encode therapeutic products that result in expression of type I IFN and/or other immune-stimulating products, such as gain-of-function (GOF) variants that do not require cytosolic nucleic acids, nucleotides, dinucleotides, or cyclic dinucleotides (CDNs) to result in expression of type I IFN, can convert macrophages that have the M2 phenotype into M1 or M1-like macrophages, with immunosuppressive properties reduced or eliminated
  • immunostimulatory bacteria that contain a plasmid encoding a therapeutic product, where infection of a macrophage, including human macrophages, by the bacterium, converts an M2 macrophage to an M1 phenotype or M1-like phenotype macrophage.
  • immunostimulatory bacteria that contain a plasmid encoding a therapeutic product whose expression in a macrophage results in the conversion of, or converts, M2 macrophages, such as human M2 macrophages, to an M1 or M1-like phenotype.
  • the immunostimulatory bacteria with such properties include any of the bacteria provided herein that contain genome modifications that result in infection of tumor-resident (in subjects with cancer), and tissue-resident myeloid cells.
  • immunostimulatory bacteria convert immunosuppressive phagocytic macrophages to immunostimulatory, phagocytic macrophages that are capable of in situ antigen cross-presentation to CD8+ T-cells, and of migration to lymph nodes to prime CD4+ and CD8+ T-cells.
  • immunostimulatory bacteria that encode therapeutic products in macrophages, that facilitate or result in the conversion of, or that convert, M2 macrophages to an M1 or M1-like phenotype, which has a profile of some or all characteristics of M1 macrophage.
  • Exemplary of the therapeutic products are those that are part of a cytosolic DNA/RNA sensor pathway that leads to expression of type I interferon (IFN), particularly constitutive expression.
  • IFN type I interferon
  • the bacteria include any that can be modified as described herein, including the species listed herein, such as Salmonella species and strains.
  • immunostimulatory bacteria that contain nucleic acid operatively linked to a prokaryotic promoter, where: the nucleic acid comprises RNA that lacks sequences necessary for translation by a prokaryotic cell, whereby the RNA is produced in the bacterium, but is not translated into protein.
  • the RNA lacks a Shine-Dalgarno sequence, and comprises an Internal Ribosome Entry Site (IRES) and/or a translational read-through 2A peptide.
  • IRES sequence prevents translation by prokaryotic ribosomes, but provides for translation by eukaryotic ribosomes.
  • the bacteria include immunostimulatory bacteria in which the 2A peptide is one or more of T2A, P2A, E2A, or F2A, to produce discrete products from polycistronic constructs. Also provide are immunostimulatory bacteria as described herein that can be a delivery vehicle for delivering RNA to eukaryotic cells, such as myeloid cells.
  • These bacteria include nucleic acid operatively linked to a prokaryotic promoter, where: the nucleic acid and prokaryotic promoter generally are encoded on a plasmid, but in some embodiments, are encoded in the bacterial genome; the nucleic acid comprises RNA that lacks sequences necessary for translation by the bacterial ribosomes, whereby the RNA is produced in the bacterium, and where: the RNA lacks a Shine- Dalgarno sequence, and comprises an Internal Ribosome Entry Sequence (IRES), or a translational read-through 2A peptide.
  • IRS Internal Ribosome Entry Sequence
  • the prokaryotic promoter when operatively linked to nucleic acid encoding a therapeutic protein (or non-bacterial protein), can be a bacterial promoter or a phage promoter, such as a bacteriophage promoter.
  • the RNA polymerase that recognizes the phage promoter can be encoded in the bacterial genome, or on a plasmid for expression in the bacteria.
  • prokaryotic promoters include any known to those of skill in the art, including, but not limited to, those that comprise all or a sufficient portion of (sufficient to initiate transcription of an operatively linked nucleic acid) the promoters whose sequences are set forth in any of SEQ ID NOs: 393-396, respectively: attatgtcttgacatgtagtgagtgggctggtataatgcagcaag (SEQ ID NO:393), ttatgcttgacgctgcgtaaggttttgttataatacaccaag (SEQ ID NO:394), or attatgtcttgacatgtagtgagtgggctggtaaatgcagcaag (SEQ ID NO:395), or These immunostimulatory bacteria comprise genomic modifications, as described herein, whereby the bacteria infect tissue-resident myeloid cells, and/or tumor- resident myeloid cells, or, in subjects that do not
  • the bacteria infect the cells and deliver the RNA, which is translated in the eukaryotic host cell.
  • Exemplary of such bacteria are those that are modified to lack flagella, such as by deletion or disruption of the genes involved in producing flagella.
  • the bacteria are species and strains that, without the genomic modifications, have flagella.
  • immunostimulatory bacteria in which an encoded 35 therapeutic product, such as a protein, is linked to a moiety that confers an improved pharmacological property, such as a pharmacokinetic or pharmacodynamic property, such as increased serum half-life.
  • an encoded therapeutic product comprises an Fc domain, or a half-life extending moiety, such as human serum albumin, or a portion thereof.
  • Half-life extension modalities or methods include, for example, PEGylation, modification of glycosylation, sialylation, PASylation (modification with polymers of PAS amino acids that are about 100-200 residues in length), ELPylation (see, e.g., Floss et al.
  • HAPylation modification with a glycine homopolymer
  • fusion to human serum albumin fusion to GLK, fusion to CTP, GLP fusion, fusion to the constant fragment (Fc) domain of a human immunoglobulin (IgG)
  • IgG human immunoglobulin
  • transferrin fusion to non-structured polypeptides, such as XTEN (also referred to as rPEG, which is a genetic fusion of non-exact repeat peptide sequences, containing A, E, G, P, S, and T; see, e.g., Schellenberger et al. (2009) Nat.
  • immunostimulatory bacteria where the encoded therapeutic product comprises the B7 protein transmembrane domain, or where the therapeutic product is GPI-anchored by virtue of an endogenous or added GPI anchor.
  • the encoded therapeutic product can comprise a fusion to collagen.
  • the immunostimulatory bacteria in any and all embodiments can be any suitable species. Where reference is made to particular genes and gene modifications, the genes and modifications are those that correspond to the genes and modifications referenced with respect to Salmonella, as an exemplary species.
  • Species and strains include, for example, a strain of Rickettsia, Klebsiella, Bordetella, Neisseria, Aeromonas, Francisella, Corynebacterium, Citrobacter, Chlamydia, Haemophilus, Brucella, Mycobacterium, Mycoplasma, Legionella, Rhodococcus, Pseudomonas, Helicobacter, Vibrio, Bacillus, and Erysipelothrix.
  • Rickettsia rickettsiae Rickettsia prowazekii, Rickettsia tsutsugamuchi, Rickettsia mooseri, Rickettsia sibirica, Bordetella bronchiseptica, Neisseria meningitidis, Neisseria gonorrhoeae, Aeromonas eucrenophila, Aeromonas salmonicida, Francisella tularensis, Corynebacterium pseudotuberculosis, Citrobacter freundii, Chlamydia pneumoniae, Haemophilus somnus, Brucella abortus, Mycobacterium intracellulare, Legionella pneumophila, Rhodococcus equi, Pseudomonas aeruginosa, Helicobacter mustelae, Vibrio cholerae, Bacillus subtilis, Erysipelo
  • genome modified bacteria comprising genome modifications, whereby TLR2, TLR4, and TLR5 signaling is reduced compared to the bacteria without the genome modifications, wherein: the bacteria comprise further genomic modifications whereby they are auxotrophic for a required nutrient or factor so that they are unable to replicate in a eukaryotic host, but can replicate in vitro when supplied with the nutrient or factor; the bacteria comprise a plasmid containing nucleic acid, or comprise RNA encoding an antigenic sequence or sequences from a pathogenic virus, bacterium, or parasite, or encoding a tumor antigen, whereby, upon expression of the encoded antigen in the host, the host develops an immunoprotective response against the pathogenic virus, bacterium, or parasite; expression of the antigenic sequence(s) is/are under control of a prokaryotic promoter so that RNA encoding the antigen(s) is produced in the bacteria; nucleic acid encoding the antigen comprises regulatory sequences that inhibit or prevent translation of
  • the nucleic acid encoding the antigenic sequence(s) can comprise an internal ribosomal entry site (IRES) sequence, whereby host cell translation is facilitated or enhanced and bacterial translation is inhibited or prevented.
  • the IRES can be Vascular Endothelial Growth Factor and Type 1 Collagen Inducible Protein (VCIP; see, e.g., SEQ ID NO:432), and the nucleic acid encoding the antigen(s) can comprise a VCIP IRES or other IRES that inhibits bacterial translation.
  • the IRES or the VCIP IRES can be included in the plasmid, at a position that is 3’ of the promoter and 5’ of the antigen(s) coding sequence.
  • the pathogen can be a bacterium or a virus, or the encoded antigen can be a tumor antigen.
  • the immunostimulatory bacteria provided herein can be vaccines to prevent or treat a viral infection or a bacterial infection, including chronic viral infections, and acute infections.
  • the infection can be from an infection by hepatitis viruses, herpes viruses, varicella zoster virus (VZV), Epstein-Barr virus, human immunodeficiency virus (HIV), human T-cell leukemia virus (HTLV), Respiratory Syncytial Virus (RSV), measles virus, and other viruses that chronically infect subjects.
  • the infectious agent can be Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), Middle East Respiratory Syndrome coronavirus (MERS-CoV), or Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2, which causes COVID-19).
  • the pathogen can be a species of Escherichia, Staphylococcus, Pseudomonas, or Porphyromonas, or the pathogen can be P. gingivalis, SARS-CoV, or E. coli.
  • the plasmid in these immunostimulatory bacteria can further encode an immunostimulatory protein or other adjuvant, or can encode a combination of immunostimulatory proteins or other therapeutic proteins.
  • the immunostimulatory protein can be a STING protein, such as one that comprises a gain-of-function mutation, or one that is a chimeric STING protein.
  • the bacteria can comprise a plasmid that encodes a combination of therapeutic products.
  • the immunostimulatory protein(s) and/or other therapeutic proteins can be encoded on the plasmid as part of a polycistronic sequence, with the antigen under the control of a prokaryotic promoter recognized by the bacteria; or the immunostimulatory protein(s) and/or other therapeutic proteins can be encoded on the plasmid under control of a eukaryotic promoter recognized by the eukaryotic host.
  • the prokaryotic promoter can be a bacterial promoter or a bacterial phage promoter, and the eukaryotic host can be a human.
  • the immunostimulatory bacteria can comprise mRNA encoding the antigen(s), and any other proteins expressed under control of a prokaryotic promoter, that are produced by culturing the bacterium in vitro.
  • the immunostimulatory bacteria can comprise genome modifications whereby the bacteria lack flagella and produce LPS with pent-acylated, and/or the bacteria can be asd-, and/or an adenosine auxotroph, and/or csgD- and/or ansB-.
  • the bacteria can comprise nucleic acid encoding a TLR8 agonist.
  • the bacteria can be msbB-/pagP-, and/or can lack flagella, and/or can be asd-.
  • the bacteria can be a species or strain of Escherichia, Listeria, or Salmonella.
  • the bacteria can be Salmonella typhimurium strains, and the unmodified Salmonella strain is a wild-type strain, or is an attenuated strain.
  • the immunostimulatory bacteria can be derived from strain AST-100 (VNP20009 or YS1646), or from strain ATCC 14028, or from a strain having all of the identifying characteristics of strain ATCC 14028.
  • the immunostimulatory bacteria can contain one or more genome modification that are one or more of a deletion, insertion, disruption, and other modification in a gene, whereby the product encoded by the gene is not produced or, as produced, is inactive.
  • pharmaceutical compositions comprising any of the immunostimulatory bacteria described or provided herein, in a pharmaceutically acceptable vehicle.
  • the pharmaceutical composition can be formulated as a vaccine, for example, as a liquid, a powder, or a tablet.
  • bacteria or pharmaceutical compositions for treating or prevent (reducing the risk of developing) a disease or condition or infection or cancer, as well as uses of the bacteria for delivering RNA, such as mRNA, and methods of delivering the RNA to a subject, comprising administering the bacteria herein.
  • bacteria comprising a plasmid encoding a product or products, where the product(s) is/are a therapeutic product(s), and the plasmid in the bacterium encodes the product(s) to produce mRNA that is not translated by the bacterium.
  • the bacteria can be attenuated, or rendered of low toxicity or non-toxic, by virtue of the modifications described herein.
  • Exemplary of bacteria are species of Salmonella, such as a Salmonella typhimurium strain.
  • the immunostimulatory bacteria provided herein include those that endogenously encode and express, or are modified to encode and express, a gene encoding resistance to complement killing (rck), such as a Salmonella rck gene.
  • rck complement killing
  • therapeutic E. coli are modified to encode rck so that they can be administered systemically.
  • delivery vehicles, cells, pharmaceutical compositions, methods, uses, and treatments of cancer particularly in humans.
  • companion diagnostics and methods for selection of subjects for treatment, and methods for monitoring treatment are described below, and also, in the claims, which are incorporated in their entirety into this section.
  • Figures 1A-1C depict the inserts in plasmids pATI-1.75 and pATI-1.76 (Fig. 1A and 1B, respectively).
  • Figure 1C depicts that the Shine-Dalgarno sequence is replaced with a Kozak sequence, for translation in eukaryotic cells, such as myeloid cells.
  • Figure 2 depicts the alignment of wild-type human STING (SEQ ID NO:306) and Kenyan devil STING (SEQ ID NO:349) proteins.
  • Figure 3 depicts the alignment of wild-type human STING (SEQ ID NO:306) and marmoset STING (SEQ ID NO:359) proteins.
  • Figure 4 depicts the alignment of wild-type human STING (SEQ ID NO:306) and cattle STING (SEQ ID NO:360) proteins.
  • Figure 5 depicts the alignment of wild-type human STING (SEQ ID NO:306) and cat STING (SEQ ID NO:356) proteins.
  • Figure 6 depicts the alignment of wild-type human STING (SEQ ID NO:306) and ostrich STING (SEQ ID NO:361) proteins.
  • Figure 7 depicts the alignment of wild-type human STING (SEQ ID NO:306) and crested ibis STING (SEQ ID NO:362) proteins.
  • Figure 8 depicts the alignment of wild-type human STING (SEQ ID NO:306) and coelacanth STING (SEQ ID NO:363) proteins.
  • Figure 9 depicts the alignment of wild-type human STING (SEQ ID NO:306) and zebrafish STING (SEQ ID NO:348) proteins.
  • Figure 10 depicts the alignment of wild-type human STING (SEQ ID NO:305) and boar STING (SEQ ID NO:365) proteins.
  • Figure 11 depicts the alignment of wild-type human (SEQ ID NO:305) and bat STING (SEQ ID NO:366) proteins.
  • Figure 12 depicts the alignment of wild-type human (SEQ ID NO:305) and manatee STING (SEQ ID NO:367) proteins.
  • Figure 13 depicts the alignment of wild-type human (SEQ ID NO:305) and ghost shark STING (SEQ ID NO:368) proteins.
  • Figure 14 depicts the alignment of wild-type human (SEQ ID NO:305) and mouse STING (SEQ ID NO:369) proteins.
  • Bacterial Cancer Immunotherapy 2. Prior Therapies that Target the Tumor Microenvironment a. Limitations of Autologous T-Cell Therapies b. Viral Vaccine Platforms c. Bacterial Cancer Therapies i. Listeria ii. Salmonella Species iii. VNP20009 iv. Wild-Type Strains 3. Limitations of Existing Bacterial Cancer Immunotherapies C.
  • RNA including mRNA and other Forms of RNA
  • Immunostimulatory Proteins a. Cytokines and Chemokines b. Co-Stimulatory Molecules 2. Constitutively Active Proteins that Stimulate the Immune Response and/or Type I IFN, Non-Human STING Proteins, STING Chimeras, and Modified Forms a. Constitutive STING Expression and Gain-of- Function Mutations b. Constitutive IRF3 Expression and Gain-of-Function Mutations c. Non-Human STING Proteins, and Variants Thereof with Increased or Constitutive Activity, and STING Chimeras, and Variants Thereof with Increased or Constitutive Activity d. Other Gene Products that Act as Cytosolic DNA/RNA Sensors and Constitutive Variants Thereof i.
  • Drug Product Manufacturing 2. Compositions 3. Formulations a. Liquids, Injectables, Emulsions b. Dried Thermostable Formulations 4. Compositions for Other Routes of Administration 5. Dosages and Administration 6. Packaging and Articles of Manufacture I. METHODS OF TREATMENT AND USES 1. Diagnostics for Patient Selection for Treatment and for Monitoring Treatment a. Patient Selection b. Diagnostics to Assess or Detect Activity of the Immunostimulatory Bacteria are Indicative of the Effectiveness of Treatment 2. Tumors 3. Administration 4. Monitoring J. EXAMPLES A. DEFINITIONS Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong.
  • terapéutica bacteria are bacteria that effect therapy, such as anti-cancer or anti-tumor therapy, when administered to a subject, such as a human.
  • immunoprivileged bacteria are therapeutic bacteria that, when introduced into a subject, accumulate in immunoprivileged tissues and cells, such as tumors, the tumor microenvironment and tumor-resident immune cells, and replicate and/or express products that are immunostimulatory or that result in immunostimulation.
  • the immunostimulatory bacteria are attenuated in the host by virtue of reduced toxicity or pathogenicity and/or by virtue of encoded products that reduce toxicity or pathogenicity, as the immunostimulatory bacteria cannot replicate and/or express products (or have reduced replication/product expression), except primarily in immunoprivileged environments, such as the tumor microenvironment (TME).
  • Immunostimulatory bacteria provided herein are modified to encode a product or products, and/or to exhibit a trait or property that renders them immunostimulatory.
  • the immunostimulatory bacteria also include genome modifications so that an endogenous product or products is/are not expressed.
  • the bacteria can be said to be deleted in such product(s).
  • genes can be inactivated by deletions, disruptions, including transposition or insertion of transposons, insertions, and any other changes that eliminate the gene product. This can be achieved by insertions, deletions, and/or disruptions, including transpositions or inclusion of transposons.
  • genes that are inactivated include, for example, msbB, pagP, ansB, gene(s) encoding curli fimbriae, genes encoding flagella whereby the bacterium lacks flagella, and other modifications described herein and/or known to those of skill in the art.
  • Those of skill in the art also understand that corresponding genes in various bacterial species may have different designations.
  • the encoded products, properties and traits in the immunostimulatory bacteria include, but are not limited to, for example, at least one of: an immunostimulatory protein, such as a cytokine, chemokine, or co-stimulatory molecule; a cytosolic DNA/RNA sensor or gain-of-function or constitutively active variant thereof (e.g., STING, IRF3, IRF7, MDA5, RIG-I); RNAi, such as siRNA (shRNA and microRNA), or CRISPR, that targets, disrupts, or inhibits an immune checkpoint, such as, for example, TREX1, PD-1, CTLA-4 and/or PD-L1; antibodies and fragments thereof, such as an anti-immune checkpoint antibody, an anti-IL-6 antibody, an anti-VEGF antibody, or a TGF- ⁇ inhibitory antibody; other antibody constructs, such as bi-specific T-cell engagers (BiTE® antibodies); soluble TGF- ⁇ receptors that act as decoys for binding TGF
  • Immunostimulatory bacteria also can include a modification that renders the bacteria auxotrophic for a metabolite that is immunosuppressive or that is in an immunosuppressive pathway, such as adenosine.
  • the strain designations VNP20009 see, e.g., International PCT Application Publication No. WO 99/13053, see, also U.S. Patent No.6,863,894
  • YS1646, and 41.2.9 are used interchangeably, and each refers to the strain deposited with the American Type Culture Collection (ATCC) and assigned Accession No. 202165.
  • VNP20009 is a modified attenuated strain of Salmonella typhimurium, which contains deletions or other modifications in msbB and purI, and was generated from wild-type S. typhimurium strain ATCC #14028.
  • the strain designations YS1456 and 8.7 are used interchangeably and each refer to the strain deposited with the American Type Culture Collection (ATCC) and assigned Accession No.202164 (see, U.S. Patent No. 6,863,894).
  • ATCC American Type Culture Collection
  • recitation that a bacterium is “derived from” a particular strain means that such strain can serve as a starting material and can be modified to result in the particular bacterium.
  • an “expression cassette” refers to a nucleic acid construct that includes regulatory sequences for gene expression, operatively linked to nucleic acid encoding open reading frames (ORFs) that encode payloads, such as therapeutic products, or other proteins.
  • ORFs open reading frames
  • 2A peptides are 18–22 amino-acid (aa)-long viral oligopeptides that mediate cleavage of polypeptides during translation in eukaryotic cells.
  • the designation “2A” refers to a specific region of the viral genome, and different viral 2As have generally been named after the virus they were derived from.
  • F2A foot-and-mouth disease virus 2A
  • E2A equine rhinitis A virus
  • P2A porcine teschovirus-12A
  • T2A Thosea asigna virus 2A.
  • F2A foot-and-mouth disease virus 2A
  • E2A equine rhinitis A virus
  • P2A porcine teschovirus-12A
  • T2A Thosea asigna virus 2A.
  • SEQ ID NOs:327-330 SEQ ID NOs:327-330.
  • These peptides generally share a core sequence motif of DxExNPGP, and occur in a large number of viral families. They help break apart polyproteins by causing the ribosome to fail at making a peptide bond.
  • the 2A peptides provide for multicistronic/polycistronic vectors, in which a plurality of proteins are expressed from a single open reading frame (ORF).
  • ORF open reading frame
  • the 2A peptides include those that are naturally occurring, and any modified forms thereof, such as any having at least 97%, 98%, or 99% sequence identity with any naturally-occurring 2A peptide, including those disclosed herein, that result in single polypeptides being transcribed and translated from a transcript comprising a plurality (2 or more) of open reading frames.
  • an “interferonopathy” refers to a disorder associated with an upregulation of interferon by virtue of a mutation in a gene product involved in a pathway that regulates or induces expression of interferon.
  • the activity of the products normally is regulated by a mediator, such as cytosolic DNA or RNA or nucleotides; when the protein product is mutated, the activity is constitutive.
  • Type I interferonopathies include a spectrum of conditions, including the severe forms of Aicardi-Goutines Syndrome (AGS), and the milder Familial Chilblain Lupus (FCL).
  • Nucleic acid molecules encoding mutated products with these properties can be produced in vitro, such as by selecting for mutations that result in a gain-of-function in the product, compared to the product of an allele that has normal activity, or has further gain-of-function compared to the disease-associated gain-of-function mutants described herein.
  • a “gain-of-function mutation” is one that increases the activity of a protein compared to the same protein that does not have the mutation. For example, if the protein is a receptor, it will have increased affinity for a ligand; if it is an enzyme, it will have increased activity, including constitutive activity.
  • a constitutively active product is one that is active in the absence of a its activating ligands, such as cGAS for STING, and/or in the absence of cytosolic nucleic acids, such as DNA, RNA, nucleotides, dinucleotides, cyclic nucleotides and/or cyclic dinucleotides or other nucleic acid molecules, that lead to production of type I interferon.
  • cytosolic nucleic acids such as DNA, RNA, nucleotides, dinucleotides, cyclic nucleotides and/or cyclic dinucleotides or other nucleic acid molecules, that lead to production of type I interferon.
  • an “origin of replication” is a sequence of DNA at which replication is initiated on a chromosome, or a plasmid, or in a virus.
  • the origin of replication determines the vector copy number, which depends upon the selected origin of replication. For example, if the expression vector is derived from the low-copy-number plasmid pBR322, the copy number is between about 15-20 copies/cell, and if derived from the high-copy-number plasmid pUC, it can be 500-700 copies/cell.
  • medium copy number of a plasmid in cells is about or is 150 or less than 150, and low copy number is 5-30, such as 20 or less than 20. Low to medium copy number is less than 150 copies/cell. High copy number is greater than 150 copies/cell.
  • a “CpG motif” is a pattern of bases that includes an unmethylated central CpG (“p” refers to the phosphodiester link between consecutive C and G nucleotides), surrounded by at least one base flanking (on the 3' and the 5' side of) the central CpG.
  • a CpG oligodeoxynucleotide is an oligodeoxynucleotide that is at least about ten nucleotides in length and includes an unmethylated CpG. At least the C of the 5' CG 3' is unmethylated.
  • a “RIG-I binding sequence” refers to a 5’triphosphate (5’ppp) structure directly, or that which is synthesized by RNA pol III from a poly(dA-dT) sequence, which, by virtue of interaction with RIG-I, can activate type I IFN via the RIG-I pathway.
  • the RNA includes at least four A ribonucleotides (A-A-A); it can contain 4, 5, 6, 7, 8, 9, 10, or more.
  • cytokines are a broad and loose category of small proteins ( ⁇ 5–20 kDa) that are important in cell signaling. Cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factors. Cytokines are cell signaling molecules that aid cell to cell communication in immune responses, and stimulate the movement of cells towards sites of inflammation, infection and trauma.
  • chemokines refer to chemoattractant (chemotactic) cytokines that bind to chemokine receptors and include proteins isolated from natural sources as well as those made synthetically, as by recombinant means or by chemical synthesis.
  • chemokines include, but are not limited to, IL-8, IL-10, GCP-2, GRO- ⁇ , GRO- ⁇ , GRO- ⁇ , ENA-78, PBP, CTAP III, NAP-2, LAPF-4, MIG (CXCL9), CXCL10 (IP-10), CXCL11, PF4, SDF-1 ⁇ , SDF-1 ⁇ , SDF-2, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MIP-1 ⁇ (CCL3), MIP-1 ⁇ (CCL4), MIP-1 ⁇ (CCL9), MIP-2, MIP-2 ⁇ , MIP-3 ⁇ , MIP-3 ⁇ , MIP-4, MIP-5, MDC, HCC-1, ALP, lungkine, Tim-1, eotaxin-1, eotaxin-2, I-309, SCYA17, TRAC, RANTES (CCL5), DC-CK-1, lymphotactin, and fractalkine, and others known to those of skill in the art.
  • MIG C
  • Chemokines are involved in the migration of immune cells to sites of inflammation, as well as in the maturation of immune cells, and in the generation of adaptive immune responses.
  • an “immunostimulatory protein” is a protein that exhibits or promotes an anti-tumor immune response in the tumor microenvironment.
  • cytokines such as, but not limited to, IFN- ⁇ , IFN- ⁇ , GM-CSF, IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL- 23, IL-12p70 (IL-12p40 + IL-12p35), IL-15/IL-15R alpha chain complex (also referred to herein as IL-15/IL-15R ⁇ , IL-15R ⁇ -IL-15sc, IL-15 complex, and other variations, set forth herein), IL-36 gamma, IL-2 that has attenuated binding to IL-2Ra, IL-2 that is modified so that it does not bind to IL-2Ra, CXCL9, CXCL10 (IP-10), CXCL11, CCL3, CCL4, CCL5, molecules involved in the potential recruitment and/or persistence of T-cells, CD40, CD40 ligand (CD40L), OX40, OX40, OX40, OX40
  • immunostimulatory proteins are truncated co-stimulatory molecules, such as, for example, 4-1BBL, CD80, CD86, CD27L, B7RP1 and OX40L, each with a full or partial cytoplasmic domain deletion, for expression on an antigen- presenting cell (APC).
  • APC antigen- presenting cell
  • truncated gene products such as those with deletions or partial deletions of the cytoplasmic domain, are truncated such that they are capable of constitutive immunostimulatory signaling to a T-cell through co-stimulatory receptor engagement, but are unable to counter-regulatory signal to the APC, due to a deleted or truncated cytoplasmic domain.
  • cytoplasmic domain deletion is a deletion in all, or a portion of, the amino acid residues that comprise the cytoplasmic, or intracellular, domain of the protein, where the deletion is sufficient to effect constitutive immunostimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is sufficient to inhibit counter-regulatory signaling to the APC.
  • the cytoplasmic domain of human 4-1BBL also known as TNFSF9 comprises amino acid residues 1-28 of SEQ ID NO:342.
  • the cytoplasmic domain of human CD80 comprises amino acid residues 264-288 of the protein; the cytoplasmic domain of human CD86 comprises amino acid residues 269-329 of the protein; the cytoplasmic domain of human CD27L (also known as CD70) comprises amino acid residues 1-17 of the protein; the cytoplasmic domain of human B7RP1 (also known as ICOSLG or ICOS ligand) comprises amino acid residues 278-302 of the protein; and the cytoplasmic domain of human OX40L (also known as TNFSF4 or CD252) comprises amino acid residues 1-23 of the protein.
  • a “decoy receptor” is a receptor that can specifically bind to specific growth factors or cytokines efficiently, but is not structurally able to signal or activate the intended receptor complex.
  • the decoy receptor acts as an inhibitor by binding to a ligand and preventing it from binding to its cognate receptor.
  • TGF- ⁇ family receptors include the cell-surface serine/threonine kinase receptors type I (T ⁇ RI or TGF ⁇ R1) and type II (T ⁇ RII or TGF ⁇ R2), which form heteromeric complexes in the presence of dimerized ligands, as well as the type III receptor betaglycan (T ⁇ RIII or TGF ⁇ R3).
  • Soluble decoy receptors for TGF- ⁇ which prevent the binding of TGF- ⁇ to its receptors, include the soluble extracellular domains (the TGF- ⁇ binding regions) of T ⁇ RI, T ⁇ RII, or T ⁇ RIII ( ⁇ glycan), which can be fused with other molecules, such as an Fc domain.
  • BAMBI bone morphogenetic protein (BMP) and activin membrane-bound inhibitor
  • BMP bone morphogenetic protein
  • activin membrane-bound inhibitor is structurally related to type I receptors and acts as a decoy that inhibits receptor activation.
  • a dominant negative TGF ⁇ R2 (DN-TGF ⁇ R2), which comprises the extracellular domain of TGF ⁇ R2 and the transmembrane region, but which lacks the cytoplasmic domain required for signaling, also can be used as a TGF- ⁇ decoy receptor (see, e.g., International Application Publication No. WO 2018/138003).
  • a co-stimulatory molecule agonist is a molecule that, upon binding to the co-stimulatory molecule, activates it or increases its activity.
  • the agonist can be an agonist antibody.
  • CD40 agonist antibodies include, for example, CP-870,893, dacetuzumab, ADC-1013 (mitazalimab), and Chi Lob 7/4.
  • a cytosolic DNA/RNA sensor pathway is one that is initiated by the presence of DNA, RNA, nucleotides, dinucleotides, cyclic nucleotides and/or cyclic dinucleotides or other nucleic acid molecules, that leads to production of type I interferon.
  • the nucleic acid molecules in the cytosol occur from viral or bacterial or radiation or other such exposure, leading to activation of an immune response in a host.
  • a “type I interferon pathway protein” is a protein that induces an innate immune response, such as the induction of type I interferon.
  • cytosolic DNA/RNA sensor is a protein that is part of a cytosolic DNA/RNA sensor pathway that leads to expression of an immune response mediator, such as type I interferon.
  • cytosolic DNA is sensed by cGAS, leading to the production of cGAMP and subsequent STING/TBK1/IRF3 signaling, and type I IFN production.
  • Bacterial cyclic dinucleotides CDNs, such as bacterial cyclic di-AMP also activate STING.
  • STING is an immunomodulatory protein that induces type I interferon.5’- triphosphate RNA and double stranded RNA are sensed by RIG-I and either MDA-5 alone, or MDA-5/LGP2.
  • RIG-I triphosphate RNA and double stranded RNA are sensed by RIG-I and either MDA-5 alone, or MDA-5/LGP2.
  • mitochondrial MAVS mitochondrial antiviral-signaling protein
  • IRF3 interferon regulatory factor 3
  • the proteins in such pathways are immunostimulatory proteins, and lead to the expression of innate immune response mediators, such as type I interferon.
  • the immunomodulatory proteins in the DNA/RNA sensor pathways can be modified so that they have increased activity, or act constitutively in the absence of cytosolic nucleic acids and/or activating/stimulating ligands, to lead to the immune response, such as the expression of type I interferon.
  • the “carboxy-terminal tail” or “C-terminal tail” (CTT) of the innate immune protein STING refers to the C-terminal portion of a STING protein that, in a wild-type STING protein, is tethered to the cGAMP-binding domain by a flexible linker region.
  • the CTT includes an IRF3 binding site, a TBK1 binding site, and a TRAF6 binding site.
  • STING promotes the induction of interferon beta (IFN- ⁇ ) production via the phosphorylation of the STING protein C-terminal tail (CTT) by TANK-binding kinase 1 (TBK1).
  • CTT carboxy-terminal tail
  • TRAF6 catalyzes the formation of K63-linked ubiquitin chains on STING, leading to the activation of the transcription factor NF- ⁇ B and the induction of an alternative STING-dependent gene expression program. Deletion or disruption of the TRAF6 binding site in the CTT can reduce activation of NF- ⁇ B signaling.
  • Substitution of the human STING CTT (or portions thereof), with the CTT (or corresponding portion thereof) from the STING protein of a species with low NF- ⁇ B activation, can decrease the NF- ⁇ B activation by the resulting modified human STING protein.
  • the STING CTT is an unstructured stretch of ⁇ 40 amino acids that contains sequence motifs required for STING phosphorylation and recruitment of IRF3 (see, de Oliveira Mann et al. (2019) Cell Reports 27:1165-1175).
  • Human STING residue S366 has been identified as a primary TBK1 phosphorylation site that is part of an LxIS motif shared among innate immune adaptor proteins that activate interferon signaling (see, de Oliveira Mann et al.
  • the human STING CTT contains a second PxPLR motif that includes the residue L374, which is required for TBK1 binding; the LxIS and PxPLR sequences are conserved among vertebrate STING alleles (see, de Oliveira Mann et al. (2019) Cell Reports 27:1165-1175).
  • Exemplary STING CTT sequences, and the IRF3, TBK1, and TRAF6 binding sites, are set forth in the following table:
  • a bacterium that is modified so that it “induces less cell death in tumor-resident immune cells” or “induces less cell death in immune cells” is one that is less toxic than the bacterium without the modification, or one that has reduced virulence compared to the bacterium without the modification.
  • modifications include disruption of or deletion of flagellin genes, pagP, or one or more components of the SPI-1 pathway, such as hilA, rod protein (e.g., prgJ), needle protein (e.g., prgI), and QseC.
  • a bacterium that is “modified so that it preferentially infects tumor-resident immune cells” or “modified so that it preferentially infects immune cells” has a modification in its genome that reduces its ability to infect cells other than immune cells.
  • modifications include modifications that disrupt the type 3 secretion system or type 4 secretion system or other genes or systems that affect the ability of a bacterium to invade a non-immune cell.
  • modifications include disruption/deletion of an SPI-1 component, which is needed for infection of cells, such as epithelial cells, but does not affect infection of immune cells, such as phagocytic cells, by Salmonella.
  • a “modification” is in reference to modification of a sequence of amino acids of a polypeptide, or a sequence of nucleotides in a nucleic acid molecule, and includes deletions, insertions, and replacements of amino acids or nucleotides, respectively. Methods of modifying a polypeptide are routine to those of skill in the art, such as by using recombinant DNA methodologies. As used herein, a modification to a bacterial genome, or to a plasmid, or to a gene, includes deletions, replacements, and insertions of nucleic acid.
  • RNA interference is a biological process in which RNA molecules inhibit gene expression or translation, by neutralizing targeted mRNA molecules to inhibit translation, and thereby expression, of a targeted gene.
  • RNA molecules that act via RNAi are referred to as inhibitory by virtue of their silencing of the expression of a targeted gene.
  • Silencing expression means that expression of the targeted gene is reduced, or suppressed, or inhibited.
  • gene silencing via RNAi is said to inhibit, suppress, disrupt, or silence expression of a targeted gene.
  • a targeted gene contains sequences of nucleotides that correspond to the sequences in the inhibitory RNA, whereby the inhibitory RNA silences expression of target mRNA.
  • inhibiting, suppressing, disrupting, or silencing a targeted gene refers to processes that alter expression, such as translation, of the targeted gene, whereby activity or expression of the product encoded by the targeted gene is reduced.
  • Reduction includes a complete knock-out or a partial knockout, whereby, with reference to the immunostimulatory bacteria provided herein and administration herein, treatment is effected.
  • siRNAs small interfering RNAs
  • ds double- stranded RNA
  • mRNA messenger RNA
  • siRNAs prevent the production of specific proteins based on the nucleotide sequences of their corresponding mRNAs.
  • RNAi RNA interference
  • siRNA silencing siRNA knockdown.
  • RNA interference RNA interference
  • shRNA short-hairpin RNA or small-hairpin RNA
  • RNAi RNA interference
  • TME tumor microenvironment
  • ECM extracellular matrix
  • an immune desert tumor or immune-excluded tumor is a tumor devoid of tumor infiltrating T-cells.
  • Immune desert tumors are solid tumors where minimal effector immune cells infiltrate the tumor and there is a lack of immune response present in the tumor.
  • Desert tumors are devoid tumor-infiltrating lymphocytes, CD8+ T-cells are absent from the tumor, including the parenchyma, stroma, and tumor periphery.
  • bactofection refers to the bacteria-mediated transfer of genes or plasmid DNA into eukaryotic cells, such as mammalian cells.
  • human type I interferons IFNs
  • IFNs human type I interferons
  • All type I IFNs bind to a specific cell surface receptor complex, such as the IFN- ⁇ receptor.
  • Type I interferons include IFN- ⁇ and IFN- ⁇ , among others.
  • Myeloid cells are the primary producers of IFN- ⁇ and IFN- ⁇ , which have antiviral activity that is involved mainly in innate immune responses.
  • Two types of IFN- ⁇ are IFN- ⁇ 1 (IFNB1) and IFN- ⁇ 3 (IFNB3).
  • M1 macrophage phenotype and M2 macrophage phenotype refer to the two broad groups into which macrophage phenotypes are divided: M1 (classically activated macrophages) and M2 (alternatively activated macrophages).
  • M1 macrophages The role of M1 macrophages is to secrete pro-inflammatory cytokines and chemokines, and to present antigens, so that they participate in the positive immune response, and function as an immune monitor.
  • the main pro-inflammatory cytokines they produce are IL-6, IL-12, and TNF-alpha.
  • M2 macrophages primarily secrete arginase-I, IL-10, TGF- ⁇ , and other anti-inflammatory cytokines, which have the function of reducing inflammation, and contributing to tumor growth and immunosuppressive function.
  • a macrophage with an M1-like phenotype secretes pro- inflammatory cytokines, and does not have the immunosuppressive activity(ies) of an M2 macrophage.
  • Conversion of an M2 macrophage into a macrophage with an M1 or M1-like phenotype converts an M2 macrophage into one that is not immunosuppressive, but participates in an anti-tumor response.
  • M2 macrophage that is converted into a macrophage with an M1 or M1-like phenotype exhibits the secretion/expression of more pro-inflammatory cytokines/chemokines and receptors, such as CD80 and CCR7, and chemokines, such as IFN ⁇ and CXCL10.
  • M1 phenotypic markers include, but are not limited to, one or more of CD80, CD86, CD64, CD16, and CD32.
  • iNOS nitric oxide synthase
  • CD163 and CD206 are major markers for the identification of M2 macrophages.
  • Other surface markers for M2-type cells also include CD68.
  • a nucleic acid or encoded RNA targets a gene means that it inhibits or suppresses or silences expression of the gene by any mechanism.
  • such nucleic acid includes at least a portion complementary to the targeted gene, where the portion is sufficient to form a hybrid with the complementary portion.
  • deletion when referring to a nucleic acid or polypeptide sequence, refers to the deletion of one or more nucleotides or amino acids compared to a sequence, such as a target polynucleotide, or polypeptide, or a native or wild-type sequence.
  • insertion when referring to a nucleic acid or amino acid sequence, describes the inclusion of one or more additional nucleotides or amino acids, within a target, native, wild-type or other related sequence.
  • a nucleic acid molecule that contains one or more insertions compared to a wild-type sequence contains one or more additional nucleotides within the linear length of the sequence.
  • substitutions to nucleic acid and amino acid sequences describe addition of nucleotides or amino acids onto either termini compared to another sequence.
  • substitution or “replacement” refers to the replacing of one or more nucleotides or amino acids in a native, target, wild-type or other nucleic acid or polypeptide sequence with an alternative nucleotide or amino acid, without changing the length (as described in numbers of nucleotides or residues) of the molecule. Thus, one or more substitutions in a molecule does not change the number of nucleotides or amino acid residues of the molecule.
  • Amino acid replacements compared to a particular polypeptide can be expressed in terms of the number of the amino acid residue along the length of the polypeptide sequence.
  • “at a position corresponding to,” or recitation that nucleotides or amino acid positions “correspond to” nucleotides or amino acid positions in a disclosed sequence refers to nucleotides or amino acid positions identified upon alignment with the disclosed sequence to maximize identity using a standard alignment algorithm, such as the GAP algorithm. By aligning the sequences, one skilled in the art can identify corresponding residues, for example, using conserved and identical amino acid residues as guides.
  • alignment of a sequence refers to the use of homology to align two or more sequences of nucleotides or amino acids. Typically, two or more sequences that are related by 50% or more identity are aligned.
  • An aligned set of sequences refers to 2 or more sequences that are aligned at corresponding positions and can include aligning sequences derived from RNAs, such as ESTs and other cDNAs, aligned with a genomic DNA sequence.
  • polypeptides or nucleic acid molecules can be aligned by any method known to those of skill in the art. Such methods typically maximize matches, and include methods, such as using manual alignments, and by using the numerous alignment programs available (e.g., BLASTP) and others known to those of skill in the art.
  • BLASTP the numerous alignment programs available
  • aligning the sequences of polypeptides or nucleic acids one skilled in the art can identify analogous portions or positions, using conserved and identical amino acid residues as guides. Further, one skilled in the art also can employ conserved amino acid or nucleotide residues as guides to find corresponding amino acid or nucleotide residues between and among human and non-human sequences.
  • Corresponding positions also can be based on structural alignments, for example by using computer simulated alignments of protein structure. In other instances, corresponding regions can be identified. One skilled in the art also can employ conserved amino acid residues as guides to find corresponding amino acid residues between and among human and non-human sequences.
  • a “property” of a polypeptide such as an antibody, refers to any property exhibited by a polypeptide, including, but not limited to, binding specificity, structural configuration or conformation, protein stability, resistance to proteolysis, conformational stability, thermal tolerance, and tolerance to pH conditions. Changes in properties can alter an “activity” of the polypeptide.
  • a change in the binding specificity of the antibody polypeptide can alter the ability to bind an antigen, and/or various binding activities, such as affinity or avidity, or in vivo activities of the polypeptide.
  • an “activity” or a “functional activity” of a polypeptide, such as an antibody refers to any activity exhibited by the polypeptide. Such activities can be empirically determined. Exemplary activities include, but are not limited to, the ability to interact with a biomolecule, for example, through antigen-binding, DNA binding, ligand binding, or dimerization, or enzymatic activity, for example, kinase activity, or proteolytic activity.
  • activities include, but are not limited to, the ability to specifically bind a particular antigen, affinity of antigen-binding (e.g., high or low affinity), avidity of antigen- binding (e.g., high or low avidity), on-rate, off-rate, effector functions, such as the ability to promote antigen neutralization or clearance, virus neutralization, and in vivo activities, such as the ability to prevent infection or invasion of a pathogen, or to promote clearance, or to penetrate a particular tissue or fluid or cell in the body.
  • affinity of antigen-binding e.g., high or low affinity
  • avidity of antigen- binding e.g., high or low avidity
  • effector functions such as the ability to promote antigen neutralization or clearance, virus neutralization
  • in vivo activities such as the ability to prevent infection or invasion of a pathogen, or to promote clearance, or to penetrate a particular tissue or fluid or cell in the body.
  • Activity can be assessed in vitro or in vivo using recognized assays, such as ELISA, flow cytometry, surface plasmon resonance or equivalent assays to measure on-rate or off-rate, immunohistochemistry and immunofluorescence histology and microscopy, cell-based assays, and binding assays (e.g., panning assays).
  • recognized assays such as ELISA, flow cytometry, surface plasmon resonance or equivalent assays to measure on-rate or off-rate, immunohistochemistry and immunofluorescence histology and microscopy, cell-based assays, and binding assays (e.g., panning assays).
  • binding e.g., panning assays
  • Binding includes, but is not limited to, non-covalent bonds, covalent bonds (such as reversible and irreversible covalent bonds), and includes interactions between molecules such as, but not limited to, proteins, nucleic acids, carbohydrates, lipids, and small molecules, such as chemical compounds, including drugs.
  • antibody refers to immunoglobulins and immunoglobulin fragments, whether natural, or partially or wholly synthetically, such as recombinantly produced, including any fragment thereof containing at least a portion of the variable heavy chain and light region of the immunoglobulin molecule that is sufficient to form an antigen-binding site and, when assembled, to specifically bind an antigen.
  • an antibody includes any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin antigen-binding domain (antibody combining site).
  • an antibody refers to an antibody that contains two heavy chains (which can be denoted H and H’) and two light chains (which can be denoted L and L’), where each heavy chain can be a full-length immunoglobulin heavy chain or a portion thereof sufficient to form an antigen-binding site (e.g., heavy chains include, but are not limited to, V H chains, V H -C H 1 chains and V H -C H 1-C H 2- CH3 chains), and each light chain can be a full-length light chain or a portion thereof sufficient to form an antigen-binding site (e.g., light chains include, but are not limited to, V L chains and V L -C L chains).
  • antibodies typically include all or at least a portion of the variable heavy (VH) chain and/or the variable light (VL) chain.
  • the antibody also can include all or a portion of the constant region.
  • the term antibody includes full-length antibodies and portions thereof including antibody fragments, such as anti-CTLA-4 antibody fragments.
  • Antibody fragments include, but are not limited to, Fab fragments, Fab’ fragments, F(ab’) 2 fragments, Fv fragments, disulfide-linked Fvs (dsFvs), Fd fragments, Fd’ fragments, single-chain Fvs (scFvs), single-chain Fabs (scFabs), diabodies, anti-idiotypic (anti-Id) antibodies, or antigen-binding fragments of any of the above.
  • Antibody also includes synthetic antibodies, recombinantly produced antibodies, multi-specific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, and intrabodies.
  • Antibodies provided herein include members of any immunoglobulin class (e.g., IgG, IgM, IgD, IgE, IgA and IgY), any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or sub-subclass (e.g., IgG2a and IgG2b).
  • immunoglobulin class e.g., IgG, IgM, IgD, IgE, IgA and IgY
  • any subclass e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2a
  • Antibodies for human therapy generally are human antibodies or are humanized.
  • antibody fragment(s) refers to (i) monovalent and monospecific antibody derivatives that contain the variable heavy and/or light chains, or functional fragments of an antibody, and that lack an Fc part; and (ii) BiTE® antibodies (such as tandem scFvs), dual-affinity re-targeting antibodies (DARTs), other dimeric and multimeric antibodies, diabodies, and single-chain diabodies (scDBs).
  • BiTE® antibodies such as tandem scFvs), dual-affinity re-targeting antibodies (DARTs), other dimeric and multimeric antibodies, diabodies, and single-chain diabodies (scDBs).
  • an antibody fragment includes, for example, a/an: Fab, Fab’, scFab, scFv, Fv fragment, nanobody (see, e.g., antibodies derived from Camelus bactriamus, Camelus dromedarius, or Lama paccos) (see, e.g., U.S. Pat. No.5,759,808; and Stijlemans et al. (2004) J. Biol. Chem.279:1256-1261), VHH, single-domain antibody (dAb or sdAb), minimal recognition unit, single-chain diabody (scDb), BiTE® antibody, and DART antibody, and other antibody constructs that bind to antigens.
  • nucleic acid refers to at least two linked nucleotides or nucleotide derivatives, including a deoxyribonucleic acid (DNA) and a ribonucleic acid (RNA), joined together, typically by phosphodiester linkages. Also included in the term “nucleic acid” are analogs of nucleic acids, such as peptide nucleic acid (PNA), phosphorothioate DNA, and other such analogs and derivatives, or combinations thereof.
  • PNA peptide nucleic acid
  • Nucleic acids also include DNA and RNA derivatives containing, for example, a nucleotide analog or a “backbone” bond other than a phosphodiester bond, for example, a phosphotriester bond, a phosphoramidate bond, a phosphorothioate bond, a thioester bond, or a peptide bond (peptide nucleic acid).
  • the term also includes equivalents, derivatives, variants, and analogs of either RNA or DNA made from nucleotide analogs, and single-stranded (sense or antisense) and double-stranded nucleic acids.
  • Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine.
  • the uracil base is uridine.
  • an isolated nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
  • An “isolated” nucleic acid molecule, such as a cDNA molecule can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • Exemplary isolated nucleic acid molecules provided herein include isolated nucleic acid molecules encoding an antibody or antigen-binding fragments provided herein.
  • “operably linked” or “operatively linked,” with reference to nucleic acid sequences, regions, elements, or domains, means that the nucleic acid regions are functionally related to each other. It refers to a juxtaposition whereby the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter effects or affects its transcription or expression.
  • a nucleic acid encoding a leader peptide can be operably linked to a nucleic acid encoding a polypeptide, whereby the nucleic acids can be transcribed and translated to express a functional fusion protein, wherein the leader peptide effects secretion of the fusion polypeptide.
  • the nucleic acid encoding a first polypeptide e.g., a leader peptide
  • the nucleic acids are transcribed as a single mRNA transcript, but translation of the mRNA transcript can result in one of two polypeptides being expressed.
  • an amber stop codon can be located between the nucleic acid encoding the first polypeptide and the nucleic acid encoding the second polypeptide, such that, when introduced into a partial amber suppressor cell, the resulting single mRNA transcript can be translated to produce either a fusion protein containing the first and second polypeptides, or can be translated to produce only the first polypeptide.
  • a promoter can be operably linked to nucleic acid encoding a polypeptide, whereby the promoter regulates or mediates the transcription of the nucleic acid.
  • synthetic refers to a nucleic acid molecule, or a gene, or a polypeptide molecule that is produced by recombinant methods and/or by chemical synthesis methods.
  • residues of naturally occurring ⁇ -amino acids are the residues of those 20 ⁇ -amino acids found in nature which are incorporated into a protein by the specific recognition of the charged tRNA molecule with its cognate mRNA codon in humans.
  • polypeptide refers to two or more amino acids covalently joined.
  • polypeptide and “protein” are used interchangeably herein.
  • a “peptide” refers to a polypeptide that is from 2 to about or 40 amino acids in length.
  • an “amino acid” is an organic compound containing an amino group and a carboxylic acid group.
  • a polypeptide contains two or more amino acids.
  • amino acids contained in the antibodies and immunostimulatory proteins provided herein include the twenty naturally-occurring amino acids (see Table below), non-natural amino acids, and amino acid analogs (e.g., amino acids wherein the ⁇ -carbon has a side chain).
  • amino acids which occur in the various amino acid sequences of polypeptides appearing herein, are identified according to their well-known, three-letter or one-letter abbreviations (see Table below).
  • amino acid residue refers to an amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages.
  • the amino acid residues described herein are generally in the “L” isomeric form.
  • Residues in the “D” isomeric form can be substituted for any L-amino acid residue, as long as the desired functional property is retained by the polypeptide.
  • NH2 refers to the free amino group present at the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxyl terminus of a polypeptide.
  • amino acid residues are shown in the following Table: Table of Correspondence All sequences of amino acid residues represented herein by a formula have a left to right orientation in the conventional direction of amino-terminus to carboxyl- terminus.
  • amino acid residue is defined to include the amino acids listed in the above Table of Correspondence, as well as modified, non-natural, and unusual amino acids.
  • a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues, or to an amino-terminal group such as NH 2 , or to a carboxyl-terminal group such as COOH.
  • suitable conservative substitutions of amino acids are known to those of skill in the art and generally can be made without altering a biological activity of a resulting molecule.
  • Those of skill in the art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub. Co., p.224).
  • Such substitutions can be made in accordance with the exemplary substitutions set forth in the following Table: Exemplary Conservative Amino Acid Substitutions
  • Other substitutions also are permissible and can be determined empirically or in accord with other known conservative or non-conservative substitutions.
  • non-natural amino acids refer to the 20 L-amino acids that occur in polypeptides.
  • non-natural amino acid refers to an organic compound that has a structure similar to a natural amino acid, but that has been modified structurally to mimic the structure and reactivity of a natural amino acid.
  • Non-naturally occurring amino acids thus include, for example, amino acids or analogs of amino acids other than the 20 naturally occurring amino acids and include, but are not limited to, the D-stereoisomers of amino acids.
  • non-natural amino acids are known to those of skill in the art, and include, but are not limited to, 2-Aminoadipic acid (Aad), 3-Aminoadipic acid (bAad), ⁇ -alanine/ ⁇ -Amino-propionic acid (Bala), 2-Aminobutyric acid (Abu), 4-Aminobutyric acid/piperidinic acid (4Abu), 6-Aminocaproic acid (Acp), 2-Aminoheptanoic acid (Ahe), 2- Aminoisobutyric acid (Aib), 3-Aminoisobutyric acid (Baib), 2-Aminopimelic acid (Apm), 2,4-Diaminobutyric acid (Dbu), Desmosine (Des), 2,2'-Diaminopimelic acid (Dpm), 2,3-Diaminopropionic acid (Dpr), N-Ethylglycine (EtGly), N-Ethylasparagine (EtAsn
  • a DNA construct is a single-stranded or double-stranded, linear or circular DNA molecule that contains segments of DNA combined and juxtaposed in a manner not found in nature. DNA constructs exist as a result of human manipulation, and include clones and other copies of manipulated molecules.
  • a DNA segment is a portion of a larger DNA molecule having specified attributes.
  • a DNA segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, which, when read from the 5’ to 3’ direction, encodes the sequence of amino acids of the specified polypeptide.
  • polynucleotide means a single- or double-stranded polymer of deoxyribonucleotides or ribonucleotide bases read from the 5’ to the 3’ end.
  • Polynucleotides include RNA and DNA, and can be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
  • the length of a polynucleotide molecule is given herein in terms of nucleotides (abbreviated “nt”), or base pairs (abbreviated “bp”).
  • nt nucleotides
  • bp base pairs
  • heterologous nucleic acid is nucleic acid that encodes products (i.e., RNA and/or proteins) that are not normally produced in vivo by the cell in which it is expressed, or nucleic acid that is in a locus in which it does not normally occur, or that mediates or encodes mediators that alter expression of endogenous nucleic acid, such as DNA, by affecting transcription, translation, or other regulatable biochemical processes.
  • Heterologous nucleic acid, such as DNA also is referred to as foreign nucleic acid.
  • heterologous nucleic acid includes exogenously added nucleic acid that is also expressed endogenously.
  • Heterologous nucleic acid is generally not endogenous to the cell into which it is introduced, but has been obtained from another cell, or prepared synthetically, or is introduced into a genomic locus in which it does not occur naturally, or its expression is under the control of regulatory sequences or a sequence that differs from the natural regulatory sequence or sequences.
  • heterologous nucleic acid examples include, but are not limited to, nucleic acid that encodes a protein in a DNA/RNA sensor pathway or a gain-of- function or constitutively active variant thereof, or an immunostimulatory protein, such as a cytokine, chemokine or co-stimulatory molecule, that confers or contributes to anti-tumor immunity in the tumor microenvironment.
  • an immunostimulatory protein such as a cytokine, chemokine or co-stimulatory molecule
  • Other products such as antibodies and fragments thereof, BiTEs®, decoy receptors, antagonizing polypeptides and RNAi, that confer or contribute to anti-tumor immunity in the tumor microenvironment, also are included.
  • the heterologous nucleic acid generally is encoded on the introduced plasmid, but it can be introduced into the genome of the bacterium, such as a promoter that alters expression of a bacterial product.
  • Heterologous nucleic acid, such as DNA includes nucleic acid that can, in some manner, mediate expression of DNA that encodes a therapeutic product, or it can encode a product, such as a peptide or RNA, that in some manner mediates, directly or indirectly, expression of a therapeutic product.
  • cell therapy involves the delivery of cells to a subject to treat a disease or condition.
  • the cells which can be allogeneic or autologous to the subject, are modified ex vivo, such as by infection of cells with immunostimulatory bacteria provided herein, so that they deliver or express products when introduced to a subject.
  • genetic therapy involves the transfer of heterologous nucleic acid, such as DNA, into certain cells, such as target cells, of a mammal, particularly a human, with a disorder or condition for which such therapy is sought.
  • the nucleic acid, such as DNA is introduced into the selected target cells in a manner such that the heterologous nucleic acid, such as DNA, is expressed, and a therapeutic product(s) encoded thereby is (are) produced.
  • Genetic therapy can also be used to deliver nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by the mammal or the cell in which it is introduced.
  • the introduced nucleic acid can encode a therapeutic compound, such as a growth factor or inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a receptor thereof, that is not normally produced in the mammalian host or that is not produced in therapeutically effective amounts or at a therapeutically useful time.
  • the heterologous nucleic acid, such as DNA, encoding the therapeutic product can be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.
  • Genetic therapy can also involve delivery of an inhibitor or repressor or other modulator of gene expression.
  • expression refers to the process by which polypeptides are produced by transcription and translation of polynucleotides.
  • the level of expression of a polypeptide can be assessed using any method known in art, including, for example, methods of determining the amount of the polypeptide produced from the host cell. Such methods can include, but are not limited to, quantitation of the polypeptide in the cell lysate by ELISA, Coomassie blue staining following gel electrophoresis, Lowry protein assay, and Bradford protein assay.
  • a “host cell” is a cell that is used to receive, maintain, reproduce and/or amplify a vector. A host cell also can be used to express the polypeptide encoded by the vector.
  • a “vector” is a replicable nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into an appropriate host cell.
  • Reference to a vector includes those vectors into which a nucleic acid encoding a polypeptide or fragment thereof can be introduced, typically by restriction digest and ligation.
  • Reference to a vector also includes those vectors that contain nucleic acid encoding a polypeptide, such as a modified anti-CTLA-4 antibody.
  • the vector is used to introduce the nucleic acid encoding the polypeptide into the host cell for amplification of the nucleic acid, or for expression/display of the polypeptide encoded by the nucleic acid.
  • the vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome.
  • vectors that are artificial chromosomes such as yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vehicles are well-known to those of skill in the art.
  • a vector also includes “virus vectors” or “viral vectors.”
  • Viral vectors are engineered viruses that are operatively linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells.
  • an “expression vector” includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments. Such additional segments can include promoter and terminator sequences, and optionally can include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or can contain elements of both.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA.
  • Appropriate expression vectors are well- known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
  • “primary sequence” refers to the sequence of amino acid residues in a polypeptide, or the sequence of nucleotides in a nucleic acid molecule.
  • sequence identity refers to the number of identical or similar amino acids or nucleotide bases in a comparison between a test and a reference poly- peptide or polynucleotide. Sequence identity can be determined by sequence alignment of nucleic acid or protein sequences to identify regions of similarity or identity. For purposes herein, sequence identity is generally determined by alignment to identify identical residues. The alignment can be local or global. Matches, mismatches and gaps can be identified between compared sequences. Gaps are null amino acids or nucleotides inserted between the residues of aligned sequences so that identical or similar characters are aligned. Generally, there can be internal and terminal gaps.
  • sequence identity can be determined with no penalty for end gaps (e.g., terminal gaps are not penalized).
  • sequence identity can be determined without taking into account gaps, as the number of identical positions/length of the total aligned sequence x 100.
  • a “global alignment” is an alignment that aligns two sequences from beginning to end, aligning each letter in each sequence only once. An alignment is produced, regardless of whether or not there is similarity or identity between the sequences. For example, 50% sequence identity based on “global alignment” means that in an alignment of the full sequence of two compared sequences each of 100 nucleotides in length, 50% of the residues are the same.
  • Exemplary programs for performing global alignment are publicly available and include the Global Sequence Alignment Tool available at the National Center for Biotechnology Information (NCBI) website (ncbi.nlm.nih.gov/), and the program available at deepc2.psi.iastate.edu/aat/align/align.html.
  • a “local alignment” is an alignment that aligns two sequences, but only aligns those portions of the sequences that share similarity or identity. Hence, a local alignment determines if sub-segments of one sequence are present in another sequence. If there is no similarity, no alignment will be returned. Local alignment algorithms include BLAST, or the Smith-Waterman algorithm (Adv. Appl. Math.2:482 (1981)).
  • sequence identity can be determined by standard alignment algorithm programs used with default gap penalties established by each supplier.
  • Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl.
  • nucleic acid molecules have nucleotide sequences, or any two polypeptides have amino acid sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% “identical,” or other similar variations reciting a percent identity, can be determined using known computer algorithms based on local or global alignment (see, e.g., wikipedia.org/wiki/Sequence_alignment_software, providing links to dozens of known and publicly available alignment databases and programs).
  • the full-length sequence of each of the compared polypeptides or nucleotides is aligned across the full-length of each sequence in a global alignment. Local alignment also can be used when the sequences being compared are substantially the same length. Therefore, as used herein, the term “identity” represents a comparison or alignment between a test and a reference polypeptide or polynucleotide. In one non- limiting example, “at least 90% identical to” refers to percent identities from 90% to 100% relative to the reference polypeptide or polynucleotide.
  • Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polypeptide or polynucleotide length of 100 amino acids or nucleotides are compared, no more than 10% (i.e., 10 out of 100) of amino acids or nucleotides in the test polypeptide or polynucleotide differ from those of the reference polypeptide or polynucleotide. Similar comparisons can be made between a test and reference polynucleotide.
  • differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence, or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g., 10/100, amino acid differences (approximately 90% identity). Differences also can be due to deletions or truncations of amino acid residues. Differences are defined as nucleic acid or amino acid substitutions, insertions or deletions. Depending on the length of the compared sequences, at the level of homologies or identities above about 85-90%, the result can be independent of the program and gap parameters set; such high levels of identity can be assessed readily, often without relying on software.
  • a “disease or disorder” refers to a pathological condition in an organism resulting from a cause or condition, including, but not limited to, infections, acquired conditions, and genetic conditions, and that is characterized by identifiable symptoms.
  • “treating” a subject with a disease or condition means that the subject’s symptoms are partially or totally alleviated, or remain static following treatment.
  • “treatment” refers to any effects that ameliorate symptoms of a disease or disorder. Treatment encompasses prophylaxis, therapy and/or cure. Treatment also encompasses any pharmaceutical use of any immunostimulatory bacterium or composition provided herein.
  • prophylaxis refers to prevention of a potential disease and/or a prevention of worsening of symptoms or of progression of a disease.
  • prevention or prophylaxis, and grammatically equivalent forms thereof refers to methods in which the risk or probability of developing a disease or condition is reduced.
  • a “pharmaceutically effective agent” includes any therapeutic agent or bioactive agent, including, but not limited to, for example, anesthetics, vasoconstrictors, dispersing agents, and conventional therapeutic drugs, including small molecule drugs and therapeutic proteins.
  • a “therapeutic effect” means an effect resulting from treatment of a subject that alters, typically improves or ameliorates, the symptoms of a disease or condition, or that cures a disease or condition.
  • a “therapeutically effective amount” or a “therapeutically effective dose” refers to the quantity of an agent, compound, material, or composition containing a compound that is at least sufficient to produce a therapeutic effect following administration to a subject. Hence, it is the quantity necessary for preventing, curing, ameliorating, arresting, or partially arresting, a symptom of a disease or disorder.
  • therapeutic efficacy refers to the ability of an agent, compound, material, or composition containing a compound to produce a therapeutic effect in a subject to whom the agent, compound, material, or composition containing a compound has been administered.
  • a “prophylactically effective amount” or a “prophylactically effective dose” refers to the quantity of an agent, compound, material, or composition containing a compound, that when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset or reoccurrence, of disease or symptoms, reducing the likelihood of the onset or reoccurrence, of disease or symptoms, or reducing the incidence of viral infection.
  • a prophylactically effective amount can be administered in one or more administrations.
  • amelioration of the symptoms of a particular disease or disorder by a treatment refers to any lessening, whether permanent or temporary, lasting or transient, of the symptoms, that can be attributed to or associated with administration of the composition or therapeutic.
  • an “anti-cancer agent” or “an anti-cancer therapeutic” refers to any agent or therapeutic that is destructive or toxic, either directly or indirectly, to malignant cells and tissues.
  • anti-cancer agents include agents that kill cancer cells or otherwise inhibit or impair the growth of tumors or cancer cells.
  • exemplary anti-cancer agents are chemotherapeutic agents, and immunotherapeutic agents.
  • therapeutic activity refers to the in vivo activity of a therapeutic product, such as a polypeptide, a nucleic acid molecule, and other therapeutic molecules. Generally, the therapeutic activity is the activity that is associated with treatment of a disease or condition.
  • the term “subject” refers to an animal, including a mammal, such as a human being.
  • a patient refers to a human subject.
  • animal includes any animal, such as, but not limited to, primates, including humans, gorillas and monkeys; rodents, such as mice and rats; fowl, such as chickens; ruminants, such as goats, cows, deer, and sheep; and pigs and other animals.
  • Non-human animals exclude humans as the contemplated animal.
  • the polypeptides provided herein are from any source, animal, plant, prokaryotic and fungal. Most polypeptides are of animal origin, including mammalian origin.
  • a “composition” refers to any mixture. It can be a solution, suspension, liquid, powder, paste, aqueous, non-aqueous, or any combination thereof.
  • a “combination” refers to any association between or among two or more items.
  • the combination can be two or more separate items, such as two compositions or two collections, a mixture thereof, such as a single mixture of the two or more items, or any variation thereof.
  • the elements of a combination are generally functionally associated or related.
  • “combination therapy” refers to administration of two or more different therapeutics.
  • the different therapeutic agents can be provided and administered separately, sequentially, intermittently, or can be provided in a single composition.
  • a “kit” is a packaged combination that optionally includes other elements, such as additional reagents and instructions for use of the combination or elements thereof, for a purpose including, but not limited to, activation, administration, diagnosis, and assessment of a biological activity or property.
  • a “unit dose form” refers to physically discrete units suitable for human and animal subjects and packaged individually, as is known in the art.
  • a “single dosage formulation” refers to a formulation for direct administration.
  • a “multi-dose formulation” refers to a formulation that contains multiple doses of a therapeutic agent and that can be directly administered to provide several single doses of the therapeutic agent.
  • the doses can be administered over the course of minutes, hours, weeks, days, or months.
  • Multi-dose formulations can allow dose adjustment, dose-pooling and/or dose-splitting. Because multi-dose formulations are used over time, they generally contain one or more preservatives to prevent microbial growth.
  • an “article of manufacture” is a product that is made and sold. As used throughout this application, the term is intended to encompass any of the compositions provided herein contained in articles of packaging.
  • a “fluid” refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams, and other such compositions.
  • an isolated or purified polypeptide or protein e.g., an isolated antibody or antigen-binding fragment thereof
  • a biologically-active portion thereof e.g., an isolated antigen-binding fragment
  • an isolated or purified polypeptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue from which the polypeptide or protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • Preparations can be determined to be substantially free if they appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), that are used by those of skill in the art to assess such purity, or are sufficiently pure such that further purification does not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
  • TLC thin layer chromatography
  • HPLC high performance liquid chromatography
  • a “cellular extract” or “lysate” refers to a preparation or fraction which is made from a lysed or disrupted cell.
  • “persistent viral infections” are those in which the virus is not cleared, but remains in specific cells of infected individuals. Persistent infections involve stages of silent and productive infection without rapidly killing or even producing excessive damage of the host cells. There are three types of overlapping persistent virus-host interactions that may be defined as latent, chronic, and slow infections.
  • AIDS acquired immunodeficiency syndrome
  • AIDS-related complexes chronic hepatitis
  • subacute sclerosing panencephalitis chronic measles encephalitis
  • chronic papovavirus encephalitis progressive multifocal leukoencephalopathy
  • spongiform encephalopathies caused by prions
  • several herpesvirus-induced diseases and some neoplasias.
  • Viruses that cause these and other infections include, for example, herpesviruses, varicella-zoster virus (VZV), measles virus, human T-cell leukemia viruses (HTLVs), human immunodeficiency virus (HIV), human papovaviruses, human parvoviruses, human papillomaviruses, hepatitis viruses, adenoviruses, and parvoviruses.
  • VZV varicella-zoster virus
  • HTLVs human T-cell leukemia viruses
  • HIV human immunodeficiency virus
  • human papovaviruses human parvoviruses
  • human papillomaviruses hepatitis viruses
  • adenoviruses and parvoviruses.
  • a “control” refers to a sample that is substantially identical to the test sample, except that it is not treated with a test parameter, or, if it is a plasma sample, it can be from a normal volunteer not affected
  • “about 5 amino acids” means “about 5 amino acids” and also “5 amino acids.”
  • “optional” or “optionally” means that the subsequently described event or circumstance does or does not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
  • an optionally variant portion means that the portion is variant or non-variant.
  • the abbreviations for any protective groups, amino acids and other compounds are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, Biochem. (1972) 11(9):1726-1732). For clarity of disclosure, and not by way of limitation, the detailed description is divided into the subsections that follow. B.
  • Some bacterial species can be engineered to be orally and systemically (intravenously; IV) administered, they propagate readily in vitro and in vivo, and they can be stored and transported in a lyophilized state.
  • Bacterial chromosomes readily can be manipulated as they lack exons, and the complete genomes for numerous strains have been fully characterized (Felgner et al. (2016) mBio 7(5):e01220-16).
  • Many types of bacteria are cheaper and easier to produce than viruses, and proper delivery of engineered bacteria can be favorable over viral delivery because they do not permanently integrate into host cell genomes, they preferentially infect myeloid cells over epithelial cells, and they can be rapidly eliminated by antibiotics if necessary, rendering them safe.
  • immunostimulatory bacteria that are modified to exploit these advantageous properties.
  • the bacteria provided herein are modified so that they infect and accumulate in the tumor microenvironment, particularly in tumor-resident immune cells (myeloid cells), such as tumor-associated macrophages (TAMs), dendritic cells (DCs), and myeloid-derived suppressor cells (MDSCs), and also are designed to express and deliver high levels of therapeutic proteins and combinations, particularly complementary combinations, thereof.
  • myeloid cells tumor-resident immune cells
  • TAMs tumor-associated macrophages
  • DCs dendritic cells
  • MDSCs myeloid-derived suppressor cells
  • the immunostimulatory bacteria provided herein can be used as vaccines to prevent and/or treat cancers and also as vaccines against pathogens, including bacterial, viral, parasitic, and other pathogens.
  • the immunostimulatory bacteria provided herein have advantageous properties that are superior to existing bacterial therapies, and also cell therapies, oncolytic virus therapies, and prior bacterial therapies.
  • the immunostimulatory bacteria provided herein while they can be administered by any suitable route, are suitable for systemic, such as intravenous, administration.
  • the immunostimulatory bacteria provided herein can target major immune pathways.
  • immunostimulatory bacteria that can be used or adapted as an anti-cancer therapeutics as well as an anti-cancer vaccines and pathogen vaccines, and also RNA delivery vehicles. The particular use can be selected based on the particular genome modifications and payloads.
  • immunostimulatory bacteria that delivers a genetic payload encoding one or more therapeutic products, including, for example, a truncated co-stimulatory molecule (receptor or ligand; e.g., 4-1BBL, CD80/CD86, CD27L, B7RP1, OX40L) with a complete or partial cytoplasmic domain deletion, for expression on an antigen-presenting cell (APC), where the truncated gene product is capable of constitutive immunostimulatory signaling to a T- cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the APC, due to a deleted or truncated cytoplasmic domain.
  • a truncated co-stimulatory molecule e.g., 4-1BBL, CD80/CD86, CD27L, B7RP1, OX40L
  • APC antigen-presenting cell
  • the immunostimulatory bacteria can encode a plurality of products include those that constitutively induce type I interferon (IFN) and those that stimulate anti-viral type of immune responses, such as IL-15, particularly IL-15 provided a IL-15/IL-15R alpha chain complex (IL-15 complex), and engineered STING proteins that constitutively induce type I IFN, and also be modified to have reduced NF- ⁇ B signaling to eliminate or reduce undesirable inflammatory responses.
  • IFN type I interferon
  • IL-15 complex IL-15/IL-15R alpha chain complex
  • the immunostimulatory bacteria can encode and express one or more of IL-2, IL-7, IL-12p70 (IL-12p40 + IL-12p35), IL-12, IL-15, IL-15/IL-15R ⁇ chain complex, IL-18, IL-21, IL-23, IL-36 ⁇ , interferon- ⁇ , interferon- ⁇ , IL-2 that has attenuated binding to IL-2Ra, IL-2 that is modified so that it does not bind to IL-2Ra, CXCL9, CXCL10, CXCL11, CCL3, CCL4, CCL5, cytosolic DNA/RNA sensors or type I IFN pathway proteins, such as gain-of-function of constitutively active STING, IRF3, IRF7, MDA5, or RIG-I variants (that induce Type I IFN), inhibitors of TGF-beta, such as TGF- ⁇ inhibitory antibodies, TGF-beta polypeptide antagonists, and TGF- beta binding decoy receptors, antibodies and fragments
  • the immunostimulatory bacteria also can encode and express a truncated co-stimulatory molecule (e.g., 4-1BBL, CD80/CD86, CD27L, B7RP1, OX40L) with a complete or partial cytoplasmic domain deletion, for expression on an antigen-presenting cell (APC), where the truncated gene product is capable of constitutive immuno- stimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the APC, due to a deleted or truncated cytoplasmic domain.
  • a truncated co-stimulatory molecule e.g., 4-1BBL, CD80/CD86, CD27L, B7RP1, OX40L
  • APC antigen-presenting cell
  • the immunostimulatory bacteria exhibit tumor-specific localization and enrichment, and provide intravenous (IV) administration for activation of anti-tumor immune pathways that are otherwise toxic if systemically activated.
  • the immunostimulatory bacteria provided herein are genetically designed to be safe and to target tumors, the tumor microenvironment, and/or tumor-resident immune cells, and also to phagocytic cells when administered as vaccines, such as by direct administration.
  • the immunostimulatory bacteria provided herein include a combination of genomic modifications and other modifications, as well as encoded therapeutic products, that function in concert to provide immunostimulatory bacteria that accumulate in tumor-resident immune cells, and that persist sufficiently long enough to deliver therapeutic products, particularly combinations that induce or promote anti-cancer immune stimulation in tumors and the tumor microenvironment, without toxic side-effects, or with limited toxic side-effects.
  • the immunostimulatory bacteria When delivered systemically, such as intravenously (IV), the immunostimulatory bacteria enrich in tumors, including in metastatic lesions; they provide efficient genetic transfer of immune payloads, specifically to tumor-resident myeloid cells, including tumor-associated macrophages (TAMs), myeloid-derived suppressor cells (MDSCs), and dendritic cells (DCs); they induce powerful, local immune responses, destroying tumors and vaccinating against future recurrence; and, when therapy is finished, they are naturally eliminated, such as by phagocytosis and destruction by the infected cells, or they can be destroyed rapidly by a course of antibiotics.
  • TAMs tumor- associated macrophages
  • MDSCs myeloid-derived suppressor cells
  • DCs dendritic cells
  • the immunostimulatory bacteria provided herein exhibit preferential accumulation in the tumor microenvironment and/or in tumor-resident immune cells due to a designed purine/adenosine auxotrophy, and exhibit an inability to replicate inside of phagocytic cells.
  • Immunostimulatory bacteria that avoid inactivation by serum complement allow for the delivery of a variety of immunotherapeutic agents and therapeutic products at high concentrations, directly within the tumor microenvironment, while minimizing toxicity to normal tissues, and are provided herein.
  • the immunostimulatory bacteria provided herein include one or more modifications of the genome that render them msbB-/pagP-, which alters the lipid A in LPS, resulting in penta-acylation (wild-type lipid A has 6-7 fatty acid chains), reducing the TLR4 affinity; are adenosine/adenine auxotrophs, such as purI-; are asparaginase II- (ansB-), which improves T-cell quality; are lacking in flagella (flagellin deficient), are deficient in genes/products that produce curli fimbriae, such as csgD-, which, among other properties, removes curli fimbriae; and include other optional genomic modifications, such as insertions, deletions, disruptions, and any other modification, so that the encoded product(s) is(are) not produced in active form, as discussed in detail herein.
  • the immunostimulatory bacteria include a plasmid that encodes one or more therapeutic products, particularly anti-cancer products, under control of a eukaryotic promoter. These same modifications and properties render them useful as vaccines and as delivery vehicles for RNA, for use as cancer therapeutics and cancer vaccines, and pathogen vaccines, particularly when delivered by direct administration, such as by inhalation, and IM, and other direct routes for delivery of payloads to phagocytic cells.
  • the immunostimulatory bacteria provided herein include genome modifications, such as deletions, disruptions, and other alterations that result in inactive encoded product(s), such as changing the orientation of all or part of the gene, so that functional gene product(s) is/are not expressed.
  • the immunostimulatory bacteria are those that are modified so that the resulting bacteria are msbB-/purI-.
  • the bacteria are msbB- and purI-, whereby the full length of at least the coding portion of the msbB and/or purI genes are/is deleted.
  • the genome of the bacteria also can be modified so that the bacteria lack flagella. This is effected in bacteria that normally express flagella.
  • the fliC and fljB genes in Salmonella, or equivalent genes in other species to fliC and fljB can be deleted or otherwise modified so that functional gene product is not expressed.
  • the bacteria also can be modified so that they are adenosine auxotrophs, and/or are msbB-/pagP-. Also provided are immunostimulatory bacteria and pharmaceutical compositions containing them, where the bacteria do not express L-asparaginase II, whereby the bacteria are ansB-. Elimination of the encoded asparaginase activity improves or retains T-cell viability/activity.
  • Therapeutic bacteria such as inactivated or attenuated bacteria that are used as vaccines, can be improved by modifying the genome to eliminate asparaginase activity. Exemplary of such vaccines is the Bacillus Calmette-Guérin (BCG) vaccine and related vaccines, used to immunize against tuberculosis.
  • BCG Bacillus Calmette-Guérin
  • the BCG vaccine is known to have variable effectiveness; eliminating the asparaginase can improve the effectiveness of such vaccine because the endogenouse bacterial asparaginase inhibits or reduces T-cell activity.
  • the immunostimulatory bacteria provided herein, that deliver therapeutic products (such as constitutively active STING variants and other immunomodulatory proteins and products), to the tumor-resident myeloid cells promote adaptive immunity and enhance T-cell function.
  • the immunostimulatory bacteria lead to a complete remodeling of the immunosuppressive tumor microenvironment, towards an adaptive anti-tumor phenotype, and away from a bacterial phenotype, which is characterized by the promotion of innate immunity and the suppression of adaptive immunity.
  • Immunostimulatory bacteria can exhibit significantly more, such as at least about 100,000-fold greater, tumor infiltration and enrichment, compared to unmodified bacteria, or compared to strain VNP20009.
  • the bacteria provided herein contain genome modifications whereby they infect macrophage in tumors (and other phagocytic cells when administered as vaccines) to deliver their payload, such as the combination of engineered STING (see discussion throughout regarding the various engineered STING proteins, such as the human STING with gain-of-function mutations, such as N154S/R284G, to render induction of type I IFN constitutive, and the CTT from a non-human STING that has lower NF- ⁇ B signaling activity, such as the CTT from Georgian devil, compared to human STING, and IL-15 in various forms, particularly IL-15/IL-15R alpha chain complex (IL-15 complex).
  • engineered STING see discussion throughout regarding the various engineered STING proteins, such as the human STING with gain-of-function mutations, such as N154S/R284G, to render induction of type I IFN constitutive
  • the CTT from a non-human STING that has lower NF- ⁇ B signaling activity such as the CTT
  • TAMs tumor-activated macrophages
  • the immunostimulatory bacteria provided herein are consumed by tumor- resident immune cells, and deliver their contents, including the plasmid encoding thetherapeutic products, which are expressed and produced in the immune cells and tumor microenvironment, to generate anti-tumor immunity.
  • Bacteria that are asd- and that do not include a complementing gene encoded on the plasmid for expression under host cell control, do not replicate in the host.
  • Bacteria are provided that are thyA-, by virtue of genome modifications, such as deletion, insertion, transposition, or modification resulting in inactive or missing gen product, requiring thymine supplementation for growth, similarly deliver payloads into phagocytic cells, but cannot replicate in such cells. 1.
  • Bacterial Cancer Immunotherapy Many solid tumor types have evolved a profoundly immunosuppressive microenvironment that renders them highly refractory to approved checkpoint therapies, such as anti-CTLA-4, anti-PD-1 and anti-PD-L1 therapies.
  • Tumors initiate multiple mechanisms to evade immune surveillance, reprogram anti-tumor immune cells to suppress immunity, exclude and inactivate anti- tumor T-cells, and develop emerged resistance to the targeted cancer therapies (see, e.g., Mahoney et al. (2015) Nat. Rev. Drug Discov.14(8):561-584). Solving this problem will require immunotherapies that can properly inflame these tumors, and generate anti-tumor immunity that can provide long-lasting tumor regressions. In addition, intratumoral therapies are intractable and will be quite limiting in a metastatic disease setting.
  • CAR-T cells chimeric antigen receptors T-cells
  • Ig variable extracellular domain specific for a particular tumor antigen This confers upon the cells the antigen-recognition properties of antibodies with the cytolytic properties of activated T-cells (see, e.g., Sadelain et al. (2015) J. Clin.
  • Tumors can mutate rapidly to downregulate the targeted tumor antigens for solid tumors, including the antigen CD19, thereby fostering immune escape (see, e.g., Mardiana et al. (2019) Sci. Transl. Med.11(495):eaaw2293).
  • Solid tumor targets that are not expressed in healthy tissue are a major impediment to CAR-T therapy. Beyond that, CAR-T therapies suffer from other impediments to accessing solid tumor microenvironments, due to the lack of sufficient T-cell chemokine gradients, which are required for proper T-cell infiltration into tumors.
  • OVs Viral Vaccine Platforms
  • Oncolytic viruses have natural and engineered properties to induce tumor cell lysis, recruit T-cells to the tumor, and deliver genetic material that can be read by tumor cells to produce immunomodulatory proteins.
  • T-VEC Talimogene laherparepvec
  • T-VEC is a modified herpes simplex virus encoding anti-melanoma antigens and the cytokine GM-CSF (granulocyte-macrophage colony-stimulating factor), that is intratumorally administered. It is FDA-approved for metastatic melanoma (see, e.g., Bastin et al. (2016) Biomedicines 4(3):21).
  • T-VEC has demonstrated clinical benefit for some melanoma patients, and with fewer immune toxicities than the immune checkpoint antibodies or the FDA-approved systemic cytokines, such as IL-2 and interferon- alpha (see, e.g., Kim et al. (2006) Cytokine Growth Factor Rev.17(5):349-366; and Paul et al. (2015) Gene 567(2):132-137).
  • Oncolytic viruses possess a number of limitations as anti-cancer therapies. First, oncolytic viruses are rapidly inactivated by the human complement system in blood. It has proven difficult to deliver enough virus through systemic administration to have a desired therapeutic effect.
  • Intratumoral delivery is limiting in a metastatic setting (where lesions are spread throughout the body), is intractable for most solid tumor types (e.g., lung and visceral lesions), and requires interventional, guided radiology for injection, which limits repeat dosing.
  • Viruses can be difficult to manufacture at commercial scale and to store.
  • Oncolytic viruses are inherently immunogenic and rapidly cleared from human blood, and T-cells that traffic into the tumor have a much higher affinity for viral antigens over weaker tumor neoantigens (see, e.g., Aleksic et al. (2012) Eur. J. Immunol. 42(12):3174-3179).
  • OVs can have limited capacity to stimulate durable anti-tumor immunity (see, e.g., Kedl et al.(2003) Curr Opinion Immunol.15:120-127; and Aleksic et al., (2012) Eur. J.
  • the bacterial strains are attenuated so that they do not cause systemic disease and/or septic shock, but still maintain some level of infectivity for effective tumor colonization, and resistance to inactivation by complement.
  • a number of different bacterial species including Clostridium (see, e.g., Dang et al. (2001) Proc. Natl. Acad. Sci. U.S.A.98(26):15155-15160; U.S. Patent Publication Nos.2017/0020931 and 2015/0147315; and U.S. Patent Nos.7,344,710 and 3,936,354), Mycobacterium (see, e.g., U.S.
  • Patent Publication Nos.2015/0224151 and 2015/0071873) Bifidobacterium (see, e.g., Dang et al. (2001); and Kimura et al. (1980) Cancer Res.40:2061-2068), Lactobacillus (see, e.g., Dang et al. (2001)), Listeria monocytogenes (see, e.g., Le et al. (2012) Clin. Cancer Res.18(3):858-868; Starks et al. ( Immunol.173:420-427; and U.S. Patent Publication No. 2006/0051380) and Escherichia coli (see, e.g., U.S.
  • Patent No.9,320,787 have been studied as possible agents for anti-cancer therapy.
  • the immunostimulatory bacteria provided herein include genome modifications that address problems with prior bacteria developed for treating tumors. Modifications generally include changes in the genome that render a gene or gene product inactive. This can be effected by deleting a gene or a portion thereof, or disrupting a gene, or any other such change that results in an inactive product.
  • the genome modifications improve the targeting to or accumulation of bacteria in the tumor microenvironment, and in particular, are designed so that the bacteria preferentially or only infect tumor-resident immune cells and do not infect healthy tissues, thereby decreasing toxicity and improving delivery of encoded products.
  • the immunostimulatory bacteria also are designed to deliver therapeutic products, including combinations thereof, designed to eliminate immune suppressive effects of tumors, enhance a host’s anti-tumor response, and provide anti-tumor products.
  • Listeria Listeria monocytogenes a live attenuated intracellular bacterium capable of inducing potent CD8 + T-cell priming to expressed tumor antigens in mouse models of cancer, has also been explored as a bacterial cancer vector (see, e.g., Le et al. (2012) Clin. Cancer Res.18(3):858-868). In a clinical trial of the L.
  • monocytogenes also has shown limited immune responses to the encoded tumor antigens due to the requirement for bacteria to be lysed after phagocytosis, a pre- requisite to efficient plasmid transfer, which has not been demonstrated to occur by L. monocytogenes in human macrophages.
  • Salmonella Species Salmonella enterica serovar Typhimurium (S. typhimurium) is exemplary of a bacterial species for use as an anti-cancer therapeutic. S.
  • typhimurium is a Gram- negative facultative anaerobe, which preferentially accumulates in hypoxic and necrotic areas due to the availability of nutrients from tissue necrosis, the leaky tumor vasculature, and their increased likelihood to survive in the immunosuppressed tumor microenvironment (see, e.g., Baban et al. (2010) Bioengineered Bugs 1(6):385-394).
  • a facultative anaerobe S. typhimurium is able to grow under aerobic and anaerobic conditions, and is therefore able to colonize both small tumors that are less hypoxic, and large tumors that are more hypoxic.
  • S. typhimurium transmission through the fecal-oral route causes localized gastrointestinal infections.
  • the bacterium can also enter the bloodstream and lymphatic system, infecting systemic tissues such as the liver, spleen and lungs.
  • Systemic administration of wild-type S. typhimurium overstimulates TNF- ⁇ and IL-6, leading to a cytokine cascade and septic shock, which, if left untreated, can be fatal.
  • pathogenic bacterial strains such as S. typhimurium, must be attenuated to prevent systemic infection, without completely suppressing their ability to effectively colonize tumor tissues.
  • S. typhimurium is an intracellular pathogen that is rapidly taken up by phagocytic myeloid cells such as macrophages, or it can directly invade non- phagocytic cells, such as epithelial cells, through its Salmonella pathogenicity island 1 (SPI-1)-encoded type III secretion system (T3SS1).
  • SPI-1 Salmonella pathogenicity island 1
  • T3SS1 Salmonella pathogenicity island 1
  • S. typhimurium has been described as anti-tumor agents to elicit direct tumoricidal effects and/or to deliver tumoricidal molecules (see, e.g., Clairmont et al. (2000) J. Infect. Dis.181:1996-2002; Bermudes, D. et al. (2002) Curr.
  • Attenuation of Salmonella and other species can be achieved by deletion or disruption of the aroA gene, which is part of the shikimate pathway, connecting glycolysis to aromatic amino acid biosynthesis (see, e.g., Felgner et al. (2016) mBio 7(5):e01220-16). Deletion or disruption of aroA results in bacterial auxotrophy for aromatic amino acids and subsequent attenuation (see, e.g., U.S. Patent Publication Nos.2003/0170276, 2003/0175297, 2012/0009153, and 2016/0369282; and International Application Publication Nos.
  • S. typhimurium strain SL7207 is an aromatic amino acid auxotroph (aroA- mutant), and strains A1 and A1-R are leucine-arginine auxotrophs.
  • Mutations that attenuate bacteria also include, but are not limited to, mutations in genes that alter the biosynthesis of lipopolysaccharide (LPS), such as rfaL, rfaG, rfaH, rfaD, rfaP, rFb, rfa, msbB, htrB, firA, pagL, pagP, lpxR, arnT, eptA, and lpxT; mutations that introduce a suicide gene, such as sacB, nuk, hok, gef, kil, or phlA; mutations that introduce a bacterial lysis gene, such as hly and cly; mutations in genes that encode virulence factors, such as IsyA, pag, prg, iscA, virG, plc, and act; mutations in genes that modify the stress response, such as recA, htrA, htpR, hsp, and
  • Attenuating mutations are gene deletions to prevent spontaneous compensatory mutations that might result in reversion to a virulent phenotype.
  • PhoP/PhoQ operon system is a typical bacterial two-component regulatory system, composed of a membrane-associated sensor kinase (PhoQ), and a cytoplasmic transcriptional regulator (PhoP)
  • PhoP/PhoQ operon system is a typical bacterial two-component regulatory system, composed of a membrane-associated sensor kinase (PhoQ), and a cytoplasmic transcriptional regulator (PhoP)
  • PhoP/PhoQ is required for virulence; its deletion results in poor survival of this bacterium in macrophages, and a marked attenuation in mice and humans (see, e.g., Miller, S. I. et al. (1989) Proc. Natl. Acad. Sci. U.S.A.86:5054- 5058; Groisman, E. A. et al. (1989) Proc. Natl. Acad. Sci. U.S.A.86:7077-7081; Galan, J. E. and Curtiss, R. III. (1989) Microb.
  • PhoP/PhoQ deletion strains have been employed as vaccine delivery vehicles (see, e.g., Galan, J. E. and Curtiss, R. III. (1989) Microb. Pathog.6:433-443; Fields, P. I. et al. (1986) Proc. Natl. Acad. Sci. U.S.A.83:5189-5193; and Angelakopoulos, H. and Hohmann, E. L. (2000) Infect. Immun.68:2135-2141).
  • typhimurium that have been attenuated for therapy are, for example, the leucine-arginine auxotroph A-1 (see, e.g., Zhao et al. (2005) Proc. Natl. Acad. Sci. U.S.A.102(3):755-760; Yu et al. (2012) Scientific Reports 2:436; U.S. Patent No.8,822,194; and U.S. Patent Publication No.2014/0178341) and its derivative AR-1 (see, e.g., Yu et al. (2012) Scientific Reports 2:436; Kawaguchi et al. (2017) Oncotarget 8(12):19065-19073; Zhao et al.
  • Patent Publication Nos.2012/0009153, 2016/0369282 and 2016/0184456), and its obligate anaerobe derivative YB1 see, e.g., International Application Publication No. WO 2015/032165; Yu et al. (2012) Scientific Reports 2:436; and Leschner et al. (2009) PLoS ONE 4(8):e6692; the aroA- /aroD- mutant S. typhimurium strain BRD509, a derivative of the SL1344 (wild-type) strain (see, e.g., Yoon et al. (2017) Eur. J. Cancer 70:48-61); the asd-/cya-/crp- mutant S.
  • the immunostimulatory bacteria such as the Salmonella strains exemplified herein, are attenuated by virtue of modifications, that can include some of those described above, but also have other modifications and properties described herein that enhance the effectiveness as a cancer therapeutic.
  • Attenuated strains of S. typhimurium possess the innate ability to deliver DNA following phagocytosis and degradation (see, e.g., Weiss, S. (2003) Int. J. Med. Microbiol.293(1):95-106). They have been used as vectors for gene therapy.
  • S. typhimurium strains have been used to deliver and express a variety of genes, including those that encode cytokines, angiogenesis inhibitors, toxins and prodrug-converting enzymes (see, e.g., U.S. Patent Publication No.2007/0298012; Loeffler et al. (2008) Cancer Gene Ther.15(12):787-794; Loeffler et al. (2007) Proc.
  • S. typhimurium has been modified to deliver the tumor-associated antigen (TAA) survivin (SVN) to antigen presenting cells (APCs) to prime adaptive immunity (see, e.g., U.S. Patent Publication No.2014/0186401; and Xu et al. (2014) Cancer Res.74(21):6260-6270).
  • TAA tumor-associated antigen
  • APCs antigen presenting cells
  • SVN is an inhibitor of apoptosis protein (IAP), which prolongs cell survival and provides cell cycle control, and is overexpressed in all solid tumors and poorly expressed in normal tissues.
  • IAP apoptosis protein
  • This technology uses SPI-2 and its type III secretion system to deliver the TAAs into the cytosol of APCs, which then are activated to induce TAA-specific CD8 + T-cells and anti-tumor immunity (see, e.g., Xu et al. (2014) Cancer Res.74(21):6260-6270). Similar to the Listeria-based TAA vaccines, this approach has shown promise in mouse models, but has not demonstrated effective tumor antigen-specific T-cell priming in humans. In addition to the delivery of DNA that encodes proteins, S. typhimurium also has been used for the delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) for cancer therapy. For example, attenuated S.
  • siRNAs small interfering RNAs
  • shRNAs short hairpin RNAs
  • typhimurium has been modified to express certain shRNAs, such as those that target the immunosuppressive gene indolamine dioxygenase (IDO).
  • IDO immunosuppressive gene indolamine dioxygenase
  • Silenced IDO expression in a murine melanoma model resulted in tumor cell death and significant tumor infiltration by neutrophils (see, e.g., Blache et al. (2012) Cancer Res.72(24):6447-6456; International Application Publication No. WO 2008/091375; and U.S. Patent No.9,453,227).
  • Co- administration of this vector with a hyaluronidase showed positive results in the treatment of murine pancreatic ductal adenocarcinoma (see, e.g., Manuel et al.
  • typhimurium strain SL7207 has been used for the delivery of shRNA targeting CTNNB1, the gene that encodes ⁇ -catenin (see, e.g., Guo et al. (2011) Gene Therapy 18:95-105; and U.S. Patent Publication Nos. 2009/0123426 and 2016/0369282).
  • the S. typhimurium strain VNP20009 has been used for the delivery of shRNA targeting STAT3 (see, e.g., Manuel et al. (2011) Cancer Res.71(12):4183-4191; U.S. Patent Publication Nos.2009/0208534, 2014/0186401 and 2016/0184456; and International Application Publication Nos.
  • siRNAs targeting the autophagy genes Atg5 and Beclin1 have been delivered to tumor cells using S. typhimurium strains A1- R and VNP20009 (see, e.g., Liu et al. (2016) Oncotarget 7(16):22873-22882). It has been found, however, that these strains do not effectively stimulate an anti-tumor immune response, nor effectively colonize tumors for delivery of therapeutic doses of encoded products. Improvement of such strains is needed so that they more effectively stimulate an anti-tumor immune response, such as the immunostimulatory bacteria provided herein. Further and alternative modifications of various bacteria have been described in published International PCT Application No.
  • VNP20009 YS1646
  • VNP20009 ATCC # 202165, YS1646
  • This virus was a clinical candidate.
  • VNP20009 ATCC # 202165, YS1646 was at least 50,000-fold attenuated for safety by deletion of the msbB and purI genes (see, e.g., Clairmont et al.
  • VNP20009 also is auxotrophic for the immunosuppressive nucleoside adenosine.
  • Adenosine can accumulate to pathologically high levels in the tumor and contribute to an immunosuppressive tumor microenvironment (see, e.g., Peter Vaupel and Arnulf Mayer, Oxygen Transport to Tissue XXXVII, Advances in Experimental Medicine and Biology 876 chapter 22, pp.177-183).
  • VNP20009 When VNP20009 was administered into mice bearing syngeneic or human xenograft tumors, the bacteria accumulated preferentially within the extracellular components of tumors at ratios exceeding 300-1000 to 1, and demonstrated tumor growth inhibition, as well as prolonged survival compared to control mice (see, e.g., Clairmont et al. (2000) J. Infect. Dis.181:1996-2002). VNP20009 demonstrated success in tumor targeting and tumor growth suppression in animal models, while eliciting very little toxicity (see, e.g., Broadway et al. (2014) J. Biotechnology 192:177-178; Loeffler et al. (2007) Proc. Natl. Acad. Sci.
  • the immunostimulatory bacteria provide numerous improvements and advantages that strain VNP20009 lacks.
  • the VNP20009 strain (YS1646) is used as the parental strain that is further modified by introduction of additional genome modifications, including those that eliminate flagella.
  • the strain also is improved by completely deleting purI and/or msbB.
  • the immunostimulatory bacteria are modified to include various payloads that stimulate the immune system and/or reduce immunosuppression and provide therapeutic products and immunizing antigens and products.
  • the immunostimulatory bacteria deliver encoded genetic payloads in a tumor- specific manner, to tumor-resident myeloid cells.
  • the immunostimulatory bacteria by virtue of genomic modifications, such as deletions or disruptions of genes, and other modifications of the genome, exhibit reduced TLR2-, TLR4-, and TLR5-mediated inflammation, for example, by virtue of the elimination of the flagella, the modifications of the LPS, and the elimination of the curli fimbriae and reduced biofilm formation.
  • elimination of TLR2, and also of TLR2/4/5- mediated activities and response promotes or enhances type I interferon production and/or reduces any reduction or inhibition of type I IFN that occurs when these receptors are activated or by virtue of TLR responses.
  • the immunostimulatory bacteria enhance T-cell function and activities and effects, such as by virtue of the elimination of the expression of L-asparaginase II, and facilitate, provide, permit, and support plasmid maintenance.
  • the bacteria accumulate in (or target) only, or substantially only, myeloid cells, particularly tumor-resident myeloid cells, providing highly efficient plasmid delivery after phagocytosis.
  • the immunostimulatory bacteria provided herein colonize the tumor microenvironment, and can be administered systemically.
  • the immunostimulatory bacteria provided herein exhibit at least 15-fold improved LD50 compared to VNP20009.
  • immunostimulatory bacteria can be administered without toxic effects, compared to VNP20009 (see, e.g., the table below in the section F.5. describing exemplary dosages and administration). It is shown and described herein that immunostimulatory bacteria modified as described herein, including elimination of flagella, LPS modifications, and other modifications, preferentially accumulate in or target myeloid cells, particularly tumor- resident myeloid cells. The Examples demonstrate that the immunostimulatory bacteria accumulate in such cells following systemic, such as intravenous, administration.
  • the Examples also describe and show plasmid transfer from the immunostimulatory bacteria into tumor-resident myeloid cells, and durable protein expression following bacterial cell death, thereby delivering therapeutic products, including products that result in an anti-cancer response and phenotype.
  • iv. Wild-Type Strains Accumulation of VNP20009 in tumors results from a combination of factors including: the inherent invasiveness of the parental strain, ATCC 14028, its ability to replicate in hypoxic environments, and its requirement for high concentrations of purines that are present in the interstitial fluid of tumors. As described herein, it is not necessary to use an attenuated strain, such a VNP20009, as a starting bacterial strain.
  • the bacteria are rendered non-toxic or attenuated.
  • the parental strain, ATCC 14028, or another wild-type strain can be used as a starting strain, and modified as described herein.
  • the immunostimulatory bacteria provided herein by virtue of genome modifications, infiltrate and colonize tumors and tumor-resident immune cells, and also tumor- resident macrophages. When used as vaccines in subjects who do not have tumors, the bacteria accumulate in phagocytic cells, such as macrophages. 3. Limitations of Prior Bacterial Cancer Immunotherapies As shown herein, and also evidenced in light of the knowledge in the art, TLRs inhibit or prevent induction of type I IFN.
  • the immunostimulatory bacteria provided herein include modifications the reduce or inhibit or eliminate TLR2/4/5 responses/activities, thereby overcoming the inhibition of type I IFN.
  • the immunostimulatory bacteria provided herein also include properties and/or payloads that enhance type I IFN expression or render type I IFN induction constitutive.
  • many classes of immunotherapies have significant limitations that limit their safety and efficacy, as well as complicated platforms that are not likely to be widely used.
  • Bacteria, particularly those provided herein have numerous advantageous properties for use as anti-cancer therapeutics, compared to, for example, oncolytic viruses. These include the ease with which they can be propagated, manufactured, stored, and eliminated from a host when treatment is completed. Viruses, however, also have advantageous properties, including the host response.
  • the response to a bacterial infection is an innate inflammatory response, which is not advantageous for an anti-cancer therapeutic.
  • the response to a viral infection is similar to an anti-cancer response. This is summarized in the following table.
  • a limitation of prior bacteria as a microbial anti-cancer platform thus, derives from the specific immune program that is initiated upon sensing of bacteria, even intracellular bacteria, by the immune system, compared to viral-sensing pathways, which are more akin to anti-cancer pathways.
  • the sensing programs that recognize viruses permit the generation of highly effective vaccines and durable adaptive immunity. Vaccinating against bacteria, however, has been met with limited success.
  • the FDA-approved vaccine for typhoid fever against Salmonella typhi is only 55% effective (see, e.g., Hart et al. (2016) PLoS ONE 11(1):e0145945), despite S. typhi containing a highly immunogenic Vi capsule and O:9 antigen, which do not occur in less immunogenic bacterial strains, such as L. monocytogenes and S. typhimurium, against which there are no vaccines.
  • Bacteria and viruses contain conserved structures known as Pathogen- Associated Molecular Patterns (PAMPs), which are sensed by host cell Pattern Recognition Receptors (PRRs).
  • PAMPs Pathogen- Associated Molecular Patterns
  • PRRs Pattern Recognition Receptors
  • PRRs Recognition of PAMPs by PRRs triggers downstream signaling cascades that result in the induction of cytokines and chemokines, and initiation of a specific immune response (see, e.g., Iwasaki and Medzhitov (2010) Science 327(5963):291-295).
  • a class of PRRs known as Toll Like Receptors (TLRs), recognize PAMPs derived from bacterial and viral origins, and are located in various compartments within the cell.
  • TLRs Toll Like Receptors
  • TLRs recognize a variety of ligands, including lipopolysaccharide (TLR4), lipoproteins (TLR2), flagellin (TLR5), unmethylated CpG motifs in DNA (TLR9), double-stranded RNA (TLR3), and single-stranded RNA (TLR7 and TLR8) (see, e.g., Akira et al. (2001) Nat. Immunol.2(8):675-680; and Kawai and Akira (2005) Curr. Opin. Immunol.17(4):338-344).
  • DNA and RNA-based viruses can be sensed either in host cytosolic compartments after phagocytosis, or directly in the cytosol.
  • Type I interferons are the signature cytokines induced by host recognition of single-stranded and double-stranded DNA and RNA, either of viral origin, or from the uptake of damaged host cell DNA.
  • the synthetic dsRNA analog polyinosinic:polycytidylic acid (poly(I:C)) is an agonist for endosomal TLR3; the more stable version, poly ICLC (such as that sold under the trademark Hiltonol®), of a dsRNA, has been in clinical development (see, e.g., Caskey et al. (2011) J. Exp. Med.208(12):2357-2366).
  • single-stranded RNA (ssRNA) in the endosome is sensed by TLR7 and TLR8 (only in humans), and its known synthetic ligands, resiquimod and imiquimod, are FDA-approved topical cancer immunotherapies.
  • dsRNA double-stranded RNA
  • RNA helicases such as retinoic acid-inducible gene I (RIG-I) and melanoma differentiation- associated gene 5 (MDA-5), leading to induction of type I IFN (see, e.g., Ireton and Gale (2011) Viruses 3(6):906-919).
  • the cytosolic sensor for dsDNA is mediated through Stimulator of Interferon Genes (STING), an ER-resident adaptor protein that is the central mediator for sensing cytosolic dsDNA from infectious pathogens or aberrant host cell damage (see, e.g., Barber (2011) Immunol. Rev.243(1):99-108).
  • STING signaling activates the TANK binding kinase 1 (TBK1)/ interferon regulatory factor 3 (IRF3) axis, and the NF- ⁇ B signaling axis, resulting in the induction of IFN- ⁇ and other pro-inflammatory cytokines and chemokines that strongly activate innate and adaptive immunity (see, e.g., Burdette et al.
  • cytosolic dsDNA through STING requires cyclic GMP-AMP synthase (cGAS), a host cell nucleotidyl transferase that directly binds dsDNA, and in response, synthesizes a cyclic dinucleotide (CDN) second messenger, cyclic GMP- AMP (cGAMP), which binds and activates STING (see, e.g., Sun et al. (2013) Science 339(6121):786-791; and Wu et al. (2013) Science 339(6121):826-830).
  • CDN cyclic dinucleotide
  • cGAMP cyclic GMP- AMP
  • STING also can bind to bacterially-derived CDNs, such as c-di-AMP produced from intracellular L. monocytogenes, or c-di-GMP from S. typhimurium.
  • Cyclic GMP-AMP synthase (cGAS) produces a non-canonical CDN that can activate human STING alleles that are non-responsive to bacterially-derived canonical CDNs.
  • the internucleotide phosphate bridge in the cGAMP synthesized by cGAS is joined by a non-canonical 2’-3’ linkage.
  • type I IFN signaling is required to induce T-cell trafficking chemokines, such as CXCL10, and also to activate DC cross-presentation of tumor antigens to prime CD8 + T-cells (see, e.g., Diamond et al. (2011) J. Exp. Med.208(10):1989–2003; and Fuertes et al. (2011) J. Exp. Med.208(10):2005–2016).
  • host surveillance of bacteria such as S.
  • TLR2 myeloid differentiation primary response protein 88
  • TLR4 MyD88-myeloid differentiation primary response protein 88
  • TRIF Toll/interleukin-1 receptor (TIR)-domain- containing adapter-inducing interferon- ⁇ ) adaptor molecules to mediate induction of the NF- ⁇ B-dependent pro-inflammatory cytokines TNF- ⁇ and IL-6 (see, e.g., Pandey et al. (2015) Cold Spring Harb. Perspect. Biol.7(1):a016246).
  • typhimurium was shown to activate the NLRP3 inflammasome pathway, resulting in the cleavage of caspase-1 and the induction of the pro-inflammatory cytokines IL-1 ⁇ and IL-18 that lead to pyroptotic cell death. Engagement of TLR2, TLR4 and TLR5, and inflammasome activation, induces chemokines and cytokines that lead to bacterial clearance by neutrophils and macrophages. Evidence that S. typhimurium is cleared by T-cells is limited, and antibodies that are generated against it are non-neutralizing (see, e.g., McSorley (2014) Immunol. Rev.260(1):168-182). Further, S.
  • typhimurium has mechanisms to directly suppress T-cell function, impairing any potential anti- tumor T-cell response from being generated (see, e.g., Kullas et al. (2012) Cell Host Microbe 12(6)791-798).
  • bacterial cancer therapies such as S. typhimurium, lead to recruitment and clearance by neutrophils and macrophages, which are not the T-cells that are required to generate adaptive anti-tumor immunity. It is described and shown herein that these differences can explain why prior bacterial anti-cancer vaccines, even those harboring host tumor antigens, are poor T-cell priming vectors in humans.
  • TLRs type I interferon (IFN), but is found and described herein that this dogma is not necessarily correct with respect to TLR2/3/4/5/7 in primary human monocyte-derived macrophages.
  • TLR agonists were performed using TLR agonists to assess the effects on type I IFN. The results showed that TLR3 and TLR4 agonists do not induce type I IFN in primary human monocytes unless pretreated with IFN ⁇ . Agonizing TLR2 does not induce type I IFN even with pretreatment with IFN ⁇ . In fact, TLR2 can inhibit induction of type I IFN. This is a heretofore unidentified problem with bacterial-based therapeutics. These problems are among those addressed by the immunostimulatory bacteria provided herein.
  • the immunostimulatory bacteria provided herein are engineered to have advantageous properties that were previously only provided by viral therapeutics, and also, to retain the advantageous properties of bacterial therapeutics.
  • the immunostimulatory bacteria provided herein can be systemically administered, can localize to tumors, tumor-resident immune cells, and/or the tumor microenvironment, overcome immunosuppression, and properly activate anti-tumor immunity, while also limiting the autoimmune-related toxicities of existing systemic immunotherapies.
  • the bacteria provided herein effectively localize to tumor-resident immune cells, and encode therapeutic anti-cancer products, and can encode a plurality of such products.
  • the bacteria provided herein can encode complementary therapeutic products.
  • the immunostimulatory bacteria provided herein are modified to reduce or eliminate activation of TLR2, 4 and 5.
  • Such immunostimulatory bacteria provided herein encode payloads that induce type I IFN. This finding is generalized such that vaccines and delivery vehicles that are provided herein are designed so that TLR2 response is eliminated or reduced so that it does not prevent or inhibit type I IFN. In some embodiments, TLR4 and 5 responses are reduced or eliminated, thereby providing vaccines and other immune-stimulating therapeutics that do not inhibit type I IFN.
  • a superior microbial anti-cancer, vaccine, RNA deliver platform engineered to retain the beneficial properties of bacteria, while eliciting a viral-like immune response that induces effective adaptive immunity.
  • bacteria such as strains of Salmonella and other species
  • bacteria can be modified as described herein to have reduced inflammatory effects, and thus, to be less toxic. As a result, for example, higher dosages can be administered.
  • the immunostimulatory bacteria provided herein are modified to have increased colonization of the tumor microenvironment, tumor-resident immune cells, and tumors. They are engineered so that they have reduced toxicity, and other properties that target them to the tumor microenvironment, including adenosine auxotrophy.
  • the strains provided herein also are engineered so that they are not inactivated by complement.
  • bacteria useful as vaccine platforms and as RNA delivery vehicles. They can be adapted for each use by virtue of the payloads selected, the regulatory sequences employed, depending upon whether bacterial or host cell transcriptional./translational machinery is to be used for expression of encoded products, and the locus of the host cells or tissues in which the products are produced.
  • the bacterial strains provided herein are engineered to deliver therapeutic products.
  • the bacterial strains herein deliver immunostimulatory proteins, including cytokines, chemokines and co-stimulatory molecules, as well as modified gain-of- function cytosolic DNA/RNA sensors that can constitutively evoke or induce type I IFN expression, and other therapeutic products, such as, but not limited to, antibodies and fragments thereof, TGF- ⁇ and IL-6 binding decoy receptors, TGF- ⁇ polypeptide antagonists, bispecific T-cell engagers (BiTEs®), RNAi, and complementary combinations thereof, that promote an anti-tumor immune response in the tumor microenvironment.
  • immunostimulatory proteins including cytokines, chemokines and co-stimulatory molecules, as well as modified gain-of- function cytosolic DNA/RNA sensors that can constitutively evoke or induce type I IFN expression
  • other therapeutic products such as, but not limited to, antibodies and fragments thereof, TGF- ⁇ and IL-6 binding decoy receptors, TGF- ⁇ polypeptide antagonists, bispecific T-cell
  • the bacterial strains also include genomic modifications that reduce pyroptosis of phagocytic cells, thereby providing for a more robust immune response, and/or reduce or eliminate the ability to infect/invade epithelial cells, but retain the ability to infect/invade phagocytic cells, so that they accumulate more effectively in tumors, the tumor microenvironment and in tumor-resident immune cells.
  • the bacterial strains also can be modified to be resistant to inactivation by complement factors in human serum.
  • the bacterial strains also can be modified to encode therapeutic products, including, alone or in combinations, for example, cytokines, chemokines, co-stimulatory molecules, constitutively active inducers of type I IFN, and monoclonal antibodies (and fragments thereof) to immune checkpoints, and also to other such targets.
  • therapeutic products including, alone or in combinations, for example, cytokines, chemokines, co-stimulatory molecules, constitutively active inducers of type I IFN, and monoclonal antibodies (and fragments thereof) to immune checkpoints, and also to other such targets.
  • an anti-cancer therapeutic product that delivers a genetic payload encoding a truncated co-stimulatory molecule (receptor or ligand; e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, OX40L), with a full or partial cytoplasmic domain deletion, for expression on an antigen-presenting cell (APC), where the truncated gene product is capable of constitutive immuno-stimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the APC due to a deleted or truncated cytoplasmic domain.
  • a truncated co-stimulatory molecule e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, OX40L
  • APC antigen-presenting cell
  • the bacteria also can encode antigens, such as tumor antigens, and pathogen antigens or proteins, in additional to (or in lieu of) the immunostimulatory protein(s), such as STING and cytokines.
  • antigens such as tumor antigens, and pathogen antigens or proteins
  • the immunostimulatory protein(s) such as STING and cytokines.
  • enhancements including modifications to the bacterial genome, or to the immunostimulatory bacteria, that, for example, reduce toxicity and improve the anti-tumor activity, such as by increasing accumulation in tumor-resident myeloid cells, improving resistance to complement inactivation, reducing immune cell death, promoting adaptive immunity, and enhancing T-cell function.
  • LPS lipopolysaccharide
  • O antigen is the outermost portion on LPS and serves as a protective layer against bacterial permeability, however, the sugar composition of O antigen varies widely between strains.
  • the lipid A and core oligosaccharide vary less, and are more typically conserved within strains of the same species.
  • Lipid A is the portion of LPS that contains endotoxin activity. It is typically a disaccharide decorated with multiple fatty acids. These hydrophobic fatty acid chains anchor the LPS into the bacterial membrane, and the rest of the LPS projects from the cell surface.
  • the lipid A domain is responsible for much of the toxicity of Gram-negative bacteria.
  • LPS in the blood is recognized as a significant pathogen associated molecular pattern (PAMP), and induces a profound pro-inflammatory response.
  • PAMP pathogen associated molecular pattern
  • LPS is the ligand for a membrane-bound receptor complex comprising CD14, MD2, and TLR4.
  • TLR4 is a transmembrane protein that can signal through the MyD88 and TRIF pathways to stimulate the NF- ⁇ B pathway and result in the production of pro-inflammatory cytokines, such as TNF- ⁇ and IL-6, the result of which can be endotoxic shock, which can be fatal.
  • LPS in the cytosol of mammalian cells can bind directly to the caspase recruitment domains (CARDs) of caspases 4, 5, and 11, leading to autoactivation and pyroptotic cell death (see, e.g., Hagar et al. (2015) Cell Research 25:149-150).
  • lipid A and the toxigenicity of lipid A variants is well documented.
  • a monophosphorylated lipid A is much less inflammatory than lipid A with multiple phosphate groups.
  • the number and length of the acyl chains on lipid A also can have a profound impact on the degree of toxicity.
  • Canonical lipid A from E. coli has six acyl chains, and this hexa-acylation is potently toxic.
  • S. typhimurium lipid A is similar to that of E. coli; it is a glucosamine disaccharide that carries four primary and two secondary hydroxyacyl chains (see, e.g., Raetz et al. (2002) Annu. Rev. Biochem.71:635-700).
  • msbB Deletion of The enzyme lipid A biosynthesis myristoyltransferase, encoded by the msbB gene in S. typhimurium, catalyzes the addition of a terminal myristoyl group to the lipid A domain of lipopolysaccharide (LPS) (see, e.g., Low et al. (1999) Nat. Biotechnol.17(1):37-41). Deletion of msbB, thus, alters the acyl composition of the lipid A domain of LPS, the major component of the outer membranes of Gram- negative bacteria. For example, deletion of msbB in the S.
  • LPS lipopolysaccharide
  • typhimurium strain VNP20009 results in the production of a predominantly penta-acylated lipid A, which is less toxic than native hexa-acylated lipid A, and allows for systemic delivery without the induction of toxic shock (see, e.g., Lee et al. (2000) International Journal of Toxicology 19:19-25).
  • This modification significantly reduces the ability of the LPS to induce septic shock, attenuating the bacterial strain, and thus, increasing the therapeutic index of Salmonella-based immunotherapeutics (see, e.g., U.S. Patent Publication Nos.2003/0170276, 2003/0109026, 2004/0229338, 2005/0255088, and 2007/0298012).
  • msbB mutants that do not express the msbB product are unable to replicate intracellularly, as exemplified herein (see, e.g., Example 2), which is a requirement for Salmonella virulence (see, e.g., Leung et al. (1991) Proc. Natl. Acad. Sci. U.S.A.88:11470-11474).
  • Other LPS mutations, including replacements, deletions, or insertions that alter LPS expression can be introduced into the bacterial strains provided herein, including the Salmonella strains, that dramatically reduce virulence, and thereby provide for lower toxicity, and permit the administration of higher doses.
  • the msbB- locus can be partially deleted, or interrupted, or translocated. It also can be completely deleted, which can improve growth of the strain.
  • Corresponding genes, encoding homologs or orthologs of lipid A biosynthesis myristoyltransferase in other bacterial species also can be deleted or disrupted to achieve similar results. These genes include, but are not limited to, for example, lpxM, encoding myristoyl-acyl carrier protein-dependent acyltransferase in E. coli; and msbB, encoding lipid A acyltransferase in S. typhi. b.
  • pagP Deletion or inactivation As described above, msbB mutants of S. typhimurium cannot undergo the terminal myristoylation of lipid A, and produce predominantly penta-acylated lipid A that is significantly less toxic than hexa-acylated lipid A.
  • the modification of lipid A with palmitate is catalyzed by the enzyme lipid A palmitoyltransferase (PagP).
  • PagP lipid A palmitoyltransferase
  • Transcription of the pagP gene is under control of the PhoP/PhoQ system, which is activated by low concentrations of magnesium, e.g., inside the SCV.
  • the acyl content of S is under control of the PhoP/PhoQ system, which is activated by low concentrations of magnesium, e.g., inside the SCV.
  • typhimurium lipid A is variable, and with wild-type bacteria, it can be hexa-acylated or penta-acylated.
  • the ability of S. typhimurium to palmitate its lipid A increases resistance to antimicrobial peptides that are secreted into phagolysosomes.
  • expression of pagP results in lipid A that is hepta-acylated.
  • msbB mutant in which the terminal acyl chain of the lipid A cannot be added
  • the induction of pagP results in a hexa-acylated lipid A (see, e.g., Kong et al.
  • Hexa-acylated lipid A has been shown to be the most pro-inflammatory. While groups have sought to exploit this pro-inflammatory signal, for example, by deletion or disruption of pagP to allow only hexa-acylated lipid A to be produced (see, e.g., Felgner et al. (2016) Gut Microbes 7(2):171-177; and Felgner et al. (2016) Oncoimmunology 7(2):e1382791), this can lead to poor tolerability, due to the TNF- ⁇ -mediated pro-inflammatory nature of the LPS, and paradoxically less adaptive immunity (see, e.g., Kocijancic et al.
  • LPS is a potent TLR4 agonist that induces TNF- ⁇ and IL-6.
  • the dose-limiting toxicities in the I.V. VNP20009 clinical trial (see, e.g., Toso et al. (2002) J. Clin. Oncol.20(1):142-152) at 1E9 CFUs/m 2 , were cytokine mediated (fever, hypotension), with TNF- ⁇ levels > 100,000 pg/ml, and IL-6 levels > 10,000 pg/ml in serum at 2 hours.
  • the LPS still can be toxic at high doses, possibly due to the presence of hexa-acylated lipid A.
  • a pagP-/msbB- strain which cannot produce hexa-acylated lipid A, and produces only penta-acylated lipid A, resulting in lower induction of pro- inflammatory cytokines, is better tolerated at higher doses, and will allow for dosing in humans at or above 1E9 CFUs/m 2 . Higher dosing leads to increased colonization of tumors, tumor-resident immune cells, and the tumor microenvironment, enhancing the therapeutic efficacy of the immunostimulatory bacteria.
  • pagP-/msbB- mutant strains have increased resistance to complement inactivation and enhanced stability in human serum.
  • immunostimulatory bacteria exemplified by live attenuated Salmonella strains, such as the exemplary strain of S. typhimurium, that only can produce LPS with penta-acylated lipid A, that contain a deletion or disruption of the msbB gene, and that further are modified by deletion or disruption of pagP.
  • deletion of msbB expression prevents the terminal myristoylation of lipid A
  • deletion of pagP expression prevents palmitoylation.
  • a strain modified to produce LPS penta-acylated lipid A results in lower levels of pro-inflammatory cytokines, improved stability in the blood, resistance to complement fixation, increased sensitivity to antimicrobial peptides, enhanced tolerability, and increased anti-tumor immunity when further modified to express heterologous genetic payloads that stimulate the immune response in the tumor microenvironment.
  • Corresponding genes, encoding homologs and orthologs of lipid A palmitoyltransferase (PagP) in other bacterial species also can be deleted or disrupted to achieve similar results.
  • genes include, but are not limited to, for example, pagP, encoding Lipid IVA palmitoyltransferase in E. coli; and pagP, encoding antimicrobial peptide resistance and lipid A acylation protein in S. typhi.
  • the immunostimulatory bacteria provided herein can be attenuated by rendering them auxotrophic for one or more essential nutrients, such as purines (for example, adenine), nucleosides (for example, adenosine), amino acids (for example, aromatic amino acids, arginine, and leucine), adenosine triphosphate (ATP), or other nutrients as known and described in the art. a.
  • purI Deletion/Disruption Phosphoribosylaminoimidazole synthetase an enzyme encoded by the purI gene (synonymous with the purM gene), is involved in the biosynthesis pathway of purines. Disruption or deletion or inactivation of the purI gene, thus, renders the bacteria auxotrophic for purines.
  • purI- mutants are enriched in the tumor environment and have significant anti-tumor activity (see, e.g., Pawelek et al. (1997) Cancer Research 57:4537-4544). It was previously described that this colonization results from the high concentration of purines present in the interstitial fluid of tumors as a result of their rapid cellular turnover.
  • the purI- bacteria are unable to synthesize purines, they require an external source of adenine, and it was thought that this would lead to their restricted growth in the purine- enriched tumor microenvironment (see, e.g., Rosenberg et al. (2002) J. Immunotherapy 25(3):218-225). While the VNP20009 strain was initially reported to contain a deletion of the purI gene (see, e.g., Low et al.
  • VNP20009 a chromosomal inversion
  • the entire gene is contained within two parts of the VNP20009 chromosome that is flanked by insertion sequences, one of which has an active transposase. While disruption of the purI gene limits replication to the tumor tissue/microenvironment, it still permits intracellular replication and virulence.
  • each of the msbB and the purI genes is required to limit bacterial growth to the extracellular space in tumor tissue, and prevent intracellular replication.
  • Provided herein are strains in which the coding portion of these genes are completely deleted to eliminate any possible reversion to wild-type by recombination. It is shown herein that such bacteria grow more effectively.
  • nutrient auxotrophy can be introduced into the immunostimulatory bacteria by deletions/mutations in genes such as aro, gua, thy, nad, and asd, for example.
  • S. typhimurium strain SL7207 is an aromatic amino acid auxotroph (aroA- mutant); strains A1 and A1-R are leucine-arginine auxotrophs; and VNP20009/YS1646 is a purine auxotroph (purI- mutant) as well as being msbB-.
  • VNP20009/YS1646 is also auxotrophic for the immunosuppressive nucleoside adenosine, and for ATP (see, e.g., Example 1).
  • Strains provided herein include strains derived from the strain designated YS1646, such as those that lack flagella, are pagP- or modified to produce penta- acylated LPS, and include additional modifications, including complete deletion of purI and/msbB, as well as deletion of the curli fimbriae, such as by genome modifications that render the bacterium csgD-, and additional modifications that require various nutrients for growth, such as thyA- strains.
  • the strains also can be have genome modifications that render them ansB- so that they do not produce asparagine synthase, which can inhibit T cells, thereby eliminating this immunosuppressive aspect of immunostimulatory bacteria.
  • Exemplary strains include those designated YS1646 ⁇ asd/ ⁇ FLG/ ⁇ pagP/ ⁇ ansB/ ⁇ csgD/F- ⁇ purI, and YS1646 ⁇ asd/ ⁇ FLG/ ⁇ pagP/ ⁇ ansB/ ⁇ csgD/F- ⁇ purI/ ⁇ thyA. It is understood that these designations reference Salmonella genes; similar modifications can be effected in other bacterial species, such as Listeria, and E. coli, such as Nissle.
  • genes encoding homologs or orthologs of phosphoribosylaminoimidazole synthetase (PurI), and other genes required for purine synthesis in other bacterial species, also can be deleted or disrupted to achieve similar results.
  • These genes include, but are not limited to, for example, purM, encoding phosphoribosylformylglycinamide cyclo-ligase in E. coli; purM, encoding phosphoribosylformylglycinamidine cyclo-ligase in S.
  • purA encoding adenylosuccinate synthetase
  • purQ encoding phosphoribosylformylglycinamidine synthase II
  • purS encoding phosphoribosylformylglycinamidine synthase subunit PurS in L.
  • Adenosine Auxotrophy Metabolites derived from the tryptophan and adenosine triphosphate (ATP)/adenosine pathways are major drivers in forming an immunosuppressive environment within the tumor/tumor microenvironment (TME).
  • Adenosine which exists in the free form inside and outside of cells, is an effector of immune function. Adenosine decreases T-cell receptor induced activation of NF- ⁇ B, and inhibits IL-2, IL-4, and IFN- ⁇ . Adenosine decreases T-cell cytotoxicity, increases T-cell anergy, and increases T-cell differentiation to Foxp3 + or Lag3 + regulatory T-cells (T-reg cells, T- regs or Tregs). On natural killer (NK) cells, adenosine decreases IFN- ⁇ production, and suppresses NK cell cytotoxicity.
  • NK natural killer
  • Adenosine blocks neutrophil adhesion and extravasation, decreases phagocytosis, and attenuates levels of superoxide and nitric oxide. Adenosine also decreases the expression of TNF- ⁇ , IL-12, and MIP-1 ⁇ (CCL3) on macrophages, attenuates major histocompatibility complex (MHC) Class II expression, and increases levels of IL-10 and IL-6. Adenosine immunomodulation activity occurs after its release into the extracellular space of the tumor and activation of adenosine receptors (ADRs) on the surface of target immune cells, cancer cells or endothelial cells.
  • ADRs adenosine receptors
  • Extracellular adenosine is produced by the sequential activities of membrane associated ectoenzymes, CD39 (ecto-nucleoside triphosphate diphosphohydrolase1, or NTPDase1) and CD73 (ecto-5’-nucleotidase), which are expressed on tumor stromal cells, together producing adenosine by phosphohydrolysis of ATP or ADP produced from dead or dying cells.
  • CD39 converts extracellular ATP (or ADP) to 5’-AMP, which is converted to adenosine by CD73.
  • Tumor hypoxia can result from inadequate blood supply and disorganized tumor vasculature, impairing delivery of oxygen (see, e.g., Carroll and Ashcroft (2005) Expert. Rev. Mol. Med.7(6), DOI: 10.1017/S1462399405009117).
  • Hypoxia which occurs in the tumor microenvironment, also inhibits adenylate kinase (AK), which converts adenosine to AMP, leading to very high extracellular adenosine concentrations.
  • AK adenylate kinase
  • the extracellular concentration of adenosine in the hypoxic tumor microenvironment has been measured at 10-100 ⁇ M, which is up to about 100-1000 fold higher than the typical extracellular adenosine concentration of approximately 0.1 ⁇ M (see, e.g., Vaupel et al. (2016) Adv. Exp. Med. Biol.876:177-183; and Antonioli et al. (2013) Nat. Rev. Can.13:842-857). Since hypoxic regions in tumors are distal from microvessels, the local concentration of adenosine in some regions of the tumor can be higher than in others.
  • adenosine also can control cancer cell growth and dissemination by effects on cancer cell proliferation, apoptosis and angiogenesis.
  • adenosine can promote angiogenesis, primarily through the stimulation of A 2A and A 2B receptors. Stimulation of the receptors on endothelial cells can regulate the expression of intercellular adhesion molecule 1 (ICAM-1) and E-selectin on endothelial cells, maintain vascular integrity, and promote vessel growth (see, e.g., Antonioli et al. (2013) Nat. Rev. Can.13:842-857).
  • IAM-1 intercellular adhesion molecule 1
  • E-selectin E-selectin
  • Activation of one or more of A2A, A2B, or A3 on various cells by adenosine can stimulate the production of the pro-angiogenic factors, such as vascular endothelial growth factor (VEGF), interleukin-8 (IL-8) or angiopoietin 2 (see, e.g., Antonioli et al. (2013) Nat. Rev. Can.13:842-857).
  • VEGF vascular endothelial growth factor
  • IL-8 interleukin-8
  • angiopoietin 2 see, e.g., Antonioli et al. (2013) Nat. Rev. Can.13:842-857.
  • Adenosine also can directly regulate tumor cell proliferation, apoptosis, and metastasis through interaction with receptors on cancer cells.
  • Adenosine also can trigger apoptosis of cancer cells, and various studies have correlated this activity to activation of the extrinsic apoptotic pathway through A3, or the intrinsic apoptotic pathway through A2A and A2B (see, e.g., Antonioli et al. (2013)).
  • Adenosine can promote tumor cell migration and metastasis, by increasing cell motility, adhesion to the extracellular matrix, and expression of cell attachment proteins and receptors to promote cell movement and motility.
  • the extracellular release of adenosine triphosphate (ATP) occurs from stimulated immune cells, and from damaged, dying, or stressed cells.
  • the NLR family pyrin domain-containing 3 (NLRP3) inflammasome when stimulated by this extracellular release of ATP, activates caspase-1 and results in the secretion of the cytokines IL-1 ⁇ and IL-18, which in turn activate innate and adaptive immune responses (see, e.g., Stagg and Smyth (2010) Oncogene 29:5346–5358).
  • ATP can accumulate to concentrations exceeding 100 mM in tumor tissue, whereas levels of ATP found in healthy tissues are very low ( ⁇ 1-5 ⁇ M) (see, e.g., Song et al. (2016) Am. J. Physiol. Cell Physiol.310(2):C99–C114). ATP is catabolized into adenosine by the enzymes CD39 and CD73. Activated adenosine acts as a highly immunosuppressive metabolite via a negative-feedback mechanism and has a pleiotropic effect against multiple immune cell types in the hypoxic tumor microenvironment (see, e.g., Stagg and Smyth (2010) Oncogene 29:5346–5358).
  • Adenosine receptors A 2A and A 2B are expressed on a variety of immune cells and are stimulated by adenosine to promote cAMP-mediated signaling changes, resulting in immunosuppressive phenotypes of T- cells, B-cells, NK cells, dendritic cells (DCs), mast cells, macrophages, neutrophils, and natural killer T (NKT) cells.
  • adenosine levels can accumulate to over one hundred times their normal concentration in pathological tissues, such as solid tumors, which have been shown to overexpress ecto-nucleotidases, such as CD73.
  • Adenosine also has been shown to promote tumor angiogenesis and development.
  • An engineered bacterium that is auxotrophic for adenosine would thus exhibit enhanced tumor-targeting and colonization.
  • Immunostimulatory bacteria such as Salmonella typhi
  • a purD gene knockout was shown to be auxotrophic for adenosine (see, e.g., Park et al. (2007) FEMS Microbiol. Lett.276:55– 59).
  • S. typhimurium strain VNP20009 is auxotrophic for adenosine due to its purI modification; hence, further modification to render it auxotrophic for adenosine is not required.
  • embodiments of the immunostimulatory bacterial strains, as provided herein are auxotrophic for adenosine.
  • auxotrophic bacteria selectively replicate in the tumor microenvironment, further increasing accumulation and replication of the administered bacteria in tumors, and decreasing the levels of adenosine in and around tumors, thereby reducing or eliminating the immunosuppression caused by the accumulation of adenosine.
  • Exemplary of such bacteria is a modified strain of S. typhimurium containing purI-/msbB- mutations to provide adenosine auxotrophy.
  • the purI gene can be disrupted as it has been in VNP20009, or it can contain a deletion of all or a portion of the purI gene, which ensures that there cannot be a reversion to a wild-type gene.
  • strain VNP20009 the purI gene was inactivated by inversion. Similarly, the msbB gene in VNP20009 was not completely deleted. As exemplified herein, strains in which the purI and msbB genes have been completely deleted to eliminate any risk of reversion, demonstrate superior fitness as assessed by growth of cultures in vitro. Immunostimulatory bacteria modified by rendering them auxotrophic for one or more essential nutrients, such as purines (for example, adenine), nucleosides (for example, adenosine), amino acids (for example, aromatic amino acids, arginine, and leucine), or adenosine triphosphate (ATP), are employed.
  • purines for example, adenine
  • nucleosides for example, adenosine
  • amino acids for example, aromatic amino acids, arginine, and leucine
  • ATP adenosine triphosphate
  • the bacteria are rendered auxotrophic for adenosine, and optionally, for ATP, and preferentially accumulate in tumor microenvironments (TMEs).
  • TMEs tumor microenvironments
  • adenosine auxotrophy eliminates the immunosuppression from adenosine that accumulates in the tumor microenvironment.
  • Thymidine Auxotrophy Genome modifications can be introduced in place of or in addition to the inactivation/deletion (see section 3) discussed below. Other deletions or inactivation of genes or gene products required for growth, such as genes that produce nutrients, can be used in place of or in addition to, for example, the asd inactivation/deletion. These include, for example, modifications that render the bacteria thyA- (see, e.g., Loessner et al.
  • Immunostimulatory bacteria that are ThyA- have genome modifications, such as insertions, deletions, replacements, transpositions, and/or other changes, that result in inactive or eliminate production of thymidylate synthase.
  • Thymidylate synthase catalyzes the reductive methylation of dUMP to dTMP, a DNA biosynthesis precursor (precursor to dTTP). Elimination of expression or production or other attenuating mutations of the bacterial genome for production of such products results in release of encoded macromolecules upon bacterial cell death in vivo after administration.
  • ThyA is an enzyme needed for DNA synthesis. Mutation of the respective genes renders the strain auxotrophic for diaminopimelic acid (DAP) or thymidine monophosphate precursors. Upon deprivation of the complementing substrates, such bacteria die by DAP-less or thymine-less death, resulting in release of bacterial proteins and plasmid. Inactivation or elimination of Asd, results in release of macromolecules.
  • DAP diaminopimelic acid
  • thymidine monophosphate precursors Upon deprivation of the complementing substrates, such bacteria die by DAP-less or thymine-less death, resulting in release of bacterial proteins and plasmid. Inactivation or elimination of Asd, results in release of macromolecules.
  • ⁇ ThyA bacteria which includes those with insertions, deletions, and other modifications so that active enzyme is not produced
  • expression/activity does not result in release of macromolecules, including proteins and plasmid, upon thymidine starvation (Loessner et al., (2006) FEBS Lett 265:81- 88).
  • ⁇ ThyA bacteria in which the genome is modified so that active enzyme is not produced, are advantageous, for example, for in vivo delivery of plasmids to host cells, since the bacteria do not prematurely release their contents.
  • the bacteria provided herein infect or accumulate in myeloid cells, such as phagocytic cells, such as macrophages, dendritic cells, monocytes, and neutrophils, which consume bacteria, the intact ⁇ ThyA bacteria, release the plasmid encoding the payloads, such as therapeutic products, inside the targeted cells for, for example, expression, if RNA, or secretion or presentation, if protein.
  • myeloid cells such as phagocytic cells, such as macrophages, dendritic cells, monocytes, and neutrophils
  • the intact ⁇ ThyA bacteria release the plasmid encoding the payloads, such as therapeutic products, inside the targeted cells for, for example, expression, if RNA, or secretion or presentation, if protein.
  • genome modifications that render the bacteria thyA- have advantages for particular applications, such as immunization, presentation on cells, delivery of RNA, and other such applications. 3. Plasmid Maintenance and Delivery a. asd Deletion
  • the selection of the particular genome modification depends upon the intended application of the bacteria. thyA inactivation is advantageous for some applications; for others rendering the bacteria asd- is advantageous; it is within the skill of the skilled person to select the particular modification(s).
  • the asd gene in bacteria encodes an aspartate-semialdehyde dehydrogenase. asd- mutants of S. typhimurium have an obligate requirement for diaminopimelic acid (DAP), which is required for cell wall synthesis, and will undergo lysis in environments deprived of DAP.
  • DAP diaminopimelic acid
  • This DAP auxotrophy can be used for plasmid selection and maintenance of plasmid stability in vivo, without the use of antibiotics, when the asd gene is complemented in trans on a plasmid in the bacterium.
  • Non-antibiotic-based plasmid selection systems are advantageous, and allow for 1) the use of administered antibiotics as a rapid clearance mechanism in the event of adverse symptoms, and 2) for antibiotic-free scale up of production, where such use is commonly avoided.
  • the asd gene complementation system provides for such non-antibiotic-based plasmid selection (see, e.g., Galán et al. (1990) Gene 94(1):29-35).
  • the use of the asd gene complementation system to maintain plasmids in the tumor microenvironment is expected to increase the potency of S. typhimurium strains engineered to deliver plasmids encoding genetic payloads/therapeutic products, such as immunostimulatory proteins (e.g., cytokines, chemokines, co- stimulatory molecules); cytosolic DNA/RNA sensors that induce type I IFN, such as STING and IRF3, and gain-of-function/constitutively active mutants thereof; antibodies and fragments thereof (e.g., checkpoint inhibitors, or anti-IL-6 or anti- VEGF antibodies); bi-specific T-cell engagers (sold under the trademark BiTEs®); interfering RNAs; and other therapeutic products as discussed elsewhere herein and known in the art; and complementary combinations of all of the preceding therapeutic products.
  • immunostimulatory proteins e.g., cytokines, chemokines, co- stimulatory molecules
  • cytosolic DNA/RNA sensors that induce
  • an asd mutant of S. typhimurium is to exploit the DAP auxotrophy to produce an autolytic (or suicidal) strain, for delivery of therapeutic products/macromolecules to infected cells, without the ability to persistently colonize host tumors.
  • Deletion of the asd gene makes the bacteria auxotrophic for DAP when grown in vitro or in vivo.
  • An example described herein provides an asd deletion strain that is auxotrophic for DAP, and that contains a plasmid suitable for delivery of immunomodulatory proteins, but that does not contain an asd complementing gene, resulting in a strain that is defective for replication in vivo.
  • This strain is propagated in vitro in the presence of DAP, and grows normally, and then is administered as an immunotherapeutic agent to a mammalian host where DAP is not present.
  • the suicidal strain is able to invade host cells but is not be able to replicate due to the absence of DAP in mammalian tissues, lysing automatically, and delivering its cytosolic contents (e.g., plasmids or proteins).
  • cytosolic contents e.g., plasmids or proteins.
  • Corresponding genes, encoding homologs or orthologs of aspartate- semialdehyde dehydrogenase (asd) in other bacterial species also can be deleted or disrupted to achieve similar results.
  • genes include, but are not limited to, for example, asd, encoding aspartate-semialdehyde dehydrogenase in E. coli; asd (STY4271), encoding aspartate-semialdehyde dehydrogenase in S. typhi; asd (lmo1437), encoding aspartate-semialdehyde dehydrogenase in L.
  • thyA can be inactivated or eliminated by genome modification in place of the asd modification. As discussed above, inactivation or elimination of thymidylate synthase expression/activity does not result in release of macromolecules, including proteins and plasmids, upon thymidine starvation.
  • the endA gene (see, for example, SEQ ID NO:250) encodes an endonuclease (DNA-specific endonuclease I; see, for example, SEQ ID NO:251) that mediates degradation of double-stranded DNA (dsDNA) in the periplasm of Gram-negative bacteria.
  • dsDNA double-stranded DNA
  • Most common strains of laboratory E. coli are endA-, as a mutation in the endA gene allows for higher yields of plasmid DNA. This gene is conserved among species.
  • the endA gene of the engineered immunostimulatory bacteria is deleted or mutated to prevent its endonuclease activity.
  • Exemplary of such mutations is an E208K amino acid substitution (see, e.g., Durfee et al. (2008) J. Bacteriol.190(7):2597-2606), or a corresponding mutation in the species of interest.
  • endA including residue E208, is conserved among bacterial species, including Salmonella.
  • the E208K mutation can be used to eliminate endonuclease activity in other species, including Salmonella species.
  • Those of skill in the art can introduce other mutations or deletions to eliminate endA activity.
  • Flagella are organelles on the surface of bacteria that are composed of a long filament that is attached, via a hook, to a rotary motor that can rotate in a clockwise or counterclockwise manner to provide a means for locomotion. Flagella, for example, in S.
  • flagella are important for chemotaxis and for establishing an infection via the oral route, due to the ability to mediate motility across the mucous layer in the gastrointestinal tract. While flagella have been demonstrated to be required for chemotaxis to and colonization of tumor cylindroids in vitro (see, e.g., Kasinskas and Forbes (2007) Cancer Res.67(7):3201-3209), and motility has been shown to be important for tumor penetration (see, e.g., Toley and Forbes (2012) Integr. Biol. (Camb) 4(2):165-176), flagella are not required for tumor colonization in animals when the bacteria are administered intravenously (see, e.g., Stritzker et al.
  • flagellar filament is composed of tens of thousands of flagellin subunits.
  • the S. typhimurium chromosome contains two genes, fliC and fljB, that encode antigenically distinct flagellin monomers. Mutants defective for both fliC and fljB are nonmotile and avirulent when administered via the oral route of infection, but maintain virulence when administered parenterally.
  • Flagellin is a major pro-inflammatory determinant of Salmonella (see, e.g., Zeng et al. (2003) J.
  • Immunol.171:3668-3674 is directly recognized by TLR5 on the surface of cells, and by NLCR4 in the cytosol (see, e.g., Lightfield et al. (2008) Nat. Immunol.9(10):1171–1178). Both pathways lead to pro-inflammatory responses resulting in the secretion of cytokines, including IL-1 ⁇ , IL-18, TNF- ⁇ , and IL-6.
  • Salmonella-based cancer immunotherapy attempts have been made to make Salmonella-based cancer immunotherapy more potent by increasing the pro-inflammatory response to flagellin by engineering the bacteria to secrete Vibrio vulnificus flagellin B, which induces greater inflammation than flagellin encoded by fliC and fljB (see, e.g., Zheng et al. (2017) Sci. Transl. Med. 9(376):eaak9537).
  • Salmonella bacteria such as S. typhimurium, are engineered to lack both flagellin subunits fliC and fljB, to reduce TLR5-mediated pro-inflammatory signaling.
  • Salmonella strains that contain flagella similarly can be engineered to eliminate flagella, and to include other modifications that have the substantially the same effects as the exemplified modifications of Salmonella.
  • a Salmonella strain lacking msbB and/or pagP which results in reduced TNF-alpha induction, is combined with elimination of flagella, which can be achieved in Salmonella by fliC and fljB knockouts. This results in a Salmonella strain that has a combined reduction in, among other effects, TNF-alpha induction and a reduction in TLR5 recognition.
  • bacterial modifications can be combined with an immunostimulatory plasmid, optionally containing CpGs, encoding therapeutic products, such as immunomodulatory proteins, and combinations of products.
  • the resulting bacteria have reduced pro-inflammatory signaling, but robust anti-tumor activity.
  • the encoded products can include antigens and proteins against which an immmunoprotective or therapeutic response is intended.
  • a fliC and fljB double mutant was constructed in the asd-deleted strain of S.
  • VNP20009 which is attenuated for virulence by disruption of purI/purM, and which contains a modification of the msbB gene (a partial deletion) that results the in production of a lipid A subunit that is less toxigenic than wild-type lipid A.
  • the resulting strain is exemplary of strains that are attenuated for bacterial inflammation by modification of lipid A to reduce TLR2/4 signaling, and by deletion of expression of the flagellin subunits to reduce TLR5 recognition and inflammasome induction.
  • Salmonella pathogenicity islands SPIs
  • Salmonella invades non-phagocytic intestinal epithelial cells using a type 3 secretion system (T3SS) encoded by the Salmonella pathogenicity island 1 (SPI-1), which forms a needle-like structure that injects effector proteins directly into the cytosol of host cells.
  • T3SS type 3 secretion system
  • SPI-1 Salmonella pathogenicity island 1
  • T3SS type 3 secretion system
  • SPI-1 Salmonella pathogenicity island 1
  • SPI-1 Salmonella pathogenicity island 1
  • the SPI designated SPI-1 mediates invasion of epithelial cells.
  • SPI-1 genes include, but are not limited to: avrA, hilA, hilD, invA, invB, invC, invE, invF, invG, invH, invI, invJ, iacP, iagB, spaO, spaP, spaQ, spaR, spaS, orgA, orgB, orgC, prgH, prgI, prgJ, prgK, sicA, sicP, sipA, sipB, sipC, sipD, sirC, sopB, sopD, sopE, sopE2, sprB, and sptP.
  • Deletion of one or more of these genes reduces or eliminates the ability of the bacterium to infect epithelial cells, but does not affect their ability to infect or invade phagocytic cells, including phagocytic immune cells.
  • deletion of both the fliC and fljB genes significantly reduced expression of SPI-1 genes, such as hilA, hilD, invA, invF, and sopB, thereby reducing the ability to invade non-phagocytic cells (see, e.g., Elhadad et al. (2015) Infect. Immun.83(9):3355-3368).
  • flagellin in addition to the SPI-1 type 3 secretion system (T3SS), is necessary for triggering pyroptosis in macrophages, and can be detected by the macrophage NLRC4 inflammasome. Elimination of flagellin subunits decreases pyroptosis in macrophages.
  • S. typhimurium with deletions in fliC and fljB results in significantly reduced IL-1 ⁇ secretion compared to the wild-type strain, whereas cellular uptake and intracellular replication of the bacterium remains unaffected. This demonstrates that flagellin plays a significant role in inflammasome activation. Additionally, S.
  • the genome of the immunostimulatory bacteria herein can be modified to delete or mutate the flagellin genes fliC and fljB in S. typhimurium, leading to decreased cell death of tumor-resident immune cells, such as macrophages, and enhancing the anti-tumor immune response of the immunostimulatory bacteria.
  • Deletion of the flagellin subunits allows for greater tolerability in the host, limits uptake into only phagocytic cells and decreases their pyroptotic cell death, and directs the immunostimulatory response towards delivery of therapeutic products, such as immunomodulatory proteins, to the TME, particularly tumor-resident myeloid cells.
  • the resulting immunostimulatory bacteria elicit an anti-tumor response, and promote an adaptive immune response to the tumor.
  • Corresponding genes, encoding flagellin in other bacterial species also can be deleted to achieve similar results.
  • genes include, but are not limited to, for example, fliC, encoding flagellar filament structural protein, and fliE, encoding flagellar basal-body protein FliE in E. coli; fliC, encoding flagellin and flgB, encoding flagellar basal-body rod protein FlgB, in S. typhi; flaA encoding flagellin, fliE, encoding flagellar hook-basal body protein FliE, and flgB, encoding flagellar basal- body rod protein FlgB, in L.
  • L-asparaginase II is an enzyme that catalyzes conversion of L-asparagine to ammonia and aspartic acid.
  • Several bacterial strains such as E. coli and S. typhimurium, utilize L-asparaginase to scavenge fructose-asparagine as a carbon and nitrogen source (see, e.g., Sabag-Daigle et al. (2016) Appl. Environ. Microbiol. 84(5):e01957-17).
  • T-cells such as in acute lymphoblastic leukemia (ALL) require asparagine as they lack the enzymes to synthesize it.
  • Administration of L- asparaginases has been a frontline therapy for ALL since the early 1970’s (see, e.g., Batool et al. (2016) Appl. Biochem. Biotechnol.178(5):900-923).
  • Production of L- asparaginase II by S. typhimurium is both necessary and sufficient for T-cell inhibition, as it directly induces T-cell receptor (TCR) downregulation, decreases T- cell cytokine production, and inhibits tumor cytolytic function (see, e.g., Kullas et al.
  • L-asparaginase II has been used as an anti-cancer therapeutic for cancers in which T-cell suppression is a therapeutic modality.
  • L-asparaginase As an anti-cancer therapeutic, it is shown herein that elimination of L-asparaginase activity in the immunostimulatory bacteria provided herein, and in other immunostimulatory bacteria and bacterial vaccines, such as the BCG vaccine used for vaccinating against tuberculosis (TB) and other diseases, enhances the function of T-cells in the tumor microenvironment. Elimination of L-asparaginase activity can be effected by modifying the bacterial genome to eliminate expression of active enzyme. Modifications include insertions, deletions, replacements, and other changes in the nucleic acids, so that the resulting encoded enzyme is not active, or not expressed, or is eliminated.
  • deletion of all or of a part of the gene that encodes L-asparaginase II, ansB, or disruption thereof, to eliminate expression of the encoded enzyme in the immunostimulatory bacteria enhances the function of T-cells in a bacterially- colonized tumor microenvironment.
  • Inhibition of L-asparaginase II activity is accomplished by deletion of all or of a part of, or interruption/disruption of, the gene ansB in the immunostimulatory bacteria, whereby L-asparaginase II is not produced.
  • immunostimulatory bacteria whose genomes are modified so that L-asparaginase II is not produced.
  • Immunostimulatory bacteria provided herein are employed to colonize tumor-resident immune cells to enhance the anti-tumor immune response; included among the bacterial genome modifications are deletions, insertions, disruptions, and/or other modifications that eliminate the expression of L- asparaginase II.
  • the genome of the immunostimulatory bacteria herein can be modified to delete ansB, or to disrupt it or to otherwise modify it, to result in inactive encoded L-asparaginase II, or to eliminate the asparaginase, thereby preventing T-cell suppression, and enhancing the anti-tumor T-cell function in vivo. It is shown herein that strains in which ansB is intact induce profound T-cell immunosuppression in T- cells co-localized with the strain.
  • ansB do not induce immunosuppression, thus, solving another problem in the art in using bacteria to deliver encoded therapeutic products to tumors.
  • Immunostimulatory bacteria that combine modifications, such as deletions or disruptions, of the ansB gene, whereby functional encoded enzyme is not expressed, with other modifications described herein that result in increased accumulation in the tumor microenvironment and/or in tumor-resident immune cells, provide superior therapeutic immunostimulatory bacteria.
  • Bacterial biofilms are encased within a mixture of secreted and cell wall- associated polysaccharides, glycoproteins, and glycolipids, as well as extracellular DNA, known collectively as extracellular polymeric substances. These extracellular polymeric substances protect the bacteria from multiple insults, such as cleaning agents, antibiotics, and antimicrobial peptides. Bacterial biofilms allow for colonization of surfaces, and are a cause of significant infection of prosthetics, such as injection ports and catheters. Biofilms also can form in tissues during the course of an infection, which leads to increases in the duration of bacterial persistence and shedding, and limits the effectiveness of antibiotic therapies. Chronic persistence of bacteria in biofilms is associated with increased tumorigenesis, for example in S.
  • csgD Deletion In Salmonella, such as S. typhimurium, biofilm formation is regulated by the csgD gene, which activates the csgBAC operon, and results in increased production of the curli fimbriae subunits CsgA and CsgB (see, e.g., Zakikhany et al. (2010) Molecular Microbiology 77(3):771–786).
  • CsgA is recognized as a PAMP by TLR2, and induces production of IL-8 from human macrophages (see, e.g., Tukel et al. (2005) Molecular Microbiology 58(1):289–304).
  • csgD indirectly increases cellulose production by activating the adrA gene that encodes for di-guanylate cyclase.
  • bacteria such as S. typhimurium
  • Bacterial mutants such as Salmonella mutants, that cannot form biofilms, are taken up more rapidly by host phagocytic cells, and are more readily cleared from infected tumors (see, e.g., Crull et al. (2011) Cellular Microbiology 13(8):1223-1233).
  • This increase in intracellular localization within phagocytic cells can reduce the persistence of extracellular bacteria, and, as shown herein, can enhance the effectiveness of plasmid delivery of therapeutic products, such as immunomodulatory proteins and other anti-cancer therapeutics, as described herein. Reduction in the capability of immunostimulatory bacteria, such as S.
  • biofilms can be achieved through deletion or disruption of genes involved in biofilm formation, such as, for example, csgD, csgA, csgB, adrA, bcsA, bcsB, bcsZ, bcsE, bcsF, bcsG, dsbA, or dsbB (see, e.g., Anwar et al. (2014) PLoS ONE 9(8):e106095).
  • genes involved in biofilm formation such as, for example, csgD, csgA, csgB, adrA, bcsA, bcsB, bcsZ, bcsE, bcsF, bcsG, dsbA, or dsbB (see, e.g., Anwar et al. (2014) PLoS ONE 9(8):e106095).
  • csgD-deleted immunostimulatory bacterial strains demonstrate improved anti-tumor efficacy because of greater bacterial uptake into tumor-resident myeloid cells. Similar genome modifications can be effected in other bacterial strains, such as E. coli and Listeria, that alter biofilm formation and/or curli fimbriae production, so that the bacteria can better infiltrate the vasculature, such as that present in tumors and the tumor microenvironment. Corresponding genes, encoding homologs and orthologs of csgD, and other genes that are required for curli fimbriae and biofilm formation in other bacterial species, also can be deleted or disrupted or otherwise modified to achieve similar results.
  • genes include, but are not limited to, for example, csgD, encoding DNA-binding transcriptional dual regulator CsgD in E. coli; csgD (STY1179), encoding regulatory protein CsgD in S. typhi; and lcp, encoding the Listeria cellulose binding protein that is involved in biofilm formation in L. monocytogenes.
  • Modification of the bacterial genome such as by deletion or disruption of genes to render the bacteria csgD-, results changes, such as one or more of elimination of curli fimbriae and inflammatory cyclic dinucleotides (CDNs), and removes cellulose secretion.
  • CDNs inflammatory cyclic dinucleotides
  • typhimurium strains that are engineered to be auxotrophic for adenosine; and are reduced in their ability to induce pro-inflammatory cytokines by modification of the LPS and/or deletion of flagellin; and/or that do not express L-asparaginase II to improve T-cell function; and/or that contain deletions or disruptions of genes required for biofilm formation; and/or that are further modified to maintain significant plasmid copy number per cell, at least low to medium copy number or higher, in the absence of antibiotic selection; and that deliver genetic expression cassettes encoding therapeutic products, promote robust anti-tumor immune responses.
  • the plasmids include regulatory sequences to promote secretion of the encoded therapeutic products into the tumor microenvironment. 7.
  • the complement system is the first line of immune defense against invading pathogens that directly activate the lectin pathway or the alternative pathway (AP) cascades in the human host.
  • the complement system involves more than 30 soluble and cell-membrane bound proteins that function in the innate immune response to recognize and kill pathogens, such as bacteria, virus-infected cells, and parasites, and also, that play a role in the antibody-mediated immune response.
  • pathogens such as bacteria, virus-infected cells, and parasites
  • Activation of the complement cascade leads to opsonization of foreign microbes, release of chemotactic peptides, and finally, to disruption of bacterial cell membranes.
  • Three homologous glycoproteins in the complement system, C3, C4, and C5 play a central role in complement function and interact with other complement components.
  • C3b and C4b generated from C3 and C4, respectively, are important components of convertases that promote activation of the complement cascade.
  • the cleavage fragments of C5 are C5a, which induces migration of phagocytes into the infection site, and C5b, which initiates the formation of the membrane attack complex (MAC), and bacterial lysis (see, e.g., Ramu et al. (2007) FEBS Letters 581:1716-1720).
  • MAC membrane attack complex
  • pathogens have developed strategies to prevent deleterious consequences of complement activation.
  • members of the Ail/Lom family of outer membrane proteins provide protection from complement-dependent killing for a number of pathogenic bacteria.
  • Ail/Lom family which include Ail (attachment invasion locus) of Yersinia species, e.g., Y. enterocolitica and Y. pseudotuberculosis, Rck (resistance to complement killing) and PagC of Salmonella species, and OmpX of Escherichia coli, are outer membrane proteins that share significant amino acid sequence similarity and identity, and have similar membrane topologies. While members of this family of proteins exhibit diverse functions, several of them, including Ail of Y. enterocolitica and Y. pseudotuberculosis, as well as Rck of S.
  • enterica function, at least in part, to protect bacteria from complement-mediated lysis (see, e.g., Bartra et al. (2008) Infection and Immunity 76:612–622).
  • Another bacterial product that aids in avoiding or mitigating complement is the surface protease, designated PgtE (outer membrane serine protease) in Salmonella, and other members of the omptin family.
  • PgtE outer membrane serine protease
  • the surface protease PgtE of S. enterica belongs to the omptin family of enterobacterial outer membrane aspartate proteases. PgtE and other omptins require rough LPS to be active, but are sterically inhibited by the O-antigen.
  • PgtE proteolytically activates the mammalian plasma proenzyme plasminogen to plasmin, inactivates the main physiological inhibitor of plasmin, alpha 2-antiplasmin, and mediates bacterial adhesion to extracellular matrices of human cells. This way, PgtE mediates the degradation of extracellular matrix components and generates potent, localized proteolytic activity, which can promote migration of Salmonella across extracellular matrices. PgtE also degrades alpha-helical antimicrobial peptides which can be important during intracellular growth of Salmonella.
  • the omptin Pla of Yersinia pestis is a close ortholog of PgtE and shares functions with PgtE. Pla cleaves C3, and PgtE increases serum resistance of Salmonella by cleaving complement components C3b, C4b, and C5.
  • the gene pgtE, and orthologs thereof from other bacterial species, can be included in the immunostimulatory bacteria herein to increase resistance to complement. It is shown herein that the effects of complement in human serum explain the failure of therapeutic immunostimulatory bacteria, such as the Salmonella strain VNP20009, which had been shown to effectively colonize tumors in rodent models.
  • VNP20009 Systemic administration of VNP20009 resulted in colonization of mouse tumors (see, e.g., Clairmont et al. (2000) J. Infect. Dis.181:1996-2002; and Bermudes et al. (2001) Biotechnol. Genet. Eng. Rev.18:219-33); whereas systemic administration of VNP20009 in human patients resulted in very little colonization.
  • very little VNP20009 was detected in human tumors after a 30 minute intravenous infusion (see, Toso et al. (2002) J. Clin. Oncol.20:142- 52).
  • VNP20009 Patients that entered into a follow-up study evaluating a longer, four-hour infusion of VNP20009, also demonstrated a lack of detectable VNP20009 after tumor biopsy (see, Heimann et al. (2003) J. Immunother.26:179–180). Following intratumoral administration, colonization of a derivative of VNP20009 was detected (see, Nemunaitis et al. (2003) Cancer Gene Ther.10:737-744). Direct intratumoral administration of VNP20009 to human tumors resulted in much higher tumor colonization, indicating that human tumors can be colonized at a high level, and that the difference in tumor colonization between mice and humans occurs only after systemic administration.
  • VNP20009 is inactivated by human complement, which explains the low tumor colonization observed in humans upon systemic administration of VNP20009.
  • Strains provided herein exhibit resistance to complement. They can be modified to express Rck and other proteins involved in mediating complement resistance or avoidance, such as Ail of Yersinia enterocolitica, or PgtE of Salmonella typhimurium, or, if they natively express such a protein, they can be modified to overexpress Rck and/or other such proteins. Rck can be introduced into bacteria, such as E. coli, that lack a homolog.
  • Rck Expression Rck (resistance to complement killing) is a 17 kDa outer membrane protein encoded by the large virulence plasmid of Salmonella species, such as S. enteritidis and S. typhimurium, that induces adhesion to and invasion of epithelial cells.
  • the Rck protein has been shown to protect S. enterica from complement by inhibiting C9 polymerization and subsequent assembly of a functional membrane attack complex.
  • An rck mutant exhibited a 2-3 fold decrease in epithelial cell invasion compared to the wild-type strain, while rck overexpression in wild-type strains leads to increased invasion.
  • the Rck protein induces cell entry by a receptor-mediated process, promoting local actin remodeling, and weak and closely adherent membrane extensions.
  • Salmonella can enter cells by two distinct mechanisms: the Trigger mechanism mediated by the T3SS-1 complex, and a Zipper mechanism induced by rck (see, e.g., Manon et al. (2012), Salmonella, Chapter 17, eds. Annous and Gurtler, Rijeka, pp.339-364).
  • rck a Zipper mechanism induced by rck
  • Expression of rck on the Salmonella virulence plasmid confers a high level of resistance to neutralization by human complement, by preventing the formation of the membrane attack complex.
  • S. typhimurium virulence plasmid containing rck was expressed in a highly serum-sensitive strain of E. coli, Rck was able to restore complement resistance.
  • the immunostimulatory bacteria provided herein retain, or are provided with, Rck to confer resistance to human complement. It is shown herein that immunostimulatory bacteria, such as E. coli, can be modified by encoding rck on a plasmid in the bacteria to thereby confer resistance to complement. Immunostimulatory bacteria provided herein encode rck, either endogenously, or can be modified to encode it in order to increase resistance to complement. Methods for conferring resistance to complement also are provided. For example, the therapeutic E. coli species described in U.S. Patent Application Publication Nos.2018/0325963 and 2018/0273956, and U.S.
  • Patent Nos.9,889,164 and 9,688,967 can be improved by modifying the bacteria therein, such as by introducing nucleic acid encoding the Salmonella rck gene on a plasmid therein, to thereby improve or provide resistance to complement.
  • Bacteria that are resistant to complement can be systemically administered, and sufficient bacteria can survive to be therapeutically effective.
  • Nucleic acids encoding the Salmonella rck gene are introduced into bacteria, such as therapeutic E. coli, to thereby confer or increase complement resistance.
  • Other orthologs and homologs of rck from other bacterial species similarly can be expressed in the immunostimulatory bacteria.
  • Ail is an Rck homolog from Yersinia enterocolitica, which enhances complement resistance under heterologous expression.
  • PgtE is an S. typhimurium surface protease that has also been shown to enhance complement resistance under heterologous expression.
  • the LPS and Braun (murein) lipoprotein (Lpp) are major components of the outer membrane of Gram-negative enteric bacteria that function as potent stimulators of inflammatory and immune responses.
  • Braun (murein) lipoprotein (Lpp) is one of the most abundant components of the outer membrane in S. typhimurium, and leads to TLR2 induction of pro-inflammatory cytokines, such as TNF ⁇ , IL-6, and IL-8 (in humans).
  • lppA SEQ ID NO:387
  • lppB SEQ ID NO:388
  • lppA and lppB genes Two functional copies of the lipoprotein gene (SEQ ID NO:387) and lppB (SEQ ID NO:388)), that are located on the bacterial chromosome of Salmonella, contribute to bacterial virulence.
  • Deletion of the lppA and lppB genes, and elimination of lipoprotein expression reduces virulence and decreases pro-inflammatory cytokine production (see, e.g., Sha et al. (2004) Infect. Immun.72(7):3987-4003; and Fadl et al. (2005) Infect. Immun.73(2):1081-1096).
  • Deletion of the Lpp genes would be expected to reduce infection of cells, and, thus, decrease plasmid delivery and expression of the encoded therapeutic products or proteins.
  • deletion of these genes did reduce tumor colonization, the amount of plasmid delivered to the targeted cells, i.e., the tumor-resident immune cells, particularly macrophages, significantly was increased.
  • deletion or disruption of these genes results in decreased virulence due to the inability to survive in infected macrophages, but results in enhanced plasmid delivery by the immunostimulatory bacteria, thereby increasing the expression of encoded therapeutic genes in the targeted cells, i.e., the tumor-resident immune cells, particularly macrophages.
  • Strains provided herein are ⁇ FLG (lack flagella), and/or ⁇ pagP, and/or ⁇ ansB, and/or ⁇ csgD. Additionally, the strains are one or more of ⁇ purI ( ⁇ purM), ⁇ msbB, and ⁇ asd (in the bacterial genome). Exemplary strains are ⁇ purI ( ⁇ purM), ⁇ msbB, ⁇ pagP, ⁇ ansB, ⁇ asd, or ⁇ ThyA in place of ⁇ asd. The strains also can be lppA- and/or lppB-, particularly lppA-/lppB-.
  • the plasmid is modified to encode therapeutic products under control of host-recognized promoters (e.g., eukaryotic promoters, such as RNA polymerase II promoters, including those from eukaryotes, and from animal viruses).
  • host-recognized promoters e.g., eukaryotic promoters, such as RNA polymerase II promoters, including those from eukaryotes, and from animal viruses.
  • the plasmids can encode asd to permit bacterial replication in vivo, and can encode nucleic acids with other beneficial functions (such as CpGs), and can encode gene products, as described elsewhere herein.
  • the immunostimulatory bacteria provided herein can be modified to eliminate the ability to infect epithelial cells, such as by elimination of the flagella.
  • Elimination of the ability to infect epithelial cells, as described elsewhere herein, also can be achieved by inactivating SPI-1-dependent invasion, through inactivation or knockout of one or more genes involved in the SPI-1 pathway.
  • genes include, but are not limited to, one more of: avrA, hilA, hilD, invA, invB, invC, invE, invF, invG, invH, invI, invJ, iacP, iagB, spaO, spaP, spaQ, spaR, spaS, orgA, orgB, orgC, prgH, prgI, prgJ, prgK, sicA, sicP, sipA, sipB, sipC, sipD, sirC, sopB, sopD, sopE, sopE2, sprB, and sptP.
  • the immunostimulatory bacteria can contain knockouts or deletions in genes to inactivate products involved in SPI-1-independent infection/invasion, such as one or more of the genes fljB, fliC, rck, pagN, hlyE, pefI, srgD, srgA, srgB, and srgC, and/or the immunostimulatory bacteria can contain knockouts or deletions to inactivate products of genes that induce cell death of tumor- resident immune cells, such as genes that encode proteins that are directly recognized by the inflammasome, including fljB, fliC, prgI (needle protein), and prgJ (rod protein).
  • the rck gene is desirable because it protects the bacteria against inactivation by complement.
  • Bacteria that do not endogenously encode rck can be modified to encode a heterologous rck gene.
  • the immunostimulatory bacteria are derived from suitable bacterial strains.
  • Bacterial strains can be attenuated strains, or strains that are attenuated by standard methods, or that, by virtue of the modifications provided herein, are attenuated in that their ability to colonize is limited primarily to immunoprivileged tissues and organs, particularly tumor-resident immune cells, the TME, and tumor cells, including solid tumors.
  • Bacteria include, but are not limited to, for example, strains of Salmonella, Shigella, Listeria, E. coli, and Bifidobacteriae.
  • species include Shigella sonnei, Shigella flexneri, Shigella dysenteriae, Listeria monocytogenes, Salmonella typhi, Salmonella typhimurium, Salmonella gallinarum, and Salmonella enteritidis.
  • Other suitable bacterial species include Rickettsia, Klebsiella, Bordetella, Neisseria, Aeromonas, Francisella, Corynebacterium, Citrobacter, Chlamydia, Haemophilus, Brucella, Mycobacterium, Mycoplasma, Legionella, Rhodococcus, Pseudomonas, Helicobacter, Vibrio, Bacillus, and Erysipelothrix.
  • Exemplary of the immunostimulatory bacteria provided herein are species of Salmonella.
  • Exemplary of bacteria for modification as described herein are wild-type strains of Salmonella, such as the strain that has all of the identifying characteristics of the strain deposited in the American Type Culture Collection (ATCC) as accession #14028.
  • Engineered strains of Salmonella typhimurium such as strain YS1646 (ATCC catalog # 202165, also referred to as VNP20009; see, also International PCT Application Publication No. WO 99/13053)
  • the strains then are modified to delete the flagellin genes, and/or to delete pagP.
  • the combination of flagella knockout and pagP deletion renders the strains highly resistant to human serum complement.
  • the strains also are rendered auxotrophic for purines, particularly adenosine, and are asd- and msbB-.
  • strains in which the purI and msbB genes are completely deleted are more fit (e.g., grow faster) that strain VNP20009, in which these genes are not deleted, but are modified to eliminate expression.
  • the asd gene can be provided on a plasmid for in vivo replication in the eukaryotic host.
  • the strains also have a modification, such as a deletion, disruption, or other modification, in the ansB gene, preventing them from producing immunosuppressive L-asparaginase II, and improving tumor T-cell function.
  • the strains also are modified to eliminate biofilm production, such as by a csgD deletion, which renders them unable to produce curli fimbriae, cellulose, and c-di-GMP, reducing unwanted inflammatory responses, and preventing the strains from forming biofilms.
  • any of the nucleic acid encoding therapeutic products can be included on the plasmid.
  • the plasmid generally is present in low to medium copy number, as described elsewhere herein.
  • Therapeutic products include gain-of-function mutants of cytosolic DNA/RNA sensors, that can constitutively evoke/induce type I IFN expression, and other immunostimulatory proteins, such as cytokines, chemokines, and co-stimulatory molecules, that promote an anti-tumor immune response in the tumor microenvironment, and other such products described herein.
  • the plasmids also can encode antibodies, and fragments thereof, e.g., single-chain antibodies that target immune checkpoints and other cancer targets, such as VEGF, IL-6, and TGF- ⁇ , and other molecules, such as bispecific T-cell engagers, or BiTEs®.
  • the plasmids also can encode IL-6 binding decoy receptors, TGF-beta binding decoy receptors, and TGF- beta polypeptide antagonists.
  • typhimurium strains that are engineered to be adenosine auxotrophic, and are reduced in their ability to induce pro- inflammatory cytokines by modification of the LPS and/or deletion of flagellin, and/or are modified by deletion or elimination of L-asparaginase II expression to improve T-cell function, and/or are modified by deletion or disruption of genes required for biofilm formation, and/or that demonstrate enhanced human serum survival due to increased rck expression, are further modified to deliver therapeutic products, such as immunomodulatory proteins, and promote robust anti-tumor immune responses.
  • Vaccines and Bacteria that Deliver RNA, including mRNA and other Forms of RNA, for Expression in a Eukaryotic Host Immunostimulatory Bacteria as Delivery Vehicles for RNA Provided are immunostimulatory bacteria that contain or that express encoded heterologous RNA, where the bacteria infect eukaryotic host cells, and release the encoded RNA into the cytoplasm of the host cell (see, e.g., U.S. Patent No. 7,390,646).
  • the RNA can be a therapeutic product, or the RNA is translated by the host cell machinery into a therapeutic product.
  • Such products include immunostimulatory proteins and antigens from pathogens and/or tumor antigens that can be expressed in cells, such as phagocytic cell for presentation to induce immune responses including T-cell responses, memory T-cells, and antibodies.
  • the bacteria can be administered to the site or by a route that is the same as naturally-occurring route of the pathogen, such as by inhalation or nasal administration for respiratory viruses, oral administration for gastric and enteric pathogens, intramuscular administration, such as for viruses, and also systemic routes. This can result in in situ immune responses that can provide lifelong immunity.
  • any of the immunostimulatory bacteria provided herein can be modified so that the bacteria produce the exogenous or heterologous RNA within the bacterial cells in vitro, such as during in vitro cell culture, or after entry of the bacterial cells into the host eukaryotic cells, or both during in vitro cell culture, and after entry of the bacterial cells into the host eukaryotic cells.
  • the bacteria release the exogenous RNA into the cytoplasm of the host cells.
  • the RNA can be encoded on a plasmid in the bacteria, and can encode a plurality of therapeutic products.
  • the forms of RNA delivered are any that can be translated by eukaryotic cell machinery.
  • RNA long non-coding RNA
  • RNAi long non-coding RNA
  • dsRNA circular RNA
  • eRNA e.g., U.S. Patent No.10,953,033
  • immunostimulatory bacteria and genomically-modified bacteria that contain or express encoded heterologous RNA, where, when the bacteria infect eukaryotic host cells, the encoded RNA, such as mRNA, is released into the cytoplasm of the host cell.
  • the bacteria include any of the immunostimulatory bacteria provided herein, and particularly, those that include genomic modifications, so that they have reduced TLR2, TLR4, and TLR5 signaling.
  • the bacteria also can encode a therapeutic product or a plurality thereof, and particularly, encode immunostimulatory proteins, including cytokines and STING proteins, including the modified STING proteins provided herein, which can act as adjuvants if the RNA is encoding an antigen or protein for vaccination, or for a treatment for which immune stimulation is advantageous.
  • the nucleic acid encoding the RNA is modified so that it is transcribed in the bacteria, but is not translated. This can be effected by designing the nucleic acid so that the transcribed RNA product is not recognized by or cannot be translated by prokaryotic ribosomes.
  • the encoding nucleic acid further is designed such that the transcript is recognized by and is translated by eukaryotic ribosomes, such as those present in a host, such as a human. This can be effected by, for example, including nucleic acid encoding an internal ribosome entry site (IRES) that is not recognized by prokaryotic ribosomes, but is recognized by eukaryotic ribosomes
  • IRS internal ribosome entry site
  • the encoded RNA typically is mRNA, but can be other forms of RNA that can be translated into therapeutic products or immunizing antigens or proteins. Other forms, of RNA include, but are not limited to, eRNA, which is circular RNA.
  • eRNA is a circular polyribonucleotide that: (a) contains an expression sequence encoding a polypeptide, such as an antigen; (b) contains an internal ribosome entry site (IRES) that is not recognized by prokaryotic ribosomes, and a termination element; and (c) lacks a poly- A sequence, a free 3' end, and an RNA polymerase recognition motif (see, e.g., U.S. Patent No.10,953,033, which describes such circular RNA).
  • the bacteria are modified so that the transcribed RNA is circularized in vivo.
  • the RNA can be a therapeutic product, or the RNA is translated by the host cell machinery into a therapeutic product.
  • the RNA can encode an antigen, whereby it is encoded into a protein when delivered into the host cells, to immunize the host against the antigen, and the pathogen or the tumor from which the antigen is derived.
  • the nucleic acid can be modified so that the encoded antigen is modified to improve its properties for immunization, such as by stabilizing a conformation of the antigen against which antibodies and other adaptive immune responses are directed. This has been done, for example, for the spike proteins, on corona viruses, so that the conformation that binds to host cell receptors is stabilized, resulting in a more robust antibody response.
  • any of the immunostimulatory bacteria provided herein can be modified so that the bacteria produce the exogenous or heterologous RNA within the bacterial cells in vitro, such as during in vitro cell culture, or after entry of the bacterial cells into the host eukaryotic cells, or both during in vitro cell culture and after entry of the bacterial cells into the host eukaryotic cells.
  • the bacteria release the exogenous RNA into the cytoplasm of the host cells.
  • the RNA can be encoded on a plasmid in the bacteria, and can encode a plurality of therapeutic products.
  • the nucleic acid encoding the RNA is operably linked to a promoter recognized by the bacteria, or the bacteria are modified to encode the RNA polymerase that recognizes the promoter, such as a bacterial promoter, or a bacteriophage promoter that is recognized by phage T7 RNA polymerase.
  • the RNA can be mRNA, or other RNA molecules that contain regulatory sequences for expression in a eukaryotic host cell.
  • the promoter can be an inducible promoter.
  • the bacteria can contain a plurality of copies of the encoded RNA, which, when introduced into a eukaryotic host, such as a human, is released into the host cell cytoplasm, where, if it is mRNA, it can be translated.
  • the nucleic acid encoding the RNA lacks a Shine-Dalgarno (SD) sequence upstream of the start codon, whereby the RNA cannot be translated by bacterial or archaeal ribosomes, but can be translated by eukaryotic ribosomes.
  • SD Shine-Dalgarno
  • the RNA can contain sequences, such as a Kozak sequence, with a start codon recognized by eukaryotic ribosomes.
  • Shine- Dalgarno sequences include, for example SEQ ID NOs: 389-392: (see, e.g., parts.igem.org/File:RBSAlignedSpacing.png).
  • the RNA also can contain one or more Internal Ribosome Entry Site(s) (IRES), which block or inhibit translation by prokaryotic ribosomes.
  • IRES Internal Ribosome Entry Site
  • the RNA is produced in the bacteria, which infect or have infected myeloid cells, thereby delivering RNA to the myeloid cells, where, if it is mRNA, it is translated in the myeloid cells, which recognize the RNA for translation because of the Shine-Dalgarno sequence, or IRES, or other such regulatory sequence.
  • the immunostimulatory bacteria serve as an RNA delivery system.
  • bacterial systems such as the immunostimulatory bacteria provided herein, are used to deliver genetic payloads to tissue-resident and/or tumor- resident myeloid cells.
  • the bacteria are dosed in vivo; the bacteria are, for example, asd-, and do not include a plasmid containing a complementing asd gene cassette, so that they cannot replicate in vivo.
  • DAP diaminopimelic acid
  • one bolus of nucleic acid is delivered to tissue-resident or tumor resident myeloid cells.
  • the RNA encoding the therapeutic product(s) is released into the cytoplasm of the myeloid cells for translation, to produce the therapeutic product(s) that is/are secreted from the myeloid cells into the surrounding environment, such as the tumor microenvironment, when the infected cells are tumor- resident myeloid cells.
  • RNA Bacteria cultured in vitro encode RNA, but lack the signals/regulatory sequences, such as the Shine-Dalgarno sequence, that are required to translate the RNA, or the encoding nucleic acid contains sequences, such as an IRES, that blocks or does not provide for translation by prokaryotic ribosomes, but that are recognized by eukaryotic ribosomes, so that the bacteria produce, but do not translate, the mRNA.
  • the bacteria which are modified as described herein, so that they infect or accumulate in tissue-resident or tumor-resident immune cells, particularly tissue- resident or tumor-resident myeloid cells, deliver the RNA to the myeloid cells, where it is translated.
  • RNA can be delivered, including RNA encoding antigens, such as from pathogens or tumors, and/or encoding anti-viral therapeutics, which are expressed under control of a prokaryotic promoter.
  • the plasmids can be present in higher copy number (e.g., 150 copies or greater, such as 200, 300, 400, 500, or more copies, such as 500-700 copies), so that large amounts of the RNA is produced and delivered to the myeloid cells.
  • the encoding and regulatory sequences can be prepared so that the RNA is produced in the bacterium, but the encoding nucleic acid includes regulatory sequences that inhibit or prevent translation by bacterial ribosomes, but that are recognized by, and/or enhance, promote, or permit translation by, eukaryotic host ribosomes.
  • the mRNA is transcribed under control of a prokaryotic promoter.
  • An IRES sequence is included in the transcript, which blocks translation in the prokaryotic bacterium, but, when delivered into a eukaryotic host cell, permits translation by eukaryotic ribosomes.
  • the bacteria thus, provide non-labile mRNA delivery systems.
  • the bacteria can be grown in large quantities, and then can be lyophilized or frozen and/or stored at room temperature. They can be formulated into tablets, or powders, or can be micronized for inhalation.
  • the bacteria include those that contain genome modifications, whereby the response by toll-like receptors (TLRs) 2, 4, and 5 is reduced, compared to the bacterium without the genome modifications.
  • TLRs toll-like receptors
  • These bacteria optionally can additionally contain genomic modifications so that they are auxotrophic for a required nutrient or factor, so that they are unable to replicate in a eukaryotic host, but can replicate in vitro when supplied with the nutrient or factor.
  • the bacteria contain a plasmid containing nucleic acid encoding a product, or comprise RNA encoding the product.
  • the plasmid can be present in low, medium, or high copy number. When used to deliver RNA, the plasmid can be present in high copy number, such as 150 copies or greater.
  • the product encoded by the nucleic acid or RNA is an antigenic sequence or sequences from a pathogenic virus, bacterium, parasite, or is a tumor antigen, whereby, upon expression of the encoded antigen in the host, the host develops an immune-protective response or immunizing response against the pathogenic virus, bacterium, or parasite, or against the tumor antigen, or the product is a therapeutic product to be delivered to the host.
  • RNA encoding the antigen(s) is produced in the bacterium, and, for RNA delivery, nucleic acid encoding the antigen comprises regulatory sequences that inhibit or prevent translation of encoded RNA by bacterial ribosomes, but that do not inhibit or prevent translation of the encoded RNA by eukaryotic host ribosomes, whereby translation is de-coupled from transcription in the bacterium.
  • the resulting bacterium is selective for infecting phagocytic cells when administered to a eukaryotic subject, and delivers the nucleic acid into the phagocytic cells, wherein the RNA is translated.
  • the immunostimulatory bacteria provided herein that are modified so that they infect phagocytic cells, such as macrophages.
  • the bacteria which can be any suitable species/genus, such as Salmonella, Listeria, and E. coli, are so-modified so that they are one or more or all of modified to produce LPS with penta-acylated lipid A, modified to lack flagella, and modified to lack curli fimbriae; for example, the bacteria are msbB-/pagP-, flagellin-, and csgD- (by modification by each of the encoding genes or equivalent genes in a particular species, so that the products are not produced, or, if produced, are inactive).
  • the bacteria also are modified, such as by rendering them asd-, so that the can be grown in vitro by providing the appropriate nutrient, such a DAP, but so that they do not replicate in a eukaryotic host, and ultimately die when the mRNA is delivered into the eukaryotic cells.
  • the bacteria also can encode additional payloads, as described herein, such as modified STING proteins and/or cytokines (all as described and listed elsewhere herein), which serve to stimulate the host immune system, thereby acting as adjuvants.
  • Such products can be encoded on plasmids in the bacterium, and can be encoded on a polycistronic construct with the mRNA encoding the antigen, and/or can be encoded under control of a eukaryotic promoter for transcription/translation into proteins, as described throughout the disclosure herein. These proteins can be designed for transcription, or, as appropriate, can be modified so that they are membrane anchored for presentations.
  • the immunostimulatory bacteria such as E. coli, can be modified so that they encoded and express rck to increase resistance to complement. 11.
  • Bacterial Vaccines Against Particular Antigens, Including from Pathogens, and also Antigens from Tumors, for use as Anti-Pathogen Treatments and Vaccines, and For Anti-Cancer Treatment and/or Prevention Vaccines can be used for preventing (reducing the risk) of contracting a disese or developing a disorder or cancer or as treatments for diseases, disorders, or cancers, and combinations thereof.
  • immunostimulatory bacteria provided herein and other vaccines can be used for these purposes. Because of the similarity in the immune response between an anti-tumor response and an anti-viral response, the immunostimulatory bacteria provided herein also can be used to treat infectious diseases.
  • the bacteria can encode an anti-viral or anti-bacterial therapeutic, such as an inhibitor of a viral or bacterial product, or an inhibitor of the expression of a viral or bacterial product, or a viral or bacterial antigen.
  • an anti-viral or anti-bacterial therapeutic such as an inhibitor of a viral or bacterial product, or an inhibitor of the expression of a viral or bacterial product, or a viral or bacterial antigen.
  • the combination of the immune response from the immunostimulatory bacteria and the therapeutic anti-pathogen product, and also, to the immunostimulatory proteins and encoded immune-stimulating proteins provides a therapeutic immunostimulatory bacterium for vaccinating against and/or treating infectious diseases, particularly diseases associated with viral infections, such as chronic viral infections and latent viral infections.
  • chronic viral infections such as infections by hepatitis viruses, herpes viruses, varicella zoster virus (VZV), Epstein-Barr virus, human immunodeficiency virus (HIV), human T-cell leukemia virus (HTLV), Respiratory Syncytial Virus (RSV), measles virus, and other such viruses that chronically infect subjects.
  • VZV varicella zoster virus
  • HAV human immunodeficiency virus
  • HTLV human T-cell leukemia virus
  • RSV Respiratory Syncytial Virus
  • measles virus and other such viruses that chronically infect subjects.
  • the immunostimulatory bacteria also can be used for the treatment of acute infections as well, such as initial infections with chronic influenza and coronaviruses, such as Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), Middle East Respiratory Syndrome coronavirus (MERS- CoV), and Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2, which causes COVID-19).
  • the immunostimulatory bacteria can encode an antigen from a pathogen, such as a viral antigen, and are used as a vaccine to prevent infection or to treat existing infections.
  • the immunostimulatory bacterium by virtue of its ability to accumulate in immune cells, such as antigen-presenting cells, such as T-cells, can promote a T-cell response to the virus.
  • immunostimulatory bacteria provided herein are deficient in asparaginase II, which enhances the function of T- cells to thereby promote the anti-viral response.
  • a viral antigen such as an antigen from an essential viral protein, such as, for example, in the case of a coronavirus, an antigen from the Nucleocapsid, M and/or S proteins, which can result in neutralizing antibodies, and the enhancement of long-lived circulating and tissue-resident CD8 + T-cells, and provides effective vaccines and treatments.
  • BCG vaccine Bacillus Calmette–Guérin
  • TB tuberculosis
  • BCG vaccine effectiveness is often reduced. This is by virtue of the asparaginase secreted by the vaccine bacteria, which decreases T-cell activity, thereby having an immuno-suppressive effect. This can be mitigated by modifying the bacteria to reduce or eliminate asparaginase activity.
  • TLR2 or TLR2/4/5 responses to the bacteria eliminate any blockade or inhibition of type I IFN by the activity or response of TLR2, or TLR4, or TLR5, or other toll-like receptors to bacteria.
  • the responses of the TLRs to bacteria can block or inhibit type I IFN; modifications of the bacteria herein by eliminating responses of these TLRs eliminate this undesirable effect.
  • the immunostimulatory bacteria can encode an anti-viral therapeutic or an anti-bacterial therapeutic, or an antigen for immunization.
  • Such therapeutics include inhibitors of viral genes and proteins, such as proteins required for replication and/or packaging, or the immunostimulatory bacteria can encode a therapeutic that prevents binding or interaction of a virus with a receptor or receptors that facilitate or provide for viral entry into a target cell.
  • the therapeutic protein can be under the control of a prokaryotic promoter.
  • the bacteria can be those that deliver RNA.
  • the bacteria can be used to deliver RNA, including mRNA for vaccination against pathogens, such as SARS-CoV, SARS-CoV-2, influenza, and other pathgens, and also, for anti-tumor therapy.
  • the bacteria can also encode immunostimulants or other immune system enhancers, or inhibitors of immunosuppressors, such as immune checkpoint proteins.
  • immunosuppressors such as immune checkpoint proteins.
  • STING proteins including the modified STING proteins provided herein, cytokines, and other such immune stimulating proteins.
  • the immunostimulatory payloads serve as adjuvants to enhance the immune response.
  • the pathogen antigen-encoding nucleic acid is under control of a prokaryotic promoter; the other payloads also can be provided as a polycistronic construct with the pathogen antigen-encoding nucleic acid, or they can be encoded under control of a eukaryotic promoter, as described herein for the anti- tumor therapeutics.
  • Bacteria such as those provided herein, that deliver payloads to phagocytic cells, and that contain the various genome modifications that improve their properties for delivery, can be used to deliver RNA.
  • the bacteria are superior vehicles to nanoparticles and other such delivery vehicles, since the RNA is delivered in the bacterial cytoplasm and contains the adjuvants to stimulate type I IFN.
  • RNA delivery “without the RNA” the bacterial delivery vehicle obviates the need for complex RNA stability/manufacturing; 2) they result in direct targeting of phagocytic antigen presenting-cells (APCs); 3) they allow for the inclusion of payloads that provide type I IFN adjuvant activity; 4) they contain genome modification so that the bacteria do not replicate in the eukaryotic (such as human) host, such as by rendering the bacteria asd- by inactivating endogenous asd activity and not encoding it on the plasmid; and 5) removal of bacterial products that are poor adjuvants by genome modification is possible, such as by eliminating the flagella, modifying the LPS, reducing or eliminating biofilm formation, as well as the elimination of asparaginase II activity.
  • APCs phagocytic antigen presenting-cells
  • bacteria are those that are msbB-/pagP-, and flagellin-, and optionally, ansB-, and csgD-, with a complete (clean) deletion of the purI gene.
  • Bacteria as vehicles also permit rapid engineering and deployment; bacteria are easily scalable and are easy to manufacture; a plurality of different RNAs can be encoded in a single bacterium; and bacteria are stable, and they can be stored at room temperature, they can be lyophilized, and they can be formulated for intranasal delivery or delivery by inhalation, as well as for intravenous delivery, and can be formulated for other suitable routes of delivery.
  • the encoded products can be operatively linked to trafficking signals, such as signals for secretion.
  • the products also can be designed for expression on a cell surface, such as the cell surfaces of tumor-resident myeloid cells and other phagocytic cells.
  • the gene products can be modified so that they are membrane anchored. For example, IL-12 has been modified herein so that it is membrane-anchored by adding a transmembrane domain to the C-terminus.
  • proteins including, for example, IL-2, IL-12, IL-12p35, IL-21, IL-15, and FLT-3L, can be similarly modified by adding a transmembrane domain or other such anchoring domain, such as a GPI anchor.
  • Anchoring such proteins to the membranes of cells that are infected with the bacteria reduces toxicity so that they are not systemically secreted, but act in the tumor microenvironment.
  • the immunostimulatory bacteria that encode such products and combinations thereof are those with genome modifications, such as, for example, modifications that result in the bacteria being msbB-/pagP- and not having flagella, whereby the response by toll-like receptors (TLRs) 2, 4, and 5 is reduced, compared to the bacteria without the genome modifications. 12.
  • Macrophages are phagocytic immune cells; they play a role in clearing senescent and apoptotic cells, as well as in the phagocytosis of immune-related complexes and pathogens, and in the maintenance of homeostasis.
  • the phenotype and function of macrophages can be polarized by the microenvironment. There are two types: M1-type (classically activated) macrophages, and M2-type (alternatively activated) macrophages.
  • M1 macrophages The role of M1 macrophages is to secrete pro-inflammatory cytokines and chemokines, and to present antigens, and thus, to participate in the positive immune response, and function as immune monitors.
  • M1 macrophages produce pro- inflammatory cytokines, including IL-6, IL-12, and TNF-alpha.
  • M2 macrophages secrete arginase 1, IL-10, TGF- ⁇ , and other anti-inflammatory cytokines, which have the function of reducing inflammation, and contributing to tumor growth and immunosuppressive function.
  • the M1 or M1-like phenotype is advantageous.
  • M2 macrophages can be converted into M1 macrophages or into macrophages with an M1-like phenotype.
  • Immunostimulatory bacteria provided herein, which infect macrophages, can convert M2 macrophages into macrophages with an M1 or M1-like phenotype.
  • M1 macrophage phenotypic markers include CD80 (also known as B7, B7.1, or BB1), CD86 (also known as B7.2), CD64 (also known as high affinity immunoglobulin gamma Fc receptor I ), CD16, and CD32 (also known as low affinity immunoglobulin gamma Fc region receptor IIb).
  • nitric oxide synthase (iNOS) in M1 macrophages can also serve as a phenotypic marker.
  • CD163 and CD206 are markers for the identification of M2 macrophages.
  • Arginase 1 (Arg1) and DECTIN-1 also are ideal phenotypic indicators for the identification of M2 macrophages. The phenotypic conversion can be monitored or assessed by virtue of expression of these markers, and/or other markers that are characteristic of such macrophage phenotypes.
  • Tumor-associated macrophages (TAMs) are associated with an immunosuppressive M2 phenotype. Immunostimulatory bacteria provided herein can convert such macrophages into macrophages with an M1 or M1-like phenotype.
  • the immunostimulatory bacteria provided herein that encode a therapeutic product that leads to expression of type I interferon (IFN), can effect such conversion.
  • IFN type I interferon
  • the encoded therapeutic products include those that are part of a cytosolic DNA/RNA sensor pathway, such as the STING variants (described in detail herein).
  • the encoding immunostimulatory bacteria can effect conversion of the infected macrophages to an M1 phenotype (or an M1-like phenotype) upon infection of the tumor-resident macrophages, and expression of the therapeutic product(s).
  • Example 12 This ability to convert macrophage phenotypes is demonstrated and exemplified in Example 12 below.
  • Immunostimulatory bacteria that express a variant STING protein that results in constitutive type I IFN expression in human primary M2 macrophages, convert these cells to M1-like (having phenotypic markers and/or expression profiles typical of M1 macrophages) type I IFN producing cells.
  • the immunostimulatory bacteria provided herein are modified so that they accumulate in the tumor microenvironment, and in tumor-resident myeloid cells, where encoded therapeutic products, under the control of eukaryotic promoters, are expressed.
  • the bacteria encode therapeutic products, particularly anti-cancer products, including products that stimulate the immune system, and/or that reverse or mitigate the immunosuppressive effects of tumors.
  • the bacteria can encode a plurality of products, where expression of each product is under the control of a separate promoter, or expression of the products is under the control of one promotor, and the expression cassette can include sequences that result in expression of the discrete products, and, where appropriate, includes regulatory sequences to ensure secretion of the encoded products into the tumor microenvironment.
  • the immunostimulatory bacteria express encoded therapeutic products on the plasmid.
  • the plasmid can encode one product, or a plurality thereof.
  • Each product can be expressed under the control of a different eukaryotic promoter, or multiple encoded products can be expressed under the control of a single promoter, such as by including 2A self-cleaving peptides between the coding portions, such as T2A (SEQ ID NO:327), P2A (SEQ ID NO:328), E2A (SEQ ID NO:329), and F2A (SEQ ID NO:330).
  • the encoded products include those described herein, and they can be anti-cancer immune stimulating products whose activities are complementary.
  • the immunostimulatory bacteria provided herein permit the combinatorial administration of multiple immunomodulatory products or payloads (multiplexed payloads) that would otherwise be too toxic if systemically administered.
  • multiplexed payloads include one or more cytokine(s), an immunostimulatory protein to stimulate or induce expression of type I IFN, such as STING or a variant thereof that has increased activity or that is constitutively active, and a co-stimulatory molecule, such as an engineered 4-1BBL co-stimulatory molecule.
  • the immunostimulatory bacteria provided herein have strong anti-tumor effects, including provision of cures, such as after IV dosing with the multiplexed payloads or single agent payloads.
  • the immunostimulatory bacteria when systemically administered, infiltrate and enrich in solid tumors, in the TME, and in tumor-resident myeloid cells, in which the encoded therapeutic products are expressed and then locally delivered to the tumor microenvironment.
  • the bacteria Upon consumption (phagocytosis) by tumor-resident myeloid cells, the bacteria deliver a genetic payload-encoding plasmid, which allows for ectopic, single or multiplexed payload expression in a tumor-specific manner.
  • the immunostimulatory bacteria herein can be modified to encode one or more of an immunostimulatory protein that promotes, induces, or enhances an anti- tumor response.
  • the order in which the encoding nucleic acids are arranged on the plasmid can improve overall expression, and modifications to the plasmids, such as complete deletions or inactivation of genes, can improve the fitness of the bacteria that contain the plasmids encoding the proteins.
  • the immunostimulatory protein(s) can be encoded on a plasmid in the bacterium, under the control of a eukaryotic promoter, such as a promoter recognized by RNA polymerase II, for expression in a eukaryotic subject, particularly the subject for whom the immunostimulatory bacterium is to be administered, such as a human.
  • a eukaryotic promoter such as a promoter recognized by RNA polymerase II
  • the nucleic acid encoding the immunostimulatory protein(s) can include, in addition to the eukaryotic promoter, other regulatory signals for expression or trafficking in the cells, such as for secretion or expression on the surface of a cell.
  • Immunostimulatory proteins are those that, in the appropriate environment, such as a tumor microenvironment (TME), can promote, or participate in, or enhance, an anti-tumor response by the subject to whom the immunostimulatory bacterium is administered.
  • Immunostimulatory proteins include, but are not limited to, cytokines, chemokines, and co-stimulatory molecules.
  • cytokines such as, but not limited to, IL-2, IL-7, IL-12, IL-15, IL-18, IL-21, IL-23, IL-12p70 (IL-12p40 + IL- 12p35), IL-15/IL-15R alpha chain complex, IL-36 ⁇ , GM-CSF, IFN ⁇ , IFN ⁇ , IL-2 that has attenuated binding to IL-2Ra, and IL-2 that is modified so that it does not bind to IL-2Ra; chemokines, such as, but not limited to, CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11; and/or co-stimulatory molecules, such as, but not limited to, CD40, CD40L, OX40, OX40L, 4-1BB, 4-1BBL, 4-1BBL with the cytoplasmic domain truncated or deleted (4-1BBL ⁇ Cyt), members of the TNF/TNFR superfamily (e.g.,
  • immunostimulatory proteins that are used for the treatment of tumors, or that can promote, enhance or otherwise increase or evoke an anti-tumor response, that are known to those of skill in the art, are contemplated for encoding in the immunostimulatory bacteria provided herein.
  • the immunostimulatory bacteria can deliver a genetic payload encoding a truncated co- stimulatory molecule (e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, and OX40L), with a full or partial cytoplasmic domain deletion, for expression on an APC, where the truncated gene product is capable of constitutive immuno-stimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter- regulatory signal to the APC due to a deleted or truncated cytoplasmic domain.
  • a truncated co- stimulatory molecule e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, and OX40L
  • the modified truncated cytoplasmic domain for example, of 4-1BBL, contains particular residues to ensure proper orientation of the protein domains, which increases expression of the protein. Deletion (full or partial), and modification, of the cytoplasmic domain of co-stimulatory molecules, potentiates the activation of the co-stimulatory molecule, without the immunosuppressive reverse signaling. a.
  • the immunostimulatory bacteria provided herein are engineered to express cytokines to stimulate the immune system, including, but not limited to, for example, IL-2, IL-7, IL-12, IL-12p70 (IL-12p40 + IL-12p35), IL-15, the IL-15/IL-15R alpha chain complex (IL-15R ⁇ -IL-15sc), IL-18, IL-21, IL-23, IL- 36 ⁇ , IL-2 that has attenuated binding to IL-2Ra, IL-2 that is modified so that it does not bind to IL-2Ra, IFN- ⁇ , and IFN- ⁇ .
  • cytokines to stimulate the immune system
  • Cytokines stimulate immune effector cells and stromal cells at the tumor site, and enhance tumor cell recognition by cytotoxic cells.
  • the immunostimulatory bacteria can be engineered to express chemokines, such as, for example, CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11.
  • IL-2 Interleukin-2 which was the first cytokine approved for the treatment of cancer, is implicated in the activation of the immune system by several mechanisms, including the activation and promotion of cytotoxic T lymphocyte (CTL) growth, the generation of lymphokine-activated killer (LAK) cells, the promotion of regulatory T-cell (Treg cell) growth and proliferation, the stimulation of tumor-infiltrating lymphocytes (TILs), and the promotion of T-cell, B cell, and NK cell proliferation and differentiation.
  • CTL cytotoxic T lymphocyte
  • LAK lymphokine-activated killer
  • TILs tumor-infiltrating lymphocytes
  • rIL-2 Recombinant IL-2
  • RCC metastatic renal cell carcinoma
  • metastatic melanoma see, e.g., Sheikhi et al. (2016) Iran J.
  • IL-7 which is a member of the IL-2 superfamily, is implicated in the survival, proliferation, and homeostasis of T-cells. Mutations in the IL-7 receptor have been shown to result in the loss of T-cells, and the development of severe combined immunodeficiency disease (SCID), highlighting the critical role that IL-7 plays in T- cell development.
  • SCID severe combined immunodeficiency disease
  • IL-7 is a homeostatic cytokine that provides continuous signals to resting na ⁇ ve and memory T-cells, and which accumulates during conditions of lymphopenia, leading to an increase in both T-cell proliferation and T-cell repertoire diversity.
  • IL-7 is selective for expanding CD8 + T-cells over CD4 + FOXP3 + regulatory T-cells.
  • Recombinant IL-7 has been shown to augment antigen-specific T-cell responses following vaccination and adoptive cell therapy in mice.
  • IL-7 also can play a role in promoting T-cell recovery following chemotherapy of hematopoietic stem cell transplantation.
  • Early phase clinical trials on patients with advanced malignancy have shown that recombinant IL-7 is well-tolerated and has limited toxicity at biologically active doses (i.e., in which the numbers of circulating CD4 + and CD8 + T-cells is increased by 3-4 fold) (see, e.g., Lee, S. and Margolin, K.
  • IL-7 has been shown to possess antitumor effects in tumors, such as gliomas, melanomas, lymphomas, leukemia, prostate cancer, and glioblastoma, and the in vivo administration of IL-7 in murine models resulted in decreased cancer cell growth.
  • IL-7 also has been shown to enhance the antitumor effects of IFN- ⁇ in rat glioma tumors, and to induce the production of IL-1 ⁇ , IL-1 ⁇ , and TNF- ⁇ by monocytes, which results in the inhibition of melanoma growth.
  • IL-12 IL-12p70 (IL-12p40 + IL-12p35)
  • Bioactive IL-12 IL-12p70
  • IL-12p70 which promotes cell-mediated immunity, is a heterodimer, composed of p35 and p40 subunits, whereas IL-12p40 monomers and homodimers act as IL-12 antagonists.
  • IL-12 which is secreted by antigen-presenting cells, promotes the secretion of IFN- ⁇ from NK and T-cells, inhibits tumor angiogenesis, results in the activation and proliferation of NK cells, CD8 + T-cells, and CD4 + T-cells, enhances the differentiation of na ⁇ ve CD4 + T-cells into Th1 cells, and promotes antibody-dependent cell-mediated cytotoxicity (ADCC) against tumor cells.
  • IL-12 has been shown to exhibit antitumor effects in murine models of melanoma, colon carcinoma, mammary carcinoma, and sarcoma (see, e.g., Kalinski et al. (2001) Blood 97:3466-3469; Sheikhi et al.
  • IL-15 and IL-15:IL-15R ⁇ (IL-15/IL-15R ⁇ ) IL-15 is structurally similar to IL-2, and while both IL-2 and IL-15 provide early stimulation for the proliferation and activation of T-cells, IL-15 blocks IL-2 induced apoptosis, which is a process that leads to the elimination of stimulated T- cells and the induction of T-cell tolerance, limiting memory T-cell responses, and potentially limiting the therapeutic efficacy of IL-2 alone.
  • IL-15 also supports the persistence of memory CD8 + T-cells for maintaining long-term antitumor immunity, and has demonstrated significant antitumor activity in pre-clinical murine models via the direct activation of CD8 + effector T-cells in an antigen-independent manner.
  • IL-15 is responsible for the development, proliferation, and activation of effector natural killer (NK) cells (see, e.g., Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893; and Han et al. (2011) Cytokine 56(3):804-810).
  • NK effector natural killer
  • Il-IL-15/IL-15R alpha chain complex can be used instead of IL-15 because has longer in vivo stability than monomeric IL-15, is 10- to 100-fold more active on immune cells than IL-15.
  • IL-15/IL-15R ⁇ stimulates the maturation, proliferation and anti-apoptotic maintenance of NK cells, ⁇ (gamma delta) T-cells and T-cells; and it promotes the survival of activated T-cells (CTLs) and generation of long-lived CD8+ CD44 hi T-cell memory cells.
  • CTLs activated T-cells
  • IL-15 is superior to IL-2 as it does not bind IL-2Ralpha, located on immunosuppressive Tregs, and does not induce activation- induced cell death (AICD) or extensive capillary leak syndrome.
  • AICD activation- induced cell death
  • IL-15 and IL-15 receptor alpha are coordinately expressed by antigen-presenting cells, such as monocytes and dendritic cells, and IL-15 is presented in trans by IL-15R ⁇ to the IL-15R ⁇ C receptor complex expressed on the surfaces of CD8 + T-cells and NK cells.
  • Soluble IL-15:IL15-R ⁇ (IL-15/IL-15R ⁇ ) complexes have been shown to modulate immune responses via the IL-15R ⁇ C complex, and the biological activity of IL-15 has been shown to be increased 50-fold by administering it in a preformed complex of IL-15 and soluble IL-15R ⁇ , which has an increased half- life compared to IL-15 alone.
  • IL-18 IL-18 induces the secretion of IFN- ⁇ by NK and CD8 + T-cells, enhancing their toxicity.
  • IL-18 also activates macrophages and stimulates the development of Th1 helper CD4 + T-cells.
  • IL-18 has shown promising anti-tumor activity in several preclinical mouse models.
  • IL-18 recombinant IL-18
  • rIL-18 recombinant IL-18
  • IL-18 anti-tumor effects were mediated by IFN- ⁇ , and involved antiangiogenic mechanisms.
  • IL-18 with other cytokines, such as IL-12, or with co-stimulatory molecules, such as CD80, enhances the IL-18-mediated anti-tumor effects.
  • IL-18 can be combined with other anti-cancer therapeutic agents, such as monoclonal antibodies, cytotoxic drugs, or vaccines (see, e.g., Fabbi et al. (2015) J. Leukoc. Biol.97:665-675; and Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).
  • Chemokines are a family of small cytokines that mediate leukocyte migration to areas of injury or inflammation, and that are involved in mediating immune and inflammatory responses.
  • Chemokines are classified into four subfamilies, based on the position of cysteine residues in their sequences, namely XC-, CC-, CXC-, and CX3C-chemokine ligands, or XCL, CCL, CXCL, and CX3CL.
  • the chemokine ligands bind to their cognate receptors and regulate the circulation, homing, and retention of immune cells, with each chemokine ligand-receptor pair selectively regulating a certain type of immune cell.
  • Different chemokines attract different leukocyte populations, and form a concentration gradient in vivo, with attracted immune cells moving through the gradient towards the higher concentration of chemokine (see, e.g., Argyle D.
  • Chemokines can improve the anti- tumor immune response by increasing the infiltration of immune cells into the tumor, and facilitating the movement of antigen-presenting cells (APCs) to tumor-draining lymph nodes, which primes na ⁇ ve T-cells and B cells (see, e.g., Lechner et al. (2011) Immunotherapy 3(11):1317-1340).
  • the immunostimulatory bacteria provided herein can be engineered to encode chemokines, including, but not limited to, CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11.
  • CCL3, CCL4, CCL5 CCL3, CCL4, and CCL5 share a high degree of homology, and bind to CCR5 (CCL3, CCL4, and CCL5) and CCR1 (CCL3 and CCL5) on several cell types, including immature DCs and T-cells, in both humans and mice.
  • Therapeutic T-cells have been shown to induce chemotaxis of innate immune cells to tumor sites, via the tumor-specific secretion of CCL3, CCL4, and CCL5 (see, e.g., Dubinett et al. (2010) Cancer J.16(4):325-335).
  • CCL3 is chemotactic for both neutrophils and monocytes; specifically, CCL3 can mediate myeloid precursor cell (MPC) mobilization from the bone marrow, and has MPC regulatory and stimulatory effects.
  • MPC myeloid precursor cell
  • DCs transfected with the tumor antigen human melanoma-associated gene (MAGE)-1 that were recruited by CCL3 exhibited superior anti-tumor effects, including increased lymphocyte proliferation, cytolytic capacity, and survival, and decreased tumor growth, in a mouse model of melanoma.
  • MAGE tumor antigen human melanoma-associated gene
  • CCL3 has been used as an adjuvant for the treatment of cancer.
  • CCL3 has also shown success as an adjuvant in systemic cancers, whereby mice vaccinated with CCL3 and IL-2 or granulocyte-macrophage colony-stimulating factor (GM-CSF), in a model of leukemia/lymphoma, exhibited increased survival (see, e.g., Schaller et al. (2017) Expert Rev. Clin. Immunol.13(11):1049-1060).
  • CCL3 and CCL4 play a role in directing CD8 + T-cell infiltration into primary tumor sites in melanoma and colon cancers.
  • CCL4 Tumor production of CCL4 leads to the accumulation of CD103 + DCs; suppression of CCL4 through a WNT/ ⁇ -catenin- dependent pathway prevented CD103 + DC infiltration of melanoma tumors (see, e.g., Spranger et al. (2015) Nature 523(7559):231-235).
  • CCL3 was also shown to enhance CD4 + and CD8 + T-cell infiltration to the primary tumor site in a mouse model of colon cancer (see, e.g., Allen et al. (2017) Oncoimmunology 7(3):e1393598).
  • CCL3 or CCL5 The binding of CCL3 or CCL5 to their receptors (CCR1 and CCR5), moves immature DCs, monocytes, and memory and T effector cells from the circulation into sites of inflammation or infection.
  • CCL5 expression in colorectal tumors contributes to T lymphocyte chemoattraction and survival.
  • CCL3 and CCL5 have been used alone or in combination therapy to induce tumor regression and immunity in several preclinical models. For example, studies have shown that the subcutaneous injection of Chinese hamster ovary cells genetically modified to express CCL3, resulted in tumor inhibition and neutrophilic infiltration.
  • CCL5 a recombinant oncolytic adenovirus expressing CCL5 (Ad-RANTES-E1A) resulted in primary tumor regression, and blocked metastasis in a mammary carcinoma murine model (see, e.g., Lechner et al. (2011) Immunotherapy 3(11):1317-1340).
  • CCL5 induced an “antiviral response pattern” in macrophages.
  • CXCR3-mediated migration of lymphocytes at the invasive margin of liver metastases in colorectal cancer CCL5 is produced.
  • Blockade of CCR5 the CCL5 receptor, results in tumor death, driven by macrophages producing IFN and reactive oxygen species.
  • CCR5 inhibition induces a phenotypic shift from an M2 to an M1 phenotype.
  • CCR5 blockade also leads to clinical responses in colorectal cancer patients (see, e.g., Halama et al. (2016) Cancer Cell 29(4):587-601).
  • CCL3, CCL4, and CCL5 can be used for treating conditions, including lymphatic tumors, bladder cancer, colorectal cancer, lung cancer, melanoma, pancreatic cancer, ovarian cancer, cervical cancer, or liver cancer (see, e.g., U.S. Patent Publication No. US 2015/0232880; and International Application Publication Nos.
  • CXCL9, CXCL10, CXCL11 CXCL9 (MIG), CXCL10 (IP10), and CXCL11 (ITAC) are induced by the production of IFN- ⁇ .
  • chemokines bind CXCR3, preferentially expressed on activated T-cells, and function both angiostatically, and in the recruitment and activation of leukocytes.
  • Prognosis in colorectal cancer is strongly correlated to tumor-infiltrating T-cells, particularly Th1 and CD8 + effector T-cells; high intratumoral expression of CXCL9, CXCL10 and CXCL11 is indicative of good prognosis.
  • high intratumoral expression of CXCL9, CXCL10 and CXCL11 is indicative of good prognosis.
  • CXCL9, CXCL10 and CXCL11 were significantly higher numbers of CD3 + T-cells, CD4 + T-helper cells, and CD8 + cytotoxic T-cells.
  • CXCL9 and CXCL10 levels were increased at the invasive margin, and correlated with effector T-cell density.
  • CXCL9 functions as a chemoattractant for tumor-infiltrating lymphocytes (TILs), activated peripheral blood lymphocytes, natural killer (NK) cells, and Th1 lymphocytes.
  • TILs tumor-infiltrating lymphocytes
  • NK natural killer cells
  • Th1 lymphocytes Th1 lymphocytes.
  • CXCL9 also is critical for T-cell-mediated suppression of cutaneous tumors.
  • CXCL9 when combined with systemic IL-2, CXCL9 has been shown to inhibit tumor growth via the increased intratumoral infiltration of CXCR3 + mononuclear cells.
  • a combination of the huKS1/4-IL-2 fusion protein with CXCL9 gene therapy achieved a superior anti- tumor effect and prolonged lifespan through the chemoattraction and activation of CD8 + and CD4 + T lymphocytes (see, e.g., Dubinett et al. (2010) Cancer J.16(4):325- 335; and Ruehlmann et al. (2001) Cancer Res.61(23):8498-8503).
  • CXCL10 produced by activated monocytes, fibroblasts, endothelial cells and keratinocytes, is chemotactic for activated T-cells, and can act as an inhibitor of angiogenesis in vivo.
  • Expression of CXCL10 in colorectal tumors has been shown to contribute to cytotoxic T lymphocyte chemoattraction and longer survival.
  • the administration of immunostimulatory cytokines, such as IL-12 has been shown to enhance the anti-tumor effects generated by CXCL10.
  • a dendritic cell (DC) vaccine primed with a tumor cell lysate, and transfected with CXCL10 had increased immunological protection and effectiveness in mice; the animals showed a resistance to a tumor challenge, a slowing of tumor growth, and longer survival time.
  • DC dendritic cell
  • Interferons (which can be produced by plasmacytoid dendritic cells; these cells are associated with primary melanoma lesions and can be recruited to a tumor site by CCL20) can act on tumor DC subsets, for example, CD103 + DCs, which have been shown to produce CXCL9/10 in a mouse melanoma model, and have been associated with CXCL9/10 in human disease.
  • CXCL10 also has shown higher expression in human metastatic melanoma samples relative to primary melanoma samples.
  • adjuvant IFN- ⁇ melanoma therapy upregulates CXCL10 production, whereas the chemotherapy agent cisplatin induces CXCL9 and CXCL10 (see, e.g., Dubinett et al. (2010) Cancer J.16(4):325-335; Kuo et al. (2016) Front. Med. (Lausanne) 5:271; Li et al. (2007) Scand. J. Immunol.65(1):8-13; and Muenchmeier et al. (2013) PLoS One 8(8):e72749).
  • CXCL10/11 and CXCR3 expression has been established in human keratinocytes derived from basal cell carcinomas (BCCs).
  • CXCL11 also is capable of promoting immunosuppressive indoleamine 2,3-dioxygenase (IDO) expression in human basal cell carcinoma, as well as enhancing keratinocyte proliferation, which could reduce the anti-tumor activity of any infiltrating CXCR3 + effector T-cells (see, e.g., Kuo et al. (2016) Front. Med. (Lausanne) 5:271).
  • CXCL9, CXCL10 and CXCL11 can be encoded in oncolytic viruses for treating cancer (see, e.g., U.S. Patent Publication No.2015/0232880; and International Application Publication No. WO 2015/059303).
  • Pseudotyped oncolytic viruses or a genetically engineered bacterium encoding the gene for CXCL10 also can be used to treat cancer (see, e.g., International Application Publication Nos. WO 2018/006005 and WO 2018/129404).
  • Co-Stimulatory Molecules Co-stimulatory molecules enhance the immune response against tumor cells, and co-stimulatory pathways are inhibited by tumor cells to promote tumorigenesis.
  • the immunostimulatory bacteria herein can be engineered to express co-stimulatory molecules, such as, for example, CD40, CD40L, 4-1BB, 4-1BBL, 4-1BBL with a deletion of the cytoplasmic domain (4-1BBL ⁇ cyt), 4-1BBL with a truncated cytoplasmic domain, OX40 (CD134), OX40L (CD252), other members of the TNFR superfamily (e.g., CD27, CD27 ligand, GITR, CD30, Fas receptor, TRAIL-R, TNF-R, HVEM, and RANK), B7, CD80, CD86, ICOS, ICOS ligand (B7RP1), and CD28.
  • co-stimulatory molecules such as, for example, CD40, CD40L, 4-1BB, 4-1BBL, 4-1BBL with a deletion of the cytoplasmic domain (4-1BBL ⁇ cyt), 4-1BBL with a truncated cytoplasm
  • the immunostimulatory bacteria can encode and express truncated co- stimulatory molecules (e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, OX40L), with a full or partial (complete, or truncated, or modified to ensure proper orientation when expressed in a cell) cytoplasmic domain deletion, for expression on an antigen- presenting cell (APC).
  • truncated co- stimulatory molecules e.g., 4-1BBL, CD80, CD86, CD27L, B7RP1, OX40L
  • APC antigen- presenting cell
  • the truncation is sufficient to provide the signaling, and for the modified co-stimulatory molecule to be unable to counter-regulatory signal to the APC.
  • the partial deletion (or truncation) of the cytoplasmic domain is a sufficient deletion to achieve these effects, without affecting the expression of the co-stimulatory molecule, or the orientation of the expressed co-stimulatory molecule.
  • the co-stimulatory molecules also can be modified to eliminate or reduce the immunosuppressive intracellular/reverse signaling by modifications to the amino acids in the cytoplasmic domain, including insertions, deletions, and/or replacements.
  • the co-stimulatory molecules are modified by modification, such as by replacement, of cytoplasmic domain phosphorylation sites. For example, replacing one or more Ser residues at an appropriate locus or loci, such as, for human 4-1BBL, Ser5 and Ser8, with a residue that reduces or eliminates reverse signaling.
  • the immunostimulatory bacteria herein also can be engineered to express agonistic antibodies against co-stimulatory molecules (e.g., 4-1BBL) to enhance the anti-tumor immune response.
  • TNF Receptor Superfamily The TNF superfamily of ligands (TNFSF) and their receptors (TNFRSF) are involved in the proliferation, differentiation, activation and survival of tumor and immune effector cells.
  • TNFSF TNF superfamily of ligands
  • TNFRSF TNF receptors
  • Members of this family include CD30, Fas-L, TRAIL-R, and TNF-R, which induce apoptosis, and CD27, OX40L, CD40L, GITR-L, and 4-1BBL, which regulate B and T-cell immune responses.
  • Other members include herpesvirus entry mediator (HVEM).
  • HVEM herpesvirus entry mediator
  • the expression of TNFSF and TNFRSF by the immunostimulatory bacteria herein can enhance the anti-tumor immune response.
  • agonistic anti-4-1BB monoclonal antibodies have been shown to enhance anti-tumor CTL responses
  • agonistic anti-OX40 antibodies have been shown to increase anti-tumor activity in transplantable tumor models.
  • agonistic anti-GITR antibodies have been shown to enhance anti-tumor responses and immunity (see, e.g., Lechner et al. (2011) Immunotherapy 3(11):1317-1340; and Peggs et al. (2009) Clinical and Experimental Immunology 157:9-19).
  • CD40 and CD40L CD40 which is a member of the TNF receptor superfamily, is expressed by APCs and B cells, while its ligand, CD40L (CD154), is expressed by activated T- cells.
  • CD40 Interaction between CD40 and CD40L stimulates B cells to produce cytokines, resulting in T-cell activation and tumor cell death.
  • CD40 is expressed on the surface of several B-cell tumors, such as follicular lymphoma, Burkitt lymphoma, lymphoblastic leukemia, and chronic lymphocytic leukemia, and its interaction with CD40L has been shown to increase the expression of B7-1/CD80, B7-2/CD86, and human leukocyte antigen (HLA) class II molecules in the CD40 + tumor cells, as well as enhance their antigen-presenting abilities.
  • B7-1/CD80, B7-2/CD86, and human leukocyte antigen (HLA) class II molecules in the CD40 + tumor cells, as well as enhance their antigen-presenting abilities.
  • CD40L Transgenic expression of CD40L in a murine model of multiple myeloma resulted in the induction of CD4 + and CD8 + T-cells, local and systemic anti-tumor immune responses, and reduced tumor growth.
  • Anti-CD40 agonistic antibodies also induced anti-tumor T-cell responses (see, e.g., Marin-Acevedo et al. (2016) Journal of Hematology & Oncology 11:39; Dotti et al. (2002) Blood 100(1):200-207; and Murugaiyan et al. (2007) J. Immunol.178:2047-2055).
  • 4-1BB and 4-1BBL 4-1BB (CD137) is an inducible co-stimulatory receptor that is expressed primarily by T-cells and NK cells; it binds its ligand 4-1BBL, that is expressed on APCs, including DCs, B-cells, and monocytes, to trigger immune cell proliferation and activation.4-1BB results in longer and more widespread responses of activated T- cells.
  • Anti-4-1BB agonists and 4-1BBL fusion proteins have been shown to increase immune-mediated anti-tumor activity, for example, against sarcoma and mastocytoma tumors, mediated by CD4 + Th1 and tumor-specific CTL activity (see, e.g., Lechner et al.
  • 4-1BBL is negatively regulated by its cytoplasmic signaling domain.
  • reverse signaling of the 4-1BBL cytoplasmic domain induces surface translocation of 4-1BBL to bind to form a signaling complex with TLR4.
  • This induces high levels of TNF- ⁇ , comparable to LPS activation of TLR4, that leads to immunosuppression of the adaptive immune response (see, e.g., Ma et al. (2013) Sci. Signaling 295(6):1-11).
  • OX40 and OX40L OX40 are members of the TNF receptor superfamily that is expressed on activated effector T-cells, while its ligand, OX40L is expressed on APCs, including DCs, B cells and macrophages, following activation by TLR agonists and CD40-CD40L signaling.
  • OX40-OX40L signaling results in the activation, potentiation, proliferation and survival of T-cells, as well as the modulation of NK cell function and inhibition of the suppressive activity of Tregs.
  • TILs tumor-infiltrating lymphocytes
  • B7-CD28 Family CD28 is a co-stimulatory molecule expressed on the surface of T-cells that acts as a receptor for B7-1 (CD80) and B7-2 (CD86), which are co-stimulatory molecules expressed on antigen-presenting cells.
  • CD28-B7 signaling is required for T-cell activation and survival, and for the prevention of T-cell anergy, and results in the production of interleukins, such as IL-6.
  • Optimal T-cell priming requires two signals: (1) T-cell receptor (TCR) recognition of MHC-presented antigens, and (2) co-stimulatory signals resulting from the ligation of T-cell CD28 with B7-1 (CD80) or B7-2 (CD86) expressed on APCs.
  • TCR T-cell receptor
  • CTLA-4 receptors are induced, which then outcompete CD28 for binding to B7-1 and B7-2 ligands.
  • Antigen presentation by tumor cells is poor due to their lack of expression of co-stimulatory molecules, such as B7-1/CD80 and B7-2/CD86, resulting in a failure to activate the T-cell receptor complex.
  • co-stimulatory molecules such as B7-1/CD80 and B7-2/CD86
  • upregulation of these molecules on the surfaces of tumor cells can enhance their immunogenicity.
  • Immunotherapy of solid tumors and hematologic malignancies has been successfully induced by B7, for example, via tumor cell expression of B7, or soluble B7-immunoglobulin fusion proteins.
  • B7 in combination with other co-stimulatory ligands, such as ICAM-3 and LFA-3, has been successful in preclinical and clinical trials for the treatment of chronic lymphocytic leukemia and metastatic melanoma. Additionally, soluble B7 fusion proteins have demonstrated promising results in the immunotherapy of solid tumors as single agent immunotherapies (see, e.g., Lechner et al. (2011) Immunotherapy 3(11):1317-1340; and Dotti et al. (2002) Blood 100(1):200-207). 2.
  • Type I interferons include IFN- ⁇ and IFN- ⁇ , and are pleiotropic cytokines with antiviral, anti-tumor, and immunoregulatory activities.
  • IFN- ⁇ is produced by most cell types; IFN- ⁇ primarily is produced by hematopoietic cells, particularly plasmacytoid dendritic cells.
  • Type I IFNs are produced following the sensing of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs).
  • PAMPs pathogen-associated molecular patterns
  • PRRs pattern recognition receptors
  • Type I IFNs exhibit anti-proliferative and pro-apoptotic effects on tumors and have anti-angiogenic effects on tumor neovasculature. They induce the expression of MHC class I molecules on tumor cell surfaces, increase the immunogenicity of tumor cells, and activate cytotoxicity against them.
  • Type I IFN has been used as a therapeutic for the treatment of cancers and viral infections.
  • IFN- ⁇ (sold under the trademark Intron®/Roferon®-A) is approved for the treatment of hairy cell leukemia, malignant melanoma, AIDS-related Kaposi’s sarcoma, and follicular non- Hodgkin’s lymphoma; it also is used in the treatment of chronic myelogenous leukemia (CML), renal cell carcinoma, neuroendocrine tumors, multiple myeloma, non-follicular non-Hodgkin’s lymphoma, desmoid tumors, and cutaneous T-cell lymphoma, although use is limited due to systemic immunotoxicity (see, e.g., Ivashkiv and Donlin (2014) Nat.
  • Type I interferons in tumors and the tumor microenvironment is among the immune responses that the immunostimulatory bacteria herein are designed to evoke. Inducing or evoking type I interferon provides anti-tumor immunity for the treatment of cancer. a. Constitutive STING Expression and Gain-of-Function Mutations The induction of type I IFNs, proinflammatory cytokines and chemokines is necessary for mounting an immune response that prevents or inhibits infection by viral pathogens.
  • the immunostimulatory bacteria provided herein encode proteins that constitutively induce type I IFNs. Among these proteins are those that occur in individuals with various diseases or disorders that involve the over-production of immune response modulators. For example, over-production or excessive production, or defective negative regulation of type I IFNs and pro-inflammatory cytokines, can lead to undesirable effects, such as inflammatory and autoimmune diseases. Disorders involving the overproduction, generally chronic, of type I IFNs, are referred to as interferonopathies (see, e.g., Lu and MacDougall (2017) Front. Genet.8:118; and Konno et al. (2016) Cell Reports 23:1112-1123).
  • Aicardi-Goutiéres syndrome Aicardi-Goutiéres syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), Singleton-Merten syndrome (SMS), atypical SMS, familial chilblain lupus (FCL), systemic lupus erythematosus (SLE), bilateral striatal necrosis (BSN), cerebrovascular disease (CVD), dyschromatosis symmetrica hereditaria (DSH), spastic paraparesis (SP), X- linked reticulate pigmentary disorder (XLPDR), proteasome-associated auto- inflammatory syndrome (PRAAS), intracranial calcification (ICC), Mendelian susceptibility to mycobacterial disease (MSMD), and spondyloenchondrodysplasia (SPENCD) (see, e.g., Rodero et al.
  • the sustained activation of interferon signaling can be due to: 1) loss-of- function mutations leading to increased cytosolic DNA (e.g., mutations in TREX1 and SAMHD1), or increased cytosolic RNA/DNA hybrids (e.g., mutations in RNASEH2A, RNASEH2B, RNASEH2C, and POLA1); 2) loss-of-function mutations resulting in a defect in RNA editing and abnormal sensing of self-nucleic acid RNA species in the cytosol (e.g., mutations in ADAR1); 3) gain-of-function mutations leading to constitutive activation of cytosolic IFN signaling pathways/increased sensitivity to cytosolic nucleic acid ligands (e.g., a mutations in TREX1 and SAMHD1), or increased cytosolic RNA/DNA hybrids (e.g., mutations in RNASEH2A, RNASEH2B, RNASEH2C
  • GEF gain-of-function
  • TMEM173 STING Alleles Stimulator of interferon genes is encoded by the transmembrane protein 173 (TMEM173) gene, which is a ⁇ 7 kb-long gene.
  • TMEM173 gene is characterized by significant heterogeneity and population stratification of alleles.
  • the most common human TMEM173 allele is referred to as R232 (referencing the amino acid present at residue 232; see, e.g., SEQ ID NOs:305-309, setting forth the sequences of various human TMEM173 alleles). More than half the American population is not R232/R232.
  • the second most common allele is R71H-G230A- R293Q (HAQ).
  • AQ G230A-R293Q
  • Q Q293
  • R232H named REF after the reference STING allele first identified and catalogued in the database by Glen Barber.
  • R232/R232 is the most common genotype in Europeans
  • HAQ/R232 is the most common genotype in East Asians. Africans have no HAQ/HAQ genotypes, but have the Q allele, and ⁇ 4% of Africans are AQ/AQ, which is absent in other ethnic populations (see, e.g., Patel and Jin (2016) Genes & Immunity, doi:10.1038/s41435- 018-0029-9).
  • the REF, AQ and Q alleles are highly refractory to bacterially-derived CDNs, such as 3’3’ c-di-GMP (see, e.g., Corrales et al. (2015) Cell Reports 11:1018- 1030).
  • STING Gain-of-Function Mutations Several activating or gain-of-function (GOF) mutations in TMEM173, the gene for STING, inherited and de novo, have been linked to the rare auto- inflammatory disease SAVI (STING-associated vasculopathy with onset in infancy). SAVI is an autosomal dominant disease and is characterized by systemic inflammation, interstitial lung disease, cutaneous vasculitis, and recurrent bacterial infection.
  • SAVI with de novo TMEM173 mutations typically is characterized by an early-onset ( ⁇ 8 weeks) and severe phenotype, while familial mutations result in late- onset (teens to adults) and milder clinical symptoms.
  • Inherited TMEM173 activating mutations include G166E and V155M, whereas de novo mutations include N154S, V155M, V147M, V147L, C206Y, R284G, R281Q, and S102P/F279L (see, e.g., Patel and Jin (2019) Genes & Immunity 20:82-89).
  • TMEM173 mutations that have been identified include R284M, R284K, R284T, E316Q, and R375A (see, e.g., U.S. Application Publication No.2018/0311343).
  • R284S Another gain-of-function mutation in TMEM173 is R284S, which results in a highly constitutively active STING, and was found to trigger innate immune signaling in the absence of activating CDNs, leading to chronic production of pro-inflammatory cytokines (see, e.g., Konno et al. (2016) Cell Reports 23:1112-1123).
  • TMEM173 mutations such as N154S, V155M and V147L, and/or any of the mutations listed in the table below, singly or in any combination, with these and any other such mutations, such as N154S/R284G, result in a gain-of-function STING that is constitutively active and does not require, or is hypersensitive to, ligand stimulation, leading to chronic activation of the STING-interferon pathway. This has been demonstrated (see, e.g., Liu et al. (2014) N. Engl. J. Med.371:507-518).
  • Stimulation with cGAMP resulted in a response in a dose-dependent manner in cells with non- mutated TMEM173, and resulted in a minimal response only at the highest cGAMP concentration, in cells expressing the loss-of-function mutant (see, e.g., Liu et al. (2014) N. Engl. J. Med.371:507-518). These results show that the activating TMEM173 mutations result in constitutive activation of STING, even in the absence of stimulation by cGAMP.
  • G207E is another gain-of-function STING mutation that causes alopecia, photosensitivity, thyroid dysfunction, and SAVI-features.
  • the G207E mutation causes constitutive activation of inflammation-related pathways in HEK cells, as well as aberrant interferon signature and inflammasome activation in patient peripheral blood mononuclear cells (PBMCs).
  • PBMCs peripheral blood mononuclear cells
  • mutants identified were hyperactive mutants R196A/D204A, S271A/Q272A, R309A/E315A, E315A, E315N, E315Q, and S271A (corresponding to R197A/D205A, S272A/Q273A, R310A/E316A, E316A, E316N, E316Q, and S272A, respectively, with reference to the sequence of human STING as set forth in SEQ ID NOs:305-309), that spontaneously induced IFN at low levels of transfection and did not respond to c-di-GMP, and the mutants R374A, R292A/T293A/E295A/E299A, D230A, R231A, K235A, Q272A
  • the immunostimulatory bacteria increase the production of type I IFN-mediated cytokines and chemokines in the tumor microenvironment, potentiating the anti-tumor immune response and improving the therapeutic efficacy of the immunostimulatory bacteria.
  • the gene encoding STING is referred to as TMEM173, the gene encoding MDA5 is IFIH1, and the gene encoding RIG-I is DDX58.
  • TMEM173 the gene encoding MDA5
  • RIG-I is DDX58.
  • STING/TMEM173 SEQ ID NOs:305-309
  • MDA5/IFIH1 SEQ ID NO:310
  • RIG-I/DDX58 SEQ ID NO:311
  • IRF3 SEQ ID NO:312
  • IRF7 SEQ ID NO:313
  • a phosphorylation site or sites such as S324/L325/S326 ⁇ S324A/L325/S326A in STING, and other replacements to eliminate a phosphorylation site to reduce nuclear factor- ⁇ B (NF- ⁇ B) signaling in STING, or other proteins that employ such signaling, also can be introduced.
  • the resulting proteins can be encoded in the immunostimulatory bacteria provided herein.
  • the proteins are encoded on plasmids in the immunostimulatory bacteria.
  • Administering nucleic acids encoding wild-type STING can induce an immune response; the administration of gain-of-function STING mutants, with constitutive activity as provided herein, in tumor-targeted immunostimulatory bacteria, leads to a more potent immune response and more effective anti-cancer therapeutic.
  • the enhanced immune response by the tumor-targeted administration of constitutively active STING, or other such modified DNA/RNA sensors, such as gain- of-function mutants of MDA5, RIG-I, IRF3, or IRF7, as provided herein, provides a therapeutically more effective anti-cancer treatment.
  • modifying the immunostimulatory bacteria so that they do not infect epithelial cells, but retain the ability to infect phagocytic cells, including tumor-resident immune cells effectively targets the immunostimulatory bacteria to the tumor microenvironment, improving therapeutic efficiency and preventing undesirable systemic immune responses.
  • These tumor-targeted bacteria are engineered to encode gain-of-function STING, MDA5, RIG-I, IRF3, or IRF7 mutants, which are constitutively active, for example, even in the absence of ligand stimulation, providing a potent type I IFN response to improve the anti-cancer immune response in the tumor microenvironment.
  • the administration of constitutively activated STING can provide an alternative means to boost STING signaling for the immunotherapeutic treatment of cancer.
  • the tumor-targeting immunostimulatory bacteria provided herein can be modified to encode STING/TMEM173 (SEQ ID NOs: 305-309) with gain-of-function mutations, selected from S102P, V147L, V147M, N154S, V155M, G166E, R197A, D205A, R197A/D205A, C206Y, G207E, D231A, R232A, K236A, R238A, D231A/R232A/K236A/R238A, S272A, Q273A, S272A/Q273A, F279L, S102P/F279L, R281Q, R284G, R284S, R284M, R284K, R284T, R293A, T294A, E296A, R293
  • IRF3 interferon regulatory factor 3, or IRF-7
  • IRF7 or IRF-7
  • IRF3 and IRF7 are key activators of type I IFN genes. Following virus-induced C-terminal phosphorylation (by TBK1), activated IRF3 and IRF7 form homodimers, translocate from the cytoplasm to the nucleus, and bind to IFN-stimulated response elements (ISREs) to induce type I IFN responses.
  • IRF3 and IRF7 are key activators of type I IFN genes. Following virus-induced C-terminal phosphorylation (by TBK1), activated IRF3 and IRF7 form homodimers, translocate from the cytoplasm to the nucleus, and bind to IFN-stimulated response elements (ISREs) to induce type I IFN responses.
  • ISREs IFN-stimulated response elements
  • IRF3 is expressed constitutively in unstimulated cells, and exists as an inactive cytoplasmic form, while IRF7 is not constitutively expressed in cells, and is induced by IFN, lipopolysaccharide and virus infection. Overexpression of IRF3 significantly increases the virus-mediated expression of type I IFN genes, resulting in the induction of an antiviral state. IRF3 activation also has been shown to up-regulate the transcription of the CC-chemokine RANTES (CCL5) following viral infection (see, e.g., Lin et al. (1999) Mol. Cell Biol.19(4):2465-2474).
  • CCL5 CC-chemokine RANTES
  • Residues S385, S386, S396, S398, S402, T404, and S405 in the C-terminal domain of IRF3 are phosphorylated after virus infection, inducing a conformational change that results in the activation of IRF3.
  • IRF3 activation is induced, not only by viral infection, but also by lipopolysaccharide (LPS) and poly(I:C).
  • LPS lipopolysaccharide
  • poly(I:C) poly(I:C)
  • IRF3(S396D) enhances the transactivation of IFN ⁇ 1, IFN- ⁇ , and RANTES promoters by 13-, 14-, and 11-fold, respectively, compared to wild-type IRF3.
  • Another mutant, IRF3(S396D/S398D) enhances the transactivation of IFN ⁇ 1, IFN- ⁇ , and RANTES promoters by 13-, 12-, and 12-fold, respectively, compared to wild-type IRF3.
  • IRF3(5D) Another constitutively active mutant of IRF3 is IRF3(5D), in which the serine or threonine residues at positions 396, 398, 402, 404, and 405 are replaced by phosphomimetic aspartic acid residues (IRF3(S396D/S398D/S402D/T404D/S405D)).
  • Similar gain-of-function mutations, leading to constitutive activity of immune response mediators, such as induction of type I interferon can be achieved by mutating serine residues to phosphomimetic aspartic acid in other proteins, such as RIG-I, MDA5 and STING, that are in immune response signaling pathways.
  • IRF3(5D) displays constitutive DNA binding and transactivation activities, dimer formation, association with the transcription coactivators p300 (also called EP300, or E1A binding protein p300)/ CBP (also known as CREB-binding protein, or CREBBP), and nuclear localization. Its transactivation activity is not induced further by virus infection.
  • IRF3(5D) is a very strong activator of IFN- ⁇ and ISG-15 gene expression; IRF3(5D) alone stimulates IFN- ⁇ expression as strongly as virus infection, and enhances transactivation of IFN ⁇ 1, IFN- ⁇ , and RANTES promoters by 9-fold, 5.5-fold, and 8-fold, respectively, compared to wild-type IRF3 (see, e.g., Lin et al. (2000) J. Biol. Chem.275(44):34320-34327; Lin et al. (1998) Mol. Cell Biol. 18(5):2986-2996; and Servant et al. (2003) J. Biol. Chem.278(11):9441-9447).
  • dsDNA cytosolic double-stranded DNA
  • IFN type I interferon
  • ER endoplasmic reticulum
  • IRF3 transcription factor interferon regulatory factor 3
  • the TANK binding kinase 1 (TBK1)/IRF3 axis results in the induction of type I IFNs, and the activation of dendritic cells (DCs) and cross-presentation of tumor antigens to activate CD8 + T cell-mediated anti-tumor immunity.
  • STING signaling also activates the nuclear factor kappa-light-chain-enhancer of activated B cell (NF- ⁇ B) signaling axis, resulting in a pro-inflammatory response, but not in the activation of the DCs and CD8 + T-cells that are required for anti-tumor immunity.
  • STING Upon recognition of 2’3’ cGAMP, STING translocates from the endoplasmic reticulum through the Golgi apparatus, allowing the recruitment of TANK-binding kinase 1 (TBK1), and the activation of the transcription factors IRF3 and NF- ⁇ B.
  • the carboxyl-terminal tail (C-terminal tail or CTT) region of STING is necessary and sufficient to activate TBK1 and stimulate the phosphorylation of IRF3; it also is involved in NF- ⁇ B signaling.
  • the CTT is an unstructured stretch of approximately 40 amino acids that contains sequence motifs required for STING phosphorylation and recruitment of IRF3.
  • IRF3 and NF- ⁇ B downstream signaling is attributed to specific sequence motifs within the C-terminal tail (CTT) of STING that are conserved among vertebrate species.
  • CTT C-terminal tail
  • Modular motifs in the CTT which include IRF3-, TBK1-, and TRAF6-binding modules, control the strength and specificity of cell signaling and immune responses.
  • the IRF3 and NF- ⁇ B downstream responses can be affected, and sometimes opposite.
  • the STING CTT elements dictate and finely tune the balance between the two signaling pathways, resulting in different biological responses. In human and mouse immune cells, for example, STING-dependent IRF3 activation results predominantly in a type I interferon response.
  • STING signaling in human cells also drives a pro-inflammatory response through canonical and possibly non-canonical NF- ⁇ B pathways via TRAF6 recruitment.
  • Human STING residue S366 (see, e.g., SEQ ID NOs:305-309) is a primary TBK1 phosphorylation site that is part of an LxIS motif in the CTT, which is required for IRF3 binding, while a second PxPLR motif, including residue L374, is required for TBK1 binding.
  • the LxIS and PxPLR motifs are highly conserved in all vertebrate STING alleles. In other species, STING signaling results predominantly in the activation of the NF- ⁇ B signaling axis.
  • the zebrafish CTT which is responsible for hyperactivation of NF- ⁇ B signaling, contains an extension with a highly conserved PxExxD motif at the extreme C-terminus that is not present in human and other mammalian STING alleles; this motif shares similarity with tumor necrosis factor receptor-associated factor 6 (TRAF6) binding sites. While the role of TRAF6 in human STING signaling is non- essential, TRAF6 recruitment is essential for zebrafish STING-induced NF- ⁇ B activation.
  • TRAF6 tumor necrosis factor receptor-associated factor 6
  • a human-zebrafish STING chimera in which human STING was engineered to contain the zebrafish STING CTT module DPVETTDY, induced more than 100-fold activation of NF- ⁇ B activation, indicating that this region is necessary and sufficient to direct enhanced NF- ⁇ B signal activation.
  • the addition of the zebrafish CTT also resulted in an increased STING interferon response (see, de Oliveira Mann et al. (2019) Cell Reports 27:1165-1175).
  • modified STING proteins that have reduced NF- ⁇ B signaling, and/or optionally, increased IRF3 signaling, so that when the STING protein is delivered to and expressed in the TME, the resulting response is an increased anti-tumor/anti-viral response, compared to the unmodified STING protein.
  • STING proteins from species that have low or no NF- ⁇ B signaling activity are provided in delivery vehicles, including any of the immunostimulatory bacteria described herein or known to those of skill in the art, as well as in other delivery vehicles, such as viral vectors, including oncolytic vectors, minicells, exosomes, liposomes, and in cells, such as T-cells that are used in cell therapy and used to deliver vehicles, such as bacteria and oncolytic vectors.
  • the non-human STING proteins can be, but are not limited to, STING proteins from the following species: Colombian devil (Sarcophilus harrisii; SEQ ID NO:349), marmoset (Callithrix jacchus; SEQ ID NO:359), cattle (Bos taurus; SEQ ID NO:360), cat (Felis catus; SEQ ID NO:356), ostrich (Struthio camelus australis; SEQ ID NO:361), crested ibis (Nipponia nippon; SEQ ID NO:362), coelacanth (Latimeria chalumnae; SEQ ID NOs:363-364), boar (Sus scrofa; SEQ ID NO:365), bat (Rousettus aegyptiacus; SEQ ID NO:366), manatee (Trichechus manatus latirostris; SEQ ID NO:367), ghost shark (Callorhinchus milii; S
  • the non-human STING proteins readily activate immune signaling in human cells, indicating that the molecular mechanism of STING signaling is shared in vertebrates (see, de Oliveira Mann et al. (2019) Cell Reports 27:1165-1175).
  • the non-human STING proteins contain any of the constitutive STING activation and gain-of-function mutations, at corresponding loci in the non-human STING corresponding to those in human STING, described above (see, Example 17 below, which provides exemplary alignments and corresponding mutations in various species; see, also, Figures 1-13).
  • chimeras of STING proteins are provided.
  • the CTT region, or portion(s) thereof that confers or participates in NF- ⁇ B signaling/activity, of a first species STING protein is replaced with the corresponding CTT or portion(s) thereof from a second species, whose STING protein has lower or very little, less than human, NF- ⁇ B signaling activity.
  • the first species is human
  • the replacing CTT or portion(s) thereof is from the STING of a species such as Georgian devil, marmoset, cattle, cat, ostrich, boar, bat, manatee, crested ibis, coelacanth, and ghost shark, which have much lower NF- ⁇ B activity.
  • the chimeras can further include the human constitutive STING activation and gain-of-function mutations in corresponding loci to increase or render type I interferon activity constitutive.
  • the TRAF6 binding motif can be deleted to further decrease or eliminate activity that is not desirable in an anti-tumor therapeutic.
  • non-human STING proteins, chimeras, and mutants are provided in delivery vehicles, such as any described herein or known to those of skill in the art, including oncolytic viral vectors, cells, such as stem cells and T-cells that are used in cell therapies, exosomes, minicells, liposomes, and the immunostimulatory bacteria provided herein, which accumulate in tumor- resident immune cells, and deliver encoded proteins to the tumor microenvironment and to tumors.
  • the non-human STING proteins, modified STING proteins, and STING chimeras are for use as therapeutics for the treatment of tumors as described herein, or for use in other methods known to those of skill in the art.
  • Pharmaceutical compositions containing the STING proteins, delivery vehicles, and encoding nucleic acids also are provided.
  • RLRs retinoic acid-inducible gene I (RIG-I)-like receptors
  • RIG-I retinoic acid-inducible gene I
  • MDA5 melanoma differentiation-associated protein 5
  • RLRs are cytoplasmic sensors of viral dsRNA and nucleic acids secreted by bacteria, and include RIG-I, MDA5, and LGP2 (laboratory of genetics and physiology 2).
  • a ligand such as a viral dsRNA
  • RIG-I and MDA5 activate the mitochondrial antiviral- signaling adaptor protein, or MAVS, which recruits tumor necrosis factor (TNF) receptor-associated factors (TRAFs), to assemble a signaling complex at the outer membranes of the mitochondria.
  • TRAFs tumor necrosis factor receptor-associated factors
  • Downstream signaling components further are recruited by TRAFs, resulting in the phosphorylation and activation of IRF3 (interferon regulatory factor 3), IRF7, NF- ⁇ B (nuclear factor kappa-light-chain- enhancer of activated B cells), and AP-1 (activator protein 1).
  • IFNs As a result, the expression of IFNs, proinflammatory cytokines, and other genes involved in pathogen clearance, is induced (see, e.g., Lu and MacDougall (2017) Front. Genet.8:118). Like STING, the constitutive activation of MDA5 and RIG-I due to gain-of-function mutations leads to the induction of type I IFNs, which can be leveraged to enhance the anti-tumor immune response in the immunostimulatory bacteria. i.
  • RIG-I Retinoic acid-inducible gene I (RIG-I), also known as DDX58 (DEXD/H-box helicase 58), is another protein whose constitutive activation has been linked to the development of interferonopathies, such as atypical Smith-Magenis syndrome.
  • RIG-I like MDA5/IFIH1, is a member of the RIG-I-like receptor (RLR) family, and is a 925- residue cytosolic pattern recognition receptor that functions in the detection of viral dsRNA.
  • RIG-I initiates an innate immune response to viral RNA through independent pathways that promote the expression of type I and type III IFNs and proinflammatory cytokines (see, e.g., Jang et al.
  • Atypical Smith-Magenis syndrome without hallmark dental anomalies, but with variable phenotypes, including glaucoma, aortic calcification and skeletal abnormalities, has been found to be caused by mutations in the DEXD/H-box helicase 58 gene (DDX58), which encodes retinoic acid-inducible gene I (RIG-I).
  • DDX58 DEXD/H-box helicase 58 gene
  • RIG-I retinoic acid-inducible gene
  • Elevated amounts of mutated DDX58 were associated with a significant increase in the basal levels of NF- ⁇ B reporter gene activity, and this activity was further increased by stimulation with the dsRNA analog poly(I:C).
  • the RIG-I mutations also induced IRF3 phosphorylation and dimerization at the basal level, and led to increased expression of IFNB1, interferon-stimulated gene 15 (ISG15), and chemokine (C-C motif) ligand 5 (CCL5) in both basal, and poly(I:C) transfected HEK293FT cells.
  • Tumor-targeting immunostimulatory bacteria can be modified to encode RIG-I/DDX58 (see, e.g., SEQ ID NO:311) with gain-of-function mutations such as, but not limited to, E373A and C268F, singly, and in combination. ii.
  • MDA5/IFIH1 Another interferonopathy gene is the IFN-induced with helicase C domain- containing protein 1 (IFIH1), also known as melanoma differentiation-associated protein 5 (MDA5), which is a member of the RIG-I-like family of cytoplasmic DExD/H box RNA receptors.
  • IFIH1 IFN-induced with helicase C domain- containing protein 1
  • MDA5 melanoma differentiation-associated protein 5
  • MDA5 melanoma differentiation-associated protein 5
  • TNF tumor necrosis factor
  • TRF7 tumor necrosis factor 7
  • NF- ⁇ B tumor necrosis factor kappa-light-chain-enhancer of activated B cells
  • AP-1 activator protein 1
  • Gain-of-function (GOF) IFIH1 variants occur in subjects with autoimmune disorders, including Aicardi-Goutiéres syndrome (AGS) and Singleton-Merten syndrome (SMS), which are characterized by prominent vascular inflammation.
  • AGS is an inflammatory disease particularly affecting the brain and skin, and is characterized by an upregulation of interferon-induced transcripts.
  • AGS typically occurs due to mutations in any of the genes encoding DNA exonuclease TREX1, the three non-allelic components of the RNase H2 endonuclease complex, the deoxynucleoside triphosphate triphosphohydrolase SAMHD1, and the double- stranded RNA editing enzyme ADAR1.
  • Singleton-Merten syndrome is an autosomal- dominant disorder characterized by abnormalities in the blood vessels (e.g., calcification), teeth (e.g., early-onset periodontitis, root resorption), and bones (e.g., osteopenia, acro-osteolysis, osteoporosis).
  • Interferon signature genes are upregulated in Singleton-Merten syndrome patients, which was linked to GOF mutations in IFIH1 (see, e.g., Rice et al. (2014) Nat. Genet.46(5):503-509; and Rutsch et al.
  • IFN- ⁇ reporter stimulatory activity of wild-type IFIH1, and six IFIH1 GOF mutants identified in AGS patients was compared in HEK293T cells, which express low levels of endogenous viral RNA receptors.
  • Wild-type IFIH1 was induced upon binding of the long (> 1 kb) dsRNA analog polyinosinic-polycytidylic acid (poly(I:C)), but not by a short 162 bp dsRNA, and had minimal activity in the absence of exogenous RNA.
  • the IFIH1 mutants displayed a significant induction of IFN signaling in response to the short 162 bp dsRNA, in addition to robust signaling in response to poly(I:C).
  • the mutants also displayed a 4-10 fold higher level of baseline signaling activity in the absence of exogenous ligand (Rice et al. Nat. Genet.46(5):503-509).
  • Another gain-of-function IFIH1 mutation, R822Q was identified as causing Singleton-Merten syndrome by triggering type I IFN production, and leading to early arterial calcification, as well as dental inflammation and resorption.
  • HEK293T cells (which have the lowest endogenous IFIH1 expression levels) were used to overexpress wild-type and R822Q MDA5.
  • IFNB1 interferon, beta 1, fibroblast
  • R822Q IFIH1 resulted in higher levels of IFNB1 expression than wild-type IFIH1, indicating that R822Q IFIH1 is hyperactive to non-self dsRNA.
  • interferon signature genes such as IFI27, IFI44L, IFIT1, ISG15, RSG15, RSAD2, and SIGLEC1 in whole-blood samples from Singleton-Merten syndrome patients, which was in agreement with the higher expression level of IFNB1 by R822Q IFIH1 (see, e.g., Rutsch et al. (2015) Am. J. Hum. Genet.96:275-282).
  • the interferon signature observed in patients with another IFIH1 GOF mutation, A489T is indicative of a type I interferonopathy; IFIH1 A489T is associated with increased interferon production and phenotypes resembling chilblain lupus, AGS, and SMS (see, e.g., Bursztejn et al. (2015) Br. J. Dermatol.173(6):1505- 1513).
  • the A489T variant not only resulted in IFN induction following stimulation with the long dsRNA analog poly(I:C), but also with short dsRNA.
  • T331I and T331R Two additional gain-of-function mutations in IFIH1, T331I and T331R, were identified in patients with SMS phenotypes, who presented with a significant upregulation of IFN-induced transcripts.
  • the T331I and T331R variants resulted in increased expression of IFN- ⁇ , even in the absence of exogenous dsRNA ligand, consistent with the observed constitutive activation of MDA5 (see, e.g., Lu and MacDougall (2017) Front. Genet. 8:118).
  • A946T is another IFIH1 GOF mutation that leads to the increased production of type I IFN, promoting inflammation and increasing the risk of autoimmunity.
  • the A946T mutation in IFIH1 results in additive effects when combined with the TMEM173 R232 allele and the G207E GOF mutation in STING, leading to a severe early-onset phenotype with features similar to SAVI (see, e.g., Keskitalo et al. (2016) preprint, available from doi.org/10.1101/394353).
  • G821S is a GOF mutation in IFIH1 which has been shown to lead to spontaneously developed lupus-like autoimmune symptoms in a mouse model (see, e.g., Rutsch et al. (2015) Am. J. Hum. Genet.
  • the tumor-targeting immunostimulatory bacteria provided herein can be modified to encode MDA5/IFIH1 (see, e.g., SEQ ID NO:310) with gain-of-function mutations selected from T331I, T331R, R337G, L372F, D393V, A452T, A489T, G495R, R720Q, R779H, R779C, G821S, R822Q, and A946T, singly, or in any combination.
  • MDA5/IFIH1 see, e.g., SEQ ID NO:310
  • gain-of-function mutations selected from T331I, T331R, R337G, L372F, D393V, A452T, A489T, G495R, R720Q, R779H, R779C, G821S, R822Q, and A946T, singly, or in any combination.
  • IRF7 Constitutively active forms of IRF7 (or IRF-7) include mutants in which different C-terminal serines are substituted by phosphomimetic Asp, including IRF7(S477D/S479D), IRF7(S475D/S477D/S479D), and IRF7(S475D/S476D/S477D/S479D/S483D/S487D).
  • IRF7(S477D/S479D) is a strong transactivator for IFNA and RANTES gene expression, and stimulates gene expression, even in the absence of virus infection.
  • IRF7(S475D/S477D/S479D), and IRF7(S475D/S476D/S477D/S479D/S483D/S487D) do not further augment the transactivation activity of IRF7(S477D/S479D), but the transactivation activity of all three mutants is stimulated further by virus infection.
  • the mutant IRF7( ⁇ 247-467), which localizes to the nucleus in uninfected cells, is a very strong constitutive form of IRF7; it activates transcription more than 1500-fold higher than wild-type IRF7 in unstimulated and virus infected cells (see, e.g., Lin et al. (2000) J. Biol. Chem.
  • the immunostimulatory bacteria provided herein can encode and express constitutively active IRF7 mutants, including those with replacements at residues 475-477, 479, 483, and 487, and those with amino acid deletions.
  • the immunostimulatory bacteria encode these proteins on plasmids under the control of promoters and, any other desired regulatory signals recognized by mammalian hosts, including humans. e. Other Type I IFN Regulatory Proteins Other proteins involved in the recognition of DNA/RNA that activate type I IFN responses can be mutated to generate constitutive type I IFN expression.
  • the unmodified and/or modified proteins can be encoded in the immunostimulatory bacteria provided herein, to be used to deliver the protein to the tumor microenvironment, such as to tumor-resident immune cells, to increase expression of type I IFN.
  • proteins include, but are not limited to, proteins designated TRIM56, RIP1, Sec5, TRAF2, TRAF3, TRAF6, STAT1, LGP2, DDX3, DHX9 (DDX9), DDX1, DDX21, DHX15, DHX33, DHX36, DDX60, and SNRNP200.
  • Gain-of-function variants can be produced, such as by screening and/or by mutagenesis.
  • Site-directed mutagenesis can be performed in vitro to identify mutations with enhanced activity, that lead to higher level and/or constitutive type I IFN expression.
  • Intact genomic DNA can be obtained from non-related patients experiencing auto-immune and auto-inflammatory symptoms, and from healthy individuals, to screen for and identify other products whose expression leads to increased or constitutive type I IFN expression.
  • Whole exome sequencing can be performed, and introns and exons can be analyzed, such that proteins with mutations in the pathways associated with the increased or constitutive expression of type I interferon are identified.
  • cDNA molecules encoding the full-length gene, with and without the identified mutation(s) are transfected into a reporter cell line that measures expression of type I interferon.
  • a reporter cell line can be generated where the expression of luciferase is placed under the control of the promoter for IFN- ⁇ .
  • a gain-of-function mutant that is constitutively active will promote the expression of IFN- ⁇ , whereas the unstimulated wild-type protein will not.
  • Stimulation can be by virus infection, bacterial infection, bacterial nucleic acids, LPS, dsRNA, poly(I:C), or by increasing exogenous levels of the protein’s ligand (e.g., CDNs).
  • Identified proteins also include those that enhance an immune response to an antigen(s) of interest in a subject.
  • the immune response comprises a cellular or humoral immune response characterized by one or more of: (i) stimulating type I interferon pathway signaling; (ii) stimulating NF- ⁇ B pathway signaling; (iii) stimulating an inflammatory response; (iv) stimulating cytokine production; (v) stimulating dendritic cell development, activity, or mobilization; (vi) any other responses indicative of a product whose expression enhances an immune response; and (vii) a combination of any of (i)-(vi). 3.
  • scFv-Fc antibody fragments include scFv-Fc antibody fragments, in which the V H domain of the scFv is linked to an Fc region, as well as dimers and multimers and other combinations and forms of antibodies that are known to those of skill in the art.
  • Antibody fragments and other constructs allow for targeting of antigens in a manner that can be encoded on a plasmid and delivered, as exemplified herein, by an immunostimulatory bacterium.
  • antigens to target include, tumor antigens, including those discussed in the Examples below, and other exemplary targets discussed below and elsewhere herein. Any target known to the skilled person is included, as are neo-antigens formed upon changes in conformation or structure. a.
  • TGF- ⁇ Transforming growth factor beta is a pleiotropic cytokine with numerous roles in embryogenesis, wound healing, angiogenesis, and immune regulation. It exists in three isoforms in mammalian cells, TGF- ⁇ 1, TGF- ⁇ 2, and TGF- ⁇ 3; TGF- ⁇ 1 is the most predominant in immune cells (see, e.g., Esebanmen et al. (2017) Immunol. Res.65:987-994). TGF- ⁇ ’s role as an immunosuppressant is arguably its most dominant function. Its activation from a latent form in the tumor microenvironment, in particular, has profound immunosuppressive effects on DCs and their ability to tolerize antigen-specific T-cells.
  • TGF- ⁇ also can directly convert Th1 CD4 + T-cells to immunosuppressive Tregs, further promoting tumor tolerance (see, e.g., Travis et al. (2014) Annu. Rev. Immunol.32:51-82). Based on its tumor- specific immunosuppressive functions, and irrespective of its known cancer cell growth and metastasis-promoting properties, inhibition of TGF- ⁇ is a cancer therapy target. High levels of TGF- ⁇ signaling have been demonstrated in several human tumor types, including colorectal cancer (CRC), hepatocellular carcinoma (HCC), pancreatic ductal adenocarcinoma (PDAC), and non-small-cell lung cancer (NSCLC) (see, e.g., Colak et al.
  • CRC colorectal cancer
  • HCC hepatocellular carcinoma
  • PDAC pancreatic ductal adenocarcinoma
  • NSCLC non-small-cell lung cancer
  • TGF- ⁇ Systemic inhibition of TGF- ⁇ can lead to unacceptable autoimmune toxicities, and its inhibition should be localized to the tumor microenvironment.
  • One way to accomplish this is to create a soluble TGF- ⁇ receptor that acts as a decoy for binding TGF- ⁇ (see, e.g., Zhang et al. (2008) J. Immunol.181:3690-3697).
  • a tumor-targeting immunostimulatory bacteria, containing a TGF- ⁇ receptor decoy, provided herein can bind and remove TGF- ⁇ from the tumor microenvironment, thereby breaking tumor immune tolerance and stimulating anti-tumor immunity.
  • TGF-beta binding decoy receptors In addition to TGF-beta binding decoy receptors, other TGF-beta polypeptide antagonists, that can bind to and eliminate or reduce TGF- ⁇ in the tumor microenvironment, thereby breaking tumor immune tolerance and stimulating anti- tumor immunity, are included. Exemplary of such are anti-TGF-beta antibodies or antibody fragments, anti-TGF-beta receptor antibodies or antibody fragments, and soluble TGF-beta antagonist polypeptides.
  • Immunostimulatory bacteria are provided herein that accumulate in the tumor microenvironment, in tumors, and in particular, in tumor-resident immune cells, and that contain plasmids encoding TGF-beta polypeptide antagonists, including, for example, TGF-beta binding decoy receptors (TGF- ⁇ receptor decoys), anti-TGF-beta antibodies or antibody fragments, anti-TGF-beta receptor antibodies or antibody fragments, and soluble TGF-beta antagonist polypeptides.
  • TGF-beta binding decoy receptors TGF- ⁇ receptor decoys
  • anti-TGF-beta antibodies or antibody fragments anti-TGF-beta receptor antibodies or antibody fragments
  • soluble TGF-beta antagonist polypeptides soluble TGF-beta antagonist polypeptides.
  • the antibody fragments can include any known in the art, or described herein, such as, but not limited to, scFvs and scFv-Fcs.
  • Bispecific scFvs and T-Cell Engagers The use of scFvs has been improved by increasing the valency of binding to the target, often through the use of one or more scFv fragments (bis-specific, tri- specific, etc.), joined together by a long linker.
  • Bi-specific T-cell engager available under the trademark BiTE®
  • BiTE® constructs are a class of artificial bispecific monoclonal antibodies that are utilized in cancer immunotherapy, and are formed by linking two single-chain variable fragments (scFvs), such that one scFv binds CD3 on the surface of cytotoxic T-cells, and the other binds a specific tumor-associated antigen (TAA).
  • BiTEs® thus target T-cells to tumor cells, stimulating T-cell activation, cytokine production and tumor cell cytotoxicity independently of MHC class I or co- stimulatory molecules.
  • Two examples of bi-specific T-cell engagers (BiTEs® have been approved by the FDA, including catumaxomab, which is directed against the tumor antigen EpCAM, and against CD3, and is used in the treatment of malignant ascites, and blinatumomab, a BiTE® antibody directed against CD19 and CD3, which is used for the treatment of relapsed, refractory acute lymphoblastic leukemia (ALL; see, e.g., Ahamadi-Fesharaki et al. (2019) Mol. Ther.
  • ALL refractory acute lymphoblastic leukemia
  • BiTEs® target a variety of antigens, including, for example, carcinoembryonic antigen (CEA), prostate-specific membrane antigen (PSMA), EGFR, EphA2, HER2/neu, ADAM17/TACE, prostate stem cell antigen (PSCA), Delta-like ligand 3 (DDL3), and melanoma-associated chondroitin sulfate proteoglycan (MCSP).
  • CEA carcinoembryonic antigen
  • PSMA prostate-specific membrane antigen
  • EGFR epidermal
  • EphA2 epidermal
  • HER2/neu epidermal
  • ADAM17/TACE prostate stem cell antigen
  • PSCA prostate stem cell antigen
  • DDL3 Delta-like ligand 3
  • MCSP melanoma-associated chondroitin sulfate proteoglycan
  • MCSP melanoma-associated chondroitin sulfate proteoglycan
  • PD-1 Anti-PD-1, Anti-PD-L1 and Anti-CTLA-4 Antibodies i. Anti-PD-1/Anti-PD-L1 Antibodies
  • Programmed cell death protein 1 PD-1 is an immune-inhibitory receptor that is involved in the negative regulation of immune responses. Its cognate ligand, programmed death-ligand 1 (PD-L1), is expressed on antigen-presenting cells (APCs), and upon binding to PD-1 on T-cells, leads to loss of CD8 + T-cell effector function, inducing T-cell tolerance.
  • APCs antigen-presenting cells
  • the expression of PD-L1 is often associated with tumor aggressiveness and reduced survival in certain human cancers (see, e.g., Gao et al. (2009) Clin. Cancer Res.15(3):971-979).
  • Antibodies designed to block immune checkpoints such as anti-PD-1 (for example, pembrolizumab, and nivolumab) and anti-PD-L1 (for example, atezolizumab, avelumab, and durvalumab) antibodies can prevent T-cell anergy and break immune tolerance. Only a fraction of treated patients, however, exhibit clinical benefit, and those that do, often present with autoimmune-related toxicities (see, e.g., Ribas (2015) N. Engl. J. Med.373(16):1490-1492; and Topalian et al. (2012) N. Engl. J. Med.366(26):2443-2454).
  • anti-PD-1 for example, pembrolizumab, and nivolumab
  • anti-PD-L1 for example, atezolizumab, avelumab, and durvalumab
  • an immunostimulatory bacterium containing a plasmid encoding an antibody or antibody fragment, such as an scFv and scFv-Fc, and others known in the art and/or described herein, against PD-1 or against PD-L1, will synergize with activation of immune cells to potentiate anti-tumor immunity. ii.
  • CTLA-4 cytotoxic T-lymphocyte-associated protein 4
  • CD152 cluster of differentiation 152
  • CTLA-4 is another immune-inhibitory receptor that functions as an immune checkpoint, and downregulates immune responses.
  • CTLA-4 is constitutively expressed in regulatory T-cells (Tregs, or T regs ), and contributes to their inhibitory function, but is upregulated in conventional T-cells only after activation.
  • Tregs regulatory T-cells
  • CTLA-4 functions as an immune checkpoint by transmitting inhibitory signals to T- cells.
  • CTLA-4 is homologous to the T-cell co-stimulatory protein, CD28, and both molecules bind to CD80 (also known as B7-1 or B7.1) and CD86 (also known as B7- 2 or B7.2) ligands on antigen-presenting cells (APCs).
  • CD80 also known as B7-1 or B7.1
  • CD86 also known as B7- 2 or B7.2
  • APCs antigen-presenting cells
  • the binding of CTLA-4 to the ligands transmits an inhibitory signal to T-cells, whereas the binding of CD28 transmits a stimulatory signal.
  • CTLA-4 receptors are induced, which then outcompete CD28 receptors on T-cells, for binding to CD80 and CD86 ligands on the surfaces of APCs.
  • CTLA-4 binds to CD80 and CD86 with greater affinity and avidity than CD28, thus enabling it to outcompete CD28 for its ligands, resulting in the transmittal of inhibitory signals to T-cells, and an immune inhibitory response.
  • T-cell activation through the T-cell receptor and CD28 leads to increased expression of CTLA-4.
  • Optimal T-cell priming requires co-stimulatory signals resulting from the ligation of T-cell CD28 with CD80 and/or CD86. The blockade of CTLA-4 from binding to these ligands thus enhances T-cell priming, and allows for the induction of an anti-tumor immune response.
  • the immunostimulatory bacterial strains provided herein contain plasmids encoding anti-CTLA-4 antibodies, including fragments thereof, such as, but not limited to, anti-CTLA-4 scFvs (see, e.g., copending PCT application International PCT Application No. PCT/US2020/060307 for sequences of exemplary human anti-CTLA-4 scFv and scFv-Fc fragments; see, also, Example 25).
  • d. Additional Exemplary Checkpoint Targets Exemplary immune checkpoint targets for which an scFv, or any other recombinant antibody fragment against them can be prepared, or are exemplified herein include, but are not limited to, those listed in the table below:
  • Cytokines are powerful modulators of the anti-tumor immune response. Cytokine combinations are known to have profound synergistic effects on different immune compartments involving T-cells, NK cells, and myeloid cells (including dendritic cells and macrophages). Cytokines are known to play major roles in antigen priming by dendritic cells, survival and proliferation of innate immune cells and antigen-specific T-cells, and the cytotoxic activity of NK and T-cells. Cytokine combinations must be properly chosen to maximize biological responses and enhance anti-tumor immunity.
  • IFN- ⁇ alone was found to enhance the CD8 + T-cell cytolytic function of virally infected cells, while IL- 15 alone enhanced the proliferation of activated lymphocytes. Together, they maximally suppressed hepatitis B (HBV) infection (see, e.g., Di Scala et al. (2016) J. Virol.90(19):8563-8574).
  • HBV hepatitis B
  • combinations of the cytokines IL-15 + IL-18, and IL-15 + IL-21 were able to enhance the production of IFN- ⁇ from human NK and T-cells (see, e.g., Strengell et al. (2003) J.
  • IL-2 + IL-18 synergized to enhance IFN- ⁇ production and increase the cytolytic function of CD4 + T-cells, CD8 + T cells, and NK lymphocytes (see, e.g., Son et al. (2001) Cancer Res.61(3):884-888).
  • IL-12 and IL-18 were found to synergize to promote antigen-CD3 T-cell ligation-independent production of IFN- ⁇ from human T-cells (see, e.g., Tominaga et al. (2000) Int. Immunol.12(2):151- 160).
  • Combinations of cytokines are powerful enhancers of T-cell function, but the FDA-approved anti-cancer cytokines are too toxic to be dosed systemically and are thus rarely used, and combinations of systemically-administered cytokines only compound the toxicity (see, e.g., Conlon et al. (2019) J. Interferon Cytokine Res. 39(1):6-21).
  • the immunostimulatory bacteria provided herein solve these problems.
  • immunostimulatory bacteria containing plasmids encoding multiple therapeutic products, such as immunomodulatory proteins, that allow for tumor- specific delivery of cytokine combinations and/or combinations with other therapeutic products, such as the inducers of type I interferon discussed herein, and others, including co-stimulatory molecules, chemokines, and antibodies and fragments thereof.
  • These immunostimulatory bacteria achieve powerful and synergistic immuno-activation without the systemic toxicities and pharmacokinetic (PK) liabilities associated with direct IV administration of the cytokines and other therapeutic products.
  • PK pharmacokinetic
  • Combinations of therapeutic products that can be encoded on the plasmids in the immunostimulatory bacteria provided herein include, but are not limited to, for example, two or more cytokines; one or more cytokines and an inducer of type I IFN (e.g., STING, IRF3, IRF7, MDA5, RIG-I, and constitutively active, GOF variants thereof), and/or a co-stimulatory molecule (e.g., 4-1BBL and 4-1BBL ⁇ cyt); a TGF- ⁇ decoy receptor and one or more cytokines; a TGF- ⁇ decoy receptor and an inducer of type I IFN; a TGF- ⁇ decoy receptor, one or more cytokines, and/or an inducer of type I IFN, and/or a co-stimulatory molecule; an antibody (e.g., against an immune checkpoint, such as CTLA-4) and one or more cytokines; an antibody and an inducer of type I IFN
  • the multiple therapeutic product expression cassettes can include single promoter constructs and/or dual/multiple promoter constructs, as well as post-transcriptional regulatory elements, and other regulatory elements, such as enhancers, polyadenylation signals, terminators, signal peptides, etc.
  • the nucleic acid sequences can be codon optimized to increase protein expression, and generally, are under control of a eukaryotic promoter. Particular constructs and details thereof are described elsewhere herein.
  • immunostimulatory bacteria include those that contain plasmids encoding immunostimulatory proteins (e.g., cytokines, chemokines, co- stimulatory molecules), and/or gene products with gain-of-function mutations that increase immune responses in the tumor microenvironment (e.g., cytosolic DNA/RNA sensors that induce type I IFN), and/or antibodies and fragments thereof, and/or other therapeutic products that enhance the anti-tumor response, such as TGF- ⁇ and/or IL-6 decoy receptors, and/or TGF- ⁇ antagonizing polypeptides.
  • immunostimulatory proteins e.g., cytokines, chemokines, co- stimulatory molecules
  • gene products with gain-of-function mutations that increase immune responses in the tumor microenvironment
  • cytosolic DNA/RNA sensors that induce type I IFN e.g., cytosolic DNA/RNA sensors that induce type I IFN
  • antibodies and fragments thereof e.g., antibodies and fragments thereof, and/
  • immunostimulatory bacteria that encode the cytokines, gain-of-function products/type I IFN pathway proteins, and/or chemokines, and/or co-stimulatory molecules, and/or antibodies and fragments thereof, such as single-chain antibodies, and other therapeutic products discussed herein, include the immunostimulatory bacteria that preferentially infiltrate the tumor microenvironment, tumors, and tumor-resident immune cells.
  • the immunostimulatory bacteria also include those in which the genome is modified so that they induce less cell death in tumor-resident immune cells, whereby the immunostimulatory bacteria accumulate in tumor-resident myeloid cells, to achieve high level ectopic expression of multiplexed genetic payloads in the target cells, and deliver the therapeutic products/immunomodulatory proteins to the tumor microenvironment (TME), to stimulate the immune response against the tumor.
  • TEE tumor microenvironment
  • the immunostimulatory bacteria provided herein include up to about 8 or 8 modifications as described herein, including, but not limited to, adenosine auxotrophy, csgD-, pagP-, msbB-, flagellin- (fliC-/fljB-), purI-, ansB-, asd-, and any other modifications described herein or known to improve targeting to, or accumulation in, the tumor microenvironment and/or tumor-resident myeloid cells, or to improve safety and tolerability (allowing for a higher dose), reduce the immunosuppressive cytokine profile, improve T-cell quality and function, limit replication in healthy tissues, eliminate biofilms, and improve the anti-tumor immune response, or to impart any of the desirable and advantageous properties discussed elsewhere herein.
  • adenosine auxotrophy csgD-, pagP-, msbB-, flagellin- (fliC-/fljB-), purI-, ansB-, asd-
  • the immunostimulatory bacteria further can encode other therapeutic products, such as a tumor antigen from the subject’s tumor, to enhance the response against the particular tumor.
  • a tumor antigen from the subject for example, a tumor antigen from the subject’s tumor.
  • Any of the immunostimulatory bacteria provided herein and described above and below can be modified to encode the therapeutic products, such as cytokines, chemokines, co-stimulatory molecules and gain-of-function type I IFN pathway product(s).
  • the therapeutic products are encoded on a plasmid under control of a promoter recognized by the host, and any other desired regulatory sequences recognized in a eukaryotic, such as a human, or other animal, or mammalian, subject.
  • the nucleic acid encoding the product is under the control of an RNA polymerase II promoter.
  • any of the bacteria described herein for modification such as any of the strains of Salmonella, Shigella, E. coli, Bifidobacteriae, Rickettsia, Vibrio, Listeria, Klebsiella, Bordetella, Neisseria, Aeromonas, Francisella, Cholera, Corynebacterium, Citrobacter, Chlamydia, Haemophilus, Brucella, Mycobacterium, Mycoplasma, Legionella, Rhodococcus, Pseudomonas, Helicobacter, Bacillus, and Erysipelothrix, or an attenuated strain thereof, or a modified strain thereof, can be modified by introducing a plasmid containing, or by encoding on a plasmid in the bacteria, nucleic acid encoding the therapeutic product(s) under control of an RNA polymerase promoter recognized by the host.
  • the therapeutic products are expressed in the infected subject’s cells.
  • the immunostimulatory bacteria include those that are modified, as described herein, to accumulate in, or to preferentially infect, tumors, the TME and/or tumor-resident myeloid cells.
  • immunostimulatory bacteria that encode gain-of-function products leading to the expression of, or the constitutive expression of, type I interferon (IFN), such as IFN-beta, and/or other therapeutic products as discussed herein further are modified to have reduced ability or no ability to infect epithelial cells, but are able to infect phagocytic cells, including tumor-resident immune cells, and/or the immunostimulatory bacteria are modified so that they do not kill the infected phagocytic cells.
  • IFN type I interferon
  • genes involved in the SPI-1 pathway, and flagella activate the inflammasome in phagocytic cells (immune cells), triggering pyroptosis.
  • Knocking out SPI-1 genes and genes that encode flagella decreases or eliminates pyroptosis of phagocytic cells, and also, eliminates infection of epithelial cells, resulting in increased infection of phagocytic cells.
  • immunostimulatory bacteria that accumulate in phagocytic cells, particularly tumor-resident immune cells, such as, for example, myeloid-derived suppresser cells (MDSCs), tumor-associated macrophages (TAMs), and dendritic cells (DCs), in which they express the genetic payloads/therapeutic products encoded on plasmids that are controlled by eukaryotic promoters, such as those recognized by RNA polymerase II, and include other eukaryotic regulatory signals, as discussed herein.
  • Expressed therapeutic products include those that evoke immune responses, such as through pathways that increase or induce type I interferons, which increase the host response in the tumor microenvironment.
  • the immunostimulatory bacteria also can encode immunostimulatory proteins, such as IL-2 and/or other cytokines, and/or other immunostimulatory proteins and therapeutic products, as discussed herein, further enhancing the immune response in the tumor microenvironment.
  • the immunostimulatory bacteria can encode products, referred to as cytosolic DNA/RNA sensors, that evoke immune responses when exposed to nucleic acids, such as RNA, DNA, nucleotides, dinucleotides, cyclic nucleotides, cyclic dinucleotides, and other such molecules, in the cytosol of cells.
  • the immunostimulatory bacteria herein encode modified therapeutic products that constitutively evoke immune responses, and do not require the presence of the DNA/RNA in the cytosol.
  • the therapeutic products contemplated herein include modified forms of these cytosolic DNA/RNA sensors, that have constitutive activity or increased activity (i.e., gain-of-function products), such that type I interferon(s) is/are expressed or produced in the absence of nucleotides, dinucleotides, cyclic nucleotides, cyclic dinucleotides, and other such ligands, in the cytosol of cells.
  • expression of these modified products in cells, particularly in tumor cells, including tumor-resident immune cells leads to constitutive expression of type I interferons, including interferon- ⁇ , in the tumor microenvironment.
  • the immunostimulatory bacteria that express these gain-of-function products accumulate in or preferentially infect tumor cells/the TME/tumor-resident immune cells, the therapeutic products are expressed in the tumor microenvironment, resulting in increased immune responses in the tumor microenvironment.
  • Exemplary gene products that can be encoded in the immunostimulatory bacteria and other vehicles include, but are not limited to, proteins that sense or are involved in innate pathways that recognize cytosolic DNA/RNA and activate type I interferon production.
  • Proteins involved in innate DNA/RNA recognition that activate type I interferon include, but are not limited to: STING, RIG-I, MDA5, IRF3, IRF7, TRIM56, RIP1/RIPK1, Sec5/EXOC2, TRAF2, TRAF3, TRAF6, STAT1, LGP2/DHX58, DDX3/DDX3X, DHX9/DDX9, DDX1, DDX21, DHX15/DDX15, DHX33/DDX33, DHX36/DDX36, DDX60, and SNRNP200.
  • Gain-of-function mutations in any of these proteins that result in constitutive type I interferon expression are known, or can be identified, and the mutants can be delivered by the immunostimulatory bacteria to the tumor microenvironment, such as by infection of phagocytic cells, or by targeting and binding to tumor cells.
  • the gain-of-function mutations include those identified from individuals with disorders resulting from constitutive type I interferon expression. Exemplary of gain- of-function products are those that occur in subjects with interferonopathies.
  • mutations can be identified by screening, to generate gain-of-function products as well.
  • the nucleic acids encoding the therapeutic products further can be modified to improve properties for expression.
  • Modifications include, for example, codon optimization to increase transcriptional efficiency in a mammalian, particularly human, subject, such as reduction of GC content or CpG dinucleotide content, removal of cryptic splicing sites, adding or removing (generally removing) CpG islands, replacement of the Shine-Dalgarno (SD) sequence, and replacement of TATA box and/or terminal signals to increase transcriptional efficiency.
  • Codons can be optimized for increasing translation efficiency by altering codon usage bias, decreasing GC content, decreasing mRNA secondary structure, removing premature PolyA sites, removing RNA instability motifs (ARE), reducing stable free energy of mRNA, modifying internal chi sites and ribosomal binding sites, and reducing RNA secondary structures.
  • type I interferon induction pathways mediated by host recognition of cytosolic nucleic acids, such as single-stranded and double-stranded RNA, cyclic di-nucleotides (CDNs), and other such forms of nucleic acids, induce type I IFN.
  • CDNs cyclic di-nucleotides
  • TLR Toll-Like Receptor
  • RNA helicases including retinoic acid- inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), and through IFN- ⁇ promoter stimulator 1 (IPS-1) adaptor protein-mediated phosphorylation of the IRF3 transcription factor, leading to induction of IFN- ⁇ (see, e.g., Ireton and Gale (2011) Viruses 3(6):906-919).
  • RIG-I retinoic acid- inducible gene I
  • MDA5 melanoma differentiation-associated gene 5
  • IPS-1 IFN- ⁇ promoter stimulator 1
  • modified STING proteins with mutations that result in constitutive expression of the type I interferons so that the interferons are expressed in the absence of induction including modified non- human STING proteins and human STING proteins, and also, chimeric STING proteins, such as those in which the a C-terminal tail (CTT) portion is replaced with a CTT portion from a STING protein from a second species, wherein the STING protein of the second species has lower NF- ⁇ B signaling activity than the NF- ⁇ B signaling activity of human STING, and the TRAF6 binding site in the CTT optionally is deleted, and chimeric STING proteins that further include one or more gain-of-function mutations.
  • CTT C-terminal tail
  • the immunostimulatory bacteria provided herein can include nucleic acids that encode molecules, such as enzymes, that activate, such as by cleavage of a portion of, therapeutic products, such as prodrugs, including chemotherapeutic prodrugs, particularly toxins, that are activated by enzymatic cleavage.
  • the inactive prodrug can be administered systemically, and is inactive.
  • the plasmid-encoded activating molecule such as an enzyme, is expressed in the tumor microenvironment after delivery of the immunostimulatory bacteria provided herein, so that the inactive prodrug is activated in the tumor microenvironment, where it exerts its anti-tumor effect.
  • prodrugs including certain nucleosides, and toxin conjugates.
  • Many such prodrugs and enzymes are known (see, e.g., Malekshah et al., (2016) Curr. Pharmacol. Rep.2(6):299-308).
  • the immunostimulatory bacteria herein can be used to provide more than one therapeutic product, particularly those that are for anti-cancer therapy.
  • the products are complementary products to enhance and re-program the anti-tumor immune response.
  • the immunostimulatory bacteria by virtue of the genomic modifications described herein, particularly the combination of several or of all of asd-, flagellin- (such as f ), pagP-, csgD-, purI-, adenosine auxotrophy, msbB-, ansB-, and any other modifications described elsewhere herein or known to those of skill in the art, accumulate in the tumor microenvironment (TME) and infect tumor- resident immune cells (myeloid cells).
  • TEE tumor microenvironment
  • myeloid cells myeloid cells
  • the immunostimulatory bacteria contain plasmids, encoding complementary therapeutic products, under control of a promoter or promoters recognized by the host, and any other desired regulatory sequences recognized in a eukaryotic, such as a human, or other animal, or mammalian, subject, to effect expression of the encoded products, and, also, secretion of the products.
  • the immunostimulatory bacteria accumulate in the TME, particularly in tumor-resident immune cells, including myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), and dendritic cells (DCs), where the encoded therapeutic products are expressed and then secreted into the tumor microenvironment to achieve an anti-tumor effect.
  • MDSCs myeloid-derived suppressor cells
  • TAMs tumor-associated macrophages
  • DCs dendritic cells
  • the anti-tumor effect can be enhanced by virtue of interactions of the various products with the host immune system.
  • the immunostimulatory bacteria containing plasmids encoding therapeutic products, with a single promoter and open reading frame (ORF)
  • ORF open reading frame
  • the immunostimulatory bacteria can express two (or more) proteins through the use of viral internal ribosomal entry sites (IRES), which are cap-independent, or through translational read-through of 2A peptides (e.g., T2A, P2A, E2A, or F2A), and subsequent self- cleavage into equally expressed co-proteins.
  • IRS viral internal ribosomal entry sites
  • the genetic payloads/ therapeutic products can be expressed using dual or multiple promoter constructs, where each protein is expressed under the control of a separate promoter.
  • the nucleic acids encoding the therapeutic products are under the control of RNA polymerase II promoters.
  • promoters include, but are not limited to EF-1 ⁇ , CMV, SV40, UBC, CBA, PGK, GUSB, GAPDH, EIF41A, CAG, CD68, and synthetic MND promoters.
  • the plasmids can contain other regulatory elements, such as post-transcriptional regulatory elements (PREs; e.g., WPRE, HPRE), polyadenylation signal sequences, terminators, enhancers, secretion signals (also known as signal peptides/sequences, leader peptides/sequences), DNA nuclear targeting sequences (DTS), and other regulatory elements, described elsewhere herein or known to those of skill in the art that can enhance or increase the expression and/or secretion of the encoded therapeutic products.
  • PREs post-transcriptional regulatory elements
  • the genetic payloads, or therapeutic products, encoded on the plasmids include immunostimulatory proteins, such as cytokines, chemokines, and co- stimulatory molecules; cytosolic DNA/RNA sensors that induce type I IFN and gain- of-function/constitutively active mutants/variants thereof; antibodies and fragments thereof; bi-specific T-cell engagers (BiTEs®); soluble TGF- ⁇ receptors that act as decoys for binding TGF- ⁇ , or TGF- ⁇ antagonizing polypeptides; IL-6 binding decoy receptors; interfering RNAs (e.g., siRNA, shRNA, miRNA); and other therapeutic products as discussed below and elsewhere herein, and as known in the art; and complementary combinations of all of the preceding therapeutic products.
  • immunostimulatory proteins such as cytokines, chemokines, and co- stimulatory molecules
  • cytosolic DNA/RNA sensors that induce type I IFN and gain- of-function/constitutively
  • the cytokines can be encoded on the plasmid within the immunostimulatory bacteria, with a membrane anchoring motif, such as a transmembrane domain, and a collagen-binding domain.
  • the immunostimulatory proteins, including cytokines, chemokines, and co- stimulatory molecules, that can be encoded on the plasmids include, but are not limited to, IL-2, IL-7, IL-12p70 (IL-12p40 + IL-12p35), IL-15, IL-15/IL-15R ⁇ chain complex, IL-18, IL-21, IL-23, IL-36 gamma, interferon- ⁇ , interferon- ⁇ , IL-2 that has attenuated binding to IL-2Ra, IL-2 that is modified so that it does not bind to IL-2Ra, CXCL9, CXCL10, CXCL11, CCL3, CCL4, CCL5, proteins that are involved in or that effect or potentiate the recruitment and/or persistence
  • the immunostimulatory proteins also include truncated co- stimulatory molecules, such as, for example, 4-1BBL, CD80, CD86, CD27L, B7RP1 and OX40L, with a cytoplasmic domain deletion, for expression on an antigen- presenting cell (APC), where the truncated gene product is capable of constitutive immunostimulatory signaling to a T-cell through co-stimulatory receptor engagement, and is unable to counter-regulatory signal to the APC due to a deleted cytoplasmic domain.
  • APC antigen- presenting cell
  • the cytosolic DNA/RNA sensors, that induce or activate type I IFN production include, but are not limited to, STING, RIG-I, MDA5, IRF3, IRF5, and IRF7, and gain-of-function (GOF) or constitutively active variants thereof.
  • Other proteins involved in the recognition of DNA/RNA that activate type I IFN responses, that can be mutated to generate constitutive type I IFN expression and can be encoded on the plasmids include, but are not limited to, TRIM56, RIP1, Sec5, TRAF2, TRAF3, TRAF6, STAT1, LGP2, DDX3, DHX9, DDX1, DDX21, DHX15, DHX33, DHX36, DDX60, and SNRNP200.
  • therapeutic products that can be encoded on the plasmids delivered by the immunostimulatory bacteria herein, or that can be co-administered with the bacteria, that enhance or increase the anti-tumor response, include, but are not limited to, antibodies and fragments thereof, for example, TGF- ⁇ inhibitory antibodies; anti- IL-6 antibodies; antibodies against checkpoint inhibitors, such as PD-1, PD-L1, and CTLA-4; and antibodies against, or inhibitors of, VEGF, CD73, CD38, Siglec-15, EGFR, Her2, Mesothelin, and BCMA.
  • TGF- ⁇ inhibitory antibodies include, but are not limited to, antibodies and fragments thereof, for example, TGF- ⁇ inhibitory antibodies; anti- IL-6 antibodies; antibodies against checkpoint inhibitors, such as PD-1, PD-L1, and CTLA-4; and antibodies against, or inhibitors of, VEGF, CD73, CD38, Siglec-15, EGFR, Her2, Mesothelin, and BCMA.
  • bispecific T-cell engagers BiTEs®
  • IL-6 binding decoy receptors TGF-beta binding decoy receptors
  • TGF-beta polypeptide antagonists TGF-beta polypeptide antagonists
  • Any of these antibodies, inhibitors or decoy receptors can be co-administered with the immunostimulatory bacteria herein.
  • PARP poly (ADP)-ribose polymerase) inhibitors, histone deacetylase (HDAC) inhibitors, and/or chemotherapy, also can be co-administered with any of the therapeutic products listed above, alone, or in any combination.
  • Exemplary of complementary combinations of therapeutic products that can be encoded on the plasmids in the immunostimulatory bacteria herein include, but are not limited to: IL-2 and IL-12p70; IL-2 and IL-21; IL-2, IL-12p70, and a STING GOF variant; IL-2, IL-21, and a STING GOF variant; IL-2, IL-12p70, a STING GOF variant, and 4-1BBL (including 4-1BBL ⁇ cyt); and IL-2, IL-21, a STING GOF variant, and 4-1BBL (including 4-1BBL ⁇ cyt); IL-15/IL-15R ⁇ and a STING GOF variant; IL-15/IL-15R ⁇ , a STING GOF variant, and 4-1BBL (including 4-1BBL ⁇ cyt); IL-15/IL-15R ⁇ and IL-12p70; IL- 15/IL-15R ⁇ , and IL-21; IL-15/IL-15R ⁇ ,
  • TGF- ⁇ decoy receptor can be replaced with a TGF- ⁇ antagonizing polypeptide.
  • TGF- ⁇ decoy receptors are any that act as decoys for binding TGF- ⁇ to remove it, or are TGF- ⁇ antagonizing polypeptides (e.g., anti-TGF-beta antibodies or antibody fragments, and anti-TGF-beta receptor antibodies or antibody fragments).
  • the STING protein or other DNA/RNA sensor that induces or activates type I IFN production can be a GOF/constitutively active variant, or can be the wild-type protein, including the modified STING polypeptides and chimeric STING polypeptides described and provided herein.
  • any of the complementary combinations above also can be administered in combination with any one or more of: an anti-PD-1 antibody, an anti-CTLA-4 antibody, an anti-PD-L1 antibody, an anti-IL-6 antibody, an anti-Siglec-15 antibody, an anti-VEGF antibody, an anti-CD73 antibody, an anti-CD38 antibody, an anti-EGFR antibody, an anti-Her2 antibody, an anti-Mesothelin antibody, an anti- BCMA antibody, and antibody fragments thereof, as well as PARP inhibitors, HDAC inhibitors, or chemotherapy, and combinations thereof.
  • Plasmids and immunostimulatory bacteria provided herein encode combinations of therapeutic payloads. These include combinations of nucleic acid encoding any or all of the products listed in the table above.
  • Combinations of complementary payloads were assessed, and exemplary combinations and their effects are described in the Examples.
  • combinations of the payloads can induce strong secretion of CXCL10 by bone marrow dendritic cells (BMDCs).
  • BMDCs bone marrow dendritic cells
  • cytokine combinations can activate T-cells.
  • cytokines IL-15/IL-15R alpha chain complex, IL12, IL-12p70, IL-15, IL-21, and IL-36 ⁇
  • 4-1BB engagement activate T-cells to secrete high levels of IFN- ⁇ , with and without TCR stimulation by an anti- CD3 ⁇ agonistic antibody, for CD4 + and CD8 + T-cells.
  • STING variants described herein as well as IL-12 can increase antigen specific activation of human CD8 + T- cells.
  • Combinations of payloads can include a co-stimulatory molecule, such as an OX40L polypeptide, or a 4-1BBL polypeptide, or one of the cytoplasmic deleted or truncated variants thereof, and/or the modified forms thereof described and exemplified herein; or an anti-immune checkpoint antibody or fragment thereof, such as an anti-CTLA-4 scFv-Fc or an anti-CTLA-4 scFv (see, Example 25 and SEQ ID NOs:428 and 429, respectively); one or more cytokines/chemokines, such as IL-12, IL-15, IL-18, IL-21, IL-23, IL-36 ⁇ , IFN- ⁇ , IFN- ⁇ 2, and CXCL10; TGF- ⁇ binding decoy receptors and other TGF-beta polypeptide antagonists, such as, for example, a human soluble TGF ⁇ receptor II fused with a human IgG1 Fc (hu sTGF
  • Payloads/products/polypeptides can be encoded as a polycistronic construct, under the control of a single promoter (i.e., a single promoter system) and, as required, other regulatory sequences, and also can include 2A polypeptides or other such polypeptides that result in the translation of individual products.
  • the payloads also can be expressed on plasmids containing two separate open reading frames (ORFs), each under the control of a different promoter (i.e., a dual promoter system).
  • ORFs open reading frames
  • Exemplary combinations of payloads, in the order they are encoded on a plasmid, and including the 2A peptide that is encoded in the polycistronic construct are set forth in the following table. The table includes the 2A peptide, but other such peptides can be substitute and/or products can be separately encoded.
  • *4-1BBL the modified 4-1BBL with the cytoplasmic truncation and residue modifications to render the remaining cytoplasmic domain more positive to retain correct orientation with respect to the cell membrane.
  • **Chimeric STING STING with the Werner CTT and the replacements R284G/N154S.
  • 5 sTGF ⁇ RIIFc # type II receptor betaglycan.
  • Other such combinations of interest include any of the modified STING proteins and a cytokine, such as a chimeric STING, such as the human chimera with the Kenyan Devil CTT, and particularly with one or more gain-of-function mutations, such as N154S/R284G.
  • the complementary combinations can provide synergistic results.
  • the combination of the chimeric STING polypeptide and IL-15/IL-15R alpha chain complex (IL-15R ⁇ -IL-15sc), shown in the Examples acts synergistically to improve anti-tumor effectiveness.
  • the properties of the immunostimulatory bacteria provided herein, such as the accumulation in tumor-resident myeloid cells, and in the TME, and the combinations of products/payloads that can be expressed, can be selected to cover the cancer immunity cycle.
  • a skilled person can identify other product payload combinations and other orders of the products as encoded on a polycistronic construct, that have immune-activating and/or immune suppressing effects, to enhance the anti-tumor activities of the immunostimulatory bacteria provided herein.
  • E. IMMUNOSTIMULATORY BACTERIA AS ANTIVIRAL THERAPEUTICS AND AS THERAPEUTICS AGAINST OTHER INFECTIOUS PATHOGENS Immunosuppression of a host immune response plays a role in many infectious diseases, and particularly, in persistent viral infection, as well as in tumor immunosuppression. In persistent infections, the virus remains in specific cells of infected individuals.
  • latent infections there is no detectable infectious virus between episodes of recurrent disease; in chronic infections, there is continued presence of infectious virus following a primary infection, and there is chronic or recurrent disease.
  • Slow infection is characterized by a prolonged incubation period, followed by progressive disease.
  • the viral genome can be stably integrated into the cellular DNA, or can be maintained episomally.
  • Persistent infection occurs with numerous viruses and infectious agents, including, but not limited to, human T-cell leukemia viruses, Epstein-Barr virus, cytomegalovirus, herpesviruses, varicella zoster virus, measles virus, papovaviruses, prions, hepatitis viruses (including types A, B, C, D, and E), adenoviruses, parvoviruses, coronaviruses, human immunodeficiency virus (HIV), smallpox viruses, poliovirus, influenza viruses, rotaviruses, yellow fever virus, mumps virus, rubella virus, and papillomaviruses.
  • viruses and infectious agents including, but not limited to, human T-cell leukemia viruses, Epstein-Barr virus, cytomegalovirus, herpesviruses, varicella zoster virus, measles virus, papovaviruses, prions, hepatitis viruses (including types A, B, C
  • Bacteria have been used as delivery vehicles for vaccines and other anti- pathogen therapeutics, and have been used as vaccines for eliciting an immune response against a peptide that is foreign to the bacterial vector.
  • an S. typhi TY21a strain containing a VEGFR2-encoding plasmid, induces VEGFR2- specific T-cell responses in humans (see, e.g., Schmitz-Winnenthal et al. (2016) Journal of Clinical Oncology 34(15_suppl):3091-3091, DOI: 10.1200/JCO.2016.34.15_suppl.3091).
  • the prior approaches using bacteria as vaccine vehicles have had limited clinical success.
  • antiviral vaccines are for use against other bacterial diseases, and have not effectively induced anti-tumor or antiviral immunity in humans.
  • the immunostimulatory bacteria address these problems.
  • One way in which antiviral vaccines work is by delivering antigens that induce antibodies that are specific for the surface glycoproteins of enveloped viruses, or that are specific for the capsid proteins of non-enveloped viruses.
  • Antibodies are the primary element of adaptive immunity, which is designed to pre-exist at protective levels, and to be present or induced during re-exposure to a viral pathogen. Pre- existing antibodies act with the speed of innate immunity, but with more specificity, higher avidity, and targeted functionality.
  • An immunological goal for immunization is the induction of durable protective antibody responses.
  • Protective antibody responses generally work best when they are neutralizing and inhibit infection.
  • Neutralization can occur by three major mechanisms. A first mechanism, aggregation or immobilization of the virus, reduces the infectious inoculum by preventing the virus from reaching the target cell.
  • a second mechanism involves an antibody directly blocking the attachment of the virus to a target cell, by blocking the receptor-binding domain.
  • the third mechanism, neutralization can occur post-attachment of the virus to a target cell, by preventing entry of the virus into the cell, or by uncoating through fusion inhibition.
  • Neutralizing antibodies need to recognize oligomeric surface proteins in their native state, or in intermediate forms that may be transiently present before completion of the fusion process.
  • epitopes are generally conformational, and are often quaternary epitopes, and are not often present on monomeric forms of viral proteins.
  • antibodies are recognized as the primary mechanism of vaccine- induced protective immunity, virus-specific CD8 + T-cell responses also are important for controlling virus infection, and for limiting the severity of disease (see, e.g., Graham (2013) Immunol. Rev.255(1):230-242).
  • Antibody-mediated effector mechanisms are for preventing infection; CD8 + T-cell-mediated effector mechanisms are for recognizing and clearing virus-infected cells. Since the immunostimulatory bacteria provided herein infect myeloid cells, the immunostimulatory bacteria can enhance antigen presentation to T-cells, inducing T-cell mediated responses.
  • Antigen-specific cytotoxic T-lymphocytes are a sub-group of CD8 + T-cells that are activated by interaction with antigens that are presented on the cell surface in a complex with major histocompatibility complex class I (MHC I), which is the presentation pathway for cytosolic proteins of mammalian cells.
  • MHC I major histocompatibility complex class I
  • Antigens are synthesized by bacterial pathogens, or bacterial vaccines release antigens into the cytoplasm, eliciting the cellular immune response by CTLs. Following this activation, CTLs are directed against infected cells that display the relevant antigenic peptides in complex with MHC I.
  • Antigens also can be directly presented by MHC class II molecules on APCs (antigen-presenting cells) to CD4 + helper cells, which can promote B-cell production of antibodies.
  • a limitation of prior bacterial vaccine and anti-pathogen strategies is that they rely on bacterial sensing pathways as adjuvants, which, as described herein, do not lead to strong adaptive antiviral or anti-tumor immunity.
  • the immunostimulatory bacteria provided herein address these limitations.
  • the immunostimulatory bacteria provided herein provide for the priming of heterologous proteins, including viral antigens, and other antiviral therapeutics, in the context of strong viral-sensing immune pathways, leading to effective antiviral vaccination, and also, to anti-tumor treatments.
  • the immunostimulatory bacteria lack many of the bacterial TLR sensing pathways, and eliminate the skewing of immunity towards innate antibacterial responses, while retaining antiviral pathways.
  • innate immune signaling pathways including toll-like receptors (TLRs), retinoic acid inducible gene-I (RIG-I)-like receptors (RLRs), and cytoplasmic DNA sensors, are activated for the synthesis of antiviral molecules, such as type I interferons (IFNs) and pro-inflammatory cytokines.
  • IFNs type I interferons
  • the immunostimulatory bacteria provided herein are designed to stimulate such pathways by virtue of the genomic modifications, and also, the encoded therapeutic cargo(es), such as the STING proteins and modified STING proteins, cytokines, and chemokines.
  • the immunostimulatory bacteria provided herein advantageously, by virtue of genomic modifications, and, optional encoded therapeutic products, can direct the host immune response to be antiviral in nature.
  • the immunostimulatory bacteria provided herein, as discussed, infect myeloid cells to deliver encoded anti-pathogen therapeutic products, such as antigens, antibodies, and other encoded therapeutics, and can encode additional products, such as immunostimulatory proteins, to enhance a host’s immune response.
  • the immunostimulatory bacteria can provide a variety of attacks on pathogens.
  • the immunostimulatory bacteria provided herein in subjects who have a tumor, accumulate in tumor-resident immune cells. In subjects who do not have a tumor, the bacteria primarily, or only, infect phagocytic antigen-presenting cells (APCs), which are cells that are very capable of transferring plasmids that can be read by the eukaryotic machinery, and produce proteins in their natural context.
  • APCs phagocytic antigen-presenting cells
  • the plasmids encode single or multiple heterologous proteins, including, for example, viral antigens and other antiviral therapeutics, and also, can encode single or multiplexed immune payloads that induce antiviral immune-sensing pathways.
  • immunostimulatory bacteria that deliver protein antigens and antibodies, and other therapeutics for vaccination against pathogens, or for the treatment of resulting infections, including persistent viral infections.
  • the pathogens include bacteria, protozoans, viruses, and prions, and other prion-like particles that cause diseases and disorders.
  • immunostimulatory bacteria and exemplary of such bacteria, are strains/species of Salmonella, such as S. typhimurium.
  • the immunostimulatory bacteria can encode the anti-pathogen products under control of a bacterial or a eukaryotic promoter.
  • the promoter can be constitutive or can be inducible. Selection of the promoter, and other regulatory sequences, depends upon factors that include the particular product, the timing of expression of the product, and the use of the bacteria, such as whether they are for the treatment of an existing infection, or are for vaccination.
  • the bacteria which generally are asd-, can encode asd on the plasmid to permit replication upon infection of the host cells with the bacteria, without any need for an antibiotic selection cassette. This permits the bacteria to replicate in vivo.
  • a suicide system can be used to deliver payloads, (i.e., therapeutic products) to tissue-resident myeloid cells.
  • the bacteria are dosed in vivo using an asd- strain that lacks a plasmid containing a complementing asd gene cassette.
  • DAP diaminopimelic acid
  • One bolus of the bacterial nucleic acid is delivered to tissue-resident myeloid cells after phagocytosis and intracellular destruction of the bacteria.
  • APCs can migrate into lymph nodes, the spleen, and liver, providing presentation of expressed antigens to lymph node resident T-cells.
  • the bacteria can be taken up by dendritic cells, which then express the antigens for the presentation pathway by MHC I and MHC II, and in turn, initiate specific T-cell responses.
  • the immunostimulatory bacteria provided herein can exploit these pathways when used as vaccines, or to encode viral antigens and/or other proteins to protect against pathogens, such as influenza viruses, Ebola virus, Severe Acute Respiratory Syndrome coronavirus (SARS-CoV), Middle East Respiratory Syndrome coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2, which causes COVID-19), Porphyromonas gingivalis (P. gingivalis), and others as set forth herein and/or as known to those of skill in the art.
  • SARS-CoV Severe Acute Respiratory Syndrome coronavirus
  • MERS-CoV Middle East Respiratory Syndrome coronavirus
  • SARS-CoV-2 Severe Acute Respiratory Syndrome coronavirus 2
  • P. gingivalis Porphyromonas gingivalis
  • others as set forth herein and/or as known to those of skill in the art.
  • Targets include proteins, such as the spike protein of the coronaviruses (see, e.g., SEQ ID NO:438), and ginigpain protease of Porphyromonas gingivalis (see, e.g., SEQ ID NOs: 442-447), particularly the lysine-gingipain protease (Kgp or Lys-gingipain) from P.
  • proteins such as the spike protein of the coronaviruses (see, e.g., SEQ ID NO:438), and ginigpain protease of Porphyromonas gingivalis (see, e.g., SEQ ID NOs: 442-447), particularly the lysine-gingipain protease (Kgp or Lys-gingipain) from P.
  • gingivalis strain ATCC 332277 see, e.g., SEQ ID NO:444
  • lysine- gingipain proteases from other strains of Porphyromonas gingivalis including strains 83, FDC381, and HG66 (see, e.g., SEQ ID NOs: 445-447, respectively).
  • Bacterial pathogens include, for example, species of Escherichia, Klebsiella, Staphylococcus, Acinetobacter, and Pseudomonas, particularly drug-resistant species and strains. Those of skill in the art readily can identify antigens to target.
  • tumor antigens see, e.g., the Examples for exemplary tumor antigens
  • proteases, reverse transcriptases (for RNA viruses), and DNA polymerases, and other replicative enzymes can be targets.
  • Exemplary species of pathogenic bacteria include, but are not limited to: E. coli, S. aureus, P. aeruginosa, K. pneumoniae, E. faecalis, and S. pneumoniae.
  • Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a novel beta-coronavirus that is the causative agent of the coronavirus disease 2019 (COVID- 19) pandemic.
  • Coronavirus virions contain a self surface spike (S) glycoprotein that binds to host cell angiotensin-converting enzyme 2 (ACE2) receptors, and mediates entry via fusion of the host and viral membranes.
  • S self surface spike
  • ACE2 host cell angiotensin-converting enzyme 2
  • the binding of the SARS-CoV-2 spike protein to the ACE2 receptor causes a larger conformational rearrangement of spike protein, from a metastable pre-fusion conformation, to a highly stable post- fusion conformation, which facilitates membrane fusion.
  • the spike (S) protein is essential for the viral life cycle, and is a primary target for neutralizing antibodies, and is a critical vaccine antigen (see, e.g., Hsieh et al. (2020) Science 369:1501-1505).
  • SARS-COV2 virus proteins that draw the best or good CD8 + , include the following (see, Cohen et al. (2021) Cell. Rep. Med.2:100354): The receptor-binding domain (RBD; see, e.g., SEQ ID NO:440) in the S1 subunit of the spike protein interacts directly with ACE2.
  • RBD receptor-binding domain
  • the metastable pre-fusion conformation of the S protein may be referred to as “laying or down,” while the conformational rearrangement into an ACE2-feasible conformation may be referred to as “up or standing.”
  • the “down” and “up” poses are differentiated based on the conformational rearrangement of the RBD; the down-to-up rearrangement facilitates receptor binding, while the rearrangement of up-to-down helps the virus to evade immune surveillance (see, e.g., Shah et al. (2020) Computational and Structural Biotechnology Journal 18:3401-3414). Binding to the ACE2 receptor is followed by cleavage with transmembrane protease serine 2 (TMPRSS2).
  • TMPRSS2 transmembrane protease serine 2
  • ACE2 and TMPRSS2 are abundantly expressed in the airways, lungs, and nasal/oral mucosa, as well as in the intestines.
  • Naturally occurring mutations in the S protein have been identified in China (H49Y), Europe (V367F and D614G), and the United States (G476S and V483A), and have been studied for their effects on cell entry of SARS-CoV-2; in cells expressing ACE2 and TMPRSS2, the G476S mutation results in reduced cell entry, and the V483A mutation has no effect on cell entry, whereas the D614G, V367F, and H49Y mutations result in enhanced cell entry compared to that of the wild-type S protein.
  • the D614G mutation displays a 3.5-fold higher level of entry activity compared to the wild-type S protein, an effect that is also seen in human small airway epithelial cells.
  • the D614G mutation also results in increased binding affinity for the ACE2 receptor.
  • the D614G mutant retains the neutralization sensitivity of the SARS-CoV-2 virus; anti- SARS-CoV-2 patient sera was able to effectively neutralize both wild-type SARS- CoV-2 and SARS-CoV-2 with the D614G mutation (see, e.g., Ozono et al. (2021) Nature Communications 12:848).
  • the S protein exists as a trimer, and structural analyses indicate that the D614G mutation stabilizes, and thus, prevents premature dissociation of the S trimer (see, e.g., Zhang et al. (2021) Science 372:525-530).
  • the V367F mutant also displays higher binding affinity to ACE2 compared to the reference strain Wuhan-Hu-1, as first isolated in Wuhan in December 2019, which may be due to stabilization of the RBD structure.
  • Virus isolates also have been identified with both the V367F and D614G mutations.
  • Phylogenetic analyses suggest that the V367F mutation evolved along with the D614G mutation, suggesting a synergistic effect of increased infectivity (see, e.g., Ou et al.
  • N501Y mutation has naturally emerged in SARS-CoV-2 lineages in the UK (B.1.1.7, or 20B/501Y.v1) and South Africa (B.1.351, or 20C/501Y.v2), and occurs at the human ACE2 binding site on the RBD of the SARS-CoV-2 S protein.
  • Molecular dynamic stimulations reveal that N501 in the SARS-CoV-2 S protein RBD is in the proximity of hydrophobic residues of human ACE2; thus, the mutation of hydrophilic N501 into a hydrophobic residue can improve interactions between the S protein and human ACE2.
  • HexaPro proline substitutions F817P, A892P, A899P, A942P, K986P, and V987P, designated “HexaPro,” displayed increased expression levels and stability compared to its parental construct.
  • the high yield and increased stability of the HexaPro mutant should allow for the industrial production of subunit vaccines; it can also improve DNA- or mRNA-based vaccines by producing more antigen per nucleic acid molecule, improving the efficacy and/or reducing the dosage required (see, e.g., Hsieh et al. (2020) Science 369:1501-1505).
  • SARS-CoV-2 spike protein that can enhance or improve its expression and/or its binding to the ACE2 receptor, include, for example, V417K (see, e.g., Shah et al. (2020) Computational and Structural Biotechnology Journal 18:3402-3414); G502D, N501T, and Q498Y, as well as mutations in the residues N439/R426, L452/R426, T470/N457, E484/P470, Q498/Y484 and N501/T487 (see, e.g., Vervicvker et al.
  • the immunostimulatory bacteria provided herein when used as vaccines, or to encode viral antigens and/or other proteins to protect against pathogens, such as Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2, which causes COVID-19), can encode the full length wild-type SARS-CoV-2 spike protein (see, e.g., SEQ ID NO:438), or can encode the full length receptor binding domain (RBD) of the SARS-CoV-2 spike protein (see, SEQ ID NO:440), or can encode a portion of the spike protein RBD that is sufficient to induce or cause an immune response, and/or to immunize or vaccinate or protect a subject against SARS-CoV-2.
  • SARS-CoV-2 Severe Acute Respiratory Syndrome coronavirus 2
  • the immunostimulatory bacteria also can encode mutants of the SARS-CoV-2 spike protein, with mutations in the spike protein or a portion thereof, such as the RBD or a portion thereof, that increase or enhance the expression of the spike protein or RBD or portions thereof, and/or that increase or enhance the binding of the spike protein or RBD, or the portions thereof to the ACE2 receptor.
  • spike protein or spike protein RBD mutants include any described herein and known in the art, including, but not limited to, those comprising the mutations V367F, D614G, G476S, V483A, H49Y, N501Y, N501F, N501W, N501V, F817P, A892P, A899P, A942P, K986P, V987P, V417K, G502D, N501T, Q498Y, W436R and D364Y, and those comprising mutations at residues corresponding to residues N439/R426, L452/R426, T470/N457, E484/P470, Q498/Y484 and N501/T487 of the spike protein or portion thereof.
  • the immunostimulatory bacteria can be used as vaccines against SARS-CoV-2 by encoding any of the antigenic sequences or modified forms of the spike protein or RBD, including portions thereof, described, for example, in U.S. Patent Nos. 10,973,908 and 10,702,600.
  • the immunostimulatory bacteria also can be used as vaccines, to deliver the mRNA sequences utilized in the Pfizer-BioNTech COVID-19 vaccine, or in the Moderna COVID-19 vaccine, wherein: 1) the sequence of the mRNA in the Pfizer-BioNTech COVID-19 vaccine, as released by the World Health Organization, includes a 5’-capping structure, a 5’ untranslated region (UTR), the extended signal sequence of the S glycoprotein, nucleic acid encoding the full-length spike (S) glycoprotein sequence containing the mutations K986P and V987P, and a poly(A) tail, and comprises the following sequence:
  • ⁇ 1-methyl-3'-pseudouridylyl
  • the sequence for the mRNA in the Pfizer-BioNTech COVID-19 vaccine can be used.
  • the immunostimulatory bacteria provided herein also can encode antigens to protect against and/or to treat tick-borne and other insect-borne diseases, and other infectious agents, such as prions and malarial pathogens, such as Plasmodium falciparum, as well as bacterial and viral pathogens.
  • the immunostimulatory bacteria also can be used as vaccines against bacterial and protozoan pathogens, including Plasmodium, C. difficile, and Listeria. Salmonella and other bacteria have been used for vaccines; any such known vaccine can be improved by encoding the antigen(s) in the immunostimulatory bacteria provided herein.
  • the immunostimulatory bacteria provided herein can induce immunity or an immune response to pathogens, particularly viral pathogens, resulting in effective antibody and T-cell responses.
  • the immunostimulatory bacteria such as the Salmonella bacteria, include genomic modifications so that they primarily or solely infect myeloid cells, and deliver plasmids that encode therapeutic products, such as antigens and antibodies, as well as additional immune-stimulating products that stimulate or induce an antiviral immune response.
  • the immunostimulatory bacteria infect these antigen-presenting cells, where the encoded therapeutic product(s) are expressed.
  • the immunostimulatory bacteria can encode antigens, which result in the immune system of the host producing antibodies, including antibodies that recognize a virus or bacterium or other pathogen before it has infected a cell.
  • the immunostimulatory bacteria for use as antivirals not only can encode antigens, but they can encode antibodies and immunostimulatory proteins to enhance a host’s antiviral response.
  • the immunostimulatory bacteria for use as vaccines, the immunostimulatory bacteria, by encoding antigens and other heterologous proteins, result in immunity or result in reduced severity of disease, or prevent the recurrence of persistent viral infections.
  • Encoded antibodies include single-chain forms thereof, such as single-chain variable fragments (scFvs), nanobodies, and other such structures.
  • the immunostimulatory properties of the bacteria including those derived from encoding immunostimulatory proteins (described herein), such as STING, that enhance or promote an antiviral immune response, and also, the genomic modifications of the bacteria, such as the modifications that eliminate or reduce expression of asparaginase II, which enhance T-cell responses, result in a robust anti-pathogen therapeutic, including activation of type I IFN.
  • inactivated pathogen vaccines such as the BCG vaccine for tuberculosis
  • Asparaginase can reduce or inhibit the immune response to the vaccine; eliminating or reducing the activity of asparaginase can improve the effectiveness of a vaccine, such as the BCG vaccine.
  • the immunostimulatory bacteria herein can be modified to encode one or more therapeutic products, including immunomodulatory proteins, that promote, or induce, or enhance an anti-tumor response.
  • the therapeutic product can be encoded on a plasmid in the bacterium, under the control of a eukaryotic promoter, such as a promoter recognized by RNA polymerase II, for expression in a eukaryotic subject, particularly the subject for whom the immunostimulatory bacterium is to be administered, such as a human.
  • a eukaryotic promoter such as a promoter recognized by RNA polymerase II
  • the nucleic acid encoding the therapeutic product(s) can include, in addition to the eukaryotic promoter, other regulatory signals for expression or trafficking in the cells, such as for secretion or expression on the surface of a cell.
  • Immunostimulatory proteins are those that, in the appropriate environment, such as a tumor microenvironment (TME), can promote, or participate in, or enhance an anti-tumor response in the subject to whom the immunostimulatory bacterium is administered.
  • Immunostimulatory proteins include, but are not limited to, cytokines, chemokines, and co-stimulatory molecules.
  • cytokines such as, but not limited to, IL-2, IL-7, IL-12, IL-12p70 (IL-12p40 + IL-12p35), IL-15, IL-15/IL-15R ⁇ chain complex, IL-18, IL-21, IL-23, IL-36 ⁇ , IL-2 that has attenuated binding to IL- 2Ra, IL-2 that is modified so that it does not bind to IL-2Ra, IFN- ⁇ , and IFN- ⁇ ; chemokines, such as, but not limited to, CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11; proteins that are involved in or that effect or potentiate the recruitment and/or persistence of T-cells; and/or co-stimulatory molecules, such as, but not limited to, CD40, CD40L, OX40, OX40L, 4-1BB, 4-1BBL, 4-1BBL with a deletion in the cytoplasmic domain (4-1BBL ⁇ cy
  • immunostimulatory proteins that are used for treatment of tumors or that can promote, enhance, or otherwise increase or evoke an anti-tumor response, known to those of skill in the art, are contemplated for encoding in the immunostimulatory bacteria provided herein.
  • Other therapeutic products, encoded by the immunostimulatory bacteria herein, include cytosolic DNA/RNA sensors that induce or activate type I interferon production, including STING, MDA5, RIG-I, IRF3, and IRF7, as well as gain-of- function and constitutively active variants thereof, and the chimeric STING polypeptides as described herein.
  • the constitutively active STING variants include those with the mutations V147L, N154S, V155M, C206Y, R281Q, and/or R284G, and combinations thereof, such as N154S/R284G, and others described herein and known in the art
  • the constitutively active IRF3 variants include those with the mutations S396D, S398D, S402D, T404D, and/or S405D, and others described herein and known in the art.
  • therapeutic products encoded by the immunostimulatory bacteria herein, include antibodies and antibody fragments, including single-chain fragment variables (scFvs), Fab fragments, Fab’ fragments, F(ab’) 2 fragments, Fv fragments, disulfide-linked Fvs (dsFvs), Fd fragments, Fd’ fragments, single-chain Fabs (scFabs), diabodies, anti-idiotypic (anti-Id) antibodies, synthetic antibodies, recombinantly produced antibodies, multi-specific antibodies (e.g., bi-specific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, and intrabodies, or antigen-binding fragments of any of the above.
  • scFvs single-chain fragment variables
  • Fab fragments fragments
  • Fab’ fragments fragments
  • F(ab’) 2 fragments Fv fragments, disulfide-linked Fvs (dsFvs), Fd fragments, Fd’ fragments
  • the antibodies can be directed against immune checkpoints, such as PD- 1, PD-L1, CTLA-4, IDO 1 and 2, CTNNB1 ( ⁇ -catenin), SIRP ⁇ , VISTA, and TREX- 1, and others known in the art or described herein, or can be directed against other targets, such as TGF- ⁇ , VEGF, HER2, EGFR, STAT3, and IL-6, and other such targets whose inhibition improves the anti-tumor response.
  • the immunostimulatory bacteria also can encode RNAi, such as siRNA (shRNA and miRNA) against immune checkpoints, such as TREX1, and other targets whose inhibition, suppression, or disruption improves the anti-tumor response.
  • the immunostimulatory bacteria herein are engineered to encode one or more cytokines to stimulate the immune system, including, but not limited to, IL-2, IL-7, IL-12 (IL-12p70 (IL-12p40 + IL-12p35)), IL-15 (and the IL- 15:IL-15R alpha chain complex (IL-15/IL-R ⁇ )), IL-18, IL-21, IL-23, IL-36 gamma, IFN-alpha and IFN-beta.
  • Cytokines stimulate immune effector cells and stromal cells at the tumor site, and enhance tumor cell recognition by cytotoxic cells.
  • the immunostimulatory bacteria can be engineered to encode chemokines, such as, for example, one or more of CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11.
  • chemokines such as, for example, one or more of CCL3, CCL4, CCL5, CXCL9, CXCL10, and CXCL11.
  • Complementary combinations of any of the therapeutic products can be encoded and delivered to the tumor microenvironment, to enhance the anti-tumor efficacy of the immunostimulatory bacteria.
  • Plasmids provided herein are designed to encode a therapeutic product, such as an immunostimulatory protein, that, when expressed in a mammalian subject, confers or contributes to anti-tumor immunity in the tumor microenvironment; the immunostimulatory protein or other therapeutic product is encoded on a plasmid in the bacterium under control of a eukaryotic promoter, such as a promoter that is recognized by RNA polymerase II (RNAP II).
  • a eukaryotic promoter such as a promoter that is recognized by RNA polymerase II (RNAP II).
  • RNAP II RNA polymerase II
  • the promoter is a constitutive promoter, such as a late eukaryotic virus promoter.
  • Exemplary promoters include, but are not limited to, a cytomegalovirus (CMV) promoter, an elongation factor-1 alpha (EF-1 ⁇ ) promoter, a ubiquitin C (UBC) promoter, a simian virus 40 (SV40) early promoter, a phosphoglycerate kinase 1 (PGK) promoter, a chicken ⁇ - actin (CBA) promoter and its derivative promoters CAGG or CAG, a ⁇ -glucuronidase (GUSB) promoter, the MND promoter (a synthetic promoter that contains the U3 region of a modified MoMuLV (Moloney murine leukemia virus) LTR with myeloproliferative sarcoma virus enhancer and deleted negative control region), a eukaryotic initiation factor 4A-I (EIF4A1) promoter, a CD68 promoter, and a GAPDH promoter, among others (see, e.g., Powell e
  • the CAG promoter consists of: (C) the cytomegalovirus (CMV) early enhancer element; (A) the promoter, the first exon, and the first intron of chicken beta-actin gene; and (G) the splice acceptor of the rabbit beta-globin gene.
  • C cytomegalovirus
  • A the promoter, the first exon, and the first intron of chicken beta-actin gene
  • G the splice acceptor of the rabbit beta-globin gene.
  • MND is a synthetic promoter that contains the U3 region of a modified MoMuLV (Moloney murine leukemia virus) LTR with myeloproliferative sarcoma virus enhancer and deleted negative control region (murine leukemia virus-derived MND promoter (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted); see, e.g., Li et al. (2010) J. Neurosci. Methods 189:56-64). Two or more of these promoters can be encoded in multiple open reading frames (ORFs) on the plasmid.
  • ORFs open reading frames
  • promoters including, but not limited to, CMV, contain multiple cAMP response element binding protein (CREB) sites.
  • CREB cAMP response element binding protein
  • the plasmids can include multiple promoters, including bacterial promoters, such as for expression of asd, and eukaryotic promoters for expression of therapeutic products.
  • Various configurations of the promoters and other regulatory sequences have been assessed to improve expression of therapeutic products, and to improve bacterial growth and fitness. For example, among the configurations tested, reversing the orientation of the eukaryotic expression cassette on the plasmid, and inclusion of one or more bacterial terminators, can increase the efficiency of encoded payload expression, and can improve bacterial fitness.
  • Multiple Therapeutic Product Expression Cassettes a. Single Promoter Constructs Expression of multiple genes in the same cell from a single construct can be achieved, and is advantageous when the co-expression of several proteins is required to elicit a desired biological effect, such as an anti-tumor response.
  • Internal ribosome entry site (IRES) sequences have been used to separate two coding sequences under control of a single promoter, however, the expression level of the second protein can be reduced compared to the first protein, and the length of the IRES sequence can be prohibitive in certain cases, such as when using viruses with small packaging capacities.
  • the discovery of short ( ⁇ 18-22 amino acid long), virus-derived peptide sequences, known as 2A peptides, that mediate a ribosome-skipping event, enables the generation of multiple separate peptide products, at similar levels, from a single mRNA.
  • the 2A peptide coding sequence is included between the polypeptide- encoding transgenes (see, e.g., Daniels et al.
  • IRES elements and 2A peptides use different mechanisms for co-expression of multiple genes in one transcript.
  • the gene directly downstream of the promoter is translated by the canonical cap-dependent mechanism, and those downstream of the IRES element are translated by a cap-independent mechanism, which has a lower translation efficiency than the cap-dependent mechanism, resulting in unbalanced expression, with lower expression of the IRES-driven gene (see, e.g., Chng et al. (2015) mAbs 7(2):403-412).2A linked genes, on the other hand, are translated in one open reading frame (ORF).
  • ORF open reading frame
  • the cleavage of proteins separated by a 2A sequence occurs co-translationally, in an unconventional process, where a peptide bond often fails to form (i.e., the peptide bond is “skipped”) between the C-terminal glycine and proline in the 2A peptide. Despite this, translation proceeds, and two distinct proteins are produced in equal amounts. A short stretch, coding for approximately 20 amino acids, of the 2A peptide sequence, is sufficient to cause the bond-skipping. If the bond skipping does not occur, however, a fusion protein is generated that will not subsequently cleave (see, e.g., Daniels et al. (2014) PLoS One 9(6):e100637).
  • T2A see, e.g., SEQ ID NO:327 from Thosea asigna virus
  • P2A see, e.g., SEQ ID NO:328
  • E2A see, e.g., SEQ ID NO:329
  • F2A see, e.g., SEQ ID NO:330
  • Cleavage efficiency and enhanced protein expression can often be improved through the use of upstream viral cleavage sequences, such as, but not limited to, the peptide furin cleavage sequence, RRKR, as well as by inserting GSG and SGS peptide linkers, a V5 epitope tag (GKPUPNPLLGLDST), or a 3xFlag epitope tag immediately preceding the 2A (see, e.g., Chng et al. (2015) mAbs 7(2):403-412).
  • upstream viral cleavage sequences such as, but not limited to, the peptide furin cleavage sequence, RRKR, as well as by inserting GSG and SGS peptide linkers, a V5 epitope tag (GKPUPNPLLGLDST), or a 3xFlag epitope tag immediately preceding the 2A (see, e.g., Chng et al. (2015) mAbs 7(2):403-412).
  • the immunostimulatory bacteria herein containing plasmids encoding therapeutic products, such as immunomodulatory proteins, with a single promoter and ORF, can express two or more proteins through the use of viral internal ribosomal entry sites (IRES), which are cap-independent, or through translational read-through of 2A peptides, and subsequent self-cleavage into equally expressed co-proteins.
  • IRS viral internal ribosomal entry sites
  • the plasmids can contain other regulatory elements, as discussed below and elsewhere herein.
  • an exemplary construct is CMV-muIL-2 CO_T2A_muIFN- ⁇ 2-WPRE, where codon optimized murine IL-2 is co-expressed with murine IFN- ⁇ 2, using a CMV promoter, and a T2A peptide. Additionally, a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is included, to enhance expression.
  • WP Woodchuck Hepatitis Virus
  • WPRE Woodchuck Hepatitis Virus
  • a 2A sequence is flanked by the first two proteins, which are expressed under the control of a first promoter, e.g., CMV, and a third protein is encoded under the control of a second promoter, e.g., EF-1 ⁇ .
  • a first promoter e.g., CMV
  • a second promoter e.g., EF-1 ⁇ .
  • Exemplary of such a construct is CMV-muIL-15R ⁇ /IL-15sc_T2A_muSTING-R283G + EF-1 ⁇ -muIL-18- WPRE, where murine 15R ⁇ /IL-15sc, and murine STING with the replacement R283G or N153S/R283G (corresponding to R284G or N154S/R284G, respectively, in human STING) are co-expressed under control of a CMV promoter, using T2A, and murine IL-18 is expressed separately under control of an EF-1 ⁇ promoter.
  • This exemplary construct also includes a WPRE for enhanced expression.
  • the immunostimulatory bacteria can be used as vaccines in which the encoded antigen(s) is/are expressed under control of a bacterial promoter for transcription in the bacterium, but include regulatory sequences, such as an IRES, that prevents translation in the bacterium, but facilitates or permits translation in the eukaryotic host, such as a human.
  • Nucleic acid constructs encoding such antigens can optionally encode additional immune system/response enhancing proteins, such as a STING protein, and/or a cytokine, and/or other combinations, which in effect, act as adjuvants. b.
  • the genetic payloads/therapeutic products can be expressed using dual or multiple promoter constructs, where each protein is expressed under the control of a separate promoter.
  • plasmids encoding therapeutic products, such as immunomodulatory proteins, expressed in combinations can contain multiple promoters, each controlling an individual intact ORF with proper stop codon processing (i.e., dual/multiple promoter constructs); or multiple proteins can be expressed in a single ORF through the use of 2A peptides (i.e., single promoter constructs); or the plasmid can contain a mixture of single and dual/multiple promoter constructs, to express three or more proteins, as described above. 3. Regulatory Elements a.
  • regulatory elements may be employed that enhance the transcription and translation of the protein(s) of interest.
  • the post-transcriptional regulatory element (PRE) of woodchuck hepatitis virus (WPRE) when inserted in the 3’ untranslated region of the ORF, can enhance expression levels several fold (see, e.g., Zufferey et al. (1999) J. Virol. 73(4):2886-2892).
  • other such elements including, but not limited to, the Hepatitis B Virus PRE (HPRE), also can enhance expression.
  • the combination of these can be used at the 3’ ends of multiple ORFs to improve expression of multiple proteins on a single plasmid.
  • the PREs WPRE and HPRE are hepadnaviral cis-acting RNA elements that can increase the accumulation of cytoplasmic mRNA by promoting mRNA exportation from the nucleus, and can enhance post-transcriptional processing and stability.
  • b. Polyadenylation Signal Sequences and Terminators Other elements on the plasmid that can enhance protein expression include polyadenylation signal sequences and terminators. Polyadenylation is the post- transcriptional addition of a poly(A) tail to the 3’ end of an mRNA transcript, which is part of the process that produces mature mRNA for translation.
  • a terminator is a sequence that defines the end of a transcript, creating a free 3’ end, and initiates the release of the newly synthesized mRNA from the transcriptional machinery. The free 3’ end is then available for the addition of the poly(A) tail. Terminators are found downstream of the gene to be transcribed, and typically occur directly after any 3’ regulatory elements, such as the polyadenylation or poly(A) signal.
  • simian virus 40 SV40
  • human growth hormone hGH
  • bovine growth hormone BGH or bGH
  • rabbit beta-globin rbGlob
  • sequences such as the simian virus 40 poly A (SV40pA) or the bovine growth hormone poly A (bGHpA) signals, result in several-fold increased expression both in vitro and in vivo (see, e.g., Powell et al. (2015) Discov. Med.19(102):49–57).
  • Enhancers and enhancers are found upstream of the multiple cloning site (MCS) in a plasmid, and cooperate to determine the rate of transcription. Enhancers are sequences that bind activator proteins, in order to loop the DNA, and bring a specific promoter to the initiation complex, thus increasing the rate of transcription.
  • MCS multiple cloning site
  • the immunostimulatory bacteria herein contain plasmids that can comprise enhancer(s) to enhance the expression of the therapeutic products/proteins encoded on the plasmids. d.
  • a secretion signal also known as a signal sequence or peptide, a leader sequence or peptide, or a localization signal or sequence, is a short peptide at the N- terminus of a newly synthesized protein that is to be secreted.
  • Signal peptides promote a cell to translocate a protein, usually to the cellular membrane. The efficiency of protein secretion is strongly determined by the signal peptide.
  • the immunostimulatory bacteria herein contain plasmids that can comprise a signal peptide/secretion signal peptide, to facilitate and/or increase the expression or secretion of the encoded therapeutic product(s). e.
  • the plasmids in the immunostimulatory bacteria that encode the therapeutic products include genes and regulatory elements that are provided for expression of bacterial genes, and also, for expression of complex polycistronic eukaryotic payloads.
  • the switch between such evolutionarily divergent organisms introduces challenges for proper functioning in prokaryotes and eukaryotes.
  • the bacteria are cultured in vitro, then administered to a eukaryotic subject, where the plasmids are delivered to cells, particularly to tumor-resident myeloid cells, in cancer subjects, where the payloads are expressed, processed and trafficked.
  • Origin of Replication and Plasmid Copy Number Plasmids are autonomously-replicating, extra-chromosomal circular double- stranded DNA molecules that are maintained within bacteria by means of a replication origin. Copy number influences the plasmid stability. High copy number generally results in greater stability of the plasmid when the random partitioning occurs at cell division. A high copy number of plasmids generally decreases the growth rate, thus possibly allowing for bacterial cells with few plasmids to dominate the culture, since they grow faster.
  • the origin of replication also determines the plasmid’s compatibility, i.e., its ability to replicate in conjunction with another plasmid within the same bacterial cell. Plasmids that utilize the same replication system cannot co-exist in the same bacterial cell; they are said to belong to the same compatibility group. The introduction of a new origin, in the form of a second plasmid from the same compatibility group, mimics the result of replication of the resident plasmid.
  • any further replication is prevented until after the two plasmids have been segregated to different cells to create the correct pre-replication copy number.
  • Numerous bacterial origins of replication are known to those of skill in the art. The origin can be selected to achieve a desired copy number. Origins of replication contain sequences that are recognized as initiation sites of plasmid replication via DNA dependent DNA polymerases (see, e.g., del Solar et al. (1998) Microbiol. Mol. Biol. Rev.62(2):434-464). Different origins of replication provide for varying plasmid copy levels within each cell, and can range from one to hundreds of copies per cell.
  • Commonly used bacterial plasmid origins of replication include, but are not limited to, pMB1 derived origins, which have very high copy derivatives, such as pUC, and lower copy derivatives, such as pBR322, as well as ColE1, p15A, and pSC101, and other origins, which have low copy numbers.
  • pMB1 derived origins which have very high copy derivatives, such as pUC
  • lower copy derivatives such as pBR322
  • ColE1, p15A, and pSC101 and other origins, which have low copy numbers.
  • Such origins are well-known to those of skill in the art.
  • the pUC19 origin results in a copy number of 500-700 copies per cell.
  • the pBR322 origin has a known copy number of 15-20 copies per cell. These origins only vary by a single base pair.
  • the ColE1 origin copy number is 15-20, and derivatives, such as pBluescript, have copy numbers ranging from 300- 500.
  • the pSC101 origins confer a copy number of approximately 5.
  • Other low copy number vectors from which origins of replication can be obtained include, for example, pWSK29, pWKS30, pWSK129, and pWKS130 (see, e.g., Wang et al. (1991) Gene 100:195-199).
  • Medium to low copy number is less than 150, or less than 100.
  • Low copy number is less than 20, 25, or 30.
  • less than medium copy number is less than 150 copies
  • less than low copy number is less than about 25 or less than 25 copies
  • copy number refers to the average copies of plasmid per bacterium in a preparation.
  • Those of skill in the art can identify plasmids with low, medium, or high copy numbers. For example, one method to determine experimentally if the copy number is high or low is to perform a miniprep.
  • a high-copy plasmid should yield between 3-5 ⁇ g DNA per 1 ml LB culture; a low-copy plasmid will yield between 0.2-1 ⁇ g DNA per ml of LB culture.
  • Sequences of bacterial plasmids including identification of and sequence of the origin of replication, are well known (see, e.g., snapgene.com/resources/plasmid_files/basic_cloning_vectors/pBR322/).
  • Exemplary origins of replication, and their plasmid copy numbers, are summarized in the table below.
  • High copy plasmids are selected for heterologous expression of proteins in vitro, because the gene dosage is increased relative to chromosomal genes, there are higher specific yields of protein, and for therapeutic bacteria, higher therapeutic dosages of encoded therapeutics. It is shown, herein, however, that for delivery of plasmids encoding therapeutic products (e.g., immunomodulatory proteins), such as by S. typhimurium, in some embodiments, a high copy plasmid might be advantageous.
  • the requirement for bacteria to maintain the high copy plasmids can be a problem if the expressed molecule is toxic to the organism.
  • the metabolic requirements for maintaining these plasmids can come at a cost of replicative fitness in vivo.
  • Optimal plasmid copy number for delivery of therapeutic products can depend on the mechanism of attenuation of the strain engineered to deliver the plasmid. If needed, the skilled person, in view of the disclosure herein, can select an appropriate copy number for a particular immunostimulatory species and strain of bacteria.
  • the plasmid can be in higher or high copy number (greater than 150), to increase the amount of RNA or mRNA produced. 5.
  • CpG Motifs and CpG Islands Unmethylated cytidine-phosphate-guanosine (CpG) motifs are prevalent in bacterial, but not in vertebrate, genomic DNA.
  • CpG motifs oligodeoxynucleotides
  • ODNs pathogenic DNA and synthetic oligodeoxynucleotides
  • the unmethylated CpG motifs contain a central unmethylated CG dinucleotide plus flanking regions.
  • K-type ODNs also referred to as B-type
  • B-type contain from 1 to 5 CpG motifs, typically on a phosphorothioate backbone.
  • D-type ODNs (also referred to as A-type) have a mixed phosphodiester/phosphorothioate backbone and have a single CpG motif, flanked by palindromic sequences that permit the formation of a stem-loop structure, as well as poly G motifs at the 3’ and 5’ ends.
  • C-type ODNs have a phosphorothioate backbone and contain multiple palindromic CpG motifs that can form stem loop structures or dimers.
  • P-Class CpG ODNs have a phosphorothioate backbone, and contain multiple CpG motifs with double palindromes that can form hairpins at their GC-rich 3’ ends (see, e.g., Scheiermann et al.
  • the CpGs are encoded in the plasmid DNA; they can be introduced as a motif, or in a gene.
  • Toll-like receptors are key receptors for sensing pathogen-associated molecular patterns (PAMPs) and activating innate immunity against pathogens (see, e.g., Akira et al. (2001) Nat. Immunol.2(8):675-680).
  • PAMPs pathogen-associated molecular patterns
  • TLR9 recognizes hypomethylated CpG motifs in the DNA of prokaryotes that do not occur naturally in mammalian DNA (see, e.g., McKelvey et al. (2011) J. Autoimmun.36:76-86).
  • Immunostimulatory bacteria such as Salmonella species, such as S. typhimurium strains, carrying plasmids containing CpG islands or motifs, are provided herein. These bacteria can activate TLR9.
  • bacterial plasmids that contain hypomethylated CpG islands can elicit innate and adaptive anti- tumor immune responses that, in combination with the therapeutic products encoded on the plasmid, such as immunostimulatory proteins and constitutively active variants of STING, IRF3, and other cytosolic DNA/RNA sensors, can have synergistic or enhanced anti-tumor activity.
  • the asd gene (see, e.g., SEQ ID NO:48) encodes a high frequency of hypomethylated CpG islands.
  • CpG motifs can be included in combination with any of the therapeutic products, described or apparent from the description herein, in the immunostimulatory bacteria, to thereby enhance or improve anti-tumor immune responses in a treated subject.
  • Immunostimulatory CpGs can be included in the plasmids, by including a nucleic acid, typically from a bacterial gene, that encodes a gene product, and also by adding a nucleic acid that encodes CpG motifs.
  • the plasmids herein can include CpG motifs. Exemplary CpG motifs are known (see, e.g., U.S. Patent Nos.8,232,259, 8,426,375, and 8,241,844).
  • oligonucleotides that are between 10 and 100, 10 and 20, 10 and 30, 10 and 40, 10 and 50, or 10 and 75, base pairs long, with the general formula: (CpG)n, where n is the number of repeats. Generally, at least one or two repeats are used; non-CG bases can be interspersed.
  • CpG motifs for inducing an immune response by modulating TLRs, particularly TLR9.
  • the use of an asd deletion mutant, complemented with a functional asd gene on the plasmid allows for plasmid selection in vitro without the use of antibiotics, and allows for plasmid maintenance in vivo.
  • the asd gene complementation system provides for such selection/maintenance (see, e.g., Galán et al. (1990) Gene 94(1):29-35).
  • the use of the asd gene complementation system to maintain plasmids in the tumor microenvironment increases the potency of S.
  • DNA nuclear targeting sequences such as the SV40 DTS, mediate the translocation of DNA sequences through the nuclear pore complex. The mechanism of this transport is reported to be dependent on the binding of DNA binding proteins that contain nuclear localization sequences. The inclusion of a DTS on a plasmid to increase nuclear transport and expression has been demonstrated (see, e.g., Dean, D.A. et al. (1999) Exp.
  • Rho-independent or class I transcriptional terminators such as the T1 terminator of the rrnB gene of E. coli, contain sequences of DNA that form secondary structures that cause dissociation of the transcription elongation complex.
  • Transcriptional terminators are included in the plasmid in order to prevent expression of heterologous proteins by the S. typhimurium transcriptional machinery.
  • Plasmids used for transformation of Salmonella contain all or some of the following attributes: 1) one or more constitutive promoters for heterologous expression of proteins; 2) one or more human immunomodulatory expression cassettes; 3) a bacterial origin of replication and optimized plasmid copy number; 4) immunostimulatory CpG islands; 5) an asd gene selectable marker for plasmid maintenance and selection; 6) DNA nuclear targeting sequences; and 7) transcriptional terminators.
  • attributes 1) one or more constitutive promoters for heterologous expression of proteins; 2) one or more human immunomodulatory expression cassettes; 3) a bacterial origin of replication and optimized plasmid copy number; 4) immunostimulatory CpG islands; 5) an asd gene selectable marker for plasmid maintenance and selection; 6) DNA nuclear targeting sequences; and 7) transcriptional terminators.
  • immunostimulatory bacteria that contain genome modifications that improve their properties for use as anti-cancer therapeutics, as vaccines against pathogens, and as delivery vehicles for RNA, which can be used for as therapeutic products, or, that, can be translated to provide immunostimulatory products, antigens, and combinations thereof for the various uses.
  • the immunostimulatory bacteria include genomic modifications discussed throughout that improve their properties for use as anti-cancer therapeutics, for vaccines, and RNA delivery platforms, and also that reduce the inflammatory properties of bacteria,.also include payloads, including combinations of payload products, that enhance or act with the properties of the bacteria for these applications.
  • Payloads and genomic modifications are discussed and described throughout the disclosure herein, and are exemplified in the working examples below. The following is a discussion of exemplary bacteria, combinations of genomic modifications and payloads, and particularly advantageous for their use as vaccines. Disclosure throughout describes properties, payloads, and modifications for use as cancer therapetuics, and as thereapeutics that are generally useful for appropriate immune stimulation or modulation for use for treating cancer and other diseases and conditions. It is understood that the skilled artisan can effect similar genomic modifications in other bacterial species and strains, such as E. coli, and Listeria, to achieve similar effects and results. Additionally, as discussed above non-Salmonella species can be modified to encode a rck gene, such the rck gene from Salmonella, to increase resistance to complement.
  • the use and general mechanism of action for the bacteria provided herein includes administration, particularly direct tissue administration, such as by intramuscular injection, inhalation, intradermal administration, vaginal administration, and other such routes, to generate an in situ immune response to the antigen or product, which can be for prevention (immunization to develop an immmunoprotective response) or treatment, for a pathogen or for cancer.
  • the bacteria induce durable adaptive antiviral immunity.
  • the bacteria are suitably formulated for the selected route. This can include formulation, for example, as an aerosol, tablet, emulsion, powder, as appropriate.
  • the so-formulated administered bacteria are taken up into tissue-resident phagocytes, by phagocytosis.
  • the bacteria are modified so that they do no replicate in vivo, but deliver their payloads into the cells, such as tissue-resident phagocytic antigen-presenting cells (APCs).
  • the encoded products include, for example antigens for presentation, STING to induce type I IFN.
  • the encoded products can go into the lymph nodes resulting in antibodies via CD4+ and CD8+ priming, and the APCs present for priming and activation of antigen- specific CD8+ cells, which stimulate IFN-gamma, and also participate in direct killing of virally infected cells; macrophages phagocytose apoptotic infected cells, thereby spreading epitopes, which results in further T-cell activation 1.
  • immunostimulatory bacteria that are designed to accumulate in tumor-resident myeloid cells, such as macrophage. These bacteria contain a plasmid that encodes immunostimulatory protein and combinations thereof that induce an anti-viral/anti- tumor immune response.
  • the genomic modifications include the elimination of flagella, alterations of the LPS, and elimination of curli fimbriae. These or modifications in bacterial strains with similar effects, reduce TLR2/4/5 responses/signaling, and result in accumulation in the tumor microenvironment and myeloid cells.
  • auxotrophies such as asd- or ThyA- render the bacteria unable to growh in vivo
  • other auxotrophies such as including purI-, that render the bacteria auxotrophic for adenosine, increase accumulation in the tumor microenvironment, which can have elevated adenosine, which immunosuppressive, and genomic modifications to eliminate or inactive asparaginase, which can inhibit T cells.
  • the combinaiont of some or all of these bacterial modifications result in bacteria that accumulate in the macrophage in the tumor microenvironment and tumors.
  • Exemplary of such immunostimulatory bacteria is the strain designated YS1646 ⁇ asd/ ⁇ FLG/ ⁇ pagP/ ⁇ ansB/ ⁇ csgD/F- ⁇ purI strain.
  • the strain can be used, for example, for in situ cancer antigen vaccination contains a plasmid expressing either STING, eSTING (referring to engineered STING, such as those provided herein, particularly those that constitutively induce type I interferon), IL-15 (or IL-15 receptor complex) + eSTING, and other type I IFN producing combinations of payloads, exptressed under control of a eukaryotic promoter, such as the CMV promoter.
  • the plasmid additionally contains sequences encoding the open reading frames of full-length tumor antigens or peptide antigen fragments.
  • the route of administration is IV, whereby the strain traffics to the tumor and is taken up by tumor- resident macrophages, resulting in plasmid transfer to the nucleus and expression of payloads.
  • the macrophages process and present the cancer antigens for CD8 + T-cell priming within the tumor, as well as trafficking to the lymph nodes to prime CD4 + and CD8 + T-cells.
  • Primed and activated CD8 + T-cells eliminate tumor cells bearing the primed antigen, induce long-lived tissue-resident memory CD8+ T-cells, as well as circulating as memory T-cells after the tumor is cleared to prevent tumor recurrence. 2.
  • Exemplary immunostimulatory bacteria for Peripheral Cancer Vaccination and Mechanism of Action The YS1646 ⁇ asd/ ⁇ FLG/ ⁇ pagP/ ⁇ ansB/ ⁇ csgD/F- ⁇ purI/ ⁇ thyA strain containing an additional thymidine auxotrophy is used for peripheral cancer antigen vaccination.
  • the strain cannot proliferate in the absence of thymidine supplementation, and, upon administration, as by intramuscular injection into an extremity, it is phagocytosed by tissue-resident macrophages, such as following IM injection in the arm.
  • the strain contains a plasmid that encodes STING, eSTING, IL- 15 + eSTING, or other type I IFN producing combination, as well as sequences of full-length tumor antigens or peptides, from either a bacterial promoter and IRES sequence or a eukaryotic promoter.
  • the bacteria will then transcribe the RNA of these encoded payloads, and deliver them upon phagocytosis and destroyed by tissue-resident macrophages.
  • the phagocyte transcribes the RNA.
  • the resulting mRNA the is translated into proteins, and the encoded antigens are presented by the macrophages in the presence of type I IFN for CD8 + T-cell priming.
  • the cancer antigen-primed CD8 + T-cells circulate and eliminate cancerous cells, such as those that remain after surgical tumor resection. Strains such as this also are used as a prophylactic vaccine to reduce the risk of developing a particular cancer, such as for vaccination against familial genetic mutations that could lead to tumor formation. 3.
  • Exemplary Immunostimulatory Bacteria for Pathogen Vaccination and Mechanism of Action MOA
  • Exemplary of such include YS1646 ⁇ asd/ ⁇ FLG/ ⁇ pagP/ ⁇ ansB/ ⁇ csgD/F- ⁇ purI/ ⁇ thyA strain, which has an additional thymidine auxotrophy. Such srains cannot proliferate in the absence of thymidine supplementation.
  • These strains can be used for vacciniation against pathogens. They are administered by route that infection by the particular pathogen occurs naturally. Following administration, such as by intramuscular, intranasal, inhalation, or oral delivery, or combinations thereof, depending on the site or sites where the infection naturally occurs, they are cleared from tissue-resident macrophages, leaving plasmids.
  • strains contain a plasmid encoding for expression of an immunostimulatory protein or combination thereof, such as STING, engineered STING (eSTING), IL-15 + eSTING, or other type I IFN producing proteins or combinations of proteins, and also pathogen sequences of antigens and/or peptides, under transcriptional control of a bacterial promoter, but including eukaryotic sequences, such as an IRES, for translation by eukarotic ribosomes.
  • the bacteria produce RNA encoding these payloads, and, after administration, upon phagocytosis and destruction by tissue-resident macrophages, deliver the encoded mRNA.
  • the mRNA is translated into proteins by the eukaryotic host cells, and the antigens are presented by the macrophages in the presence of type I IFN for CD8 + T-cell priming.
  • the type I IFN can be stimulated by the encoded immunostimulatory protein, such as a STING or modified STING.
  • the bacteria can provide the type I IFN and pathogen antigens as proteins using a plasmid with a bacterial promoter and sequences for bacterial transcription and translation.
  • the macrophages then prime CD8 + T-cells in the tissue, as well as traffic to the lymph nodes to prime CD4 + and CD8 + T-cells.
  • Primed and activated CD8 + T-cells then circulate as patrolling memory T-cells, as well as traffic back to the tissue of origin to remain as tissue-resident memory CD8 + T-cells.
  • the primed CD4 + T-cells induce B- cell activation to produce high titers of durable neutralizing antibodies.
  • This vaccination strategy mimics the highly successful smallpox, polio, measles, chicken pox, and other live-attenuated vaccines that are administered in the tissues where disease would naturally occur.
  • H. PHARMACEUTICAL PRODUCTION, COMPOSITIONS, AND FORMULATIONS Provided herein are methods for manufacturing, and pharmaceutical compositions and formulations, containing any of the immunostimulatory bacteria provided herein and pharmaceutically acceptable excipients or additives.
  • the pharmaceutical compositions can be used in the treatment of diseases, such as hyperproliferative diseases or conditions, such as a tumor or cancer.
  • the immunostimulatory bacteria can be administered as a single agent therapy, or can be administered in a combination therapy with a further agent(s) or treatment(s).
  • Combination therapy includes combining therapy with the immunostimulatory bacteria and/or other delivery vehicles provided herein, with any other anti-cancer therapy or treatment, including, but not limited to, immunotherapies, such as CAR-T therapy and checkpoint inhibitors, radiation, surgery, chemotherapeutic agents, such as nucleoside analogs and platinum compounds, and cellular therapies.
  • the compositions can be formulated for single dosage administration, or for multiple dosage administration.
  • the agents can be formulated for direct administration.
  • compositions can be provided as a liquid or dried formulation.
  • Manufacturing a. Cell Bank Manufacturing As the active ingredient of the immunotherapeutic described herein is composed of engineered self-replicating bacteria, the selected composition will be expanded into a series of cell banks that will be maintained for long-term storage and as the starting material for manufacturing of the drug substance. Cell banks are produced under current good manufacturing practices (cGMP) in an appropriate manufacturing facility per the Code of Federal Regulations (CFR) 21 part 211, or other relevant regulatory authority.
  • cGMP current good manufacturing practices
  • CFR Code of Federal Regulations
  • the active agent of the immunotherapeutic is a live bacterium, the products described herein are, by definition, non-sterile and cannot be terminally sterilized. Care must be taken to ensure that aseptic procedures are used throughout the manufacturing process to prevent contamination.
  • a master cell bank is produced by sequential serial single colony isolation of the selected bacterial strain, to ensure no contaminants are present in the starting material.
  • a sterile culture vessel containing sterile media can be complex media, e.g., LB or MSB, or defined media, e.g., M9 supplemented with appropriate nutrients) is inoculated with a single well-isolated bacterial colony and the bacteria are allowed to replicate, e.g., by incubation at 37 °C with shaking. The bacteria are then prepared for cryopreservation by suspension in a solution containing a cryoprotective agent or agents.
  • cryoprotective agents include: proteins, such as human or bovine serum albumin, gelatin, and immunoglobulins; carbohydrates, including monosaccharides (e.g., galactose, D-mannose, sorbose, etc.) and their non-reducing derivatives (e.g., methylglucoside), disaccharides (e.g., trehalose, sucrose, and others), cyclodextrins, and polysaccharides (e.g., raffinose, maltodextrins, dextrans, etc.); amino-acids (e.g., glutamate, glycine, alanine, arginine or histidine, tryptophan, tyrosine, leucine, phenylalanine, etc.); methylamines, such as betaine; polyols, such as trihydric or higher sugar alcohols, e.g., glycerin, erythritol, g
  • Cryopreservation solutions can include one or more cryoprotective agents in a solution that also can contain salts (e.g., sodium chloride, potassium chloride, magnesium sulfate), and/or buffering agents, such as sodium phosphate, tris(hydroxymethyl)aminomethane (TRIS), 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), and other such buffering agents known to those of skill in the art.
  • salts e.g., sodium chloride, potassium chloride, magnesium sulfate
  • buffering agents such as sodium phosphate, tris(hydroxymethyl)aminomethane (TRIS), 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), and other such buffering agents known to those of skill in the art.
  • Suspension of the bacteria in cryopreservation solution can be achieved either by addition of a concentrated cryoprotective agent or agents to the culture material to achieve a final concentration that preserves viability of the bacteria during the freezing and thawing process (e.g., 0.5% to 20% final concentration of glycerol), or by harvesting the bacteria (e.g., by centrifugation) and suspending in a cryopreservative solution containing the appropriate final concentration of cryoprotective agent(s).
  • the suspension of bacteria in cryopreservation solution is then filled into appropriate sterile vials (plastic or glass) with a container closure system that is capable of maintaining closure integrity under frozen conditions (e.g., butyl stoppers and crimp seals).
  • the vials of master cell bank are then frozen (either slowly by means of a controlled rate freezer, or quickly by means of placing directly into a freezer).
  • the MCB is then stored frozen at a temperature that preserves long- term viability (e.g., at or below -60 oC).
  • Thawed master cell bank material is thoroughly characterized to ensure identity, purity, and activity per regulation by the appropriate authorities.
  • Working cell banks (WCBs) are produced much the same way as the master cell bank, but the starting material is derived from the MCB.
  • MCB material can be directly transferred into a fermentation vessel containing sterile media and expanded as above.
  • the bacteria are then suspended in a cryopreservation solution, filled into containers, sealed, and frozen at or below -20 oC.
  • WCBs can be produced from MCB material, and WCB material can be used to make additional cell banks (e.g., a manufacturer’s working cell bank (MWCB)).
  • WCBs are stored frozen, and are characterized to ensure identity, purity, and activity.
  • WCB material is typically the starting material used in the production of the drug substance of biologics such as engineered bacteria.
  • Drug Substance Manufacturing Drug substance is manufactured using aseptic processes under cGMP, as described above.
  • Working cell bank material is typically used as starting material for manufacturing of drug substance under cGMP, however, other cell banks can be used (e.g., MCB or MWCB).
  • Aseptic processing is used for production of all cell therapies including bacterial cell-based therapies.
  • the bacteria from the cell bank are expanded by fermentation; this can be achieved by production of a pre-culture (e.g., in a shake flask), or by direct inoculation of a fermenter. Fermentation is accomplished in a sterile bioreactor or flask that can be single-use disposable, or re-usable. Bacteria are harvested by concentration (e.g., by centrifugation, continuous centrifugation, or tangential flow filtration). Concentrated bacteria are purified from media components and bacterial metabolites by exchange of the media with buffer (e.g., by diafiltration). The bulk drug product is formulated and preserved as an intermediate (e.g., by freezing or drying), or is processed directly into a drug product.
  • a pre-culture e.g., in a shake flask
  • Fermentation is accomplished in a sterile bioreactor or flask that can be single-use disposable, or re-usable.
  • Bacteria are harvested by concentration (e.g., by centr
  • Drug substance is tested for identity, strength, purity, potency, and quality.
  • Drug Product Manufacturing is defined as the final formulation of the active substance contained in its final container. Drug product is manufactured using aseptic processes under cGMP. Drug product is produced from drug substance. Drug substance is thawed or reconstituted if necessary, then formulated at the appropriate target strength. Because the active component of the drug product is live, engineered bacteria, the strength is determined by the number of colony forming units (CFUs) contained within the suspension. The bulk product is diluted in a final formulation appropriate for storage and use, as described below. Containers are filled and sealed with a container closure system, and the drug product is labeled.
  • CFUs colony forming units
  • compositions are prepared in view of approvals for a regulatory agency or other agency, and/or prepared in accordance with generally recognized pharmacopeia for use in animals and in humans.
  • the compositions can be prepared as solutions, suspensions, powders, or sustained release formulations.
  • the compounds are formulated into pharmaceutical compositions using techniques and procedures well-known in the art (see, e.g., Ansel, Introduction to Pharmaceutical Dosage Forms, Fourth Edition, 1985, page 126). The formulation should suit the mode of administration.
  • compositions can be formulated for administration by any route known to those of skill in the art, including intramuscular, intravenous, intradermal, intralesional, intraperitoneal, subcutaneous, intratumoral, epidural, nasal, oral, vaginal, rectal, topical, local, otic, inhalational, buccal (e.g., sublingual), and transdermal administration, or by any suitable route. Other modes of administration also are contemplated. Administration can be local, topical, or systemic, depending upon the locus of treatment.
  • Local administration to an area in need of treatment can be achieved by, for example, but not limited to, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant.
  • Compositions also can be administered with other biologically active agents, either sequentially, intermittently, or in the same composition. Administration also can include controlled release systems, including controlled release formulations and device controlled release, such as by means of a pump. The most suitable route in any given case depends on a variety of factors, such as the nature of the disease, the progress of the disease, the severity of the disease, and the particular composition which is used. Pharmaceutical compositions can be formulated in dosage forms appropriate for each route of administration.
  • compositions can be formulated into any suitable pharmaceutical preparations for systemic, local, intraperitoneal, oral, or direct administration.
  • the compositions can be formulated for administration subcutaneously, intramuscularly, intratumorally, intravenously, or intradermally.
  • Administration methods can be employed to decrease the exposure of the active agent to degradative processes, such as immunological intervention via antigenic and immunogenic responses. Examples of such methods include local administration at the site of treatment, or continuous infusion.
  • the immunostimulatory bacteria can be formulated into suitable pharmaceutical preparations, such as solutions, suspensions, tablets, dispersible tablets, pills, capsules, powders, sustained release formulations, or elixirs, for oral administrations, as well as transdermal patch preparations, and dry powder inhalers.
  • the compounds are formulated into pharmaceutical compositions using techniques and procedures well-known in the art (see, e.g., Ansel, Introduction to Pharmaceutical Dosage Forms, Fourth Edition, 1985, page 126).
  • the mode of formulation is a function of the route of administration.
  • the compositions can be formulated in dried (lyophilized or other forms of vitrification) or liquid form. Where the compositions are provided in dried form, they can be reconstituted just prior to use by addition of an appropriate buffer, for example, a sterile saline solution.
  • Formulations a. Liquids, Injectables, Emulsions The formulation generally is made to suit the route of administration.
  • Parenteral administration generally characterized by injection or infusion, either subcutaneously, intramuscularly, intratumorally, intravenously, or intradermally is contemplated herein.
  • Preparations of bacteria for parenteral administration include suspensions ready for injection (direct administration), frozen suspensions that are thawed prior to use, dry soluble products, such as lyophilized powders, ready to be combined with a resuspension solution just prior to use, and emulsions.
  • Dried thermostable formulations such as lyophilized formulations, can be used for storage of unit doses for later use.
  • the pharmaceutical preparation can be in a frozen liquid form, for example, a suspension.
  • the drug product can be provided as a concentrated preparation to be thawed and diluted to a therapeutically effective concentration before use.
  • the pharmaceutical preparations also can be provided in a dosage form that does not require thawing or dilution for use.
  • Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, as appropriate, such as suspending agents (e.g., sorbitol, cellulose derivatives, or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, or fractionated vegetable oils); and preservatives suitable for use with microbial therapeutics.
  • suspending agents e.g., sorbitol, cellulose derivatives, or hydrogenated edible fats
  • emulsifying agents e.g., lecithin or acacia
  • non-aqueous vehicles e.g., almond oil, oily esters, or fractionated vegetable oils
  • the pharmaceutical preparations can be presented in dried form, such as lyophilized or spray-dried, for reconstitution with water or other sterile suitable vehicle before use.
  • suitable excipients are, for example, water, saline, dextrose, or glycerol.
  • the solutions can be either aqueous or non-aqueous.
  • suitable carriers include physiological saline or phosphate buffered saline (PBS), and other buffered solutions used for intravenous hydration.
  • PBS physiological saline or phosphate buffered saline
  • solutions containing thickening agents such as glucose, polyethylene glycol, and polypropylene glycol, oil emulsions, and mixtures thereof can be appropriate to maintain localization of the injectant.
  • compositions can include carriers or other excipients.
  • pharmaceutical compositions provided herein can contain any one or more of a diluents(s), adjuvant(s), antiadherent(s), binder(s), coating(s), filler(s), flavor(s), color(s), lubricant(s), glidant(s), preservative(s), detergent(s), or sorbent(s), and a combination thereof, or a vehicle with which a modified therapeutic bacteria is administered.
  • pharmaceutically acceptable carriers or excipients used in parenteral preparations include aqueous vehicles, non-aqueous vehicles, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, sequestering or chelating agents, and other pharmaceutically acceptable substances.
  • Formulations, including liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives or excipients.
  • Pharmaceutical compositions can include carriers, such as a diluent, adjuvant, excipient, or vehicle, with which the compositions are administered. Examples of suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E. W. Martin.
  • compositions will contain a therapeutically effective amount of the compound or agent, generally in purified form or partially purified form, together with a suitable amount of carrier, so as to provide the form for proper administration to the patient.
  • suitable amount of carrier can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, and sesame oil. Water is a typical carrier. Saline solutions and aqueous dextrose and glycerol solutions also can be employed as liquid carriers, particularly for injectable solutions.
  • Compositions can contain along with an active ingredient: a diluent, such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; a lubricant, such as magnesium stearate, calcium stearate, and talc; and a binder, such as starch, natural gums, such as gum acacia, gelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidone, and other such binders known to those of skill in the art.
  • a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose
  • a lubricant such as magnesium stearate, calcium stearate, and talc
  • a binder such as starch, natural gums, such as gum acacia, gelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, cro
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, and ethanol.
  • suitable excipients are, for example, water, saline, dextrose, glycerol, or ethanol.
  • a composition if desired, also can contain other minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, and other such agents, such as, for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate, and cyclodextrins.
  • Pharmaceutically acceptable carriers used in parenteral preparations include aqueous vehicles, non-aqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, sequestering or chelating agents and other pharmaceutically acceptable substances.
  • aqueous vehicles include Sodium Chloride Injection, Ringer’s Injection, Isotonic Dextrose Injection, Sterile Water Injection, and Dextrose and Lactated Ringer’s Injection.
  • Non-aqueous parenteral vehicles include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, and peanut oil.
  • Isotonic agents include sodium chloride and dextrose.
  • Buffers include phosphate and citrate.
  • Antioxidants include sodium bisulfate.
  • Local anesthetics include procaine hydrochloride.
  • Suspending and dispersing agents include sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone.
  • Emulsifying agents include, for example, polysorbates, such Polysorbate 80 (TWEEN 80). Sequestering or chelating agents of metal ions, such as EDTA, can be included.
  • Pharmaceutical carriers also include polyethylene glycol, and propylene glycol for water miscible vehicles, and sodium hydroxide, hydrochloric acid, citric acid, or lactic acid, for pH adjustment. Non-anti-microbial preservatives can be included.
  • the pharmaceutical compositions also can contain other minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, and other such agents, such as, for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate, and cyclodextrins.
  • Implantation of a slow-release or sustained-release system such that a constant level of dosage is maintained (see, e.g., U.S. Patent No.3,710,795), also is contemplated herein.
  • the percentage of active compound contained in such parenteral compositions is highly dependent on the specific nature thereof, as well as the activity of the compound and the needs of the subject. b.
  • the bacteria can be dried.
  • Dried thermostable formulations such as lyophilized or spray dried powders and vitrified glass, can be reconstituted for administration as solutions, emulsions and other mixtures.
  • the dried thermostable formulations can be prepared from any of the liquid formulations, such as the suspensions, described above.
  • the pharmaceutical preparations can be presented in lyophilized or vitrified form, for reconstitution with water or other suitable vehicle, before use.
  • the thermostable formulation is prepared for administration by reconstituting the dried compound with a sterile solution.
  • the solution can contain an excipient which improves the stability or other pharmacological attribute of the active substance or reconstituted solution, prepared from the powder.
  • thermostable formulation is prepared by dissolving an excipient, such as dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose, or other suitable agent, in a suitable buffer, such as citrate, sodium or potassium phosphate, or other such buffer known to those of skill in the art. Then, the drug substance is added to the resulting mixture, and stirred until it is mixed. The resulting mixture is apportioned into vials for drying. Each vial will contain a single dosage, containing 1x10 5 to 1x10 11 CFUs per vial. After drying, the product vial is sealed with a container closure system that prevents moisture or contaminants from entering the sealed vial.
  • an excipient such as dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose, or other suitable agent
  • a suitable buffer such as citrate, sodium or potassium phosphate, or other
  • the dried product can be stored under appropriate conditions, such as at -20 °C, 4 °C, or room temperature. Reconstitution of this dried formulation with water or a buffer solution provides a formulation for use in parenteral administration. The precise amount depends upon the indication treated and selected compound. Such amount can be empirically determined. 4. Compositions for Other Routes of Administration Depending upon the condition treated, other routes of administration in addition to parenteral, such as topical application, transdermal patches, and oral and rectal administration, also are contemplated herein. The suspensions and powders described above can be administered orally, or can be reconstituted for oral administration. Pharmaceutical dosage forms for rectal administration are rectal suppositories, capsules, and tablets and gel capsules for systemic effect.
  • Rectal suppositories include solid bodies for insertion into the rectum which melt or soften at body temperature, releasing one or more pharmacologically or therapeutically active ingredients.
  • Pharmaceutically acceptable substances in rectal suppositories are bases or vehicles and agents to raise the melting point.
  • bases include cocoa butter (theobroma oil), glycerin-gelatin, CARBOWAX® (polyethylene glycol), and appropriate mixtures of mono-, di-, and triglycerides of fatty acids. Combinations of the various bases can be used.
  • Agents to raise the melting point of suppositories include spermaceti and wax. Rectal suppositories can be prepared either by the compressed method, or by molding.
  • the typical weight of a rectal suppository is about 2 to 3 grams.
  • Tablets and capsules for rectal administration are manufactured using the same pharmaceutically acceptable substance and by the same methods as for formulations for oral administration.
  • Formulations suitable for rectal administration can be provided as unit dose suppositories. These can be prepared by admixing the drug substance with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
  • compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients, such as binding agents (e.g., pregelatinized maize starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose, or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate).
  • binding agents e.g., pregelatinized maize starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose, or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc, or silica
  • disintegrants
  • Formulations suitable for buccal (sublingual) administration include, for example, lozenges containing the active compound in a flavored base, usually sucrose and acacia or tragacanth; and pastilles containing the compound in an inert base, such as gelatin and glycerin, or sucrose and acacia. Topical mixtures are prepared as described for local and systemic administration.
  • the resulting mixtures can be solutions, suspensions, emulsions or the like, and are formulated as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures, pastes, foams, aerosols, irrigations, sprays, suppositories, bandages, dermal patches, or any other formulations suitable for topical administration.
  • the compositions can be formulated as aerosols for topical application, such as by inhalation (see, e.g., U.S. Patent Nos.4,044,126, 4,414,209, and 4,364,923, which describe aerosols for the delivery of a steroid useful for treatment of lung diseases).
  • formulations for administration to the respiratory tract, can be in the form of an aerosol or solution for a nebulizer, or as a microfine powder for insufflation, alone or in combination with an inert carrier such as lactose.
  • the particles of the formulation will typically have diameters of less than 50 microns, or less than 10 microns.
  • the compounds can be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions, and for application to the eye, or for intracisternal or intraspinal application.
  • Topical administration is contemplated for transdermal delivery, and also for administration to the eyes or mucosa, or for inhalation therapies.
  • Nasal solutions of the active compound alone, or in combination with other pharmaceutically acceptable excipients also can be administered.
  • Formulations suitable for transdermal administration are provided. They can be provided in any suitable format, such as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Such patches contain the active compound in an optionally buffered aqueous solution of, for example, 0.1 to 0.2 M concentration, with respect to the active compound.
  • Formulations suitable for transdermal administration also can be delivered by iontophoresis (see, e.g., Tyle, P.
  • compositions also can be administered by controlled release formulations and/or delivery devices (see e.g., U.S. Patent Nos.3,536,809; 3,598,123; 3,630,200; 3,845,770; 3,916,899; 4,008,719; 4,769,027; 5,059,595; 5,073,543; 5,120,548; 5,591,767; 5,639,476; 5,674,533; and 5,733,566). 5. Dosages and Administration The compositions can be formulated as pharmaceutical compositions for single dosage or multiple dosage administration.
  • the immunostimulatory bacteria can be included in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated.
  • concentration of the pharmaceutically active compound is adjusted so that an injection provides an effective amount to produce the desired pharmacological effect.
  • the therapeutically effective concentration can be determined empirically by testing the immunostimulatory bacteria in known in vitro and in vivo systems, such as by using the assays described herein or known in the art. For example, standard clinical techniques can be employed. In vitro assays and animal models can be employed to help identify optimal dosage ranges.
  • the precise dose which can be determinied empirically, can depend on the age, weight, body surface area, and condition of the patient or animal, the particular immunostimulatory bacteria administered, the route of administration, the type of disease to be treated, and the seriousness of the disease.
  • the precise dosage and duration of treatment is a function of the disease being treated, and can be determined empirically using known testing protocols, or by extrapolation from in vivo or in vitro test data. Concentrations and dosage values also can vary with the severity of the condition to be alleviated.
  • compositions can be administered hourly, daily, weekly, monthly, yearly, or once.
  • dosage regimens are chosen to limit toxicity. It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust therapy to lower dosage due to toxicity, or bone marrow, liver, or kidney, or other tissue dysfunctions.
  • the immunostimulatory bacteria are included in the composition in an amount sufficient to exert a therapeutically useful effect.
  • the amount is one that achieves a therapeutic effect in the treatment of a hyperproliferative disease or condition, such as cancer, or an amount that is effective as a vaccine, or to deliver mRNA.
  • An exemplary dose can be about 1 x 10 9 CFUs/m 2 , but depends upon the route of administration. As shown in the table below, and noted above, higher doses can be administered.
  • the immunostimulatory bacteria described and provided herein can be administered by any suitable route, including, but not limited to, intravenously (IV), and mucosally, such as by nasal/intranasal administration, and by inhalation into the lung.
  • IV intravenously
  • mucosally such as by nasal/intranasal administration, and by inhalation into the lung.
  • pathogens such as bacterial and viral pathogens, including, for example, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • the bacteria can be provided as a tablet, powder, or liquid, or other suitable formulation; they can be stored frozen, or refrigerated, or stored at room temperature, depending upon the formulation.
  • the bacteria that provide mRNA can be administered via a variety of routes, and can be conveniently stored and formulated.
  • Pharmaceutically and therapeutically active compounds and derivatives thereof are typically formulated and administered in unit dosage forms or multiple dosage forms. Each unit dose contains a predetermined quantity of therapeutically active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle, or diluent.
  • Unit dosage forms include, but are not limited to, tablets, capsules, pills, powders, granules, parenteral suspensions, oral solutions or suspensions, and oil-in-water emulsions, containing suitable quantities of the compounds or pharmaceutically acceptable derivatives thereof.
  • Unit dose forms can be contained in vials, ampoules and syringes, or individually packaged tablets or capsules.
  • Unit dose forms can be administered in fractions or multiples thereof.
  • a multiple dose form is a plurality of identical unit dosage forms packaged in a single container to be administered in segregated unit dose form. Examples of multiple dose forms include vials, bottles of tablets or capsules, or bottles of pints or gallons.
  • multiple dose form is a multiple of unit doses that are not segregated in packaging.
  • dosage forms or compositions containing active ingredient in the range of 0.005% to 100%, with the balance made up from non-toxic carrier can be prepared.
  • Pharmaceutical compositions can be formulated in dosage forms appropriate for each route of administration.
  • the unit-dose parenteral preparations are packaged in an ampoule, a vial, or a syringe with a needle.
  • the volume of liquid solution or reconstituted powder preparation, containing the pharmaceutically active compound, is a function of the disease to be treated and the particular article of manufacture chosen for package. All preparations for parenteral administration must be sterile, as is known and practiced in the art.
  • compositions provided herein can be formulated for any route known to those of skill in the art, including, but not limited to, subcutaneous, intramuscular, intravenous, intradermal, intralesional, intraperitoneal, epidural, vaginal, rectal, local, otic, or transdermal administration, or any route of administration. Formulations suited for such routes are known to one of skill in the art. Compositions also can be administered with other biologically active agents, either sequentially, intermittently, or in the same composition. Pharmaceutical compositions can be administered by controlled release formulations and/or delivery devices (see, e.g., U.S.
  • Various delivery systems are known and can be used to administer selected compositions, are contemplated for use herein, and such particles can be easily made.
  • Packaging and Articles of Manufacture Also provided are articles of manufacture containing packaging materials, any pharmaceutical composition provided herein, and a label that indicates that the compositions are to be used for treatment of diseases or conditions as described herein.
  • the label can indicate that the treatment is for a tumor or for cancer.
  • Combinations of immunostimulatory bacteria described herein and another therapeutic agent also can be packaged in an article of manufacture.
  • the article of manufacture contains a pharmaceutical composition containing the immunostimulatory bacteria composition and no further agent or treatment.
  • the article of manufacture contains another further therapeutic agent, such as a different anti-cancer agent.
  • the agents can be provided together or separately, for packaging as articles of manufacture.
  • the articles of manufacture provided herein contain packaging materials. Packaging materials for use in packaging pharmaceutical products are well-known to those of skill in the art. See, for example, U.S. Patent Nos.5,323,907, 5,052,558, and 5,033,252, each of which is incorporated herein in its entirety.
  • Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
  • Exemplary of articles of manufacture are containers, including single chamber and dual chamber containers.
  • the containers include, but are not limited to, tubes, bottles, and syringes.
  • the containers can further include a needle for intravenous administration.
  • the choice of package depends on the agents, and whether such compositions will be packaged together or separately.
  • the packaging is non-reactive with the compositions contained therein.
  • some of the components can be packaged as a mixture. In other examples, all components are packaged separately.
  • the components can be packaged as separate compositions that, upon mixing just prior to administration, can be directly administered together.
  • the components can be packaged as separate compositions for administration separately.
  • Selected compositions including articles of manufacture thereof also can be provided as kits.
  • Kits can include a pharmaceutical composition described herein, and an item for administration provided as an article of manufacture.
  • the compositions can be contained in the item for administration or can be provided separately to be added later.
  • the kit can, optionally, include instructions for application, including dosages, dosing regimens, and instructions for modes of administration.
  • Kits also can include a pharmaceutical composition described herein and an item for diagnosis. I.
  • the methods provided herein include methods of administering or using the immunostimulatory bacteria, for treating subjects having a disease or condition whose symptoms can be ameliorated or lessened by administration of such bacteria, such as cancer.
  • the disease or condition is a tumor or a cancer.
  • Bacteria provided herein also can be used as vaccines and other such applications, discussed in sections above. In those instances, not only can the bacteria be administered as described in this section, as described with reference to their use as anti-cancer agents, but also by other routes that mimic the natural routes of entry of various pathogens. For example, as discussed in the above sections, for vaccination, such as against viruses, such as respiratory viruses, they can be administered by inhalation into the nose or lungs.
  • bacteria elicit T cell responses and immune responses in the tissues in which they are administered, such as the nose, esophagus, and lungs, to promote in situ immune responses, resulting in memory T cells that are antigen-specific, as well as B cells, to provide long term responses.
  • methods of combination therapies with one or more additional agents for treatment such as an anti-cancer agent or an anti-hyaluronan agent, also are provided.
  • the bacteria can be administered by any suitable route, including, but not limited to, parenteral, systemic, topical, and local, such as intra-tumoral, intravenous, rectal, oral, intramuscular, mucosal, and other routes. Because of the modifications of the bacteria described herein, problems associated with systemic administration are solved.
  • Formulations suitable for each route of administration are provided.
  • the skilled person can establish suitable regimens and doses, and select routes of administration.
  • Diagnostics for Patient Selection for Treatment and for Monitoring Treatment a.
  • Patient Selection Biomarkers can be used to identify patients who are likely to respond to therapy with the immunostimulatory bacteria provided herein.
  • the Adenosine Signature and the Myeloid Signature can be assessed by NanoString gene expression panels, and T-cell infiltration of tumors can be assessed by the Immunoscore® test, which is an in vitro diagnostic test used for predicting the risk of relapse in early stage colon cancer patients, by measuring the host immune response at a tumor site.
  • tumors or body fluids indicate an immune responsiveness or an immune response are more likely to respond to the treatment with the immunostimulatory bacteria provided herein.
  • Other biomarkers include tumor-infiltrating lymphocytes (TILs), CD73, CD39, TNAP (tissue-nonspecific alkaline phosphatase), CD38, CD68, PD-L1, and FoxP3.
  • TILs tumor-infiltrating lymphocytes
  • CD73 CD73
  • CD39 tissue-nonspecific alkaline phosphatase
  • TNAP tissue-nonspecific alkaline phosphatase
  • CD38 tissue-nonspecific alkaline phosphatase
  • CD68 tumor-infiltrating lymphocytes
  • PD-L1 tumor-infiltrating lymphocytes
  • FoxP3 tumor-infiltrating lymphocytes
  • tumors that can be treated with the immunostimulatory bacteria provided herein are T-cell excluded, exhibit high levels of purines/adenosine, and are unresponsive to PD
  • GEPs Gene expression profiles
  • CRC colorectal carcinoma
  • NSCLC non-small cell lung cancer
  • pancreatic cancer among others.
  • CRC colorectal carcinoma
  • purines/adenosine are likely to respond to therapy, since the immunostimulatory bacteria herein accumulate and replicate in purine/adenosine rich tumor microenvironments.
  • the identification of tumors that express an “Adenosine Signature” can be used to predict patient response to therapy.
  • the immunostimulatory bacteria herein preferentially accumulate in and infect tumor-resident myeloid cells.
  • the “Myeloid Signature” also can be used to predict patient response to therapy with the immunostimulatory bacteria.
  • the “Adenosine Signature” is nearly identical to the “Myeloid Signature” that is associated with poor response to atezolizumab (anti-PD- L1) monotherapy in renal cell carcinoma (RCC) patients, which is indicative of the role of adenosine in tumor escape from anti-PD-L1 therapy (see, e.g., McDermott et al. (2016) Nature Medicine 24:749-757).
  • Tumor-myeloid and tumor-adenosine NanoString signature panels are available and can be used for the selection of patients. Macrophages limit T-cell infiltration into solid tumors and suppress their function, for example, in triple negative breast cancer (see, e.g., Keren et al. (2016) Cell 174:1373-1387). In certain cancers, such as CRC, macrophages dominate the intratumoral immune population and promote T-cell exclusion, and as a result, tumor- associated macrophages are associated with poor prognosis in CRC (see, e.g., Bindea et al. (2013) Immunity 39:782-795).
  • Immunoscore® a method to estimate the prognosis of cancer patients, based on the immune cells that infiltrate the cancer and surround it, can be used to measure T-cell exclusion or T-cell infiltration.
  • Immunoscore® incorporates the effects of the host immune response into cancer classification and improves prognostic accuracy. It measures the density of two T lymphocyte populations (CD3/CD8, CD3/CD45RO, or CD8/CD45RO) in the center and at the periphery of the tumor, and provides a score ranging from 0 (I0), when low densities of both cell types are found in both regions, to Immunoscore 4 (I4), when high densities are found in both regions.
  • T lymphocytes Low infiltration of T lymphocytes results in a low Immunoscore®, which correlates with high risk, while high infiltration of T lymphocytes results in a high Immunoscore®, which correlates with low risk.
  • Immunoscore® thus, can be evaluated as a prospective biomarker to identify patients that will respond to therapy with the immunostimulatory bacteria provided herein. For example, T-cell poor/uninflamed tumors can be treated, because the immunostimulatory bacteria provided herein induce T-cell infiltration in cold tumors. Such tumors represent a high, unmet need population that is refractory to checkpoint inhibition.
  • Extracellular adenosine is produced by the sequential activities of membrane associated ectoenzymes, CD39 (ecto-nucleoside triphosphate diphosphohydrolase 1, or NTPDase1) and CD73 (ecto-5’-nucleotidase), which are expressed on tumor stromal cells, together producing adenosine by phosphohydrolysis of ATP or ADP that is produced from dead or dying cells.
  • CD39 converts extracellular ATP (or ADP) to 5’-AMP, which is converted to adenosine by CD73.
  • Expression of CD39 and CD73 on endothelial cells is increased under the hypoxic conditions of the tumor microenvironment, thereby increasing levels of adenosine.
  • CD39 and CD73 can be used as biomarkers that indicate adenosine-rich tumors that can be targeted with the immunostimulatory bacteria provided herein.
  • CD38 also known as cyclic ADP ribose hydrolase, is a glycoprotein that is found on the surface of many immune cells, including CD4 + T-cells, CD8 + T-cells, B lymphocytes, and natural killer cells.
  • the loss of CD38 which is a marker of cell activation, is associated with impaired immune responses, and has been linked to leukemias, myelomas, and solid tumors. Additionally, increased expression of CD38 is an unfavorable diagnostic marker in chronic lymphocytic leukemia and is associated with increased disease progression.
  • CD38 also is used as a target for daratumumab (Darzalex®), which has been approved for the treatment of multiple myeloma.
  • CD68 is highly expressed by monocytes, circulating macrophages and by tissue macrophages (e.g., Kupffer cells, microglia).
  • FoxP3 is involved in immune system responses, and acts as a regulator in the development and function of regulatory T-cells (or Tregs), which are immunosuppressive. In cancer, an excess of regulatory T-cell activity can prevent the immune system from destroying cancer cells.
  • CD38, CD68 and FoxP3 also can be used as biomarkers for the selection of patients that are likely, to respond to therapy with the immunostimulatory bacteria herein. b.
  • Biomarkers can be used to monitor the immunostimulatory bacteria following treatment. Biomarkers occur in tumor samples and/or in body fluid samples, such as blood, plasma, urine, saliva, and other fluids. Validated, peripheral blood biomarkers are used to evaluate the immune status of patients prior to and during treatment, to determine changes in the immune status, which correlate with the effectiveness of treatment. A change to, or an increase in, anti-tumor immune response status indicates that treatment with the immunostimulatory bacteria is having an effect. Immunomodulatory activity of the immunostimulatory bacteria provided herein, for example, in dose escalation and expansion studies, can be assessed.
  • Serum biomarkers to detect immunomodulatory activity of the immunostimulatory bacteria include, but are not limited to, CXCL10 (IP-10), CXCL9, interferon- ⁇ , interferon- ⁇ , proinflammatory serum cytokines (e.g., IL-6, TNF- ⁇ , MCP-1/CCL1), and IL-18 binding protein.
  • CXCL10 and CXCL9 are chemokines that are necessary for CD8 + T-cell activation and trafficking to tumors, for example, in response to immunotherapies.
  • an anti-PD-1 immune checkpoint inhibitor for the treatment of previously treated patients with metastatic renal cell carcinoma (mRCC), immune pharmacodynamic effects that were shared by the majority of patients, irrespective of the dose administered, were identified.
  • VNP20009 induced a dose-dependent increase in the serum levels of the pro-inflammatory cytokines IL-6, TNF- ⁇ , IL-1 ⁇ , and IL-12 (see, e.g., Toso et al. (2002) J. Clin. Oncol.20(1):142-152).
  • IL-18 participates in protective immune responses to intracellular bacteria, fungi and viruses, and has demonstrated anti-tumor activity in preclinical models of lung cancer, breast cancer, sarcoma, and melanoma.
  • the biological activity of IL-18 is modulated in a negative feedback loop by IL-18 binding protein (IL-18BP), induced through IFN- ⁇ .
  • IL-18BP IL-18 binding protein
  • serum levels of IL-18BP are predictive of clinical IFN- ⁇ activity.
  • rhIL-18 recombinant human IL-18
  • IL-18BP can be used as a biomarker for tumor immune responses.
  • Tumors The immunostimulatory bacteria, combinations, uses and methods provided herein are applicable to treating all types of tumors, including cancers, particularly solid tumors, including lung cancer, bladder cancer, non-small cell lung cancer, gastric cancers, head and neck cancers, ovarian cancer, liver cancer, pancreatic cancer, kidney cancer, breast cancer, colorectal cancer, and prostate cancer.
  • the methods also can be used for treating hematological cancers.
  • Tumors and cancers subject to treatment by the immunostimulatory bacteria, compositions, combinations, uses and methods provided herein include, but are not limited to, those that originate in the immune system, skeletal system, muscles and heart, breast, pancreas, gastrointestinal tract, central and peripheral nervous system, renal system, reproductive system, respiratory system, skin, connective tissue systems, including joints, fatty tissues, and the circulatory system, including blood vessel walls.
  • tumors that can be treated with the immunostimulatory bacteria provided herein include carcinomas, gliomas, sarcomas (including liposarcoma), adenocarcinomas, adenosarcomas, and adenomas.
  • Tumors of the skeletal system include, for example, sarcomas and blastomas such as osteosarcoma, chondrosarcoma, and chondroblastoma.
  • Muscle and heart tumors include tumors of both skeletal and smooth muscles, e.g., leiomyomas (benign tumors of smooth muscle), leiomyosarcomas, rhabdomyomas (benign tumors of skeletal muscle), rhabdomyosarcomas, and cardiac sarcomas.
  • Tumors of the gastrointestinal tract include, e.g., tumors of the mouth, esophagus, stomach, small intestine, and colon, and colorectal tumors, as well as tumors of gastrointestinal secretory organs, such as the salivary glands, liver, pancreas, and the biliary tract.
  • Tumors of the central nervous system include tumors of the brain, retina, and spinal cord, and can also originate in associated connective tissue, bone, blood vessels, or nervous tissue. Treatment of tumors of the peripheral nervous system are also contemplated.
  • Tumors of the peripheral nervous system include malignant peripheral nerve sheath tumors.
  • Tumors of the renal system include those of the kidneys, e.g., renal cell carcinoma, as well as tumors of the ureters and bladder.
  • Tumors of the reproductive system include tumors of the cervix, uterus, ovary, prostate, testes, and related secretory glands.
  • Tumors of the immune system include both blood-based and solid tumors, including lymphomas, e.g., both Hodgkin’s and non-Hodgkin’s lymphomas.
  • Tumors of the respiratory system include tumors of the nasal passages, bronchi, and lungs.
  • Tumors of the breast include, e.g., both lobular and ductal carcinomas.
  • tumors that can be treated by the immunostimulatory bacteria and methods provided herein include Kaposi’s sarcoma, CNS neoplasms, neuroblastomas, capillary hemangioblastomas, meningiomas and cerebral metastases, melanoma, gastrointestinal and renal carcinomas and sarcomas, rhabdomyosarcoma, glioblastoma (such as glioblastoma multiforme), and leiomyosarcoma.
  • cancers that can be treated as provided herein include, but are not limited to, lymphoma, blastoma, neuroendocrine tumors, mesothelioma, schwannoma, meningioma, melanoma, and leukemia or lymphoid malignancies.
  • cancers include hematologic malignancies, such as Hodgkin’s lymphoma, non- Hodgkin’s lymphomas (Burkitt’s lymphoma, small lymphocytic lymphoma, chronic lymphocytic leukemia, mycosis fungoides, mantle cell lymphoma, follicular lymphoma, diffuse large B-cell lymphoma, marginal zone lymphoma, hairy cell leukemia, and lymphoplasmacytic leukemia), tumors of lymphocyte precursor cells, including B-cell acute lymphoblastic leukemia/lymphoma, and T-cell acute lymphoblastic leukemia/lymphoma, thymoma, tumors of the mature T and NK cells, including peripheral T-cell leukemias, adult T-cell leukemia/T-cell lymphomas and large granular lymphocytic leukemia, Langerhans cell histiocytosis, myeloid neoplasia
  • immunostimulatory bacteria provided herein can be administered to a subject, including a subject having a tumor or having neoplastic cells, or a subject to be immunized.
  • One or more steps can be performed prior to, simultaneously with, or after administration of the immunostimulatory bacteria to the subject, including, but not limited to, diagnosing the subject with a condition appropriate for administering immunostimulatory bacteria, determining the immunocompetence of the subject, immunizing the subject, treating the subject with a chemotherapeutic agent, treating the subject with radiation, or surgically treating the subject.
  • the subject typically has previously been diagnosed with a neoplastic condition.
  • Diagnostic methods also can include determining the type of neoplastic condition, determining the stage of the neoplastic condition, determining the size of one or more tumors in the subject, determining the presence or absence of metastatic or neoplastic cells in the lymph nodes of the subject, or determining the presence of metastases in the subject.
  • Some embodiments of the therapeutic methods for administering immunostimulatory bacteria to a subject can include a step of determining the size of the primary tumor or the stage of the neoplastic disease, and, if the size of the primary tumor is equal to or above a threshold volume, or if the stage of the neoplastic disease is at or above a threshold stage, an immunostimulatory bacterium is administered to the subject.
  • the immunostimulatory bacterium is not yet administered to the subject; such methods can include monitoring the subject until the tumor size or neoplastic disease stage reaches a threshold amount, and then administering the immunostimulatory bacterium to the subject. Threshold sizes can vary according to several factors, including rate of growth of the tumor, ability of the immunostimulatory bacterium to infect a tumor, and immunocompetence of the subject.
  • the threshold size will be a size sufficient for an immunostimulatory bacterium to accumulate and replicate in or near the tumor, without being completely removed by the host’s immune system, and will typically also be a size sufficient to sustain a bacterial infection for a time long enough for the host to mount an immune response against the tumor cells, typically about one week or more, about ten days or more, or about two weeks or more.
  • Exemplary threshold stages are any stage beyond the lowest stage (e.g., Stage I or equivalent), or any stage where the primary tumor is larger than a threshold size, or any stage where metastatic cells are detected. Any mode of administration of a microorganism to a subject can be used, provided the mode of administration permits the immunostimulatory bacteria to enter a tumor or metastasis.
  • Modes of administration can include, but are not limited to, intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intratumoral, multipuncture, inhalation, intranasal, oral, intracavity (e.g., administering to the bladder via a catheter, or administering to the gut by suppository or enema), aural, rectal, and ocular administration.
  • One skilled in the art can select any mode of administration compatible with the subject and the bacteria, and that also is likely to result in the bacteria reaching tumors and/or metastases.
  • the route of administration can be selected by one skilled in the art according to any of a variety of factors, including the nature of the disease, the kind of tumor, and the particular bacteria contained in the pharmaceutical composition.
  • Administration to the target site can be performed, for example, by ballistic delivery, or as a colloidal dispersion system, or systemic administration can be performed by injection into an artery.
  • the dosage regimen can be any of a variety of methods and amounts, and can be determined by one skilled in the art according to known clinical factors.
  • a single dose can be therapeutically effective for treating a disease or disorder in which immune stimulation effects treatment.
  • Exemplary of such stimulation is an immune response, that includes, but is not limited to, one or both of a specific immune response and non-specific immune response, both specific and non-specific responses, innate response, primary immune response, adaptive immunity, secondary immune response, memory immune response, immune cell activation, immune cell proliferation, immune cell differentiation, and cytokine expression.
  • dosages for a subject can depend on many factors, including the subject’s species, size, body surface area, age, sex, immunocompetence, and general health, the particular bacteria to be administered, the duration and route of administration, the kind and stage of the disease, for example, the tumor size, and other compounds, such as drugs, being administered concurrently.
  • levels can be affected by the infectivity of the bacteria and the nature of the bacteria, as can be determined by one skilled in the art.
  • appropriate minimum dosage levels of bacteria can be levels sufficient for the bacteria to survive, grow and replicate in a tumor or metastasis.
  • Exemplary minimum levels for administering a bacterium to a 65 kg human can include at least about 5 x 10 6 colony forming units (CFUs), at least about 1 x 10 7 CFUs, at least about 5 x 10 7 CFUs, at least about 1 x 10 8 CFUs, or at least about 1 x 10 9 CFUs.
  • appropriate maximum dosage levels of bacteria can be levels that are not toxic to the host, levels that do not cause splenomegaly of 3x or more, or levels that do not result in colonies or plaques in normal tissues or organs after about 1 day, or after about 3 days, or after about 7 days.
  • Exemplary maximum levels for administering a bacterium to a 65 kg human can include no more than about 5 x 10 11 CFUs, no more than about 1 x 10 11 CFUs, no more than about 5 x 10 10 CFUs, no more than about 1 x 10 10 CFUs, or no more than about 1 x 10 9 CFUs.
  • the methods and uses provided herein can include a single administration of immunostimulatory bacteria to a subject, or multiple administrations of immunostimulatory bacteria to a subject, or others of a variety of regimens, including combination therapies with other anti-tumor therapeutics and/or treatments.
  • cancer therapies such as administration of modified immune cells; CAR-T therapy; CRISPR therapy; checkpoint inhibitors, such as antibodies (e.g., anti-PD-1 antibodies, anti-PD-L1 antibodies, and anti-CTLA-4 antibodies, and other such immunotherapies); chemotherapeutic compounds, such as nucleoside analogs; surgery; and radiotherapy.
  • Other cancer therapies also include anti-VEGF, anti-VEGFR, anti-VEGFR2, anti-TGF- ⁇ , or anti-IL-6 antibodies, or fragments thereof, cancer vaccines, and oncolytic viruses.
  • a single administration is sufficient to establish immunostimulatory bacteria in a tumor, where the bacteria can colonize, and can cause or enhance an anti-tumor response in the subject.
  • the immunostimulatory bacteria provided for use in the methods herein can be administered on different occasions, separated in time, typically by at least one day. Separate administrations can increase the likelihood of delivering a bacterium to a tumor or metastasis, where a previous administration may have been ineffective in delivering the bacterium to a tumor or metastasis. In embodiments, separate administrations can increase the locations on a tumor or metastasis where bacterial colonization/proliferation can occur, or can otherwise increase the titer of bacteria accumulated in the tumor, which can increase eliciting or enhancing a host’s anti- tumor immune response. When separate administrations are performed, each administration can be a dosage amount that is the same or different relative to other administration dosage amounts.
  • all administration dosage amounts are the same.
  • a first dosage amount can be a larger dosage amount than one or more subsequent dosage amounts, for example, at least 10x larger, at least 100x larger, or at least 1000x larger, than subsequent dosage amounts.
  • all subsequent dosage amounts can be the same, smaller amount, relative to the first administration.
  • Separate administrations can include any number of two or more administrations, including two, three, four, five, or six administrations. One skilled in the art readily can determine the number of administrations to perform, or the desirability of performing one or more additional administrations, according to methods known in the art for monitoring therapeutic methods, and other monitoring methods provided herein.
  • the methods provided herein include methods of providing to the subject one or more administrations of immunostimulatory bacteria, where the number of administrations can be determined by monitoring the subject, and, based on the results of the monitoring, determining whether or not to provide one or more additional administrations. Deciding whether or not to provide one or more additional administrations can be based on a variety of monitoring results, including, but not limited to, indication of tumor growth or inhibition of tumor growth, appearance of new metastases or inhibition of metastasis, the subject’s anti- bacterial antibody titer, the subject’s anti-tumor antibody titer, the overall health of the subject, and the weight of the subject.
  • the time period between administrations can be any of a variety of time periods.
  • the time period between administrations can be a function of any of a variety of factors, including monitoring steps, as described in relation to the number of administrations, the time period for a subject to mount an immune response, the time period for a subject to clear bacteria from normal tissue, or the time period for bacterial colonization/proliferation in the tumor or metastasis.
  • the time period can be a function of the time period for a subject to mount an immune response; for example, the time period can be more than the time period for a subject to mount an immune response, such as more than about one week, more than about ten days, more than about two weeks, or more than about a month.
  • the time period can be less than the time period for a subject to mount an immune response, such as less than about one week, less than about ten days, less than about two weeks, or less than about a month.
  • the time period can be a function of the time period for bacterial colonization/proliferation in the tumor or metastasis; for example, the time period can be more than the amount of time for a detectable signal to arise in a tumor or metastasis after administration of a microorganism expressing a detectable marker, such as about 3 days, about 5 days, about a week, about ten days, about two weeks, or about a month.
  • compositions such as suspensions and other formulations, containing the immunostimulatory bacteria provided herein.
  • Such compositions contain the bacteria and a pharmaceutically acceptable excipient or vehicle, as provided herein or known to those of skill in the art.
  • the uses and methods provided herein also can include administering one or more therapeutic compounds, such as anti-tumor compounds or other cancer therapeutics, to a subject, in addition to administering the immunostimulatory bacteria to the subject.
  • the therapeutic compounds can act independently, or in conjunction with the immunostimulatory bacteria, for tumor therapeutic effects.
  • Therapeutic compounds that can act independently include any of a variety of known chemotherapeutic compounds that can inhibit tumor growth, inhibit metastasis growth and/or formation, decrease the size of a tumor or metastasis, or eliminate a tumor or metastasis, without reducing the ability of the immunostimulatory bacteria to accumulate in a tumor, replicate in the tumor, and cause or enhance an anti-tumor immune response in the subject.
  • chemotherapeutic agents include, but are not limited to, alkylating agents, such as thiotepa and cyclophosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; androgens, such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; anti-adrenals, such as aminoglutethimide, mitotane, and trilostane; anti-androgens, such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; antibiotics, such as aclacinomycin, actinomycin, anthramycin, azaserine, bleomycin, cactinomycin, calicheamicin, carubicin, carminomycin, carzinophilin, chromomycin, dactinomycin
  • Therapeutic compounds that act in conjunction with the immunostimulatory bacteria include, for example, compounds that increase the immune response eliciting properties of the bacteria, e.g., by increasing expression of encoded therapeutic products, such as cytokines, chemokines, co-stimulatory molecules, proteins that constitutively induce type I IFNs, RNAi molecules that inhibit, suppress, or disrupt expression of checkpoint gene(s), a checkpoint inhibitor antibody and antibodies or fragments thereof against other targets, or compounds that can further augment bacterial colonization/proliferation.
  • encoded therapeutic products such as cytokines, chemokines, co-stimulatory molecules, proteins that constitutively induce type I IFNs, RNAi molecules that inhibit, suppress, or disrupt expression of checkpoint gene(s), a checkpoint inhibitor antibody and antibodies or fragments thereof against other targets, or compounds that can further augment bacterial colonization/proliferation.
  • a gene expression-altering compound can induce or increase transcription of a gene in a bacterium, such as an exogenous gene encoded on the plasmid, thereby provoking an immune response.
  • a gene expression-altering compound can induce or increase transcription of a gene in a bacterium, such as an exogenous gene encoded on the plasmid, thereby provoking an immune response.
  • Any of a wide variety of compounds that can alter gene expression are known in the art, including IPTG and RU486.
  • Exemplary genes whose expression can be up- regulated include those encoding proteins and RNA molecules, including toxins, enzymes that can convert a prodrug to an anti-tumor drug, cytokines, transcription regulating proteins, shRNA, siRNA, and ribozymes.
  • therapeutic compounds that can act in conjunction with the immunostimulatory bacteria to increase the colonization/proliferation or immune response eliciting properties of the bacteria are compounds that can interact with a bacterially-encoded gene product, and such interaction can result in an increased killing of tumor cells or an increased anti-tumor immune response in the subject.
  • a therapeutic compound that can interact with a bacterially-encoded gene product can include, for example, a prodrug or other compound that has little or no toxicity, or other biological activity in its subject-administered form, but after interaction with a bacterially-encoded gene product, the compound can develop a property that results in tumor cell death, including but not limited to, cytotoxicity, the ability to induce apoptosis, or the ability to trigger an immune response.
  • prodrug-like substances include ganciclovir, 5-fluorouracil, 6-methylpurine deoxyriboside, cephalosporin-doxorubicin, 4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L- glutamic acid, acetaminophen, indole-3-acetic acid, CB1954, 7-ethyl-10-[4-(1- piperidino)-1-piperidino]carbonyloxycamptothecin, bis-(2-chloroethyl)amino-4- hydroxyphenylaminomethanone 28, 1-chloromethyl-5-hydroxy-1,2-dihyro-3H- benz[e]indole, epirubicin-glucuronide, 5’-deoxy5-fluorouridine, cytosine arabinoside, and linamarin.
  • monitoring can further include one or more steps of monitoring the subject, monitoring the tumor, and/or monitoring the immunostimulatory bacteria administered to the subject. Any of a variety of monitoring steps can be included in the methods provided herein, including, but not limited to, monitoring tumor size, monitoring the presence and/or size of metastases, monitoring the subject’s lymph nodes, monitoring the subject’s weight or other health indicators, including blood or urine markers, monitoring anti-bacterial antibody titer, monitoring bacterial expression of a detectable gene product, and directly monitoring bacterial titer in a tumor, tissue, or organ of a subject.
  • the purpose of the monitoring can be simply for assessing the health state of the subject, or the progress of therapeutic treatment of the subject, or can be for determining whether or not further administration of the same or a different immunostimulatory bacterium is warranted, or for determining when or whether or not to administer a compound to the subject where the compound can act to increase the efficacy of the therapeutic method, or the compound can act to decrease the pathogenicity of the bacteria administered to the subject.
  • the methods provided herein can include monitoring one or more bacterially-expressed genes. Bacteria, such as those provided herein or otherwise known in the art, can express one or more detectable gene products, including but not limited to, detectable proteins.
  • measurement of a detectable gene product expressed in a bacterium can provide an accurate determination of the level of bacteria present in the subject.
  • measurement of the location of the detectable gene product for example, by imaging methods, including tomographic methods, can determine the localization of the bacteria in the subject.
  • the methods provided herein that include monitoring a detectable bacterial gene product can be used to determine the presence or absence of the bacteria in one or more organs or tissues of a subject, and/or the presence or absence of the bacteria in a tumor or metastases of a subject.
  • the methods provided herein that include monitoring a detectable bacterial gene product can be used to determine the titer of bacteria present in one or more organs, tissues, tumors, or metastases.
  • Methods that include monitoring the localization and/or titer of bacteria in a subject can be used for determining the pathogenicity of bacteria, since bacterial infection, and particularly the level of infection, of normal tissues and organs can indicate the pathogenicity of the bacteria.
  • the methods that include monitoring the localization and/or titer of the immunostimulatory bacteria in a subject can be performed at multiple time points and, accordingly, can determine the rate of bacterial replication in a subject, including the rate of bacterial replication in one or more organs or tissues of a subject; accordingly, methods that include monitoring a bacterial gene product can be used for determining the replication competence of the bacteria.
  • the methods provided herein also can be used to quantitate the amount of immunostimulatory bacteria present in a variety of organs or tissues, and tumors or metastases, and can thereby indicate the degree of preferential accumulation of the bacteria in a subject; accordingly, the bacterial gene product monitoring can be used in methods of determining the ability of the bacteria to accumulate in tumors or metastases, in preference to normal tissues or organs. Since the immunostimulatory bacteria used in the methods provided herein can accumulate in an entire tumor or can accumulate at multiple sites in a tumor, and can also accumulate in metastases, the methods provided herein for monitoring a bacterial gene product can be used to determine the size of a tumor, or the number of metastases present in a subject.
  • Monitoring such presence of a bacterial gene product in a tumor or metastasis over a range of time can be used to assess changes in the tumor or metastasis, including growth or shrinking of a tumor, or development of new metastases, or disappearance of metastases, and also can be used to determine the rate of growth or shrinking of a tumor, or the rate of development of new metastases or disappearance of metastases, or the change in the rate of growth or shrinking of a tumor, or the change in the rate of development of new metastases or disappearance of metastases.
  • monitoring a bacterial gene product can be used for monitoring a neoplastic disease in a subject, or for determining the efficacy of treatment of a neoplastic disease, by determining the rate of growth or shrinking of a tumor, or the development of new metastases or disappearance of metastases, or the change in the rate of growth or shrinking of a tumor, or the development of new metastases or disappearance of metastases.
  • detectable proteins can be detected by monitoring, exemplary of which are any of a variety of fluorescent proteins (e.g., green fluorescent proteins), any of a variety of luciferases, transferrin, or other iron-binding proteins; or receptors, binding proteins, and antibodies, where a compound that specifically binds the receptor, binding protein or antibody can be a detectable agent, or can be labeled with a detectable substance (e.g., a radionuclide or imaging agent).
  • a detectable substance e.g., a radionuclide or imaging agent.
  • monitoring bacterial gene expression can be used for monitoring tumor and/or metastasis size.
  • Monitoring size over several time points can provide information regarding the increase or decrease in the size of a tumor or metastasis, and can also provide information regarding the presence of additional tumors and/or metastases in the subject.
  • Monitoring tumor size over several time points can provide information regarding the development of a neoplastic disease in a subject, including the efficacy of treatment of a neoplastic disease in a subject.
  • the methods provided herein also can include monitoring the antibody titer in a subject, including antibodies produced in response to administration of the immunostimulatory bacteria to a subject.
  • the bacteria administered in the methods provided herein can elicit an immune response to endogenous bacterial antigens.
  • the bacteria administered in the methods provided herein also can elicit an immune response to exogenous genes expressed by the bacteria.
  • the bacteria administered in the methods provided herein also can elicit an immune response to tumor antigens.
  • Monitoring antibody titer against bacterial antigens, bacterially-expressed exogenous gene products, or tumor antigens can be used to monitor the toxicity of the bacteria, to monitor the efficacy of treatment methods, or to monitor the level of gene product(s) or antibodies for production and/or harvesting.
  • Monitoring antibody titer can be used to monitor the toxicity of the bacteria.
  • Antibody titer against a bacteria can vary over the time period after administration of the bacteria to the subject, where at some particular time points, a low anti-(bacterial antigen) antibody titer can indicate a lower toxicity, while at other time points, a high anti-(bacterial antigen) antibody titer can indicate a higher toxicity.
  • the bacteria used in the methods provided herein can be immunogenic, and can, therefore, elicit an immune response soon after administering the bacteria to the subject.
  • immunostimulatory bacteria against which the immune system of a subject can mount a strong immune response can be bacteria that have low toxicity when the subject’s immune system can remove the bacteria from all normal organs or tissues.
  • a high antibody titer against bacterial antigens soon after administering the bacteria to a subject can indicate low toxicity of the bacteria.
  • monitoring antibody titer can be used to monitor the efficacy of treatment methods.
  • antibody titer such as anti-(tumor antigen) antibody titer
  • a therapeutic method such as a therapeutic method to treat neoplastic disease.
  • Therapeutic methods provided herein can include causing or enhancing an immune response against a tumor and/or metastasis.
  • monitoring the anti-(tumor antigen) antibody titer it is possible to monitor the efficacy of a therapeutic method in causing or enhancing an immune response against a tumor and/or metastasis.
  • monitoring antibody titer can be used for monitoring the level of gene product(s) or antibodies for production and/or harvesting.
  • methods can be used for producing proteins, RNA molecules or other compounds, by expressing an exogenous gene in a microorganism that has accumulated in a tumor, in the tumor microenvironment, and/or in tumor-resident immune cells.
  • Monitoring antibody titer against the protein, RNA molecule, or other compound can indicate the level of production of the protein, RNA molecule, or other compound by the tumor-accumulated microorganism, and also, can directly indicate the level of antibodies specific for such a protein, RNA molecule, or other compound.
  • the methods provided herein also can include methods of monitoring the health of a subject. Some of the methods provided herein are therapeutic methods, including neoplastic disease therapeutic methods. Monitoring the health of a subject can be used to determine the efficacy of the therapeutic method, as is known in the art.
  • the methods provided herein also can include a step of administering to a subject an immunostimulatory bacterium, as provided herein.
  • Monitoring the health of a subject can be used to determine the pathogenicity of an immunostimulatory bacterium administered to a subject.
  • Any of a variety of health diagnostic methods for monitoring disease such as neoplastic disease, infectious disease, or immune-related disease, can be monitored, as is known in the art.
  • the weight, blood pressure, pulse, breathing, color, temperature, or other observable state of a subject can indicate the health of a subject.
  • the presence, or absence, or level of one or more components in a sample from a subject can indicate the health of a subject.
  • Typical samples can include blood and urine samples, where the presence, or absence, or level of one or more components can be determined by performing, for example, a blood panel or a urine panel diagnostic test.
  • Exemplary components indicative of a subject’s health include, but are not limited to, white blood cell count, hematocrit, and c-reactive protein concentration.
  • the methods provided herein can include monitoring a therapy, where therapeutic decisions can be based on the results of the monitoring.
  • Therapeutic methods provided herein can include administering to a subject immunostimulatory bacteria, where the bacteria can preferentially accumulate in a tumor, the tumor microenvironment, or in tumor-resident immune cells, and/or in metastases, and where the bacteria can cause or enhance an anti-tumor immune response.
  • Such therapeutic methods can include a variety of steps, including multiple administrations of a particular immunostimulatory bacterium, administration of a second immunostimulatory bacterium, or administration of a therapeutic compound.
  • Determination of the amount, timing, or type of immunostimulatory bacteria or compound to administer to the subject can be based on one or more results from monitoring the subject.
  • the antibody titer in a subject can be used to determine whether or not it is desirable to administer an immunostimulatory bacterium and, optionally, a compound, the quantity of bacteria and/or compound to administer, and the type of bacteria and/or compound to administer, where, for example, a low antibody titer can indicate the desirability of administering an additional immunostimulatory bacterium, a different immunostimulatory bacterium, and/or a therapeutic compound, such as a compound that induces bacterial gene expression, or a therapeutic compound that is effective independent of the immunostimulatory bacteria.
  • the overall health state of a subject can be used to determine whether or not it is desirable to administer an immunostimulatory bacterium and, optionally, a compound, the quantity of bacterium and/or compound to administer, and the type of bacterium and/or compound to administer, where, for example, determining that the subject is healthy can indicate the desirability of administering additional bacteria, different bacteria, or a therapeutic compound, such as a compound that induces bacterial gene/genetic payload/therapeutic product expression.
  • monitoring a detectable bacterially-expressed gene product can be used to determine whether it is desirable to administer an immunostimulatory bacterium and, optionally, a compound, the quantity of bacterium and/or compound to administer, and the type of bacterium and/or compound to administer, where, for example, determining that the subject is healthy can indicate the desirability of administering additional bacteria, different bacteria, or a therapeutic compound, such as a compound that induces bacterial gene/genetic payload/therapeutic product expression.
  • Such monitoring methods can be used to determine whether or not the therapeutic method is effective, whether or not the therapeutic method is pathogenic to the subject, whether or not the bacteria have accumulated in a tumor or metastasis, and whether or not the bacteria have accumulated in normal tissues or organs.
  • monitoring can determine whether or not immunostimulatory bacteria have accumulated in a tumor or metastasis of a subject. Upon such a determination, a decision can be made to further administer additional bacteria, a different immunostimulatory bacterium, and, optionally, a compound to the subject.
  • J. EXAMPLES The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
  • Example 1 Auxotrophic Strains of S. typhimurium
  • the Salmonella Strain YS1646 is Auxotrophic for Adenosine Strains provided herein are engineered to be auxotrophic for adenosine.
  • the Salmonella strain YS1646 is a derivative of the wild-type strain ATCC 14028, and was engineered to be auxotrophic for purines due to disruption of the purI gene (synonymous with purM) (see, e.g., Low et al. (2004) Methods Mol. Med.90:47-60).
  • Strain YS1646 was grown overnight in lysogeny broth (LB) medium, washed with M9 minimal medium, and diluted into M9 minimal medium containing no adenosine, or increasing concentrations of adenosine. Growth was measured using a SpectraMax® M3 Spectrophotometer (Molecular Devices) at 37 °C, reading the OD 600 every 15 minutes.
  • strain YS1646 only was able to replicate when adenosine was provided at concentrations ranging from 11 to 300 micromolar, and was completely unable to replicate in M9 alone, or in M9 supplemented with 130 nanomolar adenosine.
  • Engineered adenosine auxotrophic strains exemplified herein include strains in which all or portions of the purI open reading frame are deleted from the chromosome to prevent reversion to wild-type. Such gene deletions can be achieved by any method known to one of skill in the art, including the lambda red system, as described below.
  • the Salmonella Strain YS1646 is Auxotrophic for ATP In addition to the purine and adenosine auxotrophy, it was determined whether the purI-deleted strain also can scavenge ATP. ATP accumulates to high levels in the tumor microenvironment, due to leakage from dying tumor cells.
  • strain YS1646 when provided with ATP, strain YS1646 is able to replicate in minimal media, but is unable to grow when not supplemented with ATP.
  • strain YS1646 was grown overnight in LB medium, washed with M9 minimal medium, and diluted into M9 minimal medium containing no ATP, or increasing concentrations of ATP (Fisher). Growth was measured using a SpectraMax® M3 Spectrophotometer (Molecular Devices) at 37 °C, reading the OD600 every 15 minutes. The results demonstrated that strain YS1646 is able to replicate when ATP is provided at concentrations of 0.012 mM, but not in M9 alone.
  • Example 2 Defects in Intracellular Replication are Attributed to the msbB Mutation
  • the YS1646 strain contains mutations in purI, which limits replication to sites containing high concentrations of purines, adenosine, or ATP, and mutations in msbB, which alters the lipopolysaccharide (LPS) surface coat in order to reduce TLR4- mediated pro-inflammatory signaling. It also has been established that, unlike wild- type Salmonella, strain YS1646 is unable to replicate in macrophages. Experiments were performed to determine which of these genetic mutations is responsible for conferring that phenotype within the wild-type strain, ATCC 14028.
  • mouse RAW macrophage cells (InvivoGen, San Diego, Ca.) were infected with wild-type Salmonella strains containing deletions in purI, msbB, or both, at a multiplicity of infection (MOI) of approximately 5 bacteria per cell for 30 minutes, then the cells were washed with PBS, and medium containing gentamicin was added to kill extracellular bacteria. Intracellular bacteria are not killed by gentamicin, as it cannot cross the cell membrane.
  • MOI multiplicity of infection
  • cell monolayers were lysed by osmotic shock with water, and the cell lysates were diluted and plated on LB agar to enumerate surviving colony forming units (CFUs).
  • Salmonella typhimurium strain derived from strain YS1646 (which can be purchased from ATCC, Catalog # 202165) that has been engineered to have a deletion in the asd gene.
  • the Salmonella typhimurium strain YS1646 ⁇ asd was engineered using modifications of the method of Datsenko and Wanner (Proc. Natl. Acad. Sci. U.S.A.97:6640–6645 (2000)), as described below. Introduction of the Lambda Red Helper Plasmid into Strain YS1646 The YS1646 strain was prepared to be electrocompetent as described previously (Sambrook J.
  • Construction of asd Gene Knockout Cassette The asd gene from the genome of strain YS1646 (Broadway et al. (2014) J. Biotechnology 192:177-178) was used for designing the asd gene knockout cassette.
  • the asd gene knockout cassette then was PCR amplified using primers asd-1 and asd-2 (see, Table 1), and gel purified. Deletion of asd gene
  • the YS1646 strain carrying plasmid pKD46 was electroporated with the gel- purified linear asd gene knock-out cassette. Electroporated cells were recovered in SOC medium and plated onto LB agar plates supplemented with kanamycin (20 ⁇ g/mL) and diaminopimelic acid (DAP, 50 ⁇ g/mL).
  • lambda red recombinase induces homologous recombination of the chromosomal asd gene with the kan cassette (due to the presence of homologous flanking sequences upstream and downstream of the chromosomal asd gene), and knockout of the chromosomal copy of the asd gene occurs.
  • the presence of the disrupted asd gene in the selected kanamycin-resistant clones was confirmed by PCR amplification, with primers from the YS1646 genome flanking the sites of disruption (primer asd-3), and from the multi-cloning site (primer scFv-3) (see, Table 1).
  • Colonies were also replica plated onto LB plates, with and without supplemental DAP, to demonstrate DAP auxotrophy. All clones with the asd gene deletion were unable to grow in the absence of supplemental DAP, demonstrating DAP auxotrophy.
  • Table 1 Primer Information Kanamycin Gene Cassette Removal The kan selectable marker was removed by using the Cre/loxP site-specific recombination system. The YS1646 ⁇ asd gene Kan R mutant was transformed with pJW168 (SEQ ID NO:224), a temperature-sensitive plasmid expressing the Cre recombinase. Amp R colonies were selected at 30 °C; pJW168 was subsequently eliminated by growth at 42 °C.
  • a selected clone was tested for loss of kan by replica plating on LB agar plates with and without kanamycin, and confirmed by PCR verification using primers from the YS1646 genome flanking the sites of disruption (primers asd-3 and asd-4; for primer sequences, see Table 1). Confirmation of Functional asd Deletion Mutant Strain YS1646 ⁇ asd (also designated AST-101) The ⁇ asd mutant was unable to grow on LB agar plates at 37 °C, but was able to grow on LB plates containing 50 ⁇ g/mL diaminopimelic acid (DAP).
  • DAP diaminopimelic acid
  • the ⁇ asd mutant growth rate was evaluated in LB liquid media; it was unable to grow in liquid LB, but was able to grow in LB supplemented with 50 ⁇ g/mL DAP, as determined by measuring absorbance at 600 nM. Sequence Confirmation of the asd Locus Sequence in Strain YS1646 ⁇ asd After asd Gene Deletion The asd gene deletion strain was verified by DNA sequencing using primers asd-3 and asd-4 (see, Table 1). Sequencing of the region flanking the asd locus was performed, and the sequence confirmed that the asd gene was deleted from the YS1646 chromosome.
  • plasmid pATIU6 (SEQ ID NO:225) was chemically synthesized and assembled.
  • the plasmid contained the following features: a high copy (pUC19) origin of replication, a U6 promoter for driving expression of a short hairpin, an ampicillin resistance gene flanked by HindIII restriction sites for subsequent removal, and the asd gene containing 85 base pairs of sequence upstream of the start codon (SEQ ID NO:246).
  • shRNAs targeting murine TREX1 were introduced by restriction digestion with SpeI and XhoI, and ligation and cloning into E. coli DH5- alpha cells.
  • the resulting plasmid was designated pATI-shTREX1. Electroporation of Plasmids into Immunostimulatory Bacterial Strains Selected plasmids, containing expression cassettes encoding immunostimulatory proteins and a functional asd gene, were electroporated into S. typhimurium strains lacking the asd gene with a BTX® ECM600 electroporator, using a 0.2 cm gap cuvette (BTX, San Diego, Calif.) at the following settings: 2.5 kV, 186 ohms, and 50 ⁇ F.
  • Electroporated cells were added to 1 mL SOC supplemented with 50 ⁇ M diaminopimelic acid (DAP), incubated for 1 hour at 37 °C, and then spread onto agar plates that do not contain DAP, to select for strains that received plasmids with a functional asd gene.
  • DAP diaminopimelic acid
  • cell banks were produced by inoculating a flask of sterile lysogeny broth (LB) with a single well isolated colony of S. typhimurium, and incubating at 37 °C with agitation at 250 RPM. After the culture was grown to stationary phase, the bacteria were washed in PBS containing 10% glycerol, and stored in aliquots frozen at less than -60 °C.
  • the plasmid pATI-shTREX1 was amplified in E. coli and purified for transformation into the YS1646 ⁇ asd strain by electroporation and clonal selection on LB Amp plates, to produce strain YS1646 ⁇ asd-shTREX1.
  • the YS1646 ⁇ asd mutants complemented with pATIU6-derived plasmids were able to grow on LB agar and liquid media in the absence of DAP.
  • the ampicillin resistance gene (Amp R ) from pATI- shTREX1 was replaced with a kanamycin resistance gene.
  • kanamycin resistance (Kan R ) gene was amplified by PCR using primers APR-001 and APR-002 (SEQ ID NO:226 and SEQ ID NO:227, respectively), followed by digestion with HindIII, and ligation into the gel purified, digested pATIU6 plasmid.
  • a single point mutation was introduced into the pATIKan plasmid at the pUC19 origin of replication, using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) and the primers APR-003 (SEQ ID NO:228) and APR-004 (SEQ ID NO:229), to change the nucleotide T at position 148 to a C.
  • This mutation makes the origin of replication homologous to the pBR322 origin of replication, which is a low copy origin of replication, in order to reduce the plasmid copy number.
  • CT26 tumor-bearing mice were treated with strain YS1646 containing a plasmid that expresses an shRNA targeting TREX1 (YS1646-shTREX1), or with an asd-deleted strain of YS1646, containing a plasmid with a functional asd gene and an shRNA targeting TREX1 (YS1646 ⁇ asd-shTREX1).
  • CT26 (Colon Tumor #26) is a tumor model that originated from exposing BALB/c mice to N-nitro-N-methylurethane (NMU), resulting in a highly metastatic carcinoma that recapitulates the aggressive, undifferentiated and checkpoint- refractory human colorectal carcinoma (see, e.g., Castle et al. (2014) BMC Genomics 15(1):190).
  • NMU N-nitro-N-methylurethane
  • the tumor is rich in myeloid cells, such as macrophages and myeloid-derived suppressor cells (MDSCs) (see, e.g., Zhao et al. (2017) Oncotarget 8(33):54775-54787).
  • myeloid cells such as macrophages and myeloid-derived suppressor cells (MDSCs)
  • MDS myeloid-derived suppressor cells
  • mice bearing 8 day-old established flank tumors were intravenously (IV) injected with three doses of 5 x10 6 CFUs of the YS1646 ⁇ asd-shTREX1 strain, or the parental YS1646-shTREX1 strain, on days 8, 15, and 23.
  • the plasmid encodes shTREX1 as an exemplary therapeutic product; any other desired therapeutic product or products can be substituted.
  • Body weights and tumors were measured twice weekly. Tumor measurements were performed using electronic calipers (Fowler, Newton, MA). Tumor volume was calculated using the modified ellipsoid formula, 1/2(length ⁇ width 2 ).
  • mice were euthanized when tumor size reached >20% of body weight or became necrotic, as per IACUC regulations.
  • tumors were homogenized, and homogenates were serially diluted and plated on LB agar plates, to enumerate the total number of colony forming units (CFUs) present, or on LB plates containing kanamycin, to enumerate the number of kanamycin resistant colonies.
  • CFUs colony forming units
  • S. typhimurium strain YS1646-shTREX1 did not have selective pressure to maintain the shRNA plasmid, and demonstrated significant plasmid loss, as the percent of kanamycin resistant (Kan R ) colonies was less than 10%.
  • the strain that used the asd gene complementation system for plasmid maintenance had nearly identical numbers of kanamycin resistant and kanamycin sensitive CFUs. These data demonstrate that the asd gene complementation system is sufficient to maintain the plasmid in the context of the tumor microenvironment in mice.
  • Enhanced Anti-Tumor Efficacy Using asd Complementation System The asd complementation system is designed to prevent plasmid loss and potentiate the anti-tumor efficacy of the therapeutic product delivery by S. typhimurium strains in vivo.
  • YS1646 ⁇ asd strains containing the shTREX1 plasmid (YS1646 ⁇ asd-shTREX1), or scrambled control (YS1646 ⁇ asd- shSCR), that contain a functional asd gene cassette, were compared for anti-tumor efficacy in a murine colon carcinoma model, to strain YS1646 containing plasmid pEQU6-shTREX1 (YS1646-shTREX1), a plasmid that lacks an asd gene cassette, and therefore, does not have a mechanism for plasmid maintenance.
  • shTREX1 is an exemplary therapeutic product.
  • mice 6-8 week-old female BALB/c mice (8 mice per group) were inoculated SC in the right flank with CT26 cells (2x10 5 cells in 100 ⁇ L PBS). Mice bearing established flank tumors were IV injected twice, on day 8 and on day 18, with 5x10 6 CFUs of YS1646 ⁇ asd-shTREX1, or YS1646-shTREX1, and compared to PBS control.
  • the YS1646-shTREX1 strain demonstrated enhanced tumor control compared to PBS (70% tumor growth inhibition (TGI), day 28) despite its demonstrated plasmid loss over time.
  • These data demonstrate that improved potency is achieved by preventing plasmid loss, using the asd complementation system, and delivery of shTREX1, as compared to YS1646 containing plasmids without the asd gene complementation system.
  • strains with asd complementation systems are superior anti-cancer therapeutics.
  • the live attenuated S. typhimurium YS1646 strain containing the asd gene deletion was further engineered to delete the fliC and fljB genes, in order to remove both flagellin subunits. This eliminates pro-inflammatory TLR5 activation, in order to reduce pro-inflammatory signaling and improve anti- tumor adaptive immunity.
  • Deletion of fliC Gene In this example, fliC was deleted from the chromosome of the YS1646 ⁇ asd strain using modifications of the method of Datsenko and Wanner (Proc. Natl. Acad.
  • a kanamycin gene cassette flanked by cre/loxP sites then was cloned into plasmid pSL0147, and the fliC gene knockout cassette was then PCR amplified with primers flic-1 (SEQ ID NO:232) and flic-2 (SEQ ID NO:233), gel purified, and then introduced into the YS1646 ⁇ asd strain carrying the temperature sensitive lambda red recombination plasmid pKD46, by electroporation. Electroporated cells were recovered in SOC + DAP medium, and plated onto LB agar plates supplemented with kanamycin (20 ⁇ g/mL) and diaminopimelic acid (DAP, 50 ⁇ g/mL).
  • Colonies were selected and screened for insertion of the knockout fragment by PCR using primers flic-3 (SEQ ID NO:234) and flic-4 (SEQ ID NO:235).
  • pKD46 then was cured by culturing the selected kanamycin resistant strain at 42 °C and screening for loss of ampicillin resistance.
  • the kanamycin resistance marker then was cured by electroporation of a temperature-sensitive plasmid expressing the Cre recombinase (pJW168), and Amp R colonies were selected at 30 °C; pJW168 was subsequently eliminated by growing cultures at 42 °C.
  • fliC knockout clones were then tested for loss of the kanamycin marker by PCR, using primers flanking the sites of disruption (flic-3 and flic-4), and evaluation of the electrophoretic mobility on agarose gels.
  • Deletion of fljB Gene The fljB gene was then deleted from the YS1646 ⁇ asd/ ⁇ fliC strain using modifications of the methods described above. Synthetic fljB gene homology arm sequences that contained 249 and 213 bases of the left hand and right hand sequence, respectively, flanking the fljB gene, were synthesized and cloned into a plasmid called pSL0148 (SEQ ID NO:231).
  • a kanamycin gene cassette flanked by cre/loxP sites then was cloned into pSL0148, and the fljB gene knockout cassette was PCR amplified with primers fljb-1 (SEQ ID NO:236) and fljb-2 (SEQ ID NO:237) (see, Table 1), gel purified, and introduced into strain YS1646 ⁇ asd/ ⁇ fliC carrying the temperature sensitive lambda red recombination plasmid pKD46, by electroporation. The kanamycin resistance gene then was cured by Cre-mediated recombination, as described above, and the temperature-sensitive plasmids were cured by growth at non- permissive temperature.
  • fliC and fljB gene knockout sequences were amplified by PCR using primers flic-3 and flic-4, or fljb-3 (SEQ ID NO:238) and fljb-4 (SEQ ID NO:239), respectively, and verified by DNA sequencing.
  • This mutant derivative of strain YS1646 was designated YS1646 ⁇ asd/ ⁇ fliC/ ⁇ fljB, or YS1646 ⁇ asd/ ⁇ FLG for short.
  • YS1646 ⁇ asd/ ⁇ FLG The YS1646-derived asd- mutant strain harboring the deletions of both fliC and fljB, herein referred to as YS1646 ⁇ asd/ ⁇ FLG, was evaluated for swimming motility by spotting 10 microliters of overnight cultures onto swimming plates (LB containing 0.3% agar and 50 mg/mL DAP). While motility was observed for the YS1646 ⁇ asd strain, no motility was evident with the YS1646 ⁇ asd/ ⁇ FLG strain. The YS1646 ⁇ asd/ ⁇ FLG strain then was electroporated with a plasmid containing an asd gene, and its growth rate in the absence of DAP was assessed.
  • the YS1646 ⁇ asd/ ⁇ FLG strain, with an asd complemented plasmid was able to replicate in LB in the absence of supplemental DAP, and grew at a rate comparable to the YS1646 ⁇ asd strain containing an asd complemented plasmid.
  • the YS1646 ⁇ asd strain induced 75% maximal LDH release, while the YS1646 ⁇ asd/ ⁇ FLG strain induced 54% maximal LDH release, demonstrating that deletion of the flagellin genes reduces the S. typhimurium-induced pyroptosis of infected macrophages.
  • Flagella-Deleted Mutants Lead to Less Pyroptosis in Infected Human Monocytes
  • THP-1 human macrophage cells (ATCC Catalog # 202165) were infected with the S.
  • typhimurium strains YS1646 and YS1646 ⁇ asd/ ⁇ FLG with the ⁇ asd strain containing plasmids encoding a functional asd gene to ensure plasmid maintenance.5x10 4 cells were placed in a 96-well dish with DMEM and 10% FBS. Cells were infected with washed log-phase cultures of S. typhimurium for 1 hour at an MOI of 100 CFUs per cell, then the cells were washed with PBS, and the media was replaced with media containing 50 ⁇ g/mL gentamicin to kill extracellular bacteria, and 50 ng/mL of IFN ⁇ to convert the monocytes into a macrophage phenotype.
  • the THP-1 cells were stained with CellTiter- Glo ® reagent (Promega), and the percentage of viable cells was determined using a luminescent cell viability assay using a SpectraMax® MR plate reader (Molecular Devices) to quantify the luminescence.
  • the cells infected with the YS1646 strain had only 38% viability, while the cells infected with the YS1646 ⁇ asd/ ⁇ FLG strain had 51% viability, indicating that the deletion of the flagellin genes induced less cell death of human macrophages, despite a very high and supraphysiological MOI.
  • Flagella is not Required for Tumor Colonization After Systemic Administration
  • 6-8 week-old female BALB/c mice (5 mice per group) were inoculated SC in the right flank with CT26 cells (2x10 5 cells in 100 ⁇ L PBS).
  • Mice bearing 10-day established flank tumors were IV injected with a single dose of 3 x10 5 CFUs of the YS1646 ⁇ asd/ ⁇ FLG-shTREX1 strain, or the parental YS1646 ⁇ asd-shTREX1 strain.
  • mice were euthanized, and tumors were homogenized and plated on LB plates to enumerate the number of colony forming units (CFUs) per gram of tumor tissue.
  • CFUs colony forming units
  • the splenic colonization of the YS1646 ⁇ asd-shTREX1 strain was calculated as a mean of 1.5 x 10 3 CFUs/g of spleen tissue, whereas splenic colonization of the flagella-deleted YS1646 ⁇ asd/ ⁇ FLG-shTREX1 strain was slightly lower, at a mean of 1.2 x 10 3 CFUs/g of spleen tissue.
  • Flagella-Deleted Strains Demonstrate Enhanced Adaptive Immunity in a Murine Tumor Model
  • the CT26 murine model of colon carcinoma was used, where 6-8 week-old female BALB/c mice (5 mice per group) were inoculated SC in the right flank with CT26 cells (2x10 5 cells in 100 ⁇ L PBS).
  • mice bearing established flank tumors were IV injected 11 days post tumor implantation with 5 x10 6 CFUs of the YS1646 ⁇ asd/ ⁇ FLG-shTREX1 strain, or the parental YS1646 ⁇ asd-shTREX1, or the scrambled plasmid control strain, YS1646 ⁇ asd-shSCR, and compared to PBS control. Mice were bled 7 days post-dosing on Sodium Heparin coated tubes (Becton Dickinson).
  • Non-coagulated blood was then diluted in the same volume of PBS and peripheral blood mononuclear cells (PBMCs) were separated from the interphase layer of whole blood using Lympholyte®-M cell separation reagent (Cedarlane). Isolated PBMCs were washed with PBS + 2% FBS by centrifugation at 1300 RPM for 3 minutes at room temperature, and resuspended in flow buffer. One million PBMCs were seeded per well of a V-bottom 96-well plate.
  • PBMCs peripheral blood mononuclear cells
  • CD11b + Gr1 + neutrophils possibly MDSCs, although further phenotyping in an ex vivo functional assay would be required
  • CD11b + F4/80 + macrophages CD8 + T-cells
  • CD8 + T-cells that recognize the CT26 tumor rejection antigen gp70 (AH1), the product of the envelope gene of murine leukemia virus (MuLV)-related cell surface antigen (see, e.g., Castle et al. (2014) BMC Genomics 15(1):190).
  • both strains carrying type I IFN-inducing payloads were capable of overwriting the normal anti-bacterial immune response, which clears bacterial infections through neutrophils and macrophages, and does not induce adaptive T-cell-mediate immunity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
EP21778590.6A 2020-08-12 2021-08-12 Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms Pending EP4196139A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063064869P 2020-08-12 2020-08-12
US202163188443P 2021-05-13 2021-05-13
US17/320,200 US20220380720A1 (en) 2019-11-12 2021-05-13 Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products
PCT/US2021/045832 WO2022036159A2 (en) 2020-08-12 2021-08-12 Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms

Publications (1)

Publication Number Publication Date
EP4196139A2 true EP4196139A2 (en) 2023-06-21

Family

ID=77951789

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21778590.6A Pending EP4196139A2 (en) 2020-08-12 2021-08-12 Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms

Country Status (8)

Country Link
EP (1) EP4196139A2 (ja)
JP (1) JP2023539454A (ja)
KR (1) KR20230066000A (ja)
AU (1) AU2021324883A1 (ja)
CA (1) CA3191433A1 (ja)
IL (1) IL300447A (ja)
MX (1) MX2023001782A (ja)
WO (1) WO2022036159A2 (ja)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112852698B (zh) * 2021-01-30 2022-11-29 军事科学院军事医学研究院军事兽医研究所 牛种布鲁氏菌A19株asd基因缺失株的构建方法和应用
WO2023086796A2 (en) 2021-11-09 2023-05-19 Actym Therapeutics, Inc. Immunostimulatory bacteria for converting macrophages into a phenotype amenable to treatment, and companion diagnostic for identifying subjects for treatment
EP4241791A1 (en) * 2022-03-07 2023-09-13 InnaTher Gene Therapy S.à.r.l. Combined gene and radio therapy for the treatment of cancer
EP4241790A1 (en) * 2022-03-07 2023-09-13 InnaTher Gene Therapy S.à.r.l. Expression system for the treatment of cancer
KR20240034391A (ko) * 2022-09-07 2024-03-14 주식회사 젠라이프 폐암 진단용 전자코 센서 및 이를 이용한 폐암 진단용 전자코 시스템
WO2024096123A1 (ja) * 2022-11-04 2024-05-10 株式会社バイオパレット 遺伝子が改変された微生物およびその生産方法
CN116676324B (zh) * 2023-07-28 2023-10-27 四川大学华西医院 基于Kil蛋白构建释放抗肿瘤效应蛋白的系统及方法

Family Cites Families (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3630200A (en) 1969-06-09 1971-12-28 Alza Corp Ocular insert
US3710795A (en) 1970-09-29 1973-01-16 Alza Corp Drug-delivery device with stretched, rate-controlling membrane
US3847770A (en) 1972-04-10 1974-11-12 Continental Can Co Photopolymerizable compositions prepared from beta hydroxy esters and polyitaconates
US4044126A (en) 1972-04-20 1977-08-23 Allen & Hanburys Limited Steroidal aerosol compositions and process for the preparation thereof
GB1429184A (en) 1972-04-20 1976-03-24 Allen & Hanburys Ltd Physically anti-inflammatory steroids for use in aerosols
US3845770A (en) 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US3936354A (en) 1974-04-29 1976-02-03 Lapointe Jean Rock Anti-tumour product of bacterial origin
US4008719A (en) 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
GB8322007D0 (en) 1983-08-16 1983-09-21 Wellcome Found Pharmaceutical delivery system
US4769027A (en) 1984-08-15 1988-09-06 Burroughs Wellcome Co. Delivery system
IE58110B1 (en) 1984-10-30 1993-07-14 Elan Corp Plc Controlled release powder and process for its preparation
US5052558A (en) 1987-12-23 1991-10-01 Entravision, Inc. Packaged pharmaceutical product
US5033252A (en) 1987-12-23 1991-07-23 Entravision, Inc. Method of packaging and sterilizing a pharmaceutical product
US5073543A (en) 1988-07-21 1991-12-17 G. D. Searle & Co. Controlled release formulations of trophic factors in ganglioside-lipsome vehicle
IT1229203B (it) 1989-03-22 1991-07-25 Bioresearch Spa Impiego di acido 5 metiltetraidrofolico, di acido 5 formiltetraidrofolico e dei loro sali farmaceuticamente accettabili per la preparazione di composizioni farmaceutiche in forma a rilascio controllato attive nella terapia dei disturbi mentali organici e composizioni farmaceutiche relative.
US5120548A (en) 1989-11-07 1992-06-09 Merck & Co., Inc. Swelling modulated polymeric drug delivery device
US5733566A (en) 1990-05-15 1998-03-31 Alkermes Controlled Therapeutics Inc. Ii Controlled release of antiparasitic agents in animals
US5580578A (en) 1992-01-27 1996-12-03 Euro-Celtique, S.A. Controlled release formulations coated with aqueous dispersions of acrylic polymers
US5323907A (en) 1992-06-23 1994-06-28 Multi-Comp, Inc. Child resistant package assembly for dispensing pharmaceutical medications
EP2192131A1 (en) 1992-08-21 2010-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5591767A (en) 1993-01-25 1997-01-07 Pharmetrix Corporation Liquid reservoir transdermal patch for the administration of ketorolac
IT1270594B (it) 1994-07-07 1997-05-07 Recordati Chem Pharm Composizione farmaceutica a rilascio controllato di moguisteina in sospensione liquida
US6190657B1 (en) 1995-06-07 2001-02-20 Yale University Vectors for the diagnosis and treatment of solid tumors including melanoma
US6080849A (en) 1997-09-10 2000-06-27 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
AU749695B2 (en) 1997-09-10 2002-07-04 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
WO1999018221A1 (en) * 1997-10-07 1999-04-15 University Of Maryland Biotechnology Institute Method for introducing and expressing rna in animal cells
JP2001010973A (ja) 1999-06-29 2001-01-16 Dnavec Research Inc がんワクチン
US6962696B1 (en) 1999-10-04 2005-11-08 Vion Pharmaceuticals Inc. Compositions and methods for tumor-targeted delivery of effector molecules
CA2386806A1 (en) 1999-10-04 2001-04-12 Vion Pharmaceuticals, Inc. Non-invasive tumor imaging by tumor-targeted bacteria
AU2001227889A1 (en) 2000-01-14 2001-07-24 The United States of America, represented by The Secretary, Department of Health & Human Services Oligodeoxynucleotide and its use to induce an immune response
ES2431090T3 (es) 2001-11-21 2013-11-25 The Johns Hopkins University Terapia bacteriolítica de combinación para el tratamiento de tumores
US20040043003A1 (en) * 2002-01-31 2004-03-04 Wei Chen Clinical grade vectors based on natural microflora for use in delivering therapeutic compositions
US20060051380A1 (en) 2002-02-06 2006-03-09 The Johns Hopkins University Methods and compositions for the targeting of a systemic immune response to specific organs or tissues
US7390646B2 (en) 2003-09-17 2008-06-24 The Regents Of The University Of California Bacterial vectors and methods of use thereof
US20070298012A1 (en) 2003-12-16 2007-12-27 Ivan King Compositions and Methods for Tumor-Targeted Delivery of Effector Molecules
US8501198B2 (en) 2004-06-07 2013-08-06 Qu Biologics Inc. Tissue targeted antigenic activation of the immune response to treat cancers
AU2005260697B2 (en) 2004-06-29 2011-10-06 Anticancer, Inc. Cancer selective auxotrophs
KR100967868B1 (ko) 2004-12-17 2010-07-05 베쓰 이스라엘 디코니스 메디칼 센터 박테리아 매개 유전자 침묵을 위한 조성물 및 이것을이용하는 방법
US8426375B2 (en) 2005-10-12 2013-04-23 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
CN1974759B (zh) 2006-07-26 2010-06-09 吉林大学 运载重组质粒的减毒沙门氏菌及其在抗肿瘤中的应用
FR2920158B1 (fr) * 2007-08-24 2010-03-12 Centre Nat Rech Scient Production de plasmides et expression de proteines recombinantes dans des cellules cultivees sans antibiotiques
US8241844B2 (en) 2008-10-03 2012-08-14 Ralph Clark, legal representative Methods and compositions for modulating an immune response with immunogenic oligonucleotides
US20120009153A1 (en) 2009-08-13 2012-01-12 Hongnian Guo Compositions for bacterial mediated gene silencing and methods of using the same
WO2012149364A1 (en) 2011-04-28 2012-11-01 Diamond Don J Tumor associated vaccines and compositions for disrupting tumor-derived immunosuppression for use in combination cancer immunotherapy
EP2620159A1 (en) 2012-01-24 2013-07-31 Institut Pasteur Improved cancer treatment by immunotherapy with bcg or antigenically related non-pathogenic mycobacteria
CN108102945B (zh) 2012-04-27 2021-08-24 山东新创生物科技有限公司 包含戈氏梭菌的衍生细菌菌株的组合物及其使用方法
US20150126589A1 (en) * 2012-06-08 2015-05-07 Ethris Gmbh Pulmonary Delivery of Messenger RNA
ES2391108B1 (es) 2012-07-26 2013-10-07 Universitat Autonoma De Barcelona Uso de mycobacterium brumae para el tratamiento del cáncer de vejiga
US9539290B2 (en) 2012-12-24 2017-01-10 Anticancer Inc. Individualized bacterial treatment of pancreatic cancer
CN105307671B (zh) 2013-04-18 2020-09-04 蒂尔坦生物制药有限公司 增强过继细胞疗法
KR20160027971A (ko) 2013-07-03 2016-03-10 시티 오브 호프 항암 병용제
US10987432B2 (en) 2013-09-05 2021-04-27 The University Of Hong Kong Therapeutic delivery and expression system, methods and uses thereof
PL3021859T3 (pl) 2013-10-25 2018-06-29 Psioxus Therapeutics Limited Adenowirusy onkolityczne wyposażone w geny heterolityczne
WO2015153639A1 (en) 2014-03-31 2015-10-08 The Johns Hopkins University Use of bacteria, bacterial products, and other immunoregulatory entities in combination with anti-ctla-4 and/or anti-pd-1 antibodies to treat solid tumor malignancies
WO2016025582A2 (en) 2014-08-12 2016-02-18 Forbes Neil S Targeting epigenetic regulators using a bacterial delivery system
US9889164B2 (en) 2014-12-05 2018-02-13 Synlogic, Inc. Bacteria engineered to treat a disease or disorder
US9688967B2 (en) 2014-12-05 2017-06-27 Synlogic, Inc. Bacteria engineered to treat diseases associated with hyperammonemia
US20160206666A1 (en) 2014-12-22 2016-07-21 Synlogic, Inc. Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tighten gut mucosal barrier
US11273184B2 (en) 2015-08-31 2022-03-15 Synlogic Operating Company, Inc. Bacteria engineered to treat disorders in which oxalate is detrimental
WO2017043815A1 (en) 2015-09-08 2017-03-16 Sillajen, Inc. Modified oncolytic vaccinia viruses expressing a cytokine and a car- boxylesterase and methods of use thereof
HUE059127T2 (hu) 2015-10-22 2022-10-28 Modernatx Inc Légúti vírusok elleni vakcinák
US11497781B2 (en) 2016-03-10 2022-11-15 Cg Oncology, Inc. Methods of treating bladder cancer by combination therapy comprising the oncolytic adenovirus CG0070 and an immune checkpoint inhibitor
EP3478321A4 (en) 2016-06-30 2020-04-22 Oncorus, Inc. PSEUDOTYPIZED ONCOLYTIC VIRAL ADMINISTRATION OF THERAPEUTIC POLYPEPTIDES
BR112019008369A2 (pt) * 2016-10-26 2019-10-01 Modernatx Inc ácidos ribonucleicos mensageiros para intensificar respostas imunes e métodos para uso dos mesmos
CA3049579A1 (en) 2017-01-06 2018-07-12 Synlogic Operating Company, Inc. Microorganisms programmed to produce immune modulators and anti-cancer therapeutics in tumor cells
AU2018212403A1 (en) 2017-01-25 2019-08-22 Tessa Therapeutics Ltd. TGF-ß decoy receptor
CN110505877A (zh) 2017-02-01 2019-11-26 摩登纳特斯有限公司 Rna癌症疫苗
AU2018251987A1 (en) 2017-04-14 2019-12-05 Cg Oncology, Inc. Methods of treating bladder cancer
CA3069523A1 (en) 2017-07-11 2019-01-17 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
CN111819185A (zh) 2017-12-15 2020-10-23 旗舰创业创新第六有限责任公司 包含环状多核糖核苷酸的组合物及其用途
JP7340591B2 (ja) 2018-07-11 2023-09-07 アクティム・セラピューティクス・インコーポレイテッド 遺伝子操作された免疫刺激性細菌菌株およびその使用
WO2020176809A1 (en) 2019-02-27 2020-09-03 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
US12024709B2 (en) 2019-02-27 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
CA3177479A1 (en) 2019-11-12 2021-05-20 Actym Therapeutics, Inc. Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products
CN115335527A (zh) * 2020-01-11 2022-11-11 西韦克生物技术有限责任公司 产生真核生物可翻译mRNA并将其传递给真核生物的微生物系统
US10973908B1 (en) 2020-05-14 2021-04-13 David Gordon Bermudes Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine

Also Published As

Publication number Publication date
CA3191433A1 (en) 2022-02-17
WO2022036159A2 (en) 2022-02-17
AU2021324883A1 (en) 2023-03-23
IL300447A (en) 2023-04-01
MX2023001782A (es) 2023-05-22
WO2022036159A3 (en) 2022-04-14
JP2023539454A (ja) 2023-09-14
KR20230066000A (ko) 2023-05-12

Similar Documents

Publication Publication Date Title
US11779612B2 (en) Engineered immunostimulatory bacterial strains and uses thereof
US20220017904A1 (en) Engineered immunostimulatory bacterial strains and uses thereof
US20220135980A1 (en) Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
WO2021097144A2 (en) Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products
AU2021324883A1 (en) Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms
US20220119824A1 (en) Immunostimulatory bacteria-based vaccines, therapeutics, and rna delivery platforms
US12024709B2 (en) Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
US20220154136A1 (en) Immunostimulatory bacteria delivery platforms and their use for delivery of therapeutic products
US20240293478A1 (en) Immunostimulatory bacteria for converting macrophages into a phenotype amenable to treatment, and companion diagnostic for identifying subjects for treatment
CN116916944A (zh) 基于免疫刺激性细菌的疫苗、治疗剂和rna递送平台

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20230310

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230713

DAV Request for validation of the european patent (deleted)
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40096034

Country of ref document: HK