EP3516066A1 - Micro-organismes modifiés utilisés comme sources durables de production d'acides gras polyinsaturés oméga-3 - Google Patents

Micro-organismes modifiés utilisés comme sources durables de production d'acides gras polyinsaturés oméga-3

Info

Publication number
EP3516066A1
EP3516066A1 EP17853981.3A EP17853981A EP3516066A1 EP 3516066 A1 EP3516066 A1 EP 3516066A1 EP 17853981 A EP17853981 A EP 17853981A EP 3516066 A1 EP3516066 A1 EP 3516066A1
Authority
EP
European Patent Office
Prior art keywords
acid sequence
desaturase
seq
nucleic acid
vippl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP17853981.3A
Other languages
German (de)
English (en)
Inventor
Leslie B. POOLE
Floyd H. Chilton
Derek PARSONAGE
Susan SERGEANT
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wake Forest University
Original Assignee
Wake Forest University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wake Forest University filed Critical Wake Forest University
Publication of EP3516066A1 publication Critical patent/EP3516066A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/201—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having one or two double bonds, e.g. oleic, linoleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6432—Eicosapentaenoic acids [EPA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6434—Docosahexenoic acids [DHA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6472—Glycerides containing polyunsaturated fatty acid [PUFA] residues, i.e. having two or more double bonds in their backbone

Definitions

  • the presently disclosed subject matter pertains in some embodiments to the preparation and use of recombinant vectors and modified microorganisms for omega-3 polyunsaturated fatty acid production.
  • omega 3 (co3) polyunsaturated fatty acids PUFAs
  • PUFAs omega 3 polyunsaturated fatty acids
  • PUFAs polyunsaturated fatty acids
  • LC long chain
  • PUFAs polyunsaturated fatty acids
  • ALA is very poorly metabolized to long chain (LC) co3 PUFAs, such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) and these LC-PUFAs have the health benefits to humans.
  • LC long chain
  • the co3 LC-PUFAs also contain a complex conjugated double bond structure that makes them highly susceptible to oxidation, giving rise to substantial stability and taste issues.
  • providing a more stable alternative that humans and animals would metabolize to biologically-active co3 LC-PUFAs is an object of the presently disclosed subject matter.
  • the first metabolic step utilizing ALA in mammals is a ⁇ 6 desaturase step ( Figures 1 and 2) and numerous studies in humans illustrate that this step represents the rate-limiting (bottleneck) step for converting ALA in botanical oils to co3 LC-PUFAs.
  • microalgae Another focus of the industry (with regard to a>3 PUFA sustainability) has been microalgae. However, no one has ever used marine bacteria or cyanobacteria, each of which has major cost and capacity advantages over microalgae.
  • This invention addresses the needs described above by providing among others modified microorganisms for production of co3 PUFAs (e.g., a>3 PUFAs highly enriched in SDA), related recombinant vectors, related lipid compositions, and related methods.
  • co3 PUFAs e.g., a>3 PUFAs highly enriched in SDA
  • related recombinant vectors e.g., a>3 PUFAs highly enriched in SDA
  • related lipid compositions e.g., lipid compositions, and related methods.
  • the invention provides a recombinant vector comprising a heterologous promoter operably linked to a nucleic acid sequence encoding a thylakoid-promoting protein Vippl and at least one nucleic acid sequence encoding a ⁇ 6 desaturase or a a>3 desaturase (also known as a ⁇ 15 desaturase).
  • the vector can comprise a back bone sequence affording compatibility with a plurality of microorganisms.
  • the recombinant vector can comprise a heterologous promoter operably linked to a nucleic acid sequence encoding a thylakoid-promoting protein Vippl, a nucleic acid sequence encoding a ⁇ 6 desaturase, and a nucleic acid sequence encoding a a>3 desaturase.
  • the thylakoid-promoting protein Vippl can be encoded by a nucleic acid sequence comprising SEQ ID NO: 1, a nucleic acid sequence at least about 70% identical to SEQ ID NO: 1 , or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO:6.
  • the Vippl can have an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO: 6.
  • the desaturase can be encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs: 2 and 3, a nucleic acid sequence at least about 70% identical to SEQ ID NOs: 2 or 3, or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 5 or 7 or an amino acid sequence at least about 70% identical to SEQ ID NO: 5 or 7.
  • the desaturase can comprise an amino acid sequence selected from SEQ ID NOs: 5 and 7 or an amino acid sequence at least about 70% identical to SEQ ID NOs: 5 or 7.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and a>3 desaturase can be each encoded by a nucleic acid sequence comprising SEQ ID NO: 4 or a nucleic acid sequence at least about 70% identical to SEQ ID NO: 4 and/or another nucleic acid sequence encoding at least SEQ ID NOs: 5, 6, and 7 or encoding amino acid sequences that are at least 70% identical to SEQ ID NOs: 5, 6, and 7.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl can be a natural gene sequence or a synthetic gene sequence.
  • the recombinant vector described above can be compatible with a cyanobacterium. Examples of the cyanobacterium include species of Anabaena, Leptolyngbya, Lyngbya, No toc, Phormidium, Spirulina, Synecho coccus, or Synechocystis.
  • the recombinant vector can further comprise one or more sequences affording expression or transcription control.
  • the invention provides a lipid composition having lipid profile comprising lipids and at least about 15% or more stearidonic acid (SDA). Also provided is a lipid composition having a lipid profile comprising lipids and an a>3 fatty acid selected from the group comprising or consisting of a-linolenic acid (ALA), stearidonic acid (SDA), and/or co3 arachidonic acid (ETAco3), and/or any combination thereof.
  • the lipid profile can comprise at least about 25%, 30%, or 35% 0)3 fatty acids.
  • the lipid profile can comprise at least about 9% ALA, at least about 15% SDA, and/or at least about 1% ETAco3.
  • the lipids can comprise glycolipids, phospholipids, triglycerides or combinations thereof, optionally the glycolipids are present in a greater amount than the phospholipids and triglycerides, or optionally the glycolipids comprise galactolipids.
  • the lipid composition is produced by a modified cyanobacterium, such as a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc, Phormidium, Spirulina, Synechococcus, or Synechocystis.
  • the invention provides a modified microorganism comprising a first exogenous gene encoding thylakoid-promoting protein Vippl.
  • the modified microorganism can further comprise at least a second exogenous gene encoding a desaturase.
  • the modified microorganism produces a lipid in a greater amount than does a control microorganism identical in all respects except that it does not include the first exogenous gene encoding thylakoid-promoting protein Vippl and the second exogenous gene encoding a desaturase.
  • the modified microorganism can comprise at least two exogenous genes encoding a desaturase, where each gene encodes a different desaturase.
  • the desaturase can be ⁇ 6 desaturase or a>3 desaturase.
  • the first desaturase can be a ⁇ 6 desaturase and the second desaturase can be a a>3 desaturase.
  • the thylakoid-promoting protein Vippl can be encoded by a nucleic acid sequence comprising SEQ ID NO: 1, a nucleic acid sequence at least about 70% identical to SEQ ID NO: 1, or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO:6.
  • the Vippl can comprise an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO: 6.
  • the desaturase can be encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs: 2 and 3, a nucleic acid sequence at least about 70% identical to SEQ ID NOs: 2 or 3, or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 5 or 7 or an amino acid sequence at least about 70% identical to SEQ ID NO: 5 or 7.
  • the desaturase can comprise an amino acid sequence selected from the group comprising SEQ ID NOs: 5 and 7 or an amino acid sequence at least about 70% identical to one of SEQ ID NOs: 5 or 7.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and a>3 desaturase can be each encoded by a nucleic acid sequence comprising SEQ ID NO: 4 or a nucleic acid sequence at least about 70% identical to SEQ ID NO: 4 or another nucleic acid sequence that encodes amino acid sequences comprising each of SEQ ID NOs: 5, 6, and 7 or amino acid sequences that are at least about 70% identical to SEQ ID NOs: 5, 6, and 7.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl can be a natural gene sequence or a synthetic gene sequence.
  • the modified microorganism can be a cyanobacterium, e.g., a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc, Phormidium, Spirulina, Synechococcus or Synechocystis.
  • the invention provides a method of culturing a lipid-producing microorganism.
  • the method includes (i) providing a culture of a modified microorganism that comprises an exogenous gene encoding thylakoid-promoting protein Vippl and at least one exogenous gene encoding a desaturase and (ii) maintaining the microorganism or its progeny in a suitable culture medium under conditions in which the exogenous gene encoding the thylakoid-promoting protein Vippl and the exogenous gene encoding the desaturase are expressed.
  • the culture produces a greater amount of the lipid than does a culture comprising a control microorganism identical in all respects except that it does not include the gene encoding a exogenous thylakoid-promoting protein Vippl and at least one exogenous gene encoding a desaturase.
  • the modified microorganism can comprise at least two exogenous genes encoding a desaturase, where each gene encodes a different desaturase.
  • the desaturase can be ⁇ 6 desaturase or a>3 desaturase.
  • the first desaturase can be a ⁇ 6 desaturase and the second desaturase a a>3 desaturase.
  • the thylakoid-promoting protein Vippl can be encoded by a nucleic acid sequence comprising SEQ ID NO: 1 or a nucleic acid sequence at least about 70% identical to SEQ ID NO: 1, or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO: 6.
  • the Vippl comprises an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70% identical to SEQ ID NO: 6.
  • the desaturase can be encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs:2 and 3, or a nucleic acid sequence at least about 70% identical to SEQ ID NO: 2 or 3, or a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 5 or 7 or an amino acid sequence at least about 70% identical to SEQ ID NO: 5 or 7.
  • the desaturase comprises an amino acid sequence comprising SEQ ID NO: 5 or SEQ ID NO: 7 or an amino acid sequence at least about 70% identical to SEQ ID NO: 5 or SEQ ID NO: 7.
  • the thylakoid-promoting protein Vippl , ⁇ 6 desaturase, and a>3 desaturase can be each encoded by a nucleic acid sequence comprising SEQ ID NO:4 or a nucleic acid sequence at least about 70% identical to SEQ ID NO: 4 or a nucleic acid sequence that encodes amino acid sequences comprising each of SEQ ID Nos: 5, 6, and 7 or amino acid sequences at least about 70% identical to SEQ ID NOs: 5, 6, and 7.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl can be a natural gene sequence or a synthetic gene sequence.
  • the modified microorganism can be a cyanobacterium such as a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc, Phormidium, Spirulina, Synechococcus or Synechocystis.
  • the method described above can further comprise extracting a lipid composition from the culture.
  • the invention provides a composition comprising a microorganism described above and/or an extract and/or processed product thereof.
  • the composition can be in an administrable form selected from the group consisting of a pharmaceutical formulation, a nutritional formulation, a feed formulation, a dietary supplement, a medical food, a functional food, a beverage product and combinations thereof.
  • the composition can be nutraceuticals, pharmaceuticals, dietary supplements, medical foods and functional foods.
  • the composition can be feeds and additives to food, including food for humans and for animal feed, e.g., feed for fish and/or for other animals, including but not limited to fowl, swine and cattle.
  • the animal feed can be used for all animals utilizing these fatty acids including poultry, pork, beef, etc.
  • the invention provides a feed for use in aquaculture, optionally for use in farming various fish such as salmon and Tilapia, comprising a microorganism described above and/or an extract and/or a processed product thereof. Also provided are any and all methods, compositions, kits, reagents, devices, and/or systems shown and/or described expressly or by implication in the information provided herewith, including but not limited to features that may be apparent and/or understood by those of skill in the art.
  • Figures 1 is a schematic drawing focusing on omega-3 (co3) long chain (LC) polyunsaturated fatty acid (PUFA) biosynthesis pathways and enzymes in mammals and rare microbes ( Figure 1 adapted from Napier et al., Ann. Rev. Plant Biol. (2007) 58:295).
  • omega-3 co3) long chain (LC) polyunsaturated fatty acid (PUFA) biosynthesis pathways and enzymes in mammals and rare microbes
  • Figure 2 is a schematic drawing showing a pathway for converting cc-linolenic acid (ALA) and ⁇ -linolenic acid (GLA) into omega-3 (a>3) long chain (LC) polyunsaturated fatty acids (PUFAs), such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) via stearidonic acid (SDA) as an intermediate.
  • PUFAs long chain polyunsaturated fatty acids
  • DHA docosahexaenoic acid
  • EPA eicosapentaenoic acid
  • SDA stearidonic acid
  • Figure 3 is a graph showing the total fatty acid (FA) concentrations (in micrograms per milligram of dry weight ⁇ g/mg) produced in modified cyanobacteria strains.
  • Total FAs are shown for a cyanobacterium transformed with a plasmid containing one or more structural genes to express the delta 6 ( ⁇ 6) desaturase, or the delta 15 ( ⁇ 15 also known as a>3) desaturase, or Vippl, or combinations of delta 6/Vippl, of delta 15/Vippl, or of delta 6/delta 15/ Vippl proteins.
  • the introduced genes were engineered to express protein sequences corresponding to the ⁇ 6 desaturase from Synechocystis sp.
  • PCC 6803 the ⁇ 15 ( ⁇ >3) desaturase from Synechococcus sp. PCC 7002, and/or the thylakoid-promoting protein Vippl from Synechococcus sp. PCC 7002. Also shown is the total FA concentration from the parent cyanobacterial species Leptolyngbya sp. BL0902 (WT). The number (n) of independent experiments used to generate the data is given for each construct in the lower panel.
  • Figure 4 is a graph showing the concentrations of classes (saturated, monounsaturated, or polyunsaturated) of fatty acids in wild-type (WT) and transgenic Leptolyngbya sp. BL0902 cyanobacteria.
  • the transgenic bacteria include bacteria transformed (plasmids identical to those used in Figure 3) with a plasmid expressing the delta 6 desaturase enzyme (delta6), the delta 15 desaturase enzyme (deltal5 also a>3), the thylakoid-promoting protein Vippl (VIPP1), a combination of the delta 6 desaturase enzyme and the Vippl protein (delta6, VIPP1), a combination of the delta 15 desaturase enzyme and the Vippl protein (deltal5, VIPP1), or a combination of the delta 6 desaturase enzyme, the delta 15 desaturase enzyme and the Vippl protein (delta6, deltal5, VIPP1).
  • the delta-15 desaturase is more correctly termed an a>3 desaturase as the target site for the introduced double bond is 3 carbons from the methyl end of fatty acids.
  • the enzyme is also called the deltal5 desaturase, referencing the standard C-18 fatty acid, but the enzyme recognizes the methyl end of the fatty acid unlike the delta-6 desaturase, for example, which recognizes the carboxyl end.
  • Figure 5 A is a graph showing the polyunsaturated fatty acid (PUFA) concentrations
  • the transgenic bacteria include bacteria transformed (plasmids identical to those used in Figures 3 and 4) with a plasmid expressing the delta 6 desaturase enzyme (delta6), the delta 15 desaturase enzyme (deltal5), the thylakoid promoting protein Vippl (VIPP1), a combination of the delta 6 desaturase enzyme and the Vippl protein (delta6, VIPP1), a combination of the delta 15 desaturase enzyme and Vippl (deltal5, VIPP1), and a combination of the delta 6 desaturase enzyme, the delta 15 desaturase enzyme and Vippl (delta6, deltal5, VIPP1).
  • Figure 5B is a graph showing PUFA production from the wild-type Leptolyngbya sp. BL0902 cyanobacteria and the aforementioned transgenic combinations. However, in this case, the data is expressed as % of a given PUFA relative to the total fatty acid concentration.
  • Figures 6A and 6B are a pair of graphs showing the concentrations of individual PUFAs expressed as mass per dry weight ⁇ g/mg; 6A) or % of total FAs (6B) produced by wild-type (WT) and transgenic Anabaena sp. PCC7120 cyanobacteria. Plasmids introduced into the Anabaena sp. cyanobacteria are identical to those used in Leptolyngbya sp. BL0902 cyanobacteria as shown in Figs. 3-5.
  • the transgenic bacteria include bacteria transformed with a plasmid expressing the delta 6 desaturase enzyme (delta6), the delta 15 desaturase enzyme (deltal5), a combination of the delta 6 desaturase enzyme and the thylakoid- promoting protein Vippl (delta6, VIPP1), a combination of the delta 15 desaturase enzyme and Vippl (deltal5, VIPP1), and a combination of the delta 6 desaturase enzyme, the delta 15 desaturase enzyme and Vippl (delta6, deltal5, VIPP1).
  • FIG 7 shows thin layer chromatography analysis of the wild type (WT, "A") and the delta 6, delta 15, and Vippl transgenic strain of BL0902 (+ ⁇ 6, ⁇ 15, VIPP1, "B”). These indicate that the bacteria contain a high abundance of glycolipids including the galactolipids, mono (MGDG)- and digalactosyl-diglycerides (DGDG).
  • WT wild type
  • MGDG galactolipids
  • DGDGDG digalactosyl-diglycerides
  • Figure 8 is a plasmid map of the 13,611 basepair (bp) plasmid that includes the pAM44148 expression vector described in Taton et al. (2012) that contains both the lad repressor gene and trc promoter from E. coli, as well as synthetic genes for expression of the delta 6 ( ⁇ 6) desaturase and omega 3 (a>3) desaturase (also referred to herein and in the Figures and text as delta 15 desaturase) and the vesicle-inducing protein in plasmids (Vippl).
  • ⁇ 6 delta 6
  • omega 3 a>3 desaturase
  • Vippl vesicle-inducing protein in plasmids
  • the delta- 15 desaturase is more correctly termed an omega-3 desaturase as the target site for the introduced double bond is 3 carbons from the methyl end of the fatty acid.
  • the enzyme is also called the deltal5 desaturase, referencing the standard C-18 fatty acid, but the enzyme recognizes the methyl end of the fatty acid unlike the delta-6 desaturase, for example, which recognizes the carboxyl end.
  • Exogenous gene refers to a nucleic acid sequence that codes for the expression of an RNA and/or protein that has been introduced into a cell (e.g. by transformation/transfection), and is also referred to as a "transgene".
  • a cell comprising an exogenous gene can be referred to as a recombinant cell, into which additional exogenous gene(s) can be introduced.
  • the exogenous gene can be from a different species (and so heterologous), or from the same species (and so homologous), relative to the cell being transformed.
  • an exogenous gene can include a homologous gene that occupies a different location in the genome of the cell or is under different control, relative to the endogenous copy of the gene.
  • An exogenous gene can be present in more than one copy in the cell.
  • An exogenous gene can be a natural gene, e.g., excised from a natural source, or can be synthesized.
  • operable linkage In operable linkage, “operably linked”, and grammatical variations thereof are used interchangeably herein to refer to a functional linkage between two nucleic acid sequences, such as a control sequence (typically a promoter) and the linked sequence (typically a sequence that encodes a protein, also called a coding sequence).
  • a promoter is in operable linkage with an exogenous gene if it can mediate transcription/expression of the gene.
  • a “profile” refers to the distribution of particular chemical species within the composition. In some embodiments, a “profile” refers to a % of a given PUFA relative to the total fatty acid concentration.
  • percent sequence identity in the context of two or more amino acid or nucleic acid sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted using the NCBI BLAST software (ncbi.nlm.nih.gov/BLAST/) set to default parameters.
  • NCBI BLAST software ncbi.nlm.nih.gov/BLAST/
  • BLAST 2 Sequences Version 2.0.12 (Apr. 21, 2000) set at the following default parameters: Matrix: BLOSUM62; Reward for match: 1; Penalty for mismatch: -2; Open Gap: 5 and Extension Gap: 2 penalties; Gap.times.drop- off: 50; Expect: 10; Word Size: 11; Filter: on.
  • BLAST 2 Sequences Version 2.0.12 (Apr. 21, 2000) with blastp set, for example, at the following default parameters: Matrix: BLOSUM62; Open Gap: 11 and Extension Gap: 1 penalties; Gap.times.drop-off 50; Expect: 10; Word Size: 3; Filter: on.
  • Recombinant is a cell, nucleic acid, protein or vector that has been modified due to the introduction of an exogenous nucleic acid or the alteration of a native nucleic acid.
  • recombinant cells can express genes that are not found within the native (non- recombinant) form of the cell or express native genes differently than those genes are expressed by a non-recombinant cell (e.g., overexpress a gene).
  • Recombinant cells can, without limitation, include recombinant nucleic acids that encode for a gene product or for suppression elements such as mutations, knockouts, antisense, interfering RNA (RNAi) or dsRNA that reduce the levels of active gene product in a cell.
  • RNAi interfering RNA
  • a "recombinant nucleic acid” is a nucleic acid originally formed in vitro, in general, by the manipulation of nucleic acid, e.g., using polymerases, ligases, exo nucleases, and endonucleases, using chemical synthesis, or otherwise is in a form not normally found in nature.
  • Recombinant nucleic acids may be produced, for example, to place two or more nucleic acids in operable linkage.
  • an isolated nucleic acid or an expression vector formed in vitro by ligating DNA molecules that are not normally joined in nature are both considered recombinant for the purposes of the presently disclosed subject matter.
  • a recombinant nucleic acid Once a recombinant nucleic acid is made and introduced into a host cell or organism, it may replicate using the in vivo cellular machinery of the host cell; however, such nucleic acids, once produced recombinantly, although subsequently replicated intracellularly, are still considered recombinant for purposes of the presently disclosed subject matter.
  • a "recombinant protein” is a protein made using recombinant techniques, i.e., through the expression of a recombinant nucleic acid.
  • a recombinant vector comprising a nucleic acid sequence encoding thylakoid- promoting protein Vippl and at least one nucleic acid sequence encoding a desaturase.
  • the recombinant vector comprises a nucleic acid sequence encoding a thylakoid-promoting protein Vippl, a nucleic acid sequence encoding ⁇ 6 desaturase, a nucleic acid sequence encoding a>3 (delta 15) desaturase, or any combination thereof.
  • the recombinant vector comprises a heterologous promoter operably linked to a nucleic acid sequence encoding a thylakoid-promoting protein Vippl, a nucleic acid sequence encoding ⁇ 6 desaturase, and/or a nucleic acid sequence encoding a>3 desaturase.
  • the recombinant vector comprises a backbone sequence affording compatibility with a plurality of microorganisms.
  • the recombinant vector comprises a nucleic acid sequence encoding a thylakoid-promoting protein Vippl, a nucleic acid sequence encoding ⁇ 6 desaturase, and a nucleic acid sequence encoding a>3 desaturase operably oriented so that each polypeptide will be expressed.
  • the culture in a suitable culture where each polypeptide is expressed, the culture produces a greater amount of one or more lipid compositions than does a control culture identical in all respects except that the polypeptides are not expressed or not expressed to a degree that they are expressed in the test culture.
  • the recombinant vector comprises one or more nucleic acid sequence(s) comprising one or more sequences affording expression or transcription control, such as a promoter sequence, a repressor sequence, a terminator sequence, a transcription blocking sequence, and combinations thereof.
  • the recombinant vector comprises a nucleic acid sequence coding for a selectable marker, such as antibiotic resistance.
  • a recombinant vector in accordance with the presently disclosed subject matter comprises a plasmid.
  • a recombinant vector optimized for transformation of and/or expression in a microorganism is provided.
  • the microorganism is a cyanobacterium, a diverse phylum of oxygenic phototrophs in the kingdom bacteria.
  • the cyanobacterium is in the order Gloeobacterales.
  • the cyanobacterium is in the order Chroococcales.
  • the cyanobacterium is in the order Nostocales.
  • the cyanobacterium is in the order Oscillatoriales.
  • the cyanobacterium is in the order Pleurocapsales. In some embodiments, the cyanobacterium is in the order Prochlorales. In some embodiments, the cyanobacterium is in the order Stigonematales. In some embodiments, the cyanobacterium is unicellular. In some embodiments, the cyanobacterium is filamentous heterocystous. In some embodiments, the cyanobacterium is filamentous non-heterocystous. In some embodiments, the cyanobacterium is a freshwater strain. In some embodiments, the cyanobacterium is a marine strain.
  • the cyanobacterium is a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc, Phormidium, Spirulina, Synechococcus, or Synechocystis.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl , the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding a a>3 desaturase is a natural gene sequence. In some embodiments, the nucleic acid sequence encoding a thylakoid-promoting protein Vippl, the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding a a>3 desaturase is a synthetic gene sequence.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or co3 desaturase is/are homologous with respect to a microorganism to be transformed with the recombinant vector. In some embodiments, the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or a>3 desaturase is/are heterologous with respect to a microorganism to be transformed with the recombinant vector.
  • the thylakoid-promoting protein Vippl is encoded by a nucleic acid sequence comprising SEQ ID NO: 1.
  • the nucleic acid sequence can comprise any other sequence that encodes an amino acid sequence comprising SEQ ID NO:6.
  • the desaturase is encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs: 2 and 3 or another nucleic acid sequence that encodes an amino acid sequence as set forth in SEQ ID NO:5 or SEQ ID NO:7.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and a>3 desaturase are each encoded by a single nucleic acid sequence, such as a nucleic acid sequence comprising SEQ ID NO: 4.
  • the nucleic acid sequence can be any other single nucleic sequence that encodes each of SEQ ID NOs: 5, 6, and 7, wherein the nucleic acid sequences encoding SEQ INOs: 5, 6, and 7 can be arranged in any order within the larger nucleic acid sequence.
  • a recombinant vector in accordance with the presently disclosed subject matter comprises a coding sequence comprising a nucleotide sequence of any of SEQ ID NOs: 1-4; or a coding sequence comprising a nucleotide sequence substantially identical to any of any of SEQ ID NOs: 1-4.
  • a recombinant vector in accordance with the presently disclosed subject matter comprises a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any of SEQ ID NOs: 1-4.
  • a recombinant vector in accordance with the presently disclosed subject matter comprises a coding sequence comprising a nucleotide sequence that encodes an amino acid sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any of SEQ ID NOs: 5-7.
  • the representative recombinant vector is a 13,611 bp plasmid that includes the pAM44148 expression vector describe in Taton et al. (2012) that contains both the lacl repressor and trc promoter from E. coli, as well as synthetic genes for the delta 6 ( ⁇ 6) and omega 3 (a>3) desaturases and the vesicle-inducing protein in plasmids (Vippl).
  • lipid compositions comprising stearidonic acid, gammalinolenic acid (GLA), and/or 8,11 ,14,17 eicosatetraenoic acid (C20:4 co3, or co3 ETA).
  • GLA gammalinolenic acid
  • C20:4 co3, or co3 ETA 8,11 ,14,17 eicosatetraenoic acid
  • C20:4 co3, or co3 ETA lipid compositions comprising stearidonic acid, gammalinolenic acid (GLA), and/or 8,11 ,14,17 eicosatetraenoic acid (C20:4 co3, or co3 ETA).
  • Stearidonic acid SDA; C18:4, an omega-3 fatty acid
  • DHA and EPA (longer shelf life, higher quality pure product).
  • SDA is much more efficiently converted to the longer chain omega-3 PUFAs (compared to its precursor, alpha-linolenic acid, ALA).
  • GLA Gamma-linolenic acid
  • GLA is an omega-6, 18-carbon PUFA found in human milk and several botanical seed oils (borage [-21 % GLA], black currant [-17% GLA] and evening primrose [-9% GLA]), and is typically consumed as a part of a dietary supplement.
  • Numerous in vitro and in vivo animal models have shown that GLA- supplemented diets attenuate various inflammatory responses (Sergeant et al., Eur J Pharmacol. 2016 Aug 15; 785 :77-86).
  • Omega-3 ETA (a>3 ETA) is a very rare 20-carbon fatty acid that has been shown to be a potent inhibitor of inflammatory mechanisms induced by its omega-6 counterpart, 5,8,11 ,14 eicosatetraenoic acid (or a>6 arachidonic acid). For example, it has been shown to inhibit enzymes involved in the uptake of a>6 arachidonic acid into cells and the metabolism of a>6 arachidonic acid to prostaglandins and thromboxanes via cyclooxygenase. See Simpoulos, Am. J Clin Nutr. 1991, 55 :438-463 ; Ringbom et al., J Nat Prod.
  • lipid compositions in accordance with the presently disclosed subject matter are used as additives to food, including food for humans and for animal feed.
  • a lipid composition having a particular lipid profile is provided.
  • a "profile" refers to a % of a given PUFA relative to the total fatty acid concentration or total a>3 fatty acid concentration.
  • a lipid composition is provided, having a lipid profile comprising at least about 8% (e.g., at least about 8, 10, 12, 14, 16, 18, 20, 21 , 22, 23, or 24%) stearidonic acid (SDA).
  • SDA stearidonic acid
  • a lipid composition is provided having a lipid profile comprising at least about 10% (e.g., at least about 10, 12, 14, 16, 18, 20, 21, 22, 23, 24, or 25%) GLA.
  • a lipid composition having a lipid profile comprising at least about 9% (e.g., at least about 9, 10, 12, 14, 16, 18, 20, 21, 22, 23, 24, or 25%) ALA.
  • a lipid composition with a lipid profile comprising at least one or more omega-3 (a>3) fatty acids selected from the group comprising cc-linolenic acid (ALA), stearidonic acid (SDA), and/or co3ETA, optionally wherein the lipid profile comprises at least about 23%, at least about 24%, at least about 25%, at least about 30%, or at least about 35% of the co3 fatty acids.
  • the lipid profile comprises at least about 9% ALA, at least about 15% (e.g., 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, or 24% SDA, and/or any detectable amount of a>3 ETA, such as at least about 1 , 2, 3, 4, or 5% 0)3 ETA.
  • a lipid composition having a lipid profile comprising at least about 25% or more cc-linolenic acid (ALA), and optionally, a lipid profile comprising at least about 33% or more ALA is provided.
  • a lipid composition is provided having any detectable amount of a>3 ETA, such as at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10% 0)3 ETA, including 4-10% ⁇ 3 ETA.
  • a lipid composition in accordance with the presently disclosed subject matter has a lipid profile characterized by a significant amount of a>3 PUFAs conjugated to polar lipids, such as phospholipids and/or glycolipids.
  • polar lipids such as phospholipids and/or glycolipids.
  • the glycolipids are present in a greater amount than other lipids such as phospholipids and triglycerides.
  • MGDG monogalactosyl diglycerides
  • DGDG digalactosyl diglycerides
  • PUFAs including a>3 FAs
  • MGDG and DGDG are more soluble and can be extracted by supercritical fluid extraction.
  • recent human studies show a>3 PUFAs in galactolipids are more bioavailable in humans than phospholipids found in Krill oils. See Kagan et al., Lipids in Heath and Disease, 12: 102 (2013).
  • lipids in a lipid composition of the presently disclosed subject matter are co3 PUFAs complexed to DGDG and/or to MGDG.
  • a lipid composition in accordance with the presently disclosed subject matter is produced by a modified microorganism.
  • the microorganism is a cyanobacterium, a diverse phylum of oxygenic phototrophs in the kingdom bacteria.
  • the cyanobacterium is in the order Gloeobacterales.
  • the cyanobacterium is in the order Chroococcales.
  • the cyanobacterium is in the order Nostocales.
  • the cyanobacterium is in the order Oscillatoriales.
  • the cyanobacterium is in the order Pleurocapsales.
  • the cyanobacterium is in the order Prochlorales. In some embodiments, the cyanobacterium is in the order Stigonematales. In some embodiments, the cyanobacterium is unicellular. In some embodiments, the cyanobacterium is filamentous heterocystous. In some embodiments, the cyanobacterium is filamentous non-heterocystous. In some embodiments, the cyanobacterium is a freshwater strain. In some embodiments, the cyanobacterium is a marine strain.
  • the cyanobacterium is a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc (e.g., Nostoc commune), Phormidium (e.g., Phormidium valderianum), Spirulina, Synechococcus or Synechocystis.
  • Nostoc e.g., Nostoc commune
  • Phormidium e.g., Phormidium valderianum
  • Spirulina Synechococcus or Synechocystis.
  • the presently disclosed subject matter provides a modified microorganism, for example an engineered cyanobacterium, as a source of a>3 PUFAs and omega-6 PUFAs, such as but not limited to ALA, SDA and ETAco3.
  • the modified microorganism comprises a recombinant vector in accordance with the presently disclosed subject matter.
  • a modified microorganism in accordance with the presently disclosed subject matter comprises a first exogenous gene encoding thylakoid-promoting protein Vippl, wherein the modified microorganism further comprises at least a second exogenous gene encoding a desaturase; wherein the modified microorganism produces a lipid in a greater amount than does a control microorganism identical in all respects except that it does not include the first exogenous gene encoding thylakoid- promoting protein Vippl and the second exogenous gene encoding a desaturase.
  • the modified microorganism comprises at least two exogenous genes encoding a desaturase, wherein each gene encodes a different desaturase.
  • the desaturase is a ⁇ 6 desaturase or an a>3 desaturase.
  • the first desaturase is a ⁇ 6 desaturase and the second desaturase is an a>3 desaturase.
  • the various gene constructs as disclosed herein are integrated into the host genome.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl, the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding an a>3 desaturase is a natural gene sequence. In some embodiments, the nucleic acid sequence encoding a thylakoid-promoting protein Vippl, the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding an a>3 desaturase is a synthetic gene sequence.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or co3 desaturase is/are homologous with respect to the modified microorganism. In some embodiments, the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or a>3 desaturase is/are heterologous with respect to the modified microorganism.
  • the thylakoid-promoting protein Vippl is encoded by a nucleic acid sequence comprising SEQ ID NO: 1, or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1 and/or any nucleic acid sequence that encodes SEQ ID NO:6 or an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:6.
  • the desaturase is encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs: 2 and 3, or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 2 or 3 and/or to a nucleic acid sequence that encodes SEQ ID NO:5 or SEQ ID N07 or an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:5 or SEQ ID NO:7.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and a>3 desaturase are each encoded by a nucleic acid sequence comprising SEQ ID NO: 4 or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4.
  • the Vippl, ⁇ 6 desaturase and a>3 desaturase are each encoded by another nucleic acid that encodes each of SEQ ID NO:6, SEQ ID NO: 5, and SEQ ID NO: 7, wherein the coding sequences for SEQ ID NOs: 6, 5, and 7 are arranged in any order within the larger sequence.
  • a lipid composition in accordance with the presently disclosed subject matter is produced by a modified microorganism.
  • the microorganism is a cyanobacterium, a diverse phylum of oxygenic phototrophs in the kingdom bacteria.
  • the cyanobacterium is in the order Gloeobacterales.
  • the cyanobacterium is in the order Chroococcales.
  • the cyanobacterium is in the order Nostocales.
  • the cyanobacterium is in the order Oscillatoriales.
  • the cyanobacterium is in the order Pleurocapsales.
  • the cyanobacterium is in the order Prochlorales. In some embodiments, the cyanobacterium is in the order Stigonematales. In some embodiments, the cyanobacterium is unicellular. In some embodiments, the cyanobacterium is filamentous heterocystous. In some embodiments, the cyanobacterium is filamentous non-heterocystous. In some embodiments, the cyanobacterium is a freshwater strain. In some embodiments, the cyanobacterium is a marine strain.
  • the cyanobacterium is a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc (e.g., Nostoc commune), Phormidium (e.g., Phormidium valderianum), Spirulina, Synechococcus or Synechocystis.
  • modified microorganisms in accordance with the presently disclosed subject matter are used as nutraceuticals (including but not limited to pharmaceuticals, dietary supplements, medical foods and functional foods) and/or additives to food, including food for humans and for animal feed (e.g., feed for fish, such as Tilapia, and/or for other animals, such as fowl, swine and cattle).
  • the modified microorganisms can be use in aquaculture. Representative formulation techniques and administration approaches are disclosed in U.S. Patent No. 8,343,753, which is incorporated herein by reference in its entirety.
  • the presently disclosed subject matter provides a method of culturing a lipid-producing microorganism.
  • the method comprises: providing a culture of a modified microorganism that comprises an exogenous gene encoding thylakoid-promoting protein Vippl and at least one exogenous gene encoding a desaturase in a suitable culture medium under conditions in which the exogenous gene encoding the thylakoid-promoting protein Vippl and the exogenous gene encoding the desaturase are expressed.
  • the culture produces a greater amount and a greater proportion of selected a>6 PUFAs such as GLA and a>3 PUFAs such as ALA, SDA, and ETAco3 than does a culture comprising a control microorganism identical in all respects except that it does not include the exogenous gene encoding the thylakoid-promoting protein Vippl and at least one exogenous gene encoding a desaturase.
  • the modified microorganism comprises a recombinant vector in accordance with the presently disclosed subject matter.
  • the modified microorganism comprises at least two exogenous genes encoding a desaturase, wherein each gene encodes a different desaturase.
  • the first desaturase is ⁇ 6 desaturase and the second desaturase is a a>3 desaturase.
  • the nucleic acid sequence encoding a thylakoid-promoting protein Vippl, the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding a a>3 desaturase is a natural gene sequence. In some embodiments, the nucleic acid sequence encoding a thylakoid-promoting protein Vippl, the nucleic acid sequence encoding a ⁇ 6 desaturase, and/or the nucleic acid sequence encoding an a>3 desaturase is a synthetic gene sequence.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or co3 desaturase is/are homologous with respect to the modified microorganism. In some embodiments, the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and/or a>3 desaturase is/are heterologous with respect to the modified microorganism.
  • the thylakoid-promoting protein Vippl is encoded by a nucleic acid sequence comprising SEQ ID NO: 1, or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1 and/or by a coding sequence comprising a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO: 6 or an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:6.
  • the desaturase is encoded by a nucleic acid sequence comprising a sequence selected from the group comprising SEQ ID NOs: 2 and 3, or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 2 or 3.
  • the desaturase is encoded by a coding sequence comprising a nucleic acid sequence that encodes an amino acid sequence comprising SEQ ID NO:5 or SEQ ID NO:7 or an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:5 or SEQ ID NO:7.
  • the thylakoid-promoting protein Vippl, ⁇ 6 desaturase, and a>3 desaturase are each encoded by a nucleic acid sequence comprising SEQ ID NO: 4 or by a coding sequence comprising a nucleotide sequence that is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4.
  • the Vippl, ⁇ 6 desaturase and a>3 desaturase are each encoded by a coding sequence comprising a nucleic acid that encodes each of SEQ ID NO:6, SEQ ID NO: 5, and SEQ ID NO: 7, or an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:6, SEQ ID NO:5 or SEQ ID NO:7, wherein the respective coding sequences for a particular polypeptide are arranged in any order within the larger sequence.
  • the modified microorganism is a cyanobacterium, a diverse phylum of oxygenic phototrophs in the kingdom bacteria.
  • the cyanobacterium is in the order Gloeobacterales.
  • the cyanobacterium is in the order Chroococcales.
  • the cyanobacterium is in the order Nostocales.
  • the cyanobacterium is in the order Oscillatoriales.
  • the cyanobacterium is in the order Pleurocapsales.
  • the cyanobacterium is in the order Prochlorales.
  • the cyanobacterium is in the order Stigonematales.
  • the cyanobacterium is unicellular. In some embodiments, the cyanobacterium is filamentous heterocystous. In some embodiments, the cyanobacterium is filamentous non-heterocystous. In some embodiments, the cyanobacterium is a freshwater strain. In some embodiments, the cyanobacterium is a marine strain. In some embodiments, the cyanobacterium is a species of Anabaena, Leptolyngbya, Lyngbya, Nostoc (e.g., Nostoc commune), Phormidium (e.g., Phormidium valderianum), Spirulina, Synechococcus or Synechocystis.
  • Anabaena Leptolyngbya, Lyngbya, Nostoc (e.g., Nostoc commune), Phormidium (e.g., Phormidium valderianum), Spirulina, Synechococcus or Synecho
  • the method further comprises extracting a lipid composition from the culture.
  • a modified microorganism (or a processed product and/or extract thereof) and/or a lipid composition in accordance with the presently disclosed subject matter can be used as a food product, a dietary supplement, a medical food, a nutraceutical, a pharmaceutical, a functional food or animal feed additive.
  • compositions, methods, and kits for the prophylactic and/or therapeutic treatment of a disease or condition in particular a cardiovascular or inflammatory disease or a condition involving a psychological or neurodevelopmental disorder.
  • Representative formulation techniques and administration approaches are disclosed in U.S. Patent No. 8,343,753, which is incorporated herein by reference in its entirety.
  • the phrase "therapeutically effective amount” refers to an amount of a compound or composition that is sufficient to produce the desired effect, which can be a therapeutic or agricultural effect.
  • the therapeutically effective amount will vary with the application for which the compound or composition is being employed, the microorganism and/or the age and physical condition of the subject, the severity of the condition, the duration of the treatment, the nature of any concurrent treatment, the pharmaceutically or agriculturally acceptable carrier used, and like factors within the knowledge and expertise of those skilled in the art.
  • An appropriate "therapeutically effective amount” in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation. (See, for example for pharmaceutical applications, Remington, The Science And Practice of Pharmacy (9th Ed. 1995).)
  • the presently disclosed subject matter additionally provides methods for treating a mammalian disease in a subject in need thereof by administration to said subject a therapeutically effective amount of the compositions of the presently disclosed subject matter.
  • the mammalian diseases that are treated include, but are not limited to, cardiovascular diseases and inflammatory diseases.
  • the cardiovascular diseases to be treated include, but are not limited to, hypertriglyceridemia, coronary heart disease, stroke, acute myocardial infarction and atherosclerosis.
  • the inflammatory diseases to be treated include, but are not limited to, asthma, arthritis, allergic rhinitis, psoriasis, atopic dermatitis, inflammatory bowel diseases, Alzheimer's disease, Crohn's disease, and allergic rhinoconjunctitis.
  • the mammalian diseases to be treated include psychiatric disorders. Psychiatric disorders include, but are not limited to, depression, bipolar disorder, schizophrenia.
  • the compositions of the presently disclosed subject matter can be used to maintain and/or enhance cognitive function and prevent and/or treat brain inflammation.
  • the term "subject” refers to any animal (e.g., avian, fish or mammal), including, but not limited to, humans, non-human primates, birds, and the like, which is to be the recipient of a particular treatment.
  • the terms "subject” and “patient” are used interchangeably herein, such as but not limited to a mammalian or avian subject.
  • Illustrative avians according to the presently disclosed subject matter include chickens, ducks, turkeys, geese, quail, pheasant, ratites (e.g., ostrich), domesticated birds (e.g., parrots and canaries), and birds in ovo.
  • Fish of the presently disclosed subject matter include, but are not limited to, salmon, tilapia, carp, trout, bream, catfish, bass, sturgeon, and the like.
  • Mammals of the presently disclosed subject matter include, but are not limited to, canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g. rats and mice), lagomorphs, primates (including non-human primates), humans, and the like, and mammals in utero. Any mammalian subject in need of being treated according to the presently disclosed subject matter is suitable. According to some embodiments of the presently disclosed subject matter, the mammal is a non-human mammal.
  • the mammal is a human subject.
  • Mammalian subjects of both genders and at any stage of development i.e., neonate, infant, juvenile, adolescent, adult
  • microorganisms can be genetically modified wherein endogenous or exogenous lipid biosynthesis pathway enzymes are expressed or overexpressed.
  • Steps to genetically engineer a microbe to alter its fatty acid profile as to the degree and location in the carbon backbone of fatty acid unsaturation and to decrease or increase fatty acid chain length comprise the design and construction of a transformation vector (e.g., a plasmid), transformation of the microbe with one or more vectors, selection of transformed microbes (transformants), growth of the transformed microbe, and analysis of the fatty acid profile and distribution of complex lipids produced by the engineered microbe.
  • a transformation vector e.g., a plasmid
  • Genomic DNA from Shewanella woodyi is purchased from the American Type Culture Collection, then PCR is used to amplify the regions of interest (ORFs 2 and 8, of 833 and 1631 bp, respectively, are individually amplified; ORFs 5, 7 and 8 are in tandem on a single 16.6 kb of DNA and are amplified in 4 fragments).
  • Each PCR fragment includes a slightly overlapping segment with respect to the next fragment so that they can be mixed together with linearized plasmid vector, annealed, ligated and transformed into E. coli (or done in a more stepwise fashion).
  • a low copy number plasmid is employed for the initial cloning steps.
  • the construct is sequenced in its entirety to ensure that there are no mistakes; if there are, additional PCR is conducted to replace "cassettes" within the DNA or mutagenesis is conducted to generate the wild type sequence. Incorporation of plasmid into Leptolyngbya sp. is confirmed by PCR, and samples are tested for EPA and other fatty acid synthesis as described elsewhere herein.
  • Synechocystis sp. PCC 6803 has the ⁇ 6 desaturase gene, but does not grow very quickly.
  • Synechococcus sp. PCC 7002 does not have the ⁇ 6 desaturase gene, but does have the a>3 desaturase gene, and is claimed to grow as fast as 2 hr doubling time. However, this strain was not so "fast growing”.
  • cyanobacteria were modified by the overexpression of acyl-lipid desaturase genes, and a thylakoid membrane synthesis control protein (where PUFAs and photosynthetic complexes are localized).
  • the host cyanobacterial strains used for engineered expression of the target genes are Leptolyngbya sp. strain BL0902 (Taton et al, (2012), PLoS 7(l):e30901) and Anabaena sp. strain PCC 7120, because they typically are used for molecular biology/bioengineering and have been observed to grow well.
  • Leptolyngbya sp. strain BL0902 was chosen due to its use in the Taton et al. (2012) paper describing the molecular biology tools developed for bioengineering of this cyanobacterium (especially the expression plasmid pAM4418, see below).
  • the expression vector used was pAM4418 described by Taton et al (2012).
  • pAM4418 is a broad host range, E. co/z ' -cyanobacteria shuttle plasmid that confers resistance to streptomycin and spectinomycin, and contains both the lacl q repressor and the trc promoter from E. coli.
  • the plasmid contains a Gateway recombination cassette, which allows for gene transfer from a Gateway donor plasmid, placing the gene under the control of the trc promoter.
  • Taton et al (2012) showed that the trc promoter was active in Leptolyngba BL0902, but expression was not controlled by the lac repressor, that is, expression appeared to be constitutive.
  • the genes for synthetic ⁇ 6 desaturase and a>3 desaturase were amplified from the GenScript clones by PCR using primers which added the sequence CACC before the initiating ATG codon. This allows directional cloning of the PCR product into the Gateway donor plasmid, pENTR/SD/D-topo (Invitrogen), which provides an upstream Shine-Dalgarno sequence (ribosome-binding site) that is known to function in cyanobacteria.
  • the downstream primers for both genes contained Xhol restriction sites; in combination with an Ascl site in the pENTR/SD/D-topo plasmid this allows for addition of the vippl gene following the desaturase gene.
  • the vippl gene synthesized by Genscript contains a Xhol site at the 5' end and HmdIII plus Ascl sites at the 3' end. After digestion with Xhol and Ascl, the vippl gene was cloned following the desaturase genes in the pENTR/SD/D-topo clones. In order to create a donor plasmid containing both ⁇ 6 and a>3 desaturase genes and vip l, the a>3 desaturase gene was PCR amplified from the original pUC57 clone using a 5' primer containing HmdIII site plus a ribo some-binding site in combination with a 3' primer containing an Ascl restriction site.
  • the PCR product was digested with HmdIII and Ascl and ligated into the pENTR/SD/D-topo clone containing genes to express ⁇ 6 desaturase and Vippl, digested with the same two restriction enzymes.
  • the inserts of all 7 plasmids were sequenced and the genes found to have the correct sequences.
  • the inserts from these 7 plasmids were transferred into the E. co/z ' -cyanobacterial shuttle expression vector pAM4418 using the Gateway recombination system (Invitrogen) based on the site-specific recombination system of lambda bacteriophage. This was achieved using Invitrogen' s LR Clonase II Enzyme Mix.
  • the resultant pAM4418 clones were screened by restriction digest to identify the correct plasmids.
  • plasmids were then used to transform E.coli DH10B cells containing the conjugal plasmid, pRL443 and the helper plasmid, pRL623. These resulting strains were grown overnight in rich LB media, washed with fresh LB media and finally resuspended in BG-11 media (media that is used for growth of the two cyanobacteria in this report) as a 10- fold concentrated stock. Cultures of the two cyanobacteria were grown to late exponential phase, harvested by centrifugation and washed twice with fresh BG-11 media, before resuspension as a 4-fold concentrated stock.
  • cyanobacterial suspensions were treated for 10 min in a sonicator bath to reduce the length of the multicellular strands, before being mixed with aliquots of the DH10B transformants.
  • the cell mixtures were centrifuged, resuspended in 200 of BG-11 media and incubated for 1 hour at 30 °C, before being spread on an agar plate containing BG-11 and 5 % LB. After 24 hours incubation in low light at 30°C, the cells were washed off and spread on selective plates containing 2 ⁇ g/mL spectinomycin and streptomycin.
  • FIG. 3 shows that introduction of the genes expressing delta 6 desaturase, the a>3 desaturase (delta 15), Vippl or gene combinations (delta 6, Vippl; delta 15, Vippl ; delta 6, delta 15, Vippl) markedly increased the concentration of total fatty acids within the bacteria.
  • Figure 4 illustrates that introduction of the genes to express delta 6 desaturase, the a>3 desaturase (delta 15), or Vippl, or combinations of these genes (delta 6, Vippl; delta 15, Vippl; delta 6, delta 15, Vippl) elevated the concentrations of polyunsaturated fatty acids (PUFAs) within the bacteria.
  • PUFAs polyunsaturated fatty acids
  • Vippl in cyanobacteria, plants and other microorganisms. It is known to be a lipid transfer protein and has been suggested to enhance the production of thylakoid membranes but has not been shown to affect the level of fatty acid unsaturation in cells.
  • Vippl and delta 6 desaturase produced a bacterium highly enriched in GLA.
  • Expression of Vippl and delta 15 desaturase produced a bacterium highly enriched in ALA.
  • the combination of all three genes expressed from a single plasmid produced bacteria highly enriched in omega-3 PUFAs including ALA, SDA, and co3ETA, with a particular enrichment in SDA.
  • almost 5% of the total fatty acids was ETAco3.
  • ETAco3 is extremely promising as a therapeutic, but extremely rare in nature.
  • Figure 7 shows the distribution of complex lipids including glycerolipids and glycolipids.
  • the 40 base-pair sequence upstream of the vippl gene is identical to the sequence upstream of the PCC 6803 atpE gene.
  • atpE encodes the FiF 0 ATP synthase subunit c, which is present in a higher copy number than the other subunits, while being translated from a polycistronic operon.
  • the sequence upstream of the atpE gene was shown to be responsible for the enhanced translation needed to provide the higher copy number of subunit c.
  • the corresponding region upstream of atpE from E.coli has previously been used to increase expression of genes from plasmids in E.coli.
  • restriction enzyme sites used for the construction are in bolded double underlined and in italics.
  • Sub-sequence including the coding sequence for ⁇ 6 desaturase i.e.4-1084 of SEQ ID NO:
  • Sub-sequence including the coding sequence for Vippl (i.e.47-849 of SEQ ID NO:l), aaaaattATGGGCTTCCTGGACCGTCTGGGCCGTGTCGTGAAAGCGAACCTGAATGATATGGTGTCGA AAGCAGAAGACCCGGAAAAAATCCTGGAACAGGCAGTCGCTGATATGGGCGAAAGCCTGGTCCAACTG CGTCAGTCTGTGGCGCGTGCGATTGCGGCCCAGAAGAAAACCGAACAGCAACTGATCAAAAACCAAAC CGAAGCGACCACGTGGCAGAAGAAAGCGGAACTGGCCATTAAAAATGGTCGTGAAGATCTGGCACGCG AAGCTCTGGTTCGTAAGAAAACCTTTGCAGACACGGCAGCTGTCCTGCAGCAACAGCTGACGCAACAG AACGCCCAAGTTAAAACCCTGAAAATCTGCTGGCACTGGAAATCCATCCAGCCAAACCGCG AAGCTCTGGTTCGTAAGAAAACCTTTGCAGACACGGCAGCT
  • Sub-sequence including the coding sequence for a>3 desaturase (i.e.1-1053 of SEQ ID NO:
  • SEQ ID NO:4 is an exemplary construction of a nucleic acid sequence that encodes each of the ⁇ 6 desaturase, the a>3 desaturase, and Vippl. See also Figure 8.
  • Other constructions can include the coding sequences for the two desaturases and vippl in other orders and/or with other non-coding intervening sequences.
  • Other constructions can also include more than one copy of the coding sequence(s) of any or all of the ⁇ 6 desaturase, the co3 desaturase, and Vippl.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des vecteurs recombinés, des micro-organismes modifiés et des procédés de production d'acides gras polyinsaturés oméga-3.
EP17853981.3A 2016-09-23 2017-09-22 Micro-organismes modifiés utilisés comme sources durables de production d'acides gras polyinsaturés oméga-3 Withdrawn EP3516066A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662398604P 2016-09-23 2016-09-23
PCT/US2017/052938 WO2018057879A1 (fr) 2016-09-23 2017-09-22 Micro-organismes modifiés utilisés comme sources durables de production d'acides gras polyinsaturés oméga-3

Publications (1)

Publication Number Publication Date
EP3516066A1 true EP3516066A1 (fr) 2019-07-31

Family

ID=61690045

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17853981.3A Withdrawn EP3516066A1 (fr) 2016-09-23 2017-09-22 Micro-organismes modifiés utilisés comme sources durables de production d'acides gras polyinsaturés oméga-3

Country Status (3)

Country Link
US (1) US10941385B2 (fr)
EP (1) EP3516066A1 (fr)
WO (1) WO2018057879A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113897324B (zh) * 2021-10-13 2023-07-28 云南师范大学 一种用作抗锰剂的JcVIPP1重组大肠杆菌及其构建方法

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BRPI0717474A2 (pt) * 2006-10-20 2014-03-11 Arizona Board Of Regentes For And On Behalf Of Arizona State University Cianobactéria modificada
US20130323801A1 (en) 2007-11-01 2013-12-05 Wake Forest University School Of Medicine Compositions, Methods, and Kits for Polyunsaturated Fatty Acids from Microalgae
AU2008320328B2 (en) * 2007-11-01 2014-10-02 Frutarom Limited Lipid mixture for infant nutrition
EP2358882B1 (fr) 2008-11-18 2017-07-26 Commonwealth Scientific and Industrial Research Organisation Enzymes et méthodes de production d'acides gras oméga-3

Also Published As

Publication number Publication date
WO2018057879A1 (fr) 2018-03-29
US10941385B2 (en) 2021-03-09
US20190367889A1 (en) 2019-12-05

Similar Documents

Publication Publication Date Title
Xue et al. Production of omega-3 eicosapentaenoic acid by metabolic engineering of Yarrowia lipolytica
US6410288B1 (en) Methods and compositions for synthesis of long chain poly-unsaturated fatty acids
AU2010273508B2 (en) Novel delta9-elongase for production of polyunsaturated fatty acid-enriched oils
US10017796B2 (en) Transgenic microalgae with increased production of at least one omega-3 long chain polyunsaturated fatty acid
JP2010524468A (ja) Δ９エロンガーゼおよび多価不飽和脂肪酸の作成におけるそれらの使用
JP2009521213A (ja) トランス−１０，シス−１２オクタデカジエン酸を製造する方法
Li et al. Characterization, mRNA expression and regulation of Δ6 fatty acyl desaturase (FADS2) by dietary n− 3 long chain polyunsaturated fatty acid (LC-PUFA) levels in grouper larvae (Epinephelus coioides)
Yoshino et al. Production of ω3 fatty acids in marine cyanobacterium Synechococcus sp. strain NKBG 15041c via genetic engineering
Al-Hoqani et al. The biotechnological potential of Nannochloropsis
US20130323801A1 (en) Compositions, Methods, and Kits for Polyunsaturated Fatty Acids from Microalgae
US10941385B2 (en) Modified microorganisms as sustainable sources of omega-3 polyunsaturated fatty acid production
Tu et al. An alternative n-3 fatty acid elongation pathway utilising 18: 3n-3 in barramundi (Lates calcarifer)
Oboh Investigating the long-chain polyunsaturated fatty acid biosynthesis of the African catfish Clarias gariepinus (Burchell, 1822)
US10968437B2 (en) Factors for the production and accumulation of polyunsaturated fatty acids (PUFAs) derived from PUFA synthases
AU2022275509A1 (en) Methods for producing biomass rich in DHA, palmitic acid and protein using a eukaryotic microorganism
US20240100168A1 (en) Lipid compositions and methods of preparation thereof
CN100460506C (zh) 一种ω-3脂肪酸去饱和酶及其编码基因与应用
Chodok et al. Metabolic engineering and oil supplementation of Physcomitrella patens for activation of C 22 polyunsaturated fatty acid production
JP7372647B2 (ja) α‐リノレン酸産生能が向上した酵母またはその培養物
Zárate et al. Healthy omega-3 enhancement in Echium acanthocarpum transformed hairy roots by overexpression of a 6-desaturase gene from Primula vialli
Sun Functional Analysis of Dehydratase Domains of a Polyunsaturated fatty acid Synthase from Thraustochytrium sp. by Mutagenesis
Suhaimi et al. Expansion of omega-3 polyunsaturated fatty acid metabolism of the oleaginous diatom Fistulifera solaris by genetic engineering
Happe et al. Eukaryotic microalgae in biotechnological applications
백석현 Association Study between Phospholipid Profile and SNPs Related to Fatty Acid Metabolism in Hanwoo Beef
Lippmeier THE UNIVERSITY OF HULL

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20190423

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 1/20 20060101ALI20200922BHEP

Ipc: C12N 1/21 20060101ALI20200922BHEP

Ipc: C12P 21/00 20060101AFI20200922BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20210401