Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/158—Expression markers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

• the present invention relates to the field of diagnostics.
• the invention relates to a method for determining whether a smoker is at risk of developing coronary artery disease (CAD), atherosclerosis or cardiovascular disease.
• CAD coronary artery disease
• cardiovascular disease cardiovascular disease
• MI myocardial infarction
• the invention is based on the find that elevated levels of miR-124-3p are associated with subclinical atherosclerosis in smoking individuals.
• the inventors found that miR-124-3p was differentially expressed in smokers compared to non-smoking individuals. All non-smoking individuals had a low miR-124-3p expression level, whereas miR-124-3p expression was quite heterogeneous in smoking individuals (Fig 1A).
• the inventors observed that in a cohort of smoking and former smoking individuals an increase in miR-124-3p expression level was related to a higher risk of subclinical atherosclerosis (OR 2.36; 95%
• the invention provides a method for determining the risk of suffering from or developing coronary artery disease (CAD), atherosclerosis or a cardiovascular disease of a smoker, comprising:
• said biological sample comprises whole blood, isolated monocytes.
• said CAD is subclinical atherosclerosis.
• said method further comprising assessing the expression level of a further expression marker in the smoker; and determining said risk based on the expression level of miR-124-3p and said further expression marker.
• said expression marker is selected from the group consisting of CD206, CD29 and CD45RA.
• said method further comprising assessing a clinical factor of the smoker, wherein said clinical factor is associated with an increased risk of suffering from or developing CAD,
• said clinical factor is selected from the group consisting of: age, gender, chest pain type, neutrophil count, ethnicity, disease duration, diastolic blood pressure, systolic blood pressure, a family history parameter, cholesterol level, diabetes, use of medication, a medical history parameter, a medical symptom parameter, height, weight, a body-mass index, CAC score, and resting heart rate.
• said expression level of said miRNA is normalized using one or more reference miRNAs.
• said one or more reference miRNAs is selected from the group consisting of consisting of miR-130b and miR-342-3p.
• the method comprising a step of amplifying miR-124-3p using reverse amplification and determining the amount of amplified products.
• the invention further provides a kit of parts, comprising at least one molecule capable of specifically binding to at least one miRNA selected from the group consisting of miR-124-3p, miR-130b and miR- 342-3p, and optionally one or more controls and/or one or more standards.
• Figure 1 shows microarray miR-124-3p expression in monocytes of smoking and non-smoking individuals. It shows MiR-124-3p expression in non-smokers, individuals that stopped smoking ⁇ 5 years ago and current smokers in (Fig. 1A) Cohort I and (Fig. IB) Cohort II. Triangles represent patients with atherosclerosis, whereas hexagons represent healthy controls.
• Figure 2 shows the correlation between miR-124-3p expression and monocyte surface markers.
• Fig 2A CD45RA, classical monocytes
• Fig. 2B CD29, non-classical monocytes
• Fig. 2C CD206, classical monocytes
• Fig. 2D CD29, intermediate monocytes
• Pearson correlation coefficient (r) and p-value of the log transformed monocyte surface marker and miRNA expression (log transformed) are displayed as well as the log- regression line.
• Figure 3 shows the expression of monocyte surface markers after transfection with a miR-124-3p mimic. Expression of monocyte function markers after human monocyte induction with IL-4 and transfection with a miR-124-3p mimic.
• coronary artery disease or "CAD” encompasses all forms of atherosclerotic disease affecting the coronary arteries.
• CAD coronary artery disease
• arteriosclerosis refers to a form of arteriosclerosis in which deposits of yellowish plaques containing cholesterol, lipoid material , and lipophages are formed within the intima and innner media of large and medium-sized arteries.
• cardiovascular disease is a disease of the blood vessels of the circulation system caused by abnormally high concentrations of lipids in the vessels.
• subclinical atherosclerosis refers to an illness of an individual not exhibiting clinical symptoms, most preferably chest pain or ECG changes, indicative of stable angina, unstable angina, and/or myocardial infarction.
• the term "smoker” as used herein means a human that has smoked in the past 5 years.
• said smoker is a current smoker.
• said smoker has smoked at least 100 smokable tobacco products in his/her lifetime and preferably currently smokes tobacco every day (daily) or some days (nondaily).
• non-smoker as used herein means a human that has not smoked in the past 5 years.
• biological sample refers to a sample obtained from an individual.
• the sample may be of any biological tissue, cells or fluid.
• samples include, but are not limited to, sputum, blood, serum, plasma, blood cells (e.g., white cells), tissue, nipple aspirate, core or fine needle biopsy samples, cell-containing body fluids, free floating nucleic acids, urine, peritoneal fluid, and pleural fluid, or cells there from.
• Biological samples may also include sections of tissues such as frozen or fixed sections taken for histological purposes or microdissected cells or extracellular parts thereof.
• determining the level of a certain miRNA in a sample means assaying a test sample, e.g. a biological sample from a patient, in vitro to determine the concentration or amount of the miRNA in the sample. Any convenient qualitative, semi-quantitative or, preferably, quantitative detection method for determining nucleic acids can be used to determine the concentration or amount of the miRNA in the sample. A variety of methods for determining nucleic acids are well known to those of skill in the art, e.g. determination by nucleic acid hybridization and/or nucleic acid amplification. Exemplary methods to determine the concentration or amount of the miRNA in the sample are provided below.
• expression level refers to a value that represents a direct, indirect, or comparative measurement of the level of expression of a nucleotide (e.g., RNA or DNA) or polypeptide.
• expression level can refer to a value that represents a direct, indirect, or comparative measurement of the RNA expression level of a miRNA marker of interest.
• miR-124-3p or “hsa-miR-124-3p” as used herein refers to a miRNA having the nucleic acid sequence of UAAGGCACGCGGUGAAUGCC (SEQ ID NO: l).
• reference level or “reference value” as used herein refers to the level of expression of miR- 124-3p which is indicative for the risk a smoker of suffering from coronary artery disease (CAD), atherosclerosis or cardiovascular disease.
• CAD coronary artery disease
• atherosclerosis or cardiovascular disease.
• reference miRNA refers to a miRNA which is stably expressed in the cells of the biological sample.
• RNA may be extracted from the sample prior to miRNA processing for detection.
• RNA may be purified using a variety of standard procedures as described, for example, in RNA Methodologies, A laboratory guide for isolation and characterization, 2nd edition; 1998, Robert E. Farrell, Jr., Ed., Academic Press.
• miRNeasyTM kit Qiagen
• MagMAXTM kit Life Technologies
• Pure LinkTM kit Life Technologies
• mirVANATM miRNA Isolation Kit Ambion
• small molecular weight RNAs may be isolated by organic extraction followed by purification on a glass fiber filter.
• Alternative methods for isolating miRNAs include hybridization to magnetic beads.
• CAD coronary artery disease
• atherosclerosis cardiovascular disease
• cardiovascular disease is based on comparing the expression level(s) of the miRNAs in the smoker's biological sample with those obtained using relevant controls.
• a person skilled in the art may choose a control suitable for this purpose, including but not limited to internal standards, samples of purified monocytes from subjects known to be suffering from coronary artery disease (CAD), atherosclerosis or cardiovascular disease. It is not necessary to determine both the reference value and the test value at the same time.
• a reference value preferably using a sample from a subject not suffering from, or at risk of suffering from, a coronary artery disease (CAD), atherosclerosis or cardiovascular disease, and use said reference value over and over again to determine whether or not the relative expression of miR-124-3p in a test sample is indicative for a smoker at risk of suffering from coronary artery disease (CAD), atherosclerosis or cardiovascular disease.
• CAD coronary artery disease
• cardiovascular disease cardiovascular disease
• a level of expression that has been shown to be indicative for cardiovascular disease or for a high risk of suffering from a cardiovascular disease.
• Such reference value is for instance obtained using a sample of an individual suffering from a coronary artery disease (CAD), atherosclerosis or cardiovascular disease. It is thus possible to determine whether a subject is at risk of suffering from a coronary artery disease (CAD), atherosclerosis or cardiovascular disease, by comparing the level of expression of any of the above mentioned miRNA in a sample of the smoker with the level of expression in a sample of a healthy individual or with the level of expression in a sample of an individual suffering from a cardiovascular disease.
• CAD coronary artery disease
• CAD coronary artery disease
• cardiovascular disease a subject which is already diagnosed with cardiovascular disease and/or has an increased risk relative to the normal population of suffering from cardiovascular disease.
• a level of expression which is comparable with that of a healthy individual is indicative for said subject being not at risk of a coronary artery disease (CAD), atherosclerosis or cardiovascular disease.
• CAD coronary artery disease
• Atherosclerosis or cardiovascular disease is indicative for said subject being at risk of suffering from cardiovascular disease.
• the levels of expression are preferably less than 1.8 fold different, more preferably less than 1.5 fold different, more preferably less than 1.3 fold different, most preferably less than 1.2 fold different.
• the step of determining whether a smoker is at risk of developing coronary artery disease (CAD), atherosclerosis or cardiovascular disease may suitably be based on the information obtained by comparison between the expression level with a reference level.
• the expression level of the analysed miRNA when statistically analysed will have a threshold whereby expression levels of the individual miRNAs below or above the threshold are indicative for respectively the presence or absence of CAD, atherosclerosis or cardiovascular disease.
• Threshold miRNA levels for each of the analysed miRNAs can be determined by any suitable algorithm. Such an algorithm may involve classifying a sample between smokers who suffer from a coronary artery disease (CAD), atherosclerosis or cardiovascular disease and healthy control group.
• CAD coronary artery disease
• samples may be classified on the basis of threshold values, or based upon Mean and/or Median miRNA levels in smokers suffering from CAD, atherosclerosis or cardiovascular disease versus non-smokers (e.g., a cohort from the general population or a patient cohort with diseases unrelated to CAD, atherosclerosis or cardiovascular disease).
• Various classification schemes are known for classifying samples between two or more groups, including Decision Trees, Logistic Regression, Principal Components Analysis, Naive Bayes model, Support Vector Machine model, and Nearest Neighbour model.
• the predictions from multiple models can be combined to generate an overall prediction.
• the miRNA expression level (miRNA signature, level, or miRNA concentration) is generated (determined) from (in) the biological-sample using any of various methods known in the art for quantifying miRNA levels.
• methods include polymerase-based assays, such as Real-Time PCR (e.g., TaqmanTM), hybridization-based assays, for example using microarrays (e.g. miRNome microRNA Profilers QuantiMir Human PCR array (Biocat)), nucleic acid sequence based
• NASBA flap endonuclease -based assays
• direct RNA capture with branched DNA QuantiGeneTM
• Hybrid CaptureTM Hybrid CaptureTM
• nCounterTM miRNA detection nanostring
• the assay format in addition to determining the miRNA levels will also allow for the control of, inter alia, intrinsic signal intensity variation.
• Such controls may include, for example, controls for background signal intensity and/or sample processing, and/or hybridization efficiency, as well as other desirable controls for quantifying miRNA levels across samples (e.g., collectively referred to as "controls").
• RNA sequences may be reverse transcribed and amplified using the polymerase chain reaction (PCR) in order to facilitate detection. In these cases, it will actually be DNA and not RNA that is directly quantitated.
• PCR polymerase chain reaction
• complement refers to an oligonucleotide that has an exactly complementary sequence, i.e. for each adenine there is a thymine, etc.
• the method of the invention can further comprise determining the level of one or more normalization control(s) in the sample.
• the sample is spiked with the normalization control(s).
• the normalization control is a non-endogenous RNA or miRNA, or a miRNA not expressed in the sample.
• the normalization control may be one or more exogenously added RNA(s) or miRNA(s) that are not naturally present in the biological sample, e.g. an RNA or miRNA from another organism, and/or one or more human miRNAs not expressed in the sample-sample undergoing analysis.
• said level of the miRNA of the invention is normalized using one or more reference miRNAs which are stably expressed in whole blood.
• said one or more reference miRNAs is selected from the group consisting of miR- miR-130b and miR-342-3p.
• the miRNA level (or miRNA concentration) is preferably determined by an amplification-and/or hybridization-based assay.
• the amplification- and/or hybridization-based assay can be quantitative miRNA real-time polymerase chain reaction (RT-PCR), e.g. TaqMan.
• RT-PCR quantitative miRNA real-time polymerase chain reaction
• the miRNA level may also be determined by preparing cDNA, followed by RT-PCR.
• all variant sequences having at least 70, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or greater identity to said marker sequence.
• the percentage of sequence identity may be determined using algorithms well known to those of ordinary skill in the art, including, e.g., BLASTn, and BLASTp, as described in Stephen F. Altschul et al, J. Mol. Biol. 215:403-410 (1990) and available at the National Center for
• a method according to the invention comprising determining whether the level of expression of said miRNA in said biological sample is at least 1.50 fold increased relative to the level of expression of said miRNA in a sample of a healthy individual not at risk of cardiovascular disease. In a more preferred embodiment, it is determined whether said level of expression is at least 1.55, more preferably at least 1.60, more preferably at least 1.65, more preferably at least 1.75, most preferably at least 1.85 fold increased.
• a condition can include one clinical factor or a plurality of clinical factors.
• the invention can include assessing a clinical factor in a subject and combining the assessment with an analysis of the first dataset (see above) to identify risk of CAD atherosclerosis or cardiovascular disease in the smoker.
• a clinical factor can be included within a dataset, e.g., the first dataset.
• a dataset can include one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, twenty-three or more, twenty-four or more, twenty-five or more, twenty-six or more, twenty- seven or more, twenty-eight or more, twenty-nine or more, or thirty or more overlapping or distinct clinical factor(s).
• a clinical factor can be, for example, the condition of a subject in the presence of a disease or in the absence of a disease.
• a clinical factor can be the health status of a smoker.
• a clinical factor can be age, gender, chest pain type, neutrophil count, ethnicity, disease duration, diastolic blood pressure, systolic blood pressure, a family history parameter, a medical history parameter, a medical symptom parameter, height, weight, a body- mass index, and resting heart rate.
• Clinical factors can include whether the subject has stable chest pain, whether the subject has typical angina, whether the subject has atypical angina, whether the subject has an anginal equivalent, whether the subject has been previously diagnosed with MI, whether the subject has had a revascularization procedure, whether the subject has diabetes, whether the subject has an inflammatory condition, whether the subject has an infectious condition, whether the subject is taking a steroid, whether the subject is taking an immunosuppressive agent, and/or whether the subject is taking a chemo therapeutic agent.
• the invention further provides a kit for quantifying the amount of miR-124-3p in a biological sample comprising an amplification primer set, comprising at least one primer comprising a sequence that is complementary to a portion of miR-124-3p.
• the miRNA level (or miRNA concentration) is preferably determined by an amplification-and/or hybridization-based assay.
• the amplification- and/or hybridization-based assay can be quantitative miRNA real-time polymerase chain reaction (RT-PCR), e.g. TaqMan.
• RT-PCR quantitative miRNA real-time polymerase chain reaction
• the miRNA level may also be determined by preparing cDNA, followed by RT-PCR.
• the kit for determining the risk of suffering from or developing a coronary artery disease (CAD), atherosclerosis or a cardiovascular disease of a smoker according to the invention may comprise means for determining the concentration (expression level) of miR-124-3p in a biological sample from a subject.
• the means for determining the concentration of miR-124-3p may be TaqMan probes.
• the kit may comprise an enzyme for cDNA preparation (e.g.
• the kit may further comprise include a reagent for miRNA isolation from samples.
• the kit can also comprise one or more normalization control(s).
• the normalization control(s) can, for example, be provided as one or more separate reagent(s) for spiking samples or reactions.
• the normalization control(s) is/are selected from non-endogenous RNA or miRNA, or a miRNA not expressed in the sample.
• said kit comprises a specific primer for reverse transcribing or amplifying one or more reference miRNAs is selected from the group consisting of miR-130b and miR-342-3p.
• a specific primer for reverse transcribing or amplifying one or more reference miRNAs is selected from the group consisting of miR-130b and miR-342-3p.
• the design of oligonucleotide probes specific for miR-124-3p, miR-130b and miR-342-3p; or miRNA-specific primers for reverse transcribing or amplifying each of miR-124-3p, miR-130b and miR-342-3p to detect their expression levels (concentrations) in accordance with suitable assay formats is well known to those of skill in the art, and appropriate probes and/or primers can be commercially purchased.
• Cohorts Cohort I consisted of 40 male premature coronary artery disease (CAD) patients and 40 age- matched male controls.
• Premature CAD was defined as a first cardiovascular event before the age of 51. These individuals might have a genetic predisposition for atherosclerosis, which may be accelerated by smoking. Patients between the age of 35 and 65 years who had a premature cardiovascular event and were willing to participate were included from the outpatient clinic for premature CAD in the Academic Medical Center in Amsterdam between December 2009 and June 2010. Sample collection was performed on average 5.6 ⁇ 3.5 years after the first cardiovascular event. Control individuals were recruited by advertisement and were matched for age. Controls were eligible for participation if they did not have a personal or family history for CAD and did not use any medication.
• CAD premature coronary artery disease
• Cohort II consisted of 4 families with a high prevalence of premature CAD, of which CAD patients were treated at the outpatient clinic for premature CAD. From these families we included 21 patients with established CAD and 46 apparently healthy family members. All family members were screened at the outpatient clinic and underwent a coronary CT-scan to assess the coronary calcification score (CAC) as a marker for premature CAD.
• This group also included subjects under the age of 30 years, in whom no CAC score was measured. Since atherosclerosis is usually not as pronounced at a young age, CAC score determination is not sensitive enough in those individuals and therefore a low CAC score will not rule out the presence of advanced atherosclerosis.
• Cohort TV consisted of 71 FDRs of subjects with premature CAD that visited the outpatient clinic for risk assessment between April 2010 and May 2013. We only selected smoking FDRs or FDRs that quit smoking ⁇ 5 years ago. Of these FDRs, 39 individuals had a CAC score >80 ⁇ percentile corrected for age and gender and were considered as having subclinical atherosclerosis. The remaining 32 FDRs had a CAC score of zero and were considered healthy controls.
• Cohort V consisted of 65 non-smoking FDRs of subjects with premature CAD. Selection criteria were similar to those in cohort IV. Of these FDRs, 28 individuals had a CAC score >80 th percentile corrected for age and gender and were considered as having subclinical atherosclerosis. The remaining 37 FDRs had a CAC score of zero and were considered healthy controls. Sample collection and processing
• circulating monocytes were isolated from peripheral blood samples.
• Non-fasting venous blood was drawn in CTAD tubes (Becton Dickinson, Alphen aan de Rijn, the Netherlands) and centrifuged for 20 minutes at 163 g at 20°C.
• the buffy coat was collected and monocytes were positively selected with CD14+ Dynal beads (Invitrogen, Dynal Biotech, Oslo, Norway) according to the manufacturer's instructions. Monocytes were incubated in RNA later (Ambion) for 45 minutes.
• ice-cold PBS was added in a 1: 1 volume ratio and the samples were centrifuged for one minute at 5000 g, after which monocytes were obtained and snap- frozen in liquid nitrogen.
• Monocyte RNA was isolated using the ra rVana PARIS kit (Ambion, Inc.), according to the manufacturer's protocol.
• monocytes were isolated from fresh whole blood samples through density centrifugation using LymphoprepTM (Axis-Shield).
• CD 14+ monocytes were isolated using human CD 14 magnetic beads (Miltenyi) and MACS® cell separation columns
• RNA 6000 Pico kit Agilent Technologies
• Small RNA kit Agilent Technologies
• RNA including microRNAs 100 ng of total RNA including microRNAs was dried down in a Centrivap concentrator (Labconco) and dissolved in 2 ⁇ RNase-free water.
• Sample labeling with Cy3 was performed as described in the miRNA Microarray System with miRNA Complete Labeling and Hyb Kit manual version 2.2 (Agilent Technologies) with the inclusion of spike -ins and the optional desalting step with spin columns (Micro Bio-Spin 6, Bio-Rad). Labeled samples were hybridized on Human 8x15k miRNA microarrays based on Sanger miRBase release 19.0 containing 866 human and 89 human viral miRNAs (G4470C, Agilent Technologies) at 55°C and 20 rpm for 20 hours.
• Microarrays for cohort I and II were pre-processed and analysed separately. A two-step normalisation approach was taken. In the first step, we corrected for systematic technical effects in the raw probe- level data as extracted via the Agilent Feature Extraction software. For this purpose, we fitted a linear mixed-effects model with coefficients for two technical effects (slide and slide position, that is, upper or lower half of a slide), and patient status using the R/MAANOVA package. Residuals after correcting for the two technical effects were further pre-processed and summarized using a modified version of the robust multi-array average (RMA) method with background correction, as implemented in the AgiMicroRna R package 14 . Quality control was performed using the arrayQualityMetrics R package.
• RMA robust multi-array average
• Monocytes were gated using a protocol that was adapted from a previous study 15 . Briefly, cells were first plotted on a FCS/SSC plot and a first gate (A) was drawn to exclude the majority of debris, residual red blood cells and granulocytes. These cells were next viewed on a CD14/CD16 plot to gate CD 14+ and/or CD 16+ cells (B). When cells from gate B were viewed on a CD16/HLA-DR plot, monocytes (gate C) were easily distinguished from contaminating cells ('not monocytes').
• the final monocyte population was viewed again on a CD14/CD16 plot to gate CD14++/CD16-, CD14++/CD16+ and CD14dim/CD16+ monocyte subsets.
• Human monocytes were isolated from Buffy coats (Sanquin) via density centrifugation and CD 14+ beads isolation as described above, cultured in IMDM complete (25mM HEPES + 10% Fetal Calf Serum, +1% L-glutamine, +1% penicillin streptomycin) and stimulated half of the cells with 50ng/ml MCSF (Miltenyi). On day 6, cells were transferred to a 12-wells plate in a density of 1 ⁇ 10 6 cells/ml.
• monocytes and macrophages were transfected with 20 ⁇ miRIDIAN hsa-miR-124-3p mimic (Dharmacon, cat# C-300592-05) or 20 ⁇ negative control #1 mimic (Dharmacon, cat# CN- 001000-01-05) using the Lipofectamine 2000 transfection reagent (Invitrogen) in triplicate.
• Quantitative PCR MiR-124-3p specific reverse transcription was performed on lOOng of purified total RNA, including miRNAs, using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Gent, Belgium). RT-qPCR reactions were carried out in duplicate, on a LightCycler 480 system II (Roche, Basel, Switzerland). Data were analysed using LinRegPCR quantitative PCR data analysis software, version 11 16 MiR-124-3p expression was normalized to the geometric mean of a previously established miRNA normalization panel for whole blood samples consisting of miR-130b and miR-342-3p 17 .
• CD29 and CD45RA mRNA expression in monocytes and macrophages from the mimic experiment. qPCR was performed using SYBR Green according to the manufacture's instructions. Statistical analysis
• Results are expressed as mean ⁇ standard deviation, except when indicated otherwise. Student's t-tests and Chi-square tests were used to calculate differences in baseline characteristics. Variables with a skewed distribution, e.g. the miRNA expression levels, were log transformed before they were analysed. We used Pearson correlation to analyze the correlation between miRNA expression levels and monocyte surface markers.
• Flow cytometry analysis reveals a correlation between miR-124-3p expression and monocyte surface markers Since miR-124-3p was heterogeneously expressed within the group of smoking individuals in both independent microarray cohorts, we tested whether miRNA 124-3p expression in smoking individuals was associated with the expression of monocyte surface markers. To investigate this, we performed flow cytometry on whole blood of subjects from Cohort III and gated for monocytes. We correlated the expression of the monocyte surface markers to the miR-124- 3p expression in isolated monocytes as determined by RT-qPCR. Baseline characteristics of Cohort III are displayed in Table 1. In individuals with a high miR-124-3p expression we observed an increase in the monocyte surface marker CD45RA, CD29 and CD206.
• ( 1)29 is part of the LH integrin very late antigen-4 (VLA-4) which is also present on activated monocytes 19 .
• CD206 or the mannose receptor is a marker of the alternatively activated (M2) macrophages 20 .
• CD206 and CD64 are up regulated after stimulation of human macrophages with a miR-124-3p mimic
• miR-124-3p did not change after incubation with IL-4. This implies that in human monocytes and macrophages, miR-124-3p results in altered surface marker expression through a pathway independent of IL-4. CD29 and CD45RA mRNA expression is not altered after stimulation of human macrophages with a miR-124-3p mimic
• CD29 and CD45RA expression was upregulated in monocytes of individuals with high miR-124-3p expression of Cohort III, but not after monocyte and macrophage transfection with a miR-124-3p mimic. We hypothesized that this could be due to the short duration of incubation with the mimic. Alterations in mRNA expression might be ahead of surface marker expression. Therefore, we determined CD29 and CD45RA mRNA expression in human monocytes and macrophages transfected with a miR-124-3p mimic. In this experiment we did not observe differences in mRNA expression between miR-124-3p transefected cells and controls. MiR-124-3p expression levels in whole blood predict risk of subclinical atherosclerosis in smokers
• miR-124-3p was heterogeneously expressed in circulating monocytes of smoking individuals and that high levels of miR-124-3p correlated with changes in monocyte surface markers, we hypothesized that an increase in miR-124-3p expression is related to subclinical atherosclerosis. Therefore, we related whole blood miR-124-3p expression levels to coronary calcium abnormalities as measured by coronary CT scanning. We choose to analyse this in whole blood samples for practical reasons, since isolated monocytes are not easily obtained in clinical daily practice.
• miR-124-3p expression is heterogeneously expressed in monocytes of smoking individuals in two independent cohorts and that expression of miR-124-3p positively correlates with the expression of the surface markers CD29, CD45RA and CD206, suggesting a potential role for miR-124-3p in the development of atherosclerosis. Finally, we showed that elevated levels of miR-124-3p are associated with subclinical atherosclerosis in smoking individuals.
• miR-124-3p was heterogeneously expressed in monocytes of smoking individuals, whereas in non-smokers miR-124-3p expression was low.
• MiR-124 levels were previously reported to be elevated in plasma of smoking individuals 11 .
• Banerjee and colleagues a dose -dependent effect on miR-124 expression was reported, with an increase in miR-124-3p expression with each additionally smoked cigarette.
• miR-124-3p expression was low in non-smokers.
• a dose-dependent effect of cigarette smoke was not specifically analysed, but it could very well be that the heterogeneous expression reflects the dose-dependent effect that was reported by Banerjee.
• CD45RA protein tyrosine phosphate receptor C
• PPRC protein tyrosine phosphate receptor C
• VLA-4 Bl integrin very late antigen-4
• VCAM-1 vascular cell adhesion molecule 1
• CD206 or the mannose receptor
• M2 macrophages are generally known as anti-inflammatory, their presence has been described in various stages of the atherosclerotic plaque 5 ' 26 . It was previously shown that miR-124 up regulation in bone-marrow derived mouse macrophages was associated with a shift from the Ml to the M2 macrophage phenotype 27 . Subsequently, monocytes stimulation with IL-4 and IL-13 to obtain M2 macrophages, resulted in high miR-124 expression and up regulation of CD206 expression 13 .
• inflammatory macrophages produce reactive oxygen species that induce and exacerbate oxidative stress in the atherosclerotic plaque . Furthermore, they secrete the cytokine IL-6 that enhances atherogenesis .
• the regulation of both Ml and M2 markers on macrophages transfected with a miR-124-3p mimic indicates that up regulation of miR-124-3p does not result in a polarization towards a single macrophage subtype, but rather identifies miR-124-3p as a complex regulator of
• miR-124-3p is elevated in monocytes of smoking individuals and that increased miR-124-3p levels are associated with pro-atherogenic changes in monocyte phenotype
• miR-124-3p expression levels could be used as a biomarker for subclinical atherosclerosis in smoking individuals. For this purpose, we determined miR-124-3p levels in two independent cohorts of smoking and non-smoking individuals. The analysis revealed that in smoking individuals an increase in miR-124-3p levels was associated with a 2.36-fold increased risk of having subclinical atherosclerosis, whereas no such association was observed in non-smoking individuals.
• miR-124-3p was heterogeneously expressed among smoking individuals, whereas high miR-124-3p was associated with an increased risk of having subclinical atherosclerosis in Cohort IV. This suggests a susceptibility for the adverse effects of smoking and may explain why several smoking individuals never develop cardiovascular complaints. Therefore, miR-124-3p is a suitable whole blood biomarker for subclinical atherosclerosis in smoking individuals.
• miR-124-3p expression is heterogeneously expressed in monocytes of smoking individuals in two independent cohorts. Phenotypical analyses of these monocytes revealed that elevated miR-124-3p levels are associated with the expression of the pro-atherogenic surface markers CD29 and CD45RA, suggesting a potential role for miR-124-3p in the development of atherosclerosis. Moreover, we showed that an increase in miR-124-3p levels in whole blood is associated with subclinical atherosclerosis in smoking individuals and could therefore be used as a suitable biomarker in these individuals, thus identifying individuals with a susceptibility for the adverse effects of smoking.
• Cigarette smoking substantially alters plasma
• Banerjee A Waters D, Camacho OM, et al. Quantification of plasma microRNAs in a group of healthy smokers, ex-smokers and non-smokers and correlation to biomarkers of tobacco exposure. Biomarkers. 2015;00: 1-9.
• the adhesion molecules used by monocytes for migration across endothelium include CD1 la/CD18, CD1 lb/CD18, and VLA-4 on monocytes and ICAM-1, VCAM-1, and other ligands on endothelium. J Immunol. 1995;154:4099-112.
• Continuous data are expressed as mean ⁇ SD, categorical data as absolute number with (percentages).N, number, SD standard deviation, * p ⁇ 0.05 compared to cases.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Analytical Chemistry (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Pathology (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=54364100

Family Applications (1)

Country Status (2)

Families Citing this family (2)

Family Cites Families (2)

• 2016
  • 2016-10-24 EP EP16787799.2A patent/EP3365463A1/de not_active Withdrawn
  • 2016-10-24 WO PCT/EP2016/075588 patent/WO2017068198A1/en not_active Ceased

Also Published As

Similar Documents

Legal Events