EP2723902A1 - Behandlung und diagnose epigenetischer störungen und erkrankungen - Google Patents
Behandlung und diagnose epigenetischer störungen und erkrankungenInfo
- Publication number
- EP2723902A1 EP2723902A1 EP12803257.0A EP12803257A EP2723902A1 EP 2723902 A1 EP2723902 A1 EP 2723902A1 EP 12803257 A EP12803257 A EP 12803257A EP 2723902 A1 EP2723902 A1 EP 2723902A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- intron
- seq
- methylation
- nucleotide sequence
- epigenetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Definitions
- the present disclosure relates generally to the field of epigenetics and in particular epigenetic profiles associated with a pathological condition.
- the present specification teaches screening of individuals and populations for epigenetic profiles associated with a pathological condition. Kits and diagnostic assays are also taught herein as are computer programs to monitor changes in epigenetic patterns and profiles. Further enabled herein are methods for screening for agents which reduce or mask the adverse effects of epigenetic modification and the use of these agents in therapy and prophylaxis.
- Epigenetic modifications include histone modification, changes in acetylation, methylation, obiquitylation, phosphorylation, sumoylation, activation or deactivation, chromatin altered transcription factor levels and the like.
- Another genetic condition which can affect gene expression arises from expansion or increase in the number of repeats in a specific tandem repeat array. Such nucleotide expansion can result in repeat expansion disease conditions.
- a critical threshold of repeat expansion determines the level of pathologenicity (Orr and Zoghbi (2007) Ann Rev Neurosci J0:575-621).
- Many diseases arise from expansion of a repeat located in an open reading frame resulting in a protein with a long polyQ 2 tract that is toxic to neurons (Orr and Zoghbi, 2007 supra).
- FXS Fragile X syndrome
- FAAXE Fragile XE mental retardation
- Fragile type Fragile type
- folic acid type rare 12
- MR mental retardation
- FRDA Friedrich's ataxia
- DM myotonic dystrophy
- a particular type of expansion disorder is referred to as a trinucleotide repeat disorder (also known as trinucleotide repeat expansion disorder, triplet repeat expansion disorder and codon reiteration disorder) and results from trinucleotide repeats in certain genetic loci.
- a trinucleotide repeat disorder also known as trinucleotide repeat expansion disorder, triplet repeat expansion disorder and codon reiteration disorder
- FMR genetic locus Fragile X Mental Retardation genetic locus
- the FMR genetic locus includes the FMR1 gene which is composed of 17 exons, spanning 38Kb, and encodes Fragile X Mental Retardation Protein (FMRP), essential for normal neurodevelopment (Verkerk et al. (1991 ) Cell 65f5,):905-914; Terracciano et al, (2005) Am J Med Genet C Semin Med Genet 137C(l) 32-37).
- a CGG repeat segment is located within the 5' untranslated region (UTR) of the gene. Its normal range is ⁇ 40 repeats.
- FXS Fragile X syndrome
- FXTAS Fragile X-associated Tremor Ataxia Syndrome
- FXPOI Fragile X-associated primary ovarian insufficiency
- FXS is neurodevelopmental in nature with a frequency of 1/1400 males and 1/8000 females, associated with a Fragile site at the Xq27.3 locus (Jin and Warren (2000) Hum. Mol. Genet 9(6):9Q 1-908).
- This syndrome is caused by a CGG expansion to "full mutation” (FM) which comprises >200 repeats, leading to a gross deficit of FMRP and subsequent synaptic abnormalities (Pieretti et al. ( 1991 ) Cell 66(4): ⁇ 1 -%22 Irwin et al. (2000) Cereb Cortex 70( 0): 1038- 1044).
- FM full mutation
- the FXS clinical phenotype ranges from learning disabilities to severe mental retardation and can be accompanied by a variety of physical and behavioral characteristics.
- FXTAS is prevalent in -30% of premutation individuals (PM), comprising - 55 to 199 repeats (Nolin et al.
- FXTAS can occur in females carrying PM, but with much lower frequency as can be expected from X-linked inheritance.
- the intermediate or Gray Zone (GZ) alleles comprising 41 to 54 repeats (Bodega et al. (2006) Hum Reprod 21(4) :952-957) are the most common form of the expansion, 1 in 30 males and 1 in 15 females.
- GZ Gray Zone
- increased levels of FMR1 mRNA have been reported in the GZ individuals, proportional to the size of CGG expansion (Kenneson et al. (2001 ) Hum Mol Genet I 0(74/.14491454; Mitchell et al. (2005) Clin Genet 67 ⁇ :38-46; Loesch el al.
- Expansion related abnormalities in FMR1 are involved in pathologies with a wide spectrum of patho-mechanisms all pointing to involvement of multiple factors at the Xq27.3 locus in addition to FMR1.
- a number of antisense transcripts have been described embedded within the FMR1 sequence, ASFMRl (Ladd et al. (2007) Hum Mai Genet 76(2 ⁇ :3174-3187) and FMR4 (Khalil et al. (2008) PLoS ONE 5(7>:e l 486).
- the ASFMRl and FMR4 transcripts have been suggested to share the bi-directional promoter with FMR1 , which is heavily regulated by the state of the surrounding chromatin environment (Pietrobono et al. (2002) Nucleic Acids Res 50 ⁇ :3278-3285; Chiurazzi et a/.(1998) Hum Mol Genet 7( ,1: 1091 13).
- ASFMRl Transcription of ASFMRl is also regulated by another promoter located in the exon 2 of FMR1 , with the resulting transcript spanning the CGG repeat in the antisense direction (Ladd et al. (2007) supra), and an open reading frame (ORF) with the CGG encoding a polyproline peptide (Ladd et al. (2007) supra).
- FMR4 is a long non- coding RNA, involved in regulation of apoptosis (Khalil et al. (2008) supra).
- FM human females only 25% of all FM human females can be classified as intellectually disabled (Boyle and Kaufmann (2010) Am J Med Genet C Semin Med Genet 154C(4) A69- 16). Between 30% and 50% of FM human females carry the abnormal allele predominantly on the inactive X chromosome and have a normal IQ (de Vries et al. (1996) Am J Hum Genet 5 ⁇ : 1025-1032; Taylor et al. (1994) Jama 27 ](7):507 -514). Up to 25% of all FM carriers are either unmethylated/partially methylated FM carriers or CGG repeat mosaics.
- Methylation sensitive Southern blot analysis combined with PCR is the current 'gold standard' for molecular diagnosis of the Fragile X Syndrome (FXS), providing information on the size of the CGG expansion, as well as the methylation status of the FMRl promoter (Pieretti et al. (1991) supra).
- FXS Fragile X Syndrome
- the FMRl activation ratio which is the proportion of the normal size allele on the active X chromosome, can be also determined using this approach (de Vries et al. (1996) supra).
- SEQ IN NO: Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ IN NO:).
- the SEQ ID NOs: correspond numerically to the sequence identifiers ⁇ 400>1 (SEQ ID NO: l), ⁇ 400>2 (SEQ ID NO:2), etc.
- a summary of sequence identifiers is given in Table 1.
- aspects enabled herein are predicated in part on the determination of an association between epigenetic modification of intronic regions including intron/exon boundaries and splicing regions within a genetic locus and a pathological condition.
- the epigenetic modification occurs in:
- an intragenic site in combination with an expansion mutation within a genetic locus.
- An "intragenic site” extends to an intron including its intron/exon boundaries.
- An expansion mutation includes a CGG expansion mutation.
- Conditions contemplated herein include pathoneurological conditions such as pathoneurodevelopmental and pathoneurodegenerative conditions as well as non- neurological conditions.
- Conditions and disorders contemplated herein include polyglutamine (polyQ) diseases such as Huntington's disease (HD), dentatorubropallid- oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA).
- polyQ polyglutamine
- HD Huntington's disease
- DRPLA dentatorubropallid- oluysiantrophy
- SBMA spinobulbar muscular atrophy
- spinocerebella ataxia Type 1 SCAl
- spinocerebella ataxia Type 2 SCA2
- spinocerebella ataxia Type 3 or Machado-Joseph disease SCA3
- spinocerebella ataxia Type 6 SCA6
- spinocerebella ataxia Type 7 SCA7
- spinocerebella ataxia Type 17 SCAl 7
- non- polyQ diseases such as Fragile X syndrome (FXS), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), myotonic dystrophy (DM), spinocerebella ataxia (SCA8) and spinocerebella ataxias Type 12 (SCAl 2).
- FXPOI Fragile X-associated primary ovary insuficiency
- FRDA Friedrich's ataxia
- Fragile type Fragile type
- folic acid type rare 12
- FXPOI Fragile X-associated primary ovary insuficiency
- FRDA Friedrich's ataxia
- Fragile type Fragile type
- folic acid type rare 12
- FA12A Fragile type
- FFA12A including co-morbid autism
- MR mental retardation
- Klinefelter's syndrome RNA toxicity disease
- Turner's syndrome a modified X-chromosome and cognitive impairment.
- learning and behavioral problems Further contemplated herein are learning and behavioral problems.
- epigenetic changes in an intron, intron/exon boundary and/or splicing region within particular genetic locus are associated with the development, progression and severity of a range of pathological conditions such as but not limited to those listed above.
- the epigenetic modification occurs in: (i) two or more of (a) an intron; (b) an intron exon boundary; and/or (c) a splicing region;
- epigenetic modification includes epigenetic modifications such as methylation including hypermethylation, histone modification, changes in acetylation, obiquitylation, phosphorylation, sumoylation, activation or deactivation, chromatin altered transcription factor levels and the like.
- the epigenetic modification extends to an increase or decrease in epigenetic change relative to a normal control.
- epigenetic modification includes the methylation state of CpG and CpNpG sites within an intron of a genetic locus.
- the genetic locus is the FMR genetic locus which includes FMR1 , FMR4 and ASFMR1 genes.
- the epigenetic modification occurs in:
- the epigenetic profile is also informative as to the spectrum of disease conditions associated with a particular genetic locus, such as in relation to the FMR genetic locus, whether the subject is normal or has a PM, GZ or FM pathology and/or whether the epigenetic change and/or CGG expansion is heterozygous or homozygous at the FMR allele.
- hypermethylation of one or more sites within the FREE2 region of intron 1 in an FM subject is associated with cognitive impairment.
- Reference to the "FREE2 region of intron 1 means portions of FREE2 (A), FREE2 (B) and FREE2 (C) located within intron 1 of the FMR1 gene which includes an intron exon boundary.
- an aspect enabled herein is a method for identifying an epigenetic profile in the genome of a cell indicative of a pathological condition, the method comprising screening for a change relative to a control in the extent of epigenetic modification within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (c) an intragenic region of a genetic locus in combination with an expansion mutation; wherein the extent of epigenetic change relative to a control is indicative of the presence or severity of the pathological condition or a propensity to develop same.
- the present disclosure teaches a method for identifying an epigenetic profile in a genome of a cell indicative of a pathological condition selected from Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado-Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), myotonic dystrophy (DM), spinocerebella ataxia (SCA8) and spinocer
- a pathological condition
- the epigenetic change is in the FMR genetic locus (which includes the FMR1 , FMR4 and ASFMR1 genes) and in particular within an intron, intron/exon boundary and/or splicing region downstream of intron 1 of the FMR1 gene, two or more introns, intron/exon boundaries and/or splicing regions of the FMRl gene, approximately one seventh or greater of one or more introns within a gene of the FMR genetic locus including the FMRl gene and/or within one or more sites in the FREE2 portion of intron 1 of the FMRl gene in combination with an expansion mutation.
- the expansion mutation is a CGG expansion mutation and in particular an FM (i.e. >200 repeats).
- a further aspect taught herein is a method for identifying an epigenetic profile in the genome of a cell indicative of a pathological condition associated with the FMR genetic locus, the method comprising extracting genomic DNA from the cell and subjecting the DNA to an amplification reaction using primers selective for (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) a site within the FREE2 portion of intron 1 of the FMRl gene in combination with a CGG FM expansion mutation within the FMR genetic locus, subjecting the amplified DNA to an epigenetic assay to determine the extent of epigenetic modification of the DNA wherein a change in the extent of epigenetic modification is indicative of the presence or severity of the pathological condition or propensity to develop same.
- FMR genetic locus includes the FMRl, FMR4 and ASFMR1 genes and corresponds to Xq27.3.
- the term "FMR locus” means the "FMR genetic locus”.
- aspects taught herein determine that the intronic region downstream of intron 1 comprises Fragile X-related Epigenetic Element 3(1) as defined by SEQ ' ID NO: l or a homolog thereof or a portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions; or is intron 2 as defined by SEQ ID NO:2 or a homolog thereof or a portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions; or is a site within the FREE2 portion of intron 1 of the FMRl gene.
- the nucleotide sequence of intron 1 of the FMR1 gene is set forth in SEQ ID NO:3 and extends to a homolog thereof or a portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:3.
- the extent of epigenetic change in two or more introns, intron exon boundaries and/or splicing regions or in one seventh or greater of an intron or within the FREE2 portion of intron 1 of the FMR1 gene within the FMR genetic locus may be determined alone in the case of (i) or (ii) or in combination in the case of (i), (ii) or (iii) with extent of (CGG) n expansion and/or any other epigenetic change therein.
- the determination of epigenetic change may also be conducted in combination with an assay as contemplated by International Patent Application No. PCT/AU2010/000169 filed on 17 February 2010, the contents of which are incorporated herein by reference in their entirety.
- the epigenetic modification is methylation.
- Another aspect of the present disclosure contemplates a method for identifying a pathological condition in a mammalian subject including a human, the method comprising screening for a change relative to a control in the extent of change in methylation or other epigenetic modification within a region selected from:
- Fragile X-related Epigenetic Element 3 in FMR I comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- intron 2 of FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or a portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- a "modified" X-chromosome includes an inactivated X-chromosome or an X- chromosome having a skewed X- inactivation, or inversion, insertion, deletion, duplication or is a hybrid.
- the epigenetic profile is determined in the genome of a cell of a subject. Any cell may be tested such as a cell from a post-natal or pre-natal human or embryo. More particularly, the cell is a cultured or uncultured chorionic villi sample (CVS) cell, a lymphoblast cell, a blood cell, a buccal cell, an amniocyte or an EBV transformed lymphoblast cell line.
- CVS cultured or uncultured chorionic villi sample
- a blood test is also contemplated such as when screening for an epigenetic change in the FREE2 portion of intron 1 in the FMRl gene in combination with an expansion mutation (e.g. an FM) in a subject.
- an epigenetic change is proposed herein to be indicative of potential cognitive impairment.
- the epigenetic modification is methylation of CpG and/or CpNpG sites.
- Methylation is determined by a range of assays including bisulfite MALDI-TOF methylation assay.
- methylation is determined by use of methylation sensitive PCR, methylation specific melting curve analysis (MS- MCA) or high resolution melting (MS-HRM); quantification of methylation by MALDI- TOF MS; methylation specific MLPA; methylated-DNA precipitation and methylation- sensitive restriction enzymes (COMPARE-MS); or methylation sensitive oligonucleotide microarray; or antibodies.
- Other methods include NEXT generation (GEN) and DEEP sequencing or pyrosequencing. However, any assay of methylation status may be employed.
- a method for screening for an agent which modulates epigenetic change of (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one 7 th seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) an intragenic region within a genetic locus in combination with an expansion mutation, the method comprising screening for a change relative to a control in the extent of epigenetic modification within the intron in the presence or absence of an agent to be tested, wherein an agent is selected if it induces a change in the epigenetic modification.
- a method for screening for an agent which modulates epigenetic change of an FMR genetic locus in a mammalian cell including a human cell comprising screening for a change relative to a control in the extent of epigenetic modification within a region selected from:
- Fragile X-related Epigenetic Element 3 (I) (I)] in FMRl comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or a portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- the epigenetic modification is methylation.
- De-methylation as well as pro-methylation agents are contemplated herein.
- FREE2 means the portion of FREE(A), FREE(B) and FREE2 (C) located in intron 1 of the FMR1 gene.
- a disease condition such as Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado- Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), Fragile type, folic acid type, rare 12 (FRA12A), Friedrich's ataxia (FRDA), FXPOI and other premutation related conditions, myotonip dystrophy
- HD Huntington's disease
- DRPLA dent
- monitoring in this context includes diagnosis of disease, monitoring progress of the disease before or after treatment, prognosis of the disease development or remission as well as the pharmacoresponsiveness or pharmacosensitivity of a subject or agent.
- an epigenetic profile within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one 7 th seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) an intragenic region of a genetic locus in combination with an expansion mutation in a cell in the manufacture of an assay to identify an epigenetic profile of gene associated with a pathological condition.
- An embodiment herein is directed to the use of an epigenetic profile within the FMR genetic locus in a mammalian cell including a human cell, the epigenetic profile including methylation of CpG and/or CpNpG sites located in a region selected from:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the assay taught herein may also be used alone or in combination with assays to detect extent of a nucleotide expansion such as a (CGG) n expansion, such as suing PCR and Southern blot assays. This is particularly useful in determining homozygosity, heterozygosity and mosaicism of a disease or condition.
- the assay herein is also useful in population studies such as epidemiological studies as well as studies based on ethnic populations.
- another aspect enabled herein provides a method of identifying epigenetic profile in populations of subjects indicative of a pathological condition associated with epigenetic modifications or changes in an intron, intron/exon boundary and/or splicing region, the method comprising screening for a change, relative to a control in a statistically significant number of subjects, in the extent of epigenetic change within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) an intragenic region of a genetic locus in combination with an expansion mutation, the epigenetic change including extent of methylation of CpG and/or CpNpG sites located within the intron, intron exon boundary and/or splicing region wherein a change in extent of epigenetic modification is indicative of the presence or severity of the
- Contemplated herein is a method of identifying a methylation or other epigenetic profile in a population of subjects indicative of a pathological condition associated with the FMR locus, the method comprising screening for a change, relative to a control, in a statistically significant number of subjects in the extent of epigenetic modification including extent of change in methylation of CpG and/or CpNpG sites within a region selected from:
- Fragile X-related Epigenetic Element 3 (I) [FREE3 (1)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the assay may comprise the further step of determining the extent of a nucleotide expansion such as a (CGG)n expansion such as by PCR and/or Southern blot analysis.
- a nucleotide expansion such as a (CGG)n expansion
- aspects herein extend to the use of the epigenetic profile of an intron within a genetic locus to determine the status, prognosis or disease development or recovery and/or treatment options including responsiveness of the subjeict to pharmacological agents and/or behavioral intervention strategies.
- another aspect provides a method of allowing a user to determine the status, prognosis and/or treatment response of a subject with respect to an FMR locus- associated pathology, the method including: (a) receiving data in the form of extent of methylation or other epigenetic modification at a site within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one 7 th (seventh) or greater of an intron including an crizron/exon boundary and/or a splicing region; and/or (iii) an intragenic region of a genetic locus in combination with an expansion mutation associated with the pathology, wherein the extent of methylation or other epigenetic modification provides a correlation to the presence, state, classification or progression of the pathology; (b) transferring the data from the user via a communications network;
- contemplated herein is a method of allowing a user to determine the status, prognosis and/or treatment response of a subject with respect to an FMR locus- associated pathology, the method including:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] in F R1 comprising the nucleotide sequence set forth in SEQ ID NO: l or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- a further embodiment enabled herein is a kit comprising primers which amplify regions of the FMR genetic locus, comprising CpG and/or CpNpG sites located within a region selected from:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO: l or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 of FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the epigenetic modification relates to extent of, or change in, methylation at CpG and/or CpNpG sits within the selected regions of the FMR genetic locus, defined as FREE 3 (I), intron 2 and an intron, intron/exon boundary and/or splicing region downstream of intron 2, when in combination with an FM, or the FREE2 portion of intron 1 of the FMRl gene.
- FREE 3 I
- An embodiment associates hypermethylation at a site within FREE2 portion of intron 1 of the FMRl gene with cognitive impairment. In an embodiment, this aspect applies to female subjects having a FM.
- FM and PM individuals have a significant relationship between methylation of specific CpG sites within the FREE regions proximal to the 3' and 5' epigenetic boundaries and learning and behavioral problems including co-morbid autism and that these epigenetic changes are consistent between different tissues and over a lifetime. It is also taught herein that these epigenetic changes are related to abnormal or lack of binding of a CCCTC-binding factor (CTCF) in the proximity of epigenetic boundaries in FM and PM individuals resulting in abnormal FMRl/ASFMRl expression.
- CCCTC-binding factor CCCTC-binding factor
- the primers useful in practicing the subject assay are selected from the list consisting of SEQ ID NOs:6 through 11. Those sequences include tag sequences. The present disclosure extends to the primer only portions of SEQ ID NOs:6 through 1 1.
- SEQ ID NOs:43 through 49 represent the nucleotide sequences of FREE2(A) 5' Intrl Amp 5, FREE2(B) 5' Intr 1 PP2, FREE2(C) 4' Intr 1 PP3, FREE2(D) 5' intr 1 PP4, 2CpGs, FREE2(E) 5' Intr 1 PP6 and ASFMR1 . Table 1
- CpG Cytosine and guanine separated by a phosphate (C-phosphate-G), which links the two nucleosides together in DNA
- N any nucleotide but guanine.
- the cytosine and N nucleotide are phosphorylated.
- FMR Fragile X mental retardation genetic locus comprising of FMRl and
- FRA12A Fragile type folic acid type, rare 12
- FREE Fragile X related Epigenetic Element e.g. FREE2 and FREE3(I)
- FREE2 and FREE3(I) ABBREVIATION DESCRIPTION
- Figure 1A is diagrammatic representation of the DNA map of the intron and exon regions 5' and 3' of the FMRl CGG expansion (sequence numbering from GenBank L29074 L38501) in relation to FMRl and ASFMR1 transcription start sites (the broken lines indicated spliced out regions), FMRl promoter, the Fragile X-related epigenetic elements 1 and 2 (FREE 1 and 2), the FMRl CpG island and methylation sensitive restriction sites ⁇ Nrul, EagI and BssHII) analyzed using routine Fragile X Southern blot testing.
- a CGG repeat is located within the 5' (UTR) of the FMRl gene.
- ASFMR1 spans the CGG expansion in the antisense direction and is regulated by two promoters, with promoter one located within the CpG island (yellow box) and promoter located in the intron 2 of FMRl (light pink box).
- the FREE2 located downstream of the CGG expansion.
- CTCF binding sites are located on either side of the CGG expansion (indicated by purple boxes).
- Primers utilized for MALDI-TOF methylation analysis targeted 6 regions at the Xq27.3 locus designated as FREE1, FREE2(A) described as amplicon 5 in (Godler et al. (2010) Hum Mol Genet 19(8): l 6 ⁇ %- ⁇ 632); FREE2(B) FREE2(C); ⁇ FREE2(D); FREE2(E), and intragenic ASFMR1 promoter (color coded) [FREE3J.
- Figure IB is a representation of the sequences amplified by primers utilized for MALDI-TOF methylation analysis targeted 6 regions at the Xq27.3 locus designated as FREE2(A) (described as amplicon 5 in Godler et al. (2010) supra; HUG); FREE2(B); FREE2(C); FREE2(D); FREE2(E), FREE2(F) and FREE3 / ASFMR1 promoter (color coded). Individual CPG sites within each region are numbered accordingly. Prominent transcription factor binding sites and methylation sensitive restriction enzyme recognition sites are indicated in capital font, and are listed/identified in Table 1. « Indicates ASFMR1 transcription start site.
- the red arrow indicates the FREE2 3' Boundary located at CpG 1 of FREE2(E) which is underlined in the sequence. Text highlighted in pink indicates CTCF binding sites from UCSF Chip-Seq: CTCF site #1 binds FREE2(B) CpGl to CpG32; CTCF site #2 binds FREE2(D) CpG5-7.
- FIGS 2A through C are photographic and graphical representations showing FMRl mRNA and FMRP expression and FMRl intron ⁇ methylation in lymphoblast cell lines from normal range controls and FXS individuals.
- FMRP and B FMRl mRNA expression and
- C FMRl intron 1 methylation analysis using SEQUENOM mass spectrometry assays, color coded (see Figure 1 for sequence location), were examined in the cells from the same wells.
- FMRl 5' and 3' mRNA levels and FMRP expression were assessed using real-time PCR and western blot analysis, respectively.
- A The full size and truncated FMRP were expressed in controls and absent in these FM cell lines from individuals with clinical FXS.
- FMRl 5' and 3' mRNA were absent in the cell lines from FXS males with 490, 530 and 543 -633 CGG alleles as well as a FM female carrier of 47 and 563 alleles, all affected with clinical FXS and hypermethylation at the CpG island (assessed using Southern blot).
- C the FMRl intron 1 sequences were hypermethylated in FXS cell lines, while the intron was hypomethylated in all sites examined up to the 3' epigenetic boundary (red arrow).
- Figure 3 is a diagrammatic representation of the intron and exon regions at the Xq27.3 locus (sequence numbering from GenBank L29074 L38501), locations of FMRl and ASFMRl transcription start sites and alternative splicing events.
- ASFMRl (-1) real-time assay detects unspliced and splice variant C (positioned -282 to - 343 from FMRl transcription start site)
- ASFMRl (-2) real-time assay detects unspliced only (positioned -588 to -663 from FMRl transcription start site)
- ASFMRl real-time assay detects all (positioned -1299 to -1360 from FMRl transcription start site).
- Figures 4A through C are graphical representations of different FMRl and ASFMRl transcripts in RNA samples from lymphoblast lines of 6 male controls, two FXS males (samples 849 and 862) and one FXS female (865) (described in Figure 2).
- the control and FXS RNA samples were either treated with TURBO DNase (A), RQl DNase (B), RNase A (C), or were untreated. Addition of TURBO DNase or RQl DNAse buffers to RNA samples without DNase were included as additional controls in A and B.
- FMRl and ASFMR1 transcripts were quantified using real-time RT-PCR relative standard curve method, normalized to mRNA levels of three internal control genes, GUS, GAPDH and B2M.
- FMRl 5' and 3' assays showed no signal for the FXS RNA samples, while similar levels were detected in all control samples (upper two panels in A, B and C).
- TURBO and RQl DNAse treatment caused ⁇ 50% decrease in the FMRl levels in most of the control samples; while RNase A treatment caused complete loss of FMRl and ASFMR1 signals.
- Figure 5 is a graphical representation showing full scale IQ (FIQ) and FREE2 methylation in the blood of human female subjects.
- FIQ full scale IQ
- FREE2 methylation output ratio y axis
- NC normal CGG size controls
- PM carriers with FIQ>70 PM carriers with FIQ>70
- FM carriers with FIQ>70 FM carriers with FIQ ⁇ 70
- x axis FM carriers with FIQ ⁇ 70
- FM IQ ⁇ 70 compared to FM IQ>70 ### - p ⁇ 0.0001 ; ##-p ⁇ 0.001 ; #-p ⁇ 0.05
- Figure 6 is a graphical representation showing verbal IQ (VIQ) and FREE2 methylation in the blood of human female subjects.
- VIQ verbal IQ
- A The difference in FREE2 methylation output ratio (y axis) between normal CGG size controls (NC), PM carriers with VIQ>70, FM carriers with VIQ>70, and FM carriers with VIQ ⁇ 70 (x axis).
- B Nonparametric Spearman correlation between FREE2 methylation output ratio (y axis) and VIQ (x axis) in FM only females.
- FM VIQ ⁇ 70 compared to FM VIQ>70 ### - p ⁇ 0.0001 ; ##-p ⁇ 0.001 ; #-p ⁇ 0.05
- Figure 7 is a graphical representation of performance IQ (PIQ) and FREE2 methylation in the blood of human female subjects.
- PIQ performance IQ
- FREE2 methylation output ratios y axis
- NC normal CGG size controls
- PM carriers with FIQ>70 FM carriers with FIQ>70
- FM carriers with PIQ ⁇ 70 x axis
- B Nonparametric Spearman correlation between FREE2 methylation output ratio (y axis) and PIQ (x axis) in FM only females.
- FM PIQ ⁇ 70 compared to FM PIQ>70 ### - pO.0001 ; ##-p ⁇ 0.001 ; #-p ⁇ 0.05
- Figure 8 is a graphical representation showing comparison of methylation at the Exonl/Intron 1 border and the 3' epigenetic boundary in 15 control (HC), 18 premutation (PM), 4 'high functioning' full mutation (IQ>70; UFM) males and 41 FM males with cognitive impairment (IQ ⁇ 70; FXS).
- Figures 9A and B are graphical representations showing FREE2 pG 10- 12 methylation in newborn blood spots (NBS), dri.ed blood spots (DBS) and fresh blood.
- NBS newborn blood spots
- DBS dri.ed blood spots
- Taught herein is a method for identifying an epigenetic profile of an intron, intron/exon boundary and/or splicing region within a genetic locus associated, indicative, 5 instructive or informative of a pathological condition.
- the epigenetic modification occurs in:
- epigenetic profile includes epigenetic modifications such as methylation including hypermethylation, RNA/DNA interactions, expression profiles of non-coding RNA, histone modification, changes in acetylation, obiquitylation, phosphorylation, sumoylation, activation or deactivation, chromatin altered transcription factor levels and 0 the like. Particularly, the extent of methylation, RNA/DNA interaction and non-coding RNA expression are determined as well as any changes therein.
- the pathological condition may be a neurological or non-neurological condition.
- the condition may be described as a neuropathological 25 condition or a pathoneurological condition which encompasses neurodegenerative and neurodevelopmental disorders.
- Non-neurological pathologies are also contemplated herein as well as any nucleotide expansion disease or condition.
- Conditions and disorders contemplated herein include polyglutamine (polyQ) 30 diseases such as Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado- Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17) and non-polyQ diseases such as Fragile X syndrome (FXS), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), Fragile type, folic acid type, rare 12 (FRA12A), Friedrich's ataxia (FR
- FXPOl Fragile X-associated primary ovary insufficiency
- MR mental retardation
- Klinefelter's syndrome RNA toxicity disease
- Turner's syndrome a modified X-chromosome and cognitive impairment.
- Other conditions include learning and behavioral problems.
- the present disclosure particularly identifies nucleotide expansion diseases and conditions and FMR genetic locus-associated pathology conditions.
- a method is enabled for identifying an epigenetic profile in a genome of a cell indicative of a pathological condition selected from Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1 ), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado-Joseph disease (SCA3).
- a pathological condition selected from Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1 ), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado-Joseph disease (SCA3).
- spinocerebella ataxia Type 6 SCA6
- spinocerebella ataxia Type 7 SCA7
- spinocerebella ataxia Type 17 SCA17
- FXTAS Fragile X-associated tremor or ataxia
- FXE Fragile XE mental retardation
- FRDA Friedrich's ataxia
- Fragile type folic acid type, rare 12 (FRA12A), myotonic dystrophy (DM), spinocerebella ataxia (SCA8) and spinocerebella ataxias Type 12 (SCA12)
- autism including co-morbid autism
- mental retardation Klinefelter's syndrome
- RNA toxicity disease Turner's syndrome and a modified X-chromosome and cognitive impairment
- the method comprising screening for a change relative to the control in the extent of epigenetic modification within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c
- Particular conditions include Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), premutation-related conditions including but not limited to FXPOI, Friedrich's ataxia (FRDA), Fragile type, folic acid type, rare 12 (FRA12A), autism (including co-morbid autism), mental retardation, Klinefeltcr's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome and cognitive impairment.
- FXTAS Fragile X-associated tremor or ataxia
- FXE Fragile XE mental retardation
- premutation-related conditions including but not limited to FXPOI, Friedrich's ataxia (FRDA), Fragile type, folic acid type, rare 12 (FRA12A), autism (including co-morbid autism), mental retardation, Klinefeltcr's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome
- an "intron”, “intron/exon boundary” and “splicing region”, are regarded as an intron, intron/exon boundary and splicing region within a genetic locus or a gene within a genome.
- the intron, intron/exon boundary and splicing region may also encode a regulatory RNA species.
- the pathological condition is associated with an epigenetic profile of the FMR genetic locus.
- the "FMR genetic locus” includes the FMR1, FMR4 and ASFMRl genes as well as promoter and regulatory regions and introns and exons.
- the FMR genetic locus comprises a promoter region, a (CGG) n region proximal to the promoter and exonic and intronic regions of the FMR1, FMR4 and ASFMRl genes as depicted in Figures 1A and 4A.
- the promoter is generally referred to as the "FMR1 promoter".
- the FMR locus includes introns, intron/exon boundaries and splicing regions wherein it is proposed herein that epigenetic changes occur within (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) with the FREE2 portion of intron 1 of the FMR1 gene in combination with an FM which are indicative or diagnostic of a pathological condition or its severity .
- FREE3(I) is further defined below.
- "FREE2" means the portion of FREE2(A), FREE2(B) and/or FREE2(C) within intron 1 of the FMR1 gene including an intron/exon boundary.
- a method is contemplated -for identifying an epigenetic profile in a genome of a cell indicative of a pathological condition selected from Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado-Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), FXPOI, Friedrich's ataxia (FRDA), Fragile type, folic acid type,
- a pathological condition
- Particular conditions include Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), premutation-related conditions including but not limited to FXPOI, Friedrich's ataxia (FRDA), Fragile type, folic acid type, rare 12 (FRA12A), autism (including co-morbid autism), mental retardation, Klinefelter's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome and cognitive impairment.
- the epigenetic change is in the FMR genetic locus and in particular within an intron, intron/exon boundary and/or splicing region downstream of the FMR genetic locus including the FMRl gene.
- the epigenetic change is hypermethylation of a site within the FREE2 portion of intron 1 of the FMRl gene wherein hypermethylation of one or more sites within FREE2 is associated with cognitive impairment.
- the cognitive impairment is in a female human subject.
- the human female subject presents with a full mutation (FM); i.e. >200 CGG repeats.
- the present disclosure teaches the manufacture of an assay to identify an epigenetic profile of an FMR genetic locus-associated pathological condition.
- the FMR genetic locus is depicted in part in Figures 1A and 4A.
- the present disclosure is predicated in part on a determination of the methylation or other epigenetic signature of introns, intron/exon boundaries and/or splicing signals or part within the FMR genetic locus and in particular the FMRl gene.
- the nucleotide sequence of intron 1 of the FMRl gene is set forth in SEQ ID NO:3.
- the present disclosure extends to homologs of a gene such as genetic loci comprising a nucleotide sequence at least 80% identical to SEQ ID NO:3 or a nucleotide sequence capable of hybridizing to SEQ ID NO:3 under medium stringency conditions.
- intron 2 SEQ ID NO:2
- FREE3 (I) FREE3
- the present disclosure extends to any intron, intron/exon boundary and splicing region within the FMRl gene including (i) two or more of (a) an intron; (b) an intron exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region as well as nucleotide sequences having at least 80% identity to any of these regions or a nucleotide sequence capable of hybridizing to these sequences or their complementary forms under medium stringency conditions.
- the present disclosure extends to portions and fragments of these regions.
- the present disclosure also teaches hypermethylation or other epigenetic changes in one or more sites of the FREE2 portion of intron 1 of the FMRl gene in combination with an FM.
- the present disclosure further teaches isolated nucleotide sequences corresponding to these regions. Without limiting the present disclosure to any one theory or mode of action, epigenetic changes in these introns may affect the ability of the introns, intron/exon boundaries and/or splicing regions to transcribe regulatory R As which in turn have an effect on transcription capability.
- FM and PM individuals have a significant relationship between methylation of specific CpG sites within the FREE regions proximal to the 3' and 5' epigenetic boundaries and learning and behavioral problems including co-morbid autism and that these epigenetic changes are consistent between different tissues and over a lifetime. It is also taught herein that these epigenetic changes are related to abnormal or lack of binding of a CCCTC-binding factor (CTCF) in the proximity of epigenetic boundaries in FM and PM individuals resulting in abnormal FMR1/ASFMR1 expression. This is the first functional evidence for long range epigenetic modification specific to FM and PM alleles and enables avenues for earlier diagnosis, treatment and intervention in individuals with an abnormal FMR1 gene.
- CCCTC-binding factor CCCTC-binding factor
- an aspect provides a method for identifying a pathological condition in a mammalian subject including a human, the method comprising screening for a change relative to a control in the extent of epigenetic modification within a region selected from:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- intron 2 of FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the present disclosure enables a method for identifying in a genome of a mammalian cell including a human cell, a pathological condition associated with methylation and other epigenetic change within the FMR locus, the method comprising extracting genomic DNA from the cell and subjecting the DNA to an amplication reaction using primers selective of a region of the FMR genetic locus comprising CpG and/or CpNpG sites, the CpG and CpNpG sites located in a region selected from:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] of FMR1 comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:l or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- intron 2 of FMR1 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the epigenetic modification is methylation of CpG and/or CpNpG sites and the assay identifies the extent of methylation change. This change may be an elevation or increase in methylation or a decrease in methylation relative to a control.
- the epigenetic modification is extent of change in RNA/DNA interaction and/or change in profile of expression of expression of non-coding RNA.
- the epigenetic profile is a change in histone modification, changes in acetylation, obiquitylation, phosphorylation, sumoylation, activation or deactivation, chromatin altered transcription factor levels and the like.
- the epigenetic change is hypermethylation.
- An aspect of the present disclosure teaches a method for diagnosing or predicting cognitive impairment in a subject, the method comprising screening for an enhanced epigenetic profile in the FREE2 portion of intron 1 of the FMR1 gene wherein the presence of enhanced epigenesis in combination with an FM or a CGG expansion approaching an FM is indicative of cognitive impairment or a risk of developing same.
- the subject is a human.
- the human is a human female.
- the human female presents with an expanded FMR1 gene anneal or is in the process of developing an FXS or passing on the expanded FMR1 anneal to offspring.
- the term "enhanced epigenetic profile" includes hypermethylation.
- the extent of methylation or other epigenetic modification provides a quantitative or semiquantitative or qualitative indication of extent of change in epigenetic profile in (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) the FREE2 portion of intron 1 of the FMR1 gene in combination with an FM and as such the level of epigenetic modification defines the severity of the pathological condition alone or in combination with the extent of (CGG) n expansion.
- the number of repeats indicate whether a subject is a healthy control or has a Gray Zone (GZ) pathology, premutation (PM) pathology or full mutation (FM) pathology.
- GZ Gray Zone
- PM premutation
- FM full mutation
- the method of the present disclosure may also be used in conjunction with other assays such as Southern blot or PCR to measure (CGG) n expansion.
- An "intragenic region” includes the FREE2 portion of intron 1 of FMR1.
- Reference to "a site in an intragenic region” or a "site in FREE2” includes a single or multiple sites.
- Reference to "FREE2” includes FREE2(A), FREE2(B) and/or FREE2(C) insofar as they are located in intron 1 of the FMR1 gene.
- the present disclosure is not limited to the FMR genetic locus and pathological conditions only associated therewith. Rather, the present disclosure teaches any epigenetic modification in any genetic locus selected from (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh greater of an intron including an intron/exon boundary and/or splicing region; and/or (iii) an intragenic region in combination with an expansion mutation and which epigenetic change is associated with a pathological condition.
- approximately one seventh or greater means from about 20% or greater or nucleotides capable of epigenetic change or modification have undergone a change. This includes 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 67, 58, 59, 60, 61 , 62, 63, 64, 65.
- a "pathological condition” or "disease condition” includes an abnormal condition including a neurodevelopmental condition or a neurodegenerative condition or a non-neurological condition as defined by objective or subjective manifestations of disease.
- the assay herein described is particularly useful for diagnosing nucleotide expansion diseases or conditions.
- the assay of enabled herein includes a genetic determination to be made to complement other symptom-based diagnoses such as based on behavioral studies or may be made in its own right.
- the assay may be part of a suit of diagnostic or prognostic genetic assays of embryos, pre- and post-natal subjects.
- a saliva test may also be conducted.
- a saliva test enables salival DNA to be analyzed. This also applies to a cheek sample.
- the terms "method”, “assay”, “system”, “test”, “determination”, “prognostic”, “diagnostic”, “report” and the like may all be used to describe the methylation assay of selected regions of the FMR genetic locus or other genetic locus.
- the epigenetic assay such as a methylation assay determines the epigenetic profile or extent of epigenetic change compared to a control which suggests or indicates or is instructive of a disease or condition associated with epigenetic modification of an intron within a genetic locus. " The present assay is also useful in population studies such as epidemiological studies including studies of ethnic populations.
- the present disclosure further provides a method of identifying a methylation or other epigenetic profile in populations of subjects indicative of a pathological condition, the method comprising screening for a change relative to a control in a statistically significant number of subjects the extent of epigenetic modification in (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) an intragenic region in combination with an expansion mutation; within a genetic locus wherein a change in extent of epigenetic modification is indicative of the presence or severity of the pathological condition or a propensity to develop same.
- the present disclosure teaches a method of identifying a methylation or other epigenetic profile in a population of subjects indicative of a pathological condition associated with the FMR locus, the method comprising screening for a change, relative to a control, in a statistically significant number of subjects in the extent of epigenetic modification including extent of change in methylation of CpG and/or CpNpG sites within a region selected from:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or fragment thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the assay may comprise the further step of determining the extent of (CGG) n expansion such as by PCR and/or Southern blot analysis of bisulfite converted and/or non converted DNA.
- this assay may be conducted with one or more assays contemplated and described in International Patent Application NO. PCT/AU2010/000169 filed on 17 February 2010, the contents of which are incorporated by reference in their entirety.
- a subject may first be screened to ascertain if the subject has a FM, PM or GZ.
- Subjects, including female human subjects, with a FM may then be selected to ascertain the presence or absence of hypermethylation in one or more sites with the FREE2 portion of intron 1 of the FMR1 gene.
- the presence of hypermethylation within FREE2 is indicative of cognitive impairment or the potential of development of same when in combination with an FM or a CGG expansion approaching an FM.
- the extent of methylation or change in extent of methylation is detected and associated with the pathology condition such as but not limited to an expansion disease or condition.
- An epigenetic map and in particular a methylation map of introns, intron/exon boundaries and/or splicing regions within the FMR locus has thus been constructed in accordance with the present disclosure using standard techniques such as high throughput mass spectrometry in the genome of various cells. Any cell or sample type of cell may be assayed.
- a sample type includes fresh and dried blood samples, salvial and buccal samples.
- These cells or sample types include cultured or uncultured Chorionic Villi Sample (CVS) cells, lymphoblasts, blood cells, dried adult or newborn blood spots, buccal cells, an amniocyte, EBV transformed lymphoblast cell lines and DNA from a salival swab or cheek sample from male and female subjects with either no symptoms or from a spectrum of a pathological condition such as Fragile X mental retardation symptoms.
- CVS Chorionic Villi Sample
- FREE3 (I) has been identified within intron 2 of the FMR1 gene.
- this region [FREE3 (I)] or other regions of intron 2 or other introns or parts thereof including intron/exon boundaries and splicing regions downstream of intron 2 of FMR1 or elsewhere in the FMR genetic locus are responsible for the regulation of transcription of FMR4 and ASFMR1 and FMR1 and expression of FMRP.
- hyper-epigenetic changes at one or more sites within the FREE2 portion of intron 1 of the FMR1 gene in human female subjects with an FM are likely to have or develop cognitive impairment. The latter can conveniently be measured in cells obtained from a blood test or a saliva DNA test.
- the present disclosure determines that the extent of methylation in CpG and/or CpNpG sites located within the region downstream of intron 1 or part thereof such as FREE3 (I) closely corresponds to a healthy condition or a level or severity of disease within the spectrum of PM to FM including GZ subjects such a correspondence may be in a further association with other epigenetic modifications within the FMR genetic locus and/or CGG expansion.
- FREE3 (I) methylation levels of the FREE3 (I) region provide fully quantitative results, which also reflect the degree of X-chromosome modification in females. This can be more informative than methylation patterns of a promoter region only, which may be biased due to its proximity to a nucleotide expansion, and hence can only provide a qualitative assessment of methylation.
- the present disclosure contemplates a change in extent of methylation which includes an increase or decrease in extent of methylation. There may also be no change in the extent of methylation within an intron of a genetic locus. However, the present disclosure extends to the detection of the change in extent of any epigenetic modification. Such a change or level of methylation in an intron is proposed to be associated with a pathological condition or its severity.
- an "intron” includes an intron/exon boundary and/or a splicing region.
- the present disclosure enables identification of subjects, including human female subjects, having or likely to develop cognitive impairment, the method comprising screening for increased epigenesis (including hypermethylation) in one or more sites within the FREE2 portion of intron 1 of the FMR1 gene in subjects with an FM or who are developing an FM wherein the presence of increased epigenesis is indicative of a subject with cognitive impairment or a likelihood of developing same.
- a "normal” or “control” in the assay of the present disclosure may be a control genome from a healthy individual performed at the same time or the epigenetic pattern may be compared to a statistically validated standard.
- a healthy individual includes a subject with a nucleotide repeat within the normal range with no clinically apparent pathological phenotype.
- (CGG) n expansion conditions within the FMR genetic locus this includes when n is ⁇ 40.
- a "part” includes an intron/exon boundary and splicing region.
- methylated CpG sites are identified within FREE3 (I) or intron 2 or a FREE2 portion of intron 1 of the FMRl gene in subjects with Fragile X mental retardation conditions including symptoms of cognitive impairment.
- the methylated CpG sites are identified in (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or (ii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iii) in a site in FREE2 of intron 1 of the FMRl gene in combination with an FM.
- the terms "subject”, “patient”, “individual”, “target” and the like refer to any organism or cell of the organism on which an assay of the present disclosure is performed whether for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include both male and female humans but the present disclosure extends to experimental animals such as non-human primates, (e.g., mammals, mice, rats, rabbits, pigs and guinea pigs/hamsters).
- the "subject” may also be referred to as a population since the present disclosure is useful in populations studies including epidemiological studies or assays of ethnic population.
- the subject is a human.
- the test may be tailored to human females or human males or pre-natal humans and may also be conducted in utero.
- the subject in relation to epigenetic changes in the FREE2 portion of intron 1 of the FMRl gene, the subject includes a human female as well as a human female with an FM.
- FMR condition refers to a neurological disease, disorder and/or condition characterized by one or more of the following symptoms: (1) behavioral symptoms, including but not limited to hyperactivity, stereotypy, anxiety, seizure, impaired social behavior, learning and attention problems and/or cognitive delay; (2) defective synaptic morphology, such as an abnormal number, length, and/or width of dendritic spines; and/or (3) defective synaptic function, such as enhanced long-term depression (LTD); and/or reduced long-term potentiation (LTP); and/or impaired cognitive ability and/or behavioral deficiency.
- behavioral symptoms including but not limited to hyperactivity, stereotypy, anxiety, seizure, impaired social behavior, learning and attention problems and/or cognitive delay
- defective synaptic morphology such as an abnormal number, length, and/or width of dendritic spines
- defective synaptic function such as enhanced long-term depression (LTD); and/or reduced long-term potentiation (LTP); and/or impaired cognitive ability and/or behavioral deficiency.
- the pathological condition is a disease, disorder, and/or condition caused by and/or associated with epigenetic changes within an intron or part thereof within the FMR genetic locus such as downstream of intron 1 of the FMR1 gene.
- epigenetic changes may be alone or in combination with one or more of the following: (1) a mutation in FMR1 or FMR4 or ASFMR1 ; (2) defective FMR1/FMR4/ASFMR1 expression; (3) increased and/or decreased levels of FMRP; (4) defective FMRP function; (5) increased and/or decreased expression of genes or genetic functions regulated by FMR1, FMRP, FMR4 transcript or ASFMR1 transcript; (6) the increased methylation of FMR locus at CpG or CpNpG sites in the region upstream of FMR1 promoter and/or the region downstream of the (CGG)phon portion of the FMR1 promoter but not including the (CGG) n portion; (7) an increased and/or decreased function of the FMR locus via miRNAs and/or members of the miRNA pathway
- polyglutamine diseases such as Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado- Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17) and non-polyQ diseases such as Fragile X syndrome (FXS), Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), Friedrich's ataxia (FR
- autism Other conditions contemplated herein include autism, mental retardation, Klinefelter's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome as well as certain trinucleotide expansion disorders, cognitive impairment, behavioral and learning problems.
- genomic DNA includes all DNA in a cell, group of cells, or in an organelle of a cell and includes exogenous DNA such a transgenes introduced into a cell.
- the present disclosure teaches the determination of the presence of an FMR genetic locus-associated pathology based on extent of methylation of CpG/CpNpG sites located within (i) an intron downstream of intron 1 of the FMRl gene or part of an intron; (ii) two or more of (a) an intron; (b) an intron/exon boundary; (c) a splicing region; and/or (iii) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and/or (iv) one or more sites in the FREE2 portion of intron 1 of the FMRl gene in combination with an FM.
- the downstream FMRl introns may extend beyond the FMRl gene.
- the extent of methylation in part of intron 2 [FREE3 (I)] is identified in the FMRl gene.
- the extent of methylation is determined in the FREE2 portion of intron 1 of the FMRl gene such as in a human subject including a human female subject with an FM or a developing FM- Examples of sites in FREE2 include CpG units 6/7 and 10- 12.
- the present disclosure teaches a method for identifying a methylation or other epigenetic profile in the genome of a cell indicative of a pathological condition associated with the FMR genetic locus, the method comprising screening for a change relative to the control in the extent of epigenetic modification of CpG and/or CpNpG sites located within: (i) (a) FREE3 (I); (b) intron 2; and (c) an intron downstream of intron 2 or a homolog thereof or a portion or fragment thereof within the FMR1 gene;
- FREE2 portion of intron 1 of the FMR1 gene in a subject with an FM or a developing FM wherein a change in the extent of epigenetic modification is indicative of the presence of the pathological condition or a propensity to develop same.
- the nucleotide sequences of FREE3 (I) and intron 2 are set forth in SEQ ID NOs: 1 and 2, respectively and the present disclosure extends to their homologs and portions and parts thereof having at least 80% identity thereto or a nucleotide sequence capable of hybridizing to these sequences or their complementary forms under medium stringency conditions.
- Reference to FREE3 (I), and an intron such as intron 2 includes portions, fragments, parts, regions and domains thereof.
- the nucleotide sequence of intron 1 of the FMR1 gene containing all or a portion of FREE2(A), FREE2(B) and FREE2(C) is as set forth in SEQ ID NO:3.
- the present disclosure extends to homologs and portions and parts thereof having at least 80% identity to SEQ ID NO:3 or a nucleotide sequence capable of hybridizing to this sequence or its complementary form under medium stringency conditions.
- the epigenetic modification is methylation and RNA DNA interactions.
- the present disclosure further teaches a method for identifying a pathological condition in a subject associated with methylation within the FMR locus, the method comprising extracting genomic DNA from a cell of the subject and subjecting the DNA to an amplication reaction using primers selective of a region of the FMR genetic locus comprising CpG and/or CpNpG sites, the CpG and CpNpG sites located in (i) a region in the FMR1 gene selected from:
- Fragile X-related Epigenetic Element 3 (a) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] comprising the nucleotide sequence set forth in SEQ ID NO: l or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- a region in the FMR genetic locus selected from: (a) two or more introns; an intron/exon boundary and/or splicing region; or (b) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region; and
- the sites in FREE2 include CpG units 6/7 and 10-12.
- methylation assay such as methylation sensitive PCR, methylation specific melting curve analysis (MS-MCA) or high resolution melting (MS-
- oligonucleotide microarray 34(3) e ⁇ 9] or methylation sensitive oligonucleotide microarray (Gitan et al. (2002) Genome Res. 72 ⁇ : 158-164), as well as via antibodies.
- Other assays include NEXT generation (GEN) and DEEP sequencing or pyrosequencing.
- amplification methodologies contemplated herein include the polymerase chain reaction (PCR) such as disclosed in U.S. Patent Nos. 4,683,202 and 4,683,195; the ligase chain reaction (LCR) such as disclosed in European Patent Application No. EP-A-320 308 and gap filling LCR (GLCR) or variations thereof such as disclosed in International Patent Publication No. WO 90/01069, European Patent Application EP-A-439 182, British Patent No. GB 2,225,1 12A and International Patent Publication No. WO 93/00447.
- PCR polymerase chain reaction
- LCR ligase chain reaction
- LCR ligase chain reaction
- GLCR gap filling LCR
- amplification techniques include Q replicase such as described in the literature; Stand Displacement Amplification (SDA) such as described in European Patent Application Nos. EP-A-497 272 and EP-A-500 224; Self-Sustained Sequence Replication (3SR) such as described in Fahy et al. (1991 ) PCR Methods Appl. y / ):25-33) and Nucleic Acid Sequence-Based Amplification (NASBA) such as described in the literature.
- SDA Stand Displacement Amplification
- 3SR Self-Sustained Sequence Replication
- NASBA Nucleic Acid Sequence-Based Amplification
- a PCR amplification process is particularly useful in the practice of aspects enabled herein.
- cytosines in the DNA sample are selectively de-aminated, but 5-methylcytosines remain essentially unchanged or essentially all 5-methylcytosines in the DNA sample are selectively de-aminated, but cytosines remain essentially unchanged.
- Cytosine-guanine (CpG) dinucleotides and CpNpG trinucleotides are detected, allowing conclusions about the methylation state of cytosines in the CpG dinucleotides and CpNpG trinucleotide in the DNA sample.
- This delamination is generally performed using a bisulfite reagent.
- the sample DNA is only amplified by chosen PCR primers if a certain methylation state is present at a specific site in the sample DNA the sequence context of which is essentially complementary to one or more of the chosen PCR primers. This can be done using primers annealing selectively to bisulfite treated DNA which contains in a certain position either a TG or a CG or CNG, depending on the methylation status in the genomic DNA. Primers are designed based on particular regions around CpG and/or CpNpG sites or other FMR1 intronic regions.
- Introns or parts thereof including intron/exon boundaries and splicing regions downstream of intron 2 of FMR1 or downstream of the FMR1 gene itself are also contemplated herein as are (i) two or more of (a) an intron; (b) an intron/exon boundary; and/or (c) a splicing region; and/or ⁇ (H) approximately one seventh or greater of an intron including an intron/exon boundary and/or a splicing region within the FMR genetic locus; and/or (iii) a site within the FREE2 portion of the FMR1 gene in combination with an FM.
- a technology which can alternatively be employed for methylation analysis utilizes base-specific cleavage followed by MALDI-TOF mass spectrometry on DNA after bisulfite treatment, where all the 5-methylcytosines residues are converted to thymine (T) or where all unmethylated cytosines residues are not converted to thymine (T).
- Primers are designed based on particular regions around CpG and/or CpNpG sites or other FMR1 intronic regions or downstream thereof. Primer sequences are designed to amplify without bias both converted and unconverted sequences using the PCR amplification process under the medium to high stringency conditions.
- the PCR products are in vitro transcribed and subjected to base specific cleavage and fragmentation analysis using MALDI-TOF MS.
- the size ratio of the cleaved products provides quantitative methylation estimates for CpG sites within a target region.
- the shift in mass for non-methylated (NM) from methylated (M) fragments for a single CpG site is -16 daltons due to the presence of an adenosine residue in the place of a guanosinei
- a software is then used to calculate methylation for each fragment based on this difference in mass, where the output methylation ratios are the intensities of methylated signal/[methylated+unmethylated signal].
- a method for determining the methylation profile of one or more CpG or CpNpG sites located within the genome of a eukaryotic cell or group of cells comprising obtaining a sample of genomic DNA from the cell or group of cells and subjecting the genomic DNA to primer-specific amplification within an intron of a genetic locus and assaying for extent of methylation relative to a control, including a change in the extent of methylation and associating this change with a pathological condition.
- a "nucleic acid” as used herein is a covalently linked sequence of nucleotides in which the 3' position of the phosphorylated pentose of one nucleotide is joined by a phosphodiester group to the 5' position of the pentose of the next nucleotide and in which the nucleotide residues are linked in specific sequence; i.e. a linear order of nucleotides.
- a "polynucleotide” as used herein, is a nucleic acid containing a sequence that is greater than about 100 nucleotides in length.
- oligonucleotide as used herein, is a short polynucleotide or a portion of a polynucleotide.
- An oligonucleotide typically contains a sequence of about two to about one hundred bases.
- the word “oligo” may be used in place of the word “oligonucleotide”.
- the term “oligo” also includes a particularly useful primer length in the practice of the present disclosure of up to about 10 nucleotides.
- primer refers to an oligonucleotide or polynucleotide that is capable of hybridizing to another nucleic acid of interest under particular stringency conditions.
- a primer may occur naturally as in a purified restriction digest or be produced synthetically, by recombinant means or by PCR amplification.
- probe and “primers” may be used interchangeably, although to the extent that an oligonucleotide is used in a PCR or other amplification reaction, the term is generally "primer".
- the ability. to hybridize is dependent in part on the degree of complementarity between the nucleotide sequence of the primer and complementary sequence on the target DNA.
- Complementary or “complementarity” are used in reference to nucleic acids (i.e. a sequence of nucleotides) related by the well-known base-pairing rules that A pairs with T or U and C pairs with G.
- sequence 5'-A-G-T-3' is complementary to the sequence 3 -T-C-A-5' in DNA and 3'-U-C-A-5' in RNA.
- Complementarity can be “partial” in which only some of the nucleotide bases are matched according to the base pairing rules. On the other hand, there may be “complete” or “total” complementarity between the nucleic acid strands when all of the bases are matched according to base-pairing rules.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands as known well in the art. This is of particular importance in detection methods that depend upon binding between nucleic acids, such as those of the disclosure.
- the term "substantially complementary” is used to describe any primer that can hybridize to either or both strands of the target nucleic acid sequence under conditions of low stringency as described below or, preferably, in polymerase reaction buffer heated to 95 °C and then cooled to room temperature.
- the primer when the primer is referred to as partially or totally complementary to the target nucleic acid, that refers to the 3 '-terminal region of the probe (i.e. within about 10 nucleotides of the 3'-terminal nucleotide position).
- Reference herein to a stringency in relation to hybridization includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions.
- low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions.
- Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt ' for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions.
- medium stringency which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions
- high stringency which includes and encompasses from at least about 31% v/v to at least about 50% v/
- T m of a duplex DNA decreases by 1 °C with every increase of 1 % in the number of mismatch base pairs (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974).
- Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS- at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1 % w/v SDS al a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1 % w/v SDS at a temperature of at least 65°C.
- Reference to at least "80% identity” includes 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 and 100%.
- the present disclosure enables determination of a methylation or other epigenetic profile of sites within an intron, intron/exon boundary and/or splicing region of a genetic locus in a genome of a eukaryotic cell or group of cells, the method comprising obtaining a sample of genomic DNA from the cell or group of cells, subjecting the digested DNA to an amplification reaction using primers selected to amplify a region of the genetic locus selected from:
- a methylation profile of the sites within the FMR locus in a genome of a eukaryotic cell or group of cells the methylation profile comprising the extent or level of methylation within the FMR locus
- the method comprising obtaining a sample of genomic DNA from the cell or group of cells, subjecting the digested DNA to an amplification reaction using primers selected to amplify a region of the FMR genetic locus selected from:
- the present disclosure further teaches a methylation profile of the sites within the FMR locus in a genome of a eukaryotic cell or group of cells, the methylation, profile comprising the extent or level of methylation within the FMR locus, the method comprising obtaining a sample of genomic DNA from the cell or group of cells, subjecting the digested DNA to an amplification reaction using primers selected to amplify FREE 3(1) within the F ' MRl gene and then subjecting the amplified DNA to methylation detection means to determine relative to control the extent of methylation wherein a change in methylation relative to the control is indicative of a pathological condition associated with the FMR genetic locus.
- the present disclosure further enables a methylation profile of the sites within the FMR locus in a genome of a eukaryotic cell or group of cells, the methylation profile comprising the extent or level of methylation within the FMR locus, the method comprising obtaining a sample of genomic DNA from the cell or group of cells, subjecting the digested DNA to an amplification reaction using primers selected to amplify all or part of the FREE2 portion of intron 1 of the FMR1 gene and then subjecting the amplified DNA to methylation detection means to determine relative to control the extent of methylation wherein a change in methylation relative to the control is indicative of a pathological condition associated with the FMR genetic locus.
- This aspect further screening for the presence of an FM wherein the combination of hypermethylation in the FREE2 region and an FM is instructive as to cognitive impairment or a likelihood of developing same.
- the cells may be a lymphoblast, a CVS cell, a blood cell, an amniocyte or an EBV transformed lymphoblast cell line.
- the methylation profile may be determined or one or both alleles a genetic locus and in selected cells where mosaicism has occurred.
- the extent of methylation can determine homozygosity or heterozygosity or mosaicism.
- Reference to "mosaicism" includes the situation wherein two or more populations of cells have different genotypes or epigenetic profiles at the genetic locus.
- the diagnostic assay herein can also detect heterozygosity or mosaicism where the methylation pattern is indicative of, for example, in relation to an FMR genetic locus- associated pathology, an FM.
- the latter may also be conducted in combination with an assay to detect (CGG) juxtapos expansion.
- kits for determining the methylation or other epigenetic profile of one or more nucleotides at one or more sites within the genome of a eukaryotic cell or group of cells may comprise many different forms but in one embodiment, the kits comprise reagents for the bisulfite methylation assay.
- a further embodiment of the present disclosure is a kit for the use in the above methods comprising primers to amplify an intron within a genetic locus.
- the present disclosure provides a use of primers which amplify regions of the FMR genetic locus, comprising CpG and or CpNpG sites located within:
- Fragile X-related Epigenetic Element 3 [FREE3 (I)] comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portions or parts thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO: l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO: 2 or a homolog thereof or portions or parts thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the FMR genetic locus selected from: (a) two or more introns; an intron/exon boundary; and/or a splicing region;
- a kit for the use in the above methods comprising primers identified by SEQ ID NOs:6 through 1 1 to amplify an intronic site within the FMR1 genetic locus.
- the nucleotide sequences in SEQ ID NOs:6 through 1 1 comprise primer and tag sequences.
- the present number extends to SEQ ID NO:6 through 1 1 as well as primer only portions therein.
- the primers may also include primers disclosed in PCT/AU2010/000169. Primers may also be ' used to exemplify F EE2 or part thereof or used to identify a subject with an FM.
- the kit may also comprise instructions for use.
- kits are adapted to contain compartments for two or more of the above-listed components.
- buffers, nucleotides and/or enzymes may be combined into a single compartment.
- instructions optionally present in such kits instruct the user on how to use the components of the kit to perform the various methods of the present disclosure. It is contemplated that these instructions include a description of the detection methods of the subject disclosure, including detection by gel electrophoresis.
- kits which contain a primer for a nucleic acid target of interest with the primer being complementary to a predetermined nucleic acid target.
- the kit contains multiple primers or probes, each of which contains a different base at an interrogation position or which is designed to interrogate different target DNA sequences.
- multiple probes are provided for a set of nucleic acid target sequences that give rise to analytical results which are distinguishable for the various probes.
- the multiple probes may be in microarray format for ease of use.
- a kit may comprise a vessel containing a purified and isolated enzyme whose activity is to release one or more nucleotides from the 3' terminus of a hybridized nucleic acid probe and a vessel containing pyrophosphate. In one embodiment, these items are combined in a single vessel. It is contemplated that the enzyme is either in solution or provided as a solid (e.g. as a lyophilized powder); the same is true for the pyrophosphate. Preferably, the enzyme is provided in solution. Some contemplated kits contain labeled nucleic acid probes. Other contemplated kits further comprise vessels containing labels and vessels containing reagents for attaching the labels. Microtiter trays are particularly useful and these may comprise from two to 100,000 wells or from about six to about 10,000 wells or from about six to about 1,000 wells.
- Another important application is in the high throughput screening of agents which are capable of demethylation genomes and in particular intronic regions within genomes. This may be important, for example, in de-differentiating cells and/or treating pathological conditions.
- the present disclosure enables a method for screening for an agent which modulates methylation or other epigenetic modification of a genetic locus, the method comprising screening for a change relative to a control in the extent of methylation or other epigenetic modification in an intron, intron/exon boundary and/or splicing region and/or an intragenic region within the genetic locus which is associated with a pathological condition in the presences or absence of an agent to be tested, wherein an agent is selected if it induces a change in the extent of methylation or other epigenetic change.
- Agents include de-methylation agents and hyper-methylation agents, global and site specific.
- a method for screening for an agent which modulates methylation of an FMR genetic locus in a mammalian cell including a human cell comprising screening for a change relative to a control in the extent of methylation in a region selected from: (i) Fragile X-related Epigenetic Element 3 [FREE3 (I)] in FMR1 comprising the nucleotide sequence set forth in SEQ ID NO: l or a homolog thereof or portions or parts thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: l or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- the present disclosure further teaches a method for monitoring the treatment of a genetic locus-associated disease including a nucleotide expansion disease in which the treatment modulates the methylation of the genetic locus, the method comprising monitoring for a change relative to a control or a pre and post-treatment sample in the extent of methylation within an intron, intron/exon boundary and/or splicing region of the genetic locus.
- nucleotide expansion diseases such as but not limited to polyglutamine (polyQ) diseases such as Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA1), spinocerebella ataxia Type 2 (SCA2), spinocerebella ataxia Type 3 or Machado- Joseph disease (SCA3), spinocerebella ataxia Type 6 (SCA6), spinocerebella ataxia Type 7 (SCA7), spinocerebella ataxia Type 17 (SCA17) and non-polyQ diseases such as Fragile, polyglutamine (polyQ) diseases such as Huntington's disease (HD), dentatorubropallid-oluysiantrophy (DRPLA), spinobulbar muscular atrophy or Kennedy disease (SBMA), spinocerebella ataxia Type 1 (SCA
- autism including co-morbid autism
- Klinefelter's syndrome RNA toxicity disease
- Turner's syndrome a modified X- chromosome.
- cognitive impairment as well as learning and behavioral problems.
- Reference to a "modified" X-chromosome includes skewed X-inactivation, inversions, deletions, duplications, hybrids and any modification leading to X-chromosome inactivation.
- Particular conditions include Fragile X-associated tremor or ataxia (FXTAS), Fragile XE mental retardation (FRAXE), Friedrich's ataxia (FRDA), premutation-related disorders such as but not limited to FXPOI, Fragile type, folic acid type, rare 12 (FRA12A), autism (including co-morbid autism), mental retardation, Klinefelter's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome and cognitive impairment.
- FXTAS Fragile X-associated tremor or ataxia
- FXE Fragile XE mental retardation
- FRDA Friedrich's ataxia
- premutation-related disorders such as but not limited to FXPOI, Fragile type, folic acid type, rare 12 (FRA12A), autism (including co-morbid autism), mental retardation, Klinefelter's syndrome, RNA toxicity disease, Turner's syndrome, a modified X-chromosome and
- the present disclosure further teaches the identification of genes having introns with CpG or CpNpG sites or other methylation-sensitive restriction sites. The identification of these sites permits identification of potential regulatory regions which can be targeted for agonists or antagonists of gene expression.
- a transgene encoding a double stranded RNA homologous to the affected sequences or homologs thereof are transfected as a transgene into cells to methylate the gene, silence it and thereby correct the defect.
- Such double stranded RNA-encoding transgenes are introduced with modulating sequences which protect it from methylation, keep it transcriptionally active and producing double stranded RNA.
- the present disclosure provides a computer program and hardware which monitors the changing state, if any, of extent of methylation over time or in response to therapeutic and/or behavioral modification.
- Such a computer program has important utility in monitoring disease progression, response to intervention and may guide modification of therapy or treatment.
- the computer program is also useful in understanding the association between increasing methylation and disease progression.
- the computer program monitors in a quantitative or semi-quantitative manner one or more features including extent of methylation or other epigenetic modification in an intron of a genetic locus, in addition, the length of a nucleotide expansion may be determined or any epigenetic changes therein.
- a behavioral assessment may be made using criteria associated with normal subjects or subjects considered to be suffering with a disease condition. For example, cognitive ability and/or behavioral deficiency can be measured as well as the general phenotype or clinical manifestations in subjects with a neurodevelopmental or neurodegenerative condition or other condition associated with nucleotide expansion.
- values are assigned to the listed features which are stored in a machine-readable storage medium, which is capable of processing the data to provide an extent of disease progression or change in methylation or other epigenetic modification for a subject.
- the disclosure teaches a computer program product for assessing progression of a pathological condition associated with the FMR locus in a subject, the product comprising:
- the disclosure teaches to a computer for assessing an association between extent of methylation or other epigenetic modification within the FMR locus, the FMR locus and progression of a disease condition wherein the computer comprises:
- a machine-readable data storage medium comprising a data storage material encoded with machine-readable data, wherein the machine-readable data comprise index values associated with the features of one or more of:
- the computer system of the present disclosure may also be linked to detection systems such as MALDI-TOF mass spectrometry machines.
- the present disclosure further provides a web-based system where data on extent of methylation within a genetic locus (optionally together with clinical phenotype) are provided by a client server to a central processor which analyzes and compares to a control and optionally considers other information such as patient age, sex, weight and other medical conditions and then provides a report, such as, for example, a risk factor for disease severity or progression or status or response to treatment or an index of probability of a genetic locus-associated pathology in a subject.
- a report such as, for example, a risk factor for disease severity or progression or status or response to treatment or an index of probability of a genetic locus-associated pathology in a subject.
- the assays herein may be used in existing or newly developed knowledge-based architecture or platforms associated with pathology services. For example, results from the assays are transmitted via a communications network (e.g. the internet) to a processing system in which an algorithm is stored and used to generate a predicted posterior probability value which translates to the index of disease probability which is then forwarded to an end user in the form of a diagnostic or predictive report.
- the assay may, therefore, be in the form of a kit or computer-based system which comprises the reagents necessary to detect the extent of meihylation or other epigenetic modification within the genetic locus and includes computer hardware and/or software to facilitate determination and transmission of reports to a clinician.
- the assay herein described permits integration into existing or newly developed pathology architecture or platform systems.
- a method is provided of allowing a user to determine the status of a subject with respect to an FMR locus- associated pathology, the method including: (a) receiving data in the form of extent of methylation or other epigenetic modification at a site within:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [FREE3 (I)] comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: 1 or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the method generally further includes: (a) having the user determine the data using a remote end station; and
- the base station can include first and second processing systems, in which case the method can include:
- the method may also include: (a) transferring the results of the multivariate or univariate analysis function to the first processing system; and
- the method also includes at lest one of:
- the second processing system may be coupled to a database adapted to store predetermined data and/or the multivariate analysis and/or univariate analysis function, the method including: (a) querying the database to obtain at least selected predetermined data or access to the multivariate or univariate analysis function from the database; and (b) comparing the selected predetermined data to the subject data or generating a predicted probability index.
- the second processing system can be coupled to a database, the method including storing the data in the database.
- the method can also include having the user determine the data using a secure array, the secure array of elements capable of determining the extent of methylation in an intron with a genetic locus and having a number of features each located at respective position(s) on the respective code.
- the method typically includes causing the base station to:
- the method can also include causing the base station to: (a) determine payment information, the payment information representing the provision of payment by the user; and
- the present disclosure also teaches a base station for determining the status of a subject with respect to a pathology associated with a genetic locus such as the FMR locus, the base station including:
- the processing system can be adapted to receive data from a remote end station adapted to determine the data.
- the processing system may include:
- Fragile X-related Epigenetic Element 3 (i) Fragile X-related Epigenetic Element 3 (I) [ FREE3 (I)] comprising the nucleotide sequence set forth in SEQ ID NO: l or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: 1 or which hybridizes to SEQ ID NO:l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- the FREE2 portion of intron 1 enables establishment of a diagnostic or prognostic rule based on the extent of methylation relative to controls.
- the diagnostic or prognostic rule is based on the application of a statistical and machine learning algorithm.
- Such an algorithm uses relationships between methylation profiles and disease status observed in training data (with known disease status) to infer relationships which are then used to predict the status of patients with unknown status.
- An algorithm is employed which provides an index of probability that a patient has an FMR locus-associated pathology. The algorithm performs a multivariate or univariate analysis function.
- the present disclosure teaches a diagnostic rule based on the application of statistical and machine learning algorithms.
- Such an algorithm uses the relationships between epigenetic profile and disease status observed in training data (with known disease status) to infer relationships which are then used to predict the status of patients with unknown status.
- Practitioners skilled in the art of data analysis recognize that many different forms of inferring relationships in the training data may be used without materially changing the present disclosure.
- the present disclosure contemplates the use of a knowledge base of training data comprising extent of methylation within a genetic locus such as the FMR genetic locus from a subject with locus-associated pathology to generate an algorithm which, upon input of a second knowledge base of data comprising levels of the same biomarkers from a patient with an unknown pathology, provides an index of probability that predicts the nature of unknown pathology or response to treatment.
- training data includes knowledge of the extent of methylation relative to a control.
- a “control” includes a comparison to levels in a healthy subject devoid of a pathology or is cured of the condition or may be a statistically determined level based on trials.
- the present disclosure contemplates, therefore, the use of the methylation, including epigenetic profile of intronic sites within the FMR genetic locus and in particular the FMR1 gene to assess or determine the status of a subject with respect to disease, to stratify a subject relative to normal controls or unhealthy subjects, to provide a prognosis of recovery or deterioration and/or to determine the pharmacoresponsiveness or pharmacosensitivity of a subject to treatment or an agent for use in treatment and/or determine applicability for other treatment options including behavioral intervention, and the like.
- intronic sites includes intron/exon boundaries and splicing regions.
- another aspect of the present disclosure provides a method of allowing a user to determine the status, prognosis and/or treatment response of a subject with respect to an FMR locus-associated pathology, the method including:
- Fragile X-related Epigenetic Element 3 comprising the nucleotide sequence set forth in SEQ ID NO:l or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO: 1 or which hybridizes to SEQ ID NO.l or its complementary form under medium stringency conditions;
- intron 2 comprising the nucleotide sequence set forth in SEQ ID NO:2 or a homolog thereof or portion or part thereof defined by having at least 80% nucleotide sequence identity to SEQ ID NO:2 or which hybridizes to SEQ ID NO:2 or its complementary form under medium stringency conditions;
- FXS, premutation and healthy control EBV transformed lymphoblast cell lines were obtained from the tissue culture storage repository of the Murdoch Childrens Research Institute, Melbourne, Victoria, Australia or purchased from Coriell. DNA extraction
- DNA for CGG repeat size PCR and methylation analysis was obtained either from 200 ⁇ 1 venous blood samples anti-coagulated with EDTA or from EBV transformed lymphoblasts 1 to 5xl0 6 cells per sample and extracted using a BIO ROBOT M48 DNA Extractor, as per manufacturer's instructions (Qiagen Inc., Hilden, Germany).
- DNA for Southern blot or methylation analysis was extracted from 3ml blood samples anti- coagulated with EDTA or from EBV trahsformed lymphoblasts 5 to lOxlO 6 cells per sample.
- CGG repeat size for all samples was initially assessed using a fully validated PCR assay with precision of +/- one triplet repeat across the normal and GZ ranges, performed using a fragment analyzer (MegaBace, GE Healthcare), with the higher detection limit of 170 repeats, as previously described (Khaniani et al , Mol Cytogenet 1(1):5, 2008). Briefly, PCR amplifications were performed using primers:
- Alleles were sized by capillary electrophoresis using an automatic sequencer (MegaBACETM 1000 - GE HealthCare Amersharn) with size standards (HealthCare) and controls of lengths 10, 23, 29, 30, 52 and 74 repeats determined by sequencing in-house or obtained from Coriel Cell Repositories web site (http://www.phppo.cdc.gov/dls/genetics/qcmaterials/). CGG repeat size by Southern Blot
- CGG sizes were assessed using a fully validated Southern Blot procedure with appropriate normal and abnormal controls for samples where the products could not be amplified using PCR (Fu et al 1991, supra; Francis et al., Mol Diagn 5(3):22 ⁇ -225, 2000). Briefly, 5mg of DNA was digested with Pstl (Boehringer Mannheim, Castle Hill, Australia), separated on 1% w/v agarose gels, and analyzed by Southern blot hybridization. The FMR-1 gene was detected using Southern blot analysis with probe Fxa3 and an X chromosome control probe, pS8 (Yu et al , Science 252(5010): ⁇ 179- 1 181 , 1991 ).
- Probes were labeled using random oligonucleotide priming (Boehringer, Mannheim) with [a32-P]CTP (NEN Dupont, Boston, MA). Autoradiography was performed at -80°C, with intensifying screens and Kodak XAR films (Sigma-Aldrich).
- the FMR1 alleles were detected using Southern blot analysis with probe S.B 12.3, labeled with Dig-l l-dUTP by PCR (PCR Dig Synthesis kit; Roche Diagnostics). Autoradiography was performed with intensifying screens and Fuji Medical X-Ray film (Bedford, UK) and FMRl methylation values for the expanded alleles were calculated as preciously described (Tassone et al., 2008 supra).
- the FMRl activation ratios for female samples were calculated based on the following formula: optically scanned density of the 2.8kb band / combined densities of the 2.8kb and 5.2kb bands (where the 2.8kb band represents the proportion of normal active X and the 5.2kb band represents the proportion of normal inactive X), as preciously described (de Vries et al, 1996 supra).
- the captured DNA was then washed in Reagent #4 (XCEED kit, Human Genetic Signatures, Sydney, Australia), and DNA eluted twice by placing 50 ⁇ 1 of the pre-warmed solution #5 (XCEED kit, Human Genetic Signatures, Sydney, Australia) onto column membrane, which was incubated for 1 minute at room temperature, and spun down at 10,000g for 1 minute. The eluted DNA was then incubated at 95°C for 20 minutes, with resulting final concentration at ⁇ 20ng ⁇ l per sample.
- Reagent #4 XCEED kit, Human Genetic Signatures, Sydney, Australia
- the modified and cleaned DNA was then eluted with 40 ⁇ 1 of the CF6 solution (Methylamp kit, Epigentek, Brookly, NY, USA), with resulting converted DNA final concentration at ⁇ 20ng ⁇ l per sample.
- the converted DNA was kept at -20°C, and for storage of more than 3 months it was kept at -80°C.
- the primers used to amplify the target regions and the annealing temperatures are listed in Tables 3 and 4.
- Each bisulfite converted sample was analyzed in duplicate PCR reactions, carried out in a total volume of 5 ⁇ 1 using lpmol of each primer, 40 ⁇ dNTP, 0.2 U Hot Star Taq DNA polymerase (Qiagen Inc., Hilden, Germany), 1.5mM MgCl 2 and buffer supplied with the enzyme (final concentration IX).
- the reaction mix was pre-activated for 15min at 95°C, followed by 45 cycles of amplification at 94°C for 20s, primer specific annealing for 30s and 72°C for 1 min followed by 72°C for 3 min.
- PCR products were run on 1.5% w/v agarose gel to confirm successful PCR amplification and efficiency.
- the DNA was then cleaned up and the T or C-cleavage reactions were carried out (T-cleave for Amplicons 1 to 5, C-cleave for Amplicon 5 only) as per manufacturer's instructions (SEQUENOM, San Diego, CA). Briefly, unincorporated dNTPs were dephosphorylated by adding 1.7 ⁇ 1 H 2 0 and 0.3U Shrimp Alkaline Phosphatase (SAP) [SEQUENOM, San Diego] to PCR products, which were incubated at 37°C for 20min, and lOmin at 85°C to heat-inactivate the SAP.
- SAP Secure Solubility
- the transcription was performed on 2 ⁇ 1 of template DNA in the 6.5ul reaction consisting of 20 U of the T7 R&DNA polymerase (Epicentre, Madison, WI) to incorporate either dCTP or dTTP; Ribonucleotides at InM and the dNTP substrate at 2.5mM, with other components used as recommended (SEQUENOM, San Diego).
- RNase A SEQUENOM, San Diego
- the mix was diluted to 27 ⁇ 1 in H 2 0, and 6mg CLEAN Resin (SEQUENOM, San Diego, CA) was added for conditioning of the phosphate backbone prior to MALDI- TOF MS.
- the SEQUENOM Nanodispenser was then used to spot the samples onto a SpectroCHIP for subsequent analysis.
- MassARRAY mass spectrometer (Bruker- SEQUENOM) was then used to collect mass spectra, which were analyzed using the EpiTYPER software (Bruker-SEQUENOM).
- the calculation of the output methylation ratios for each CpG unit were based on the ratio of the signal intensities for the fragment from a methylated CpG unit/[methylated+unmethylated CpG units]. Further details are described in (Godler et al, 2010 supra).
- RNA sample was then diluted to 30ng/ul, to be used in for reverse transcription real-time PCR analysis, where mRNA quality at the Xq27.3 region was initially assessed by examining the relationship between 5" and 3" levels of FMR1 mRNA.
- Reverse transcription was performed one reaction per sample using the Multiscribe Reverse Transcription System, 50 units/ ⁇ (Applied Biosystems).
- the 7900HT Fast Real Time PCR (Applied Biosystems) was used to quantify FMR1-5', FMR1 -3', ASFMR1 (-1), (-2), (-3), GAPDH, B2M, and GUS, using the relative standard curve method.
- the target gene and the internal control gene dynamic linear ranges were performed on a series of doubling dilutions of an RNA standard (160-4 ng/ ⁇ ). Since, both ASFMR1 assays do not target an exon/exon boundary, to minimize the impact of potential DNA contamination on the expression results, a no reverse transcription enzyme control was included for every sample.
- ASFMR1 expression value The difference between the plus and minus no reverse transcriptase control was considered as the ASFMR1 expression value for each sample.
- Previously published sequences were be used for primers and probe for: FMR1-5' and GUS (32); FMR1-3' (41).
- the following ASFMR1 primers and probes were designed using Primer Express 3.0 (Applied Biosystems):
- ASFMR1 (-1) - Fw Primer (CCGCGGAATCCCAGAGA) [SEQ ID NO:34]; Rv Primer: (CAGTGGCGTGGGAAATCAA) [SEQ ID NO:35]; Probe: (FAM- TGGGATAACCGGATGCA-MGB) [SEQ ID NO:36].
- ASFMR1 (-2) - Fw Primer: (ACACCCTGTGCCCTTTAAGG) [SEQ ID NO:37]; Rv Primer: (TCAAAGCTGGGTCTGAGGAAAG) [SEQ ID NO:38]; Probe: (VIC- TCGGGATCTCAAAATGT-TAMRA) [SEQ ID NO:39].
- Rv Primer (GCCCTAGATCCACCGCTTTAA) [SEQ ID NO:41]; Probe: (FAM- TGCTGGTGGAACTC-MGB) [SEQ ID NO:42].
- FMR1-5', FMR1-3', ASFMRl primers and probes were be used at concentrations of 18 ⁇ and 2 ⁇ , respectively.
- GAPDH and B 2 M primer/probe mixes will be obtained from PrimerDesign (PerfectProbe ge-PP-12-hu kit) and used at concentration of 2 ⁇ . All of the above assays were single-plexed, with each sample assayed in duplicate 10 ⁇ PCR reactions.
- the reactions consisted of 5.8 raM MgC12, 1 ⁇ Buffer A (Applied Biosystems), 3.35 ⁇ Rnase-free water, 1.2 mM dNTPs, 0.01 units/ ⁇ of AmpliTaq Gold, 0.5 ⁇ 1 of TaqMan probe and 0.5 ⁇ 1 forward and 0.5 ⁇ 1 reverse primers, and ⁇ ⁇ of the reverse transcription (cDNA) reaction.
- the annealing temperature for thermal cycling protocol was 60°C for 40 cycles.
- the samples were quantified in arbitrary units (au) in relation to the standard curves performed on each plate, standardized to the mean of the 3 internal control genes (GUS, GAPDH and B 2 M).
- Participants comprised 50 PM and 20 FM carrier human females and 21 control females. Other participants included 14 PM and 2 FM carrier human females.
- the standardized assessments of cognitive status for PM and FM participants were performed using Wechsler Adult Intelligence Scale (WAIS-III) IQ tests.
- the PM carriers were between 26 and 67 years of age.
- the FM carriers were between 7 and 35 years of age.
- the controls were between 2 and 38 years of age. Fifteen controls had no clinical history of developmental delay. All controls had CGG allele sizes below 40 repeats.
- a fully validated PCR assay was initially used to determine CGG repeat sizes using a fragment analyzer (MegaBace, GE Healthcare), with a higher detection limit of 170 repeats, as described (Khaniani et al. (2008) supra).
- a fragment analyzer MegaBace, GE Healthcare
- methylation of the FMR1 CpG island was assessed using a fully validated methyl sensitive Southern blot procedure with appropriate normal and abnormal controls, as described (Tassone et al. (2008) supra; de Vries et al. (1996) supra); EcoRl and Nrul digestion was performed on 7 to 9 ⁇ g of DNA.
- the FMR1 activation ratios for female samples was calculated based on the ratio of density (optically scanned) of the 2.8kb band to combined densities of the 2.8kb and 5.2kb bands, where the 2.8kb band represents the proportion of normal active X and the 5.2kb band represents the proportion of normal inactive (methylated) X (de Vries et al. (1996) supra).
- MassARRAY mass spectrometer (Bruker- Sequenom) was then used to collect mass spectra, which were analyzed using the EpiTYPER 1.0.5 software (Bruker-Sequenom).
- the calculation of the output methylation ratios for each CpG unit was based on the ratio of the signal intensities for the fragment from a methylated CpG unit/[methylated+unmethylated CpG units] as described (Godler et al. (2010) supra).
- the structure of the FMR genetic locus is shown in Figure 1A and comprises the FMRl promoter, and FMRl and ASFMR1 genes.
- a CGG repeat is located within the 5' (UTR) of the FMRl gene.
- ASFMR1 spans the CGG expansion in the antisense direction and is also regulated by another promoter located in the exon 2 of FMRl .
- the FREE2 located downstream of the CGG expansion.
- the FREE3 region is located within intron 2 of FMRl downstream of the second ASFMR1 promoter.
- the primers utilized for MALDI-TOF methylation analysis targeted 6 regions at the Xq27.3 locus designated as FREE2(A) [described as amplicon 5 in Godler el ai, 2010 supra ⁇ ; FREE2(B); FREE2(C); FREE2(D); FREE2(E); FREE2(F) and FREE3/ASFMR (color coded) [Figure IB].
- FREE2(A) [described as amplicon 5 in Godler el ai, 2010 supra ⁇ ; FREE2(B); FREE2(C); FREE2(D); FREE2(E); FREE2(F) and FREE3/ASFMR (color coded) [Figure IB].
- Individual CPG sites within each region are numbered accordingly.
- Prominent transcription factor binding sites and methylation sensitive restriction enzyme recognition sites are indicated in capital font, and are listed/identified in Table 3.
- Numerous Hpall/Mspl sites (CCGG) are located throughout the FREE2 A, B and C region.
- Regions identified as biologically significant showed consistent differences in methylation between healthy controls and FXS samples ( Figures 2A through C). These include Hpall Mspl sites throughout FREE2 A, B, C, D, E and F regions including but not restricted to the FREE2B CCGG sites located at CpGs 6, 9, 13 and between CpGs 25 and 26; as well as FREE2 (C) CCGG site located at CpGl . These would be sensitive to Hpall methylation specific digestion, which can be followed by PCR or other restriction enzyme based methods to assay differential methylation between healthy controls and FXS samples, and potentially carriers of smaller expansion alleles.
- RNA:DNA hybrids Differential methylation of any of these sites in diseased individuals compared to controls may have an affect of relevant transcription factor binding and/or further epigenetic modification; which would inturn affect transcription of FMR1, ASFMR1 and/or FMR4. Or may result or reflect aberrant non coding RNA expression and/or RNArDNA interactions or stability of RNA:DNA hybrids ( Figuress 3 and 4).
- CTCF CCCTC-binding factor
- Sites designated ACpG 10-12 are identified in the proximal region between FREE(A) and FREE2(B) to be most informative for the severity of cognitive impairment from the comparison of methylation within FREE2(A) which contains a total of 12 CpG sites(see Godler et al. (2012) supra). These biomarker sites are located at the 5' end of a large CTCF binding site. Data indicate that there are more of these informative sites well within the FMRl intron 1. Furthermore, inside the intron there is a novel 3' epigenetic boundary, with 57 novel biomarker sites, in proximity of the 3 'epigenetic boundary and a second smaller CTCF binding site.
- (B)CpGl l and (B) CpG16 also had fragments of the same mass. SEQUENOM mass. Methylation for these fragments of the same mass; which explains why values are identical for units represented in the same color. Green arrow indicates methylation of a CpG unit 10-12 was noted which was previously described to be significantly associated with the type and severity of cognitive impairment in female carrier of expanded FMR1 alleles. Methylation CpG unit was identified which clearly separates the FM individuals into two distinct groups. Methylation CpG units were identified at the novel 3' epigenetic boundary.
- the 3' epigenetic boundary within FREE2 acts as an insulator, protecting the FMRl promoter from being hypermethylated in controls, PM carriers, and 'high functioning' UFM males.
- FM/FXS males with cognitive impairment with no FMRl expression the 3' epigenetic boundary disappears.
- the phenomenon of FXS specific methylation does not apply to the CpG sites within the ASFMR1 promoter, as the ASFMR1 promoter is equally hypermethylated in control, PM, low and high functioning FM individuals.
- the ASFMR1 promoter is hypomethylated, while in lymphoblast controls it is hypermethylated, suggesting that differential expression of ASFMR1 contributes to the FXS phenotype in a cell type specific manner.
- DNA from lymphoblasts of healthy controls with 30 CGG repeats, normal levels of FMR1 mRNA and FMRP, and DNA from lymphoblasts of FXS patient with 530 CGG, silenced FMR1 transcription and absence of FMRP were mixed at ratios of 1 :0; 2: 1 ; 1 : 1 ; 1 :2; 0:1 corresponding to 0, 33.3, 50, 66.6, 100% FXS DNA in the sample.
- the spiked DNA samples were bisulfite converted in duplicate reactions.
- Each reaction was amplified with primer sets (forward and reverse primers) as listed by NOs: ID NOs: which corresponded to 3 SEQUENOM mass spectrometry assays (A: FREE2(B); B: FREE2(C); C: FREE3).
- the spiked DNA samples were analyzed using MALDI-TOF methylation analysis at three sequential regions at the Xq27.3 locus (see Figures 1A and B for locations).
- the methylated vs unmethylated ratios at each analysable CpG unit were expressed as output methylation ratios on Y axis, with FXS DNA input % expressed on the X axis (each point represents mean of duplicate PCRs from a single bisulfite converted DNA mixture).
- Standard curve and amplification real-time PCR plots show that in the FXS cell lines with fully methylated FMR1 promoter and silenced FMR1 and FMRP, ASFMR1 is expressed.
- RNA was extracted from 3 FXS cell lines whose methylation profiles are presented in Figure 2; Sample 849 was taken from the male 490 CGG repeat line; Sample 862 was taken from the male 530 CGG repeat line; Sample 865 was taken from the female 563 and 47 CGG repeat line.
- Each RNA sample was split in two, with one half subjected to Rnase A treatment prior to ASFMRl (-3) relative standard curve analysis.
- the ASFMRl (-3) real-time PCR analysis was performed in quadruplicate reactions. The difference in Ct values between Rnase A treated and untreated samples represents the level of ASFMRl expression.
- Standard curve and amplification real-time PCR plots also indicate that in the FXS cell lines, ASFMRl RNA forms RNA:DNA complexes.
- FXS RNA samples were treated with TURBO Dnase and RQl Dnase. These Dnase treatments caused complete loss of real-time-PCR signal for the ASFMRl (-3) assay. Because Dnase can only degrade RNA molecules if they form complexes with DNA, loss of ASFMRl after Dnase treatment suggests that ASFMRIRNA forms RNA:DNA complexes in FXS samples with fully methylated FMR1 promoter and silenced FMR1 expression,
- the FMR1 and ASFMRl transcripts were quantified using real-time RT-PCR relative standard curve method, normalized to mRNA levels of three internal control genes, GUS, GAPDH and B2M.
- FMR15' and 3' assays showed no signal for the FXS RNA samples, while similar levels were detected in all control samples ( Figures 4A, B and C).
- TURBO and RQl DNAse treatment cased -50% decrease in the FMR1 levels in most of the control samples; while Rnase A treatment caused complete loss of FMRl and ASFMRl signals.
- FMRl intron 1 methylation in blood predicts cognitive impairment in female carriers of expanded FMRl alleles
- FMRl intron 1 methylation in blood is significantly correlated with cognitive scores
- the aim of this Example was to identify those FREE2 CpG sites within intron 1 of the FMRl gene which can be most effectively used to detect low functioning FM human females amongst control, PM and FM human females.
- the data on full scale IQ (FIQ), verbal IQ (VIQ) and performance IQ (PIQ), as well as whole blood DNA were available in this cohort, and DNA was re-tested in this study using the Sequenom EpiTYPER system and Southern blot tools to determine methylation output ratio and activation ratio, respectively.
- the sensitivity was further determined, which represents the proportion of the low functioning females (IQ ⁇ 70) identified as having a positive methylation test result, and specificity, which represented the proportion of borderline to normal IQ (IQ>70) identified as having a negative methylation test result.
- IQ ⁇ 70 the proportion of the low functioning females identified as having a positive methylation test result
- specificity which represented the proportion of borderline to normal IQ (IQ>70) identified as having a negative methylation test result.
- the specificity for CpG unit 6/7 was 95%, while for the CpG unit 10-12 it was 94%.
- VIQ ⁇ 70 VIQ ⁇ 70
- Two outliers that had methylation output ratio for CpG unit 6/7 above the positive threshold of 0.47 represented FM human females, where methylation output ratios were 0.6 and 0.62 with VIQ values of 95 and 77, respectively.
- VIQ is merely a combination of scores representing different aspects of verbal skills and memory
- Arithmetic skills which largely rely on the working memory and attention, stood out as the subtest score showing the highest correlations with intronic methylation, and the only clinical measure that showed a highly significance significant relationship with methylation of the exonic units.
- Arithmetic skills were found impaired in FM human females even in the absence of other cognitive impairments (Lachiewicz et al. (2006) Am J Med Genet A. 140(7) :665 -672; Wisniewski et al. ( 1985) Ann Neruol 18(6):665-669). Consistent with these data, it was found that even in high- functioning FM human females with VIQ>70, the FREE2 analysis can identify individuals with specific impairments in Arithmetic.
- results presented in this study for FXS may also highlight the importance of epigenetic modification of intronic-exonic boundary sequences and intragenic methylation in general on clinical outcome in other triplet-repeat nucleotide expansion disorders.
- the data show that FREE2 MALDI-TOF MS methylation analysis of FMRl intron 1 sequences is superior to methylation sensitive Southern blot and FMRP immunostaining in blood as a predictor of cognitive impairment in female carriers of expanded FMRl alleles. Because previously developed PCR based tests for FMRl CpG island methylation analysis (Coffee et al.
- Patient cohort A total of 409 archival blood DNA samples from carriers of expanded FMR1 alleles and healthy controls, with parallel ADOS and WISC IQ scores and sub-score data are assessed. These include 227 males (71 FM, 16 PM/FM mosaics, 70 PM males and 70 controls) and 182 females (40 FM, 1 16 PM and 20 controls).
- Cognitive and behavioral assessments are also performed on an additional 120 FMR1 expansion carriers (60 FM and 60 PM) and 30 age matched controls. Blood and saliva are collected from these 150 individuals. In addition, blood and saliva from 40 controls are assessed.
- Neuropsychological assessments The individuals whose archival data and DNA samples are assessed using the Autism Diagnostic Observation Schedule-Generic (ADOS- G) (Loesch et al. (2007) Neurosci Behav Rev 31(3):3 ⁇ 5-326) and Wechsler intelligence test appropriate for chronological age: WPPSI-III for ages less than 6, WISC-III for ages between 6 and 16 years and WAIS-III for ages greater than 16 years.
- the cognitive status of these individuals is described in Loesch et al. (2007) supra, and this information is used for the epi-genotype-phenotype assessments. Additional PM and FM individuals recruited in this study undergo the same clinical assessments.
- RNA extractions and reverse transcription real-time PCR The 7900HT Fast Real Time PCR (Applied Biosystems) is used to quantify FMR1-5', FMR1-3', ASFMR1, and three internal control genes using the relative standard curve method. All of the above assays are single-plexed, using PCR conditions descibred in Godler ei al. (2009) BMC Clincial Pathol 9(1 ):5.
- Nonparametric regression is used to determine whether there is a non-linear relationship between each predictor of FREE1 and FREE2 methylation levels in PM and FM individuals, and cognitive/behavioral and molecular outcome measures in the combined sample of 433 expansion carriers; (ii) FMR1/ASFMR1 mRNA and FMRP levels in blood samples of the freshly recruited 120 carriers.
- a best subset of CpG variables that are independently associated with cognitive measures, FMR1/ASFMR1 expression and FMRP in blood are identified using stepwise forward/backward multiple logistic regression model using the Bayesian Information Criterion (BIC) and validated (Godler et ah. (2012) supra).
- Anova or nonparametric ruskal-Wallis rank test are used to compare the differences in the levels of methylation for specific CpG units within FREEl and FREE2 regions, and the neuropsychological and molecular measures between the PM, FM and age matched control groups.
- Determination in lymphoblasts of FMR1 expansion carriers the functional significance of abnormal methylation at CTCF binding sites on CTCF binding, preservation of the epigenetic boundaries and prevention of methylation spreading into the FMR1 promoter, and the affect of these events on FMR1/ASFMR1/FMRP production.
- Lymphoblast cell lines There are 83 lymphoblast cell lines from patients recruited for FXS/FMRl studies. Of these 30 are control cell lines (CGG ⁇ 40); 40 PM (CGGs 56 to 170); 1 1 FM/FXS (CGGs 200 to 715); 2 'high functioning' (IQ>70) UFM males (CGGs 230 to 650). 25 of these have been already characterized for FMR1 expression, FMRP, and FREE 1/2 methylation.
- Targeted methylation is performed of single CpG sites using: (i) transfection of 16- bp phosphorothioated oligonucleotide (Proligo, Boulder, CO) with 5 '-methyl cytosines (mC) in CpG dinucleotide; (ii) DNA Methyltransferase coupled to a triple helix forming oligonucleotide in control, PM and UFM cell lines.
- mC 5 '-methyl cytosines
- RNAi-depletion of CTCF Knockdown of CTCF is performed using modified siRNA protocols from Thermo Scientific Dharmacon (ON-TARGET /ws siRNA Reagents, Thermo Scientific Dharmacon). The effectiveness of the knockdown is monitored using CTCF real time PCR assay. It is then determine whether CTCF knockdown affects methylation of 5' and 3' epigenetic boundaries and proximal regions, as well as FMRl/ASFMRl mRNA and FMRP levels in 5 control, 5 PM and 5 FM/FXS and 2 UFM cell lines.
- FMR1 intron 1 If the site specific separation deep within FMR1 intron 1 is related to: (i) differential CTCF binding in FXS affected compared to UFM males, PM, and controls; (ii) FMR1/ASMR1 expression and the severity of the phenotype in FM and PM carriers; it provides an avenue for epigenetic treatments targeted at re-activation of FMRl/ASFMRl transcription in FXS, or reduction of RNA toxicity observed in PM individuals.
- Patient cohort The freshly recruited 120 carriers (60 FM, 60 PM) and 70 age matched controls (see Example 9) is used for the blood/saliva methylation comparison. Neuropsychological assessments in these individuals are performed as in Example 9.
- Laboratory protocols Saliva samples are collected using the Oragene® DNA Sel - Collection Kit and isolated as per manufacturer's instructions (DNA Genotek Inc., Ottawa, Canada). Blood is collected, and methylation analyses are performed in blood and saliva DNA as detailed in Example 9.
- Statistical analysis The sensitivity is considered to be a measure of the probability of correctly identifying the presence of specific cognitive and behavioral deficits as determined using neuropsychological assessments, and the specificity - a measure of the probability of correctly identifying a person not affected.
- the individuals would be considered as affected with: (i) ASD if the ADOS-G score is >17; (ii) cognitive impairment if IQ test score is ⁇ 70; or cognitive indexes or cognitive sub-scores are ⁇ 7.5. Comparisons between the median methylation for each FREE1 and FREE2 unit for blood and saliva DNA between PM and FM groups and healthy controls will be also conducted using the nonparametric Mann- Whitney two-sample test. Furthermore, nonparametric regression will be used to determine whether there is a non-linear relationship between each predictor of FREE1 and FREE2 methylation levels in PM and FM groups in saliva and blood, and cognitive/behavioral outcome for the subsample of 120 carriers.
- Newborn Guthrie spot samples The newborn blood spots have been collected between 1971 and 2012, by a newborn screening program after all newborn screening has been completed. Newborn blood spots are already available for 26 FM individuals recruited by CIC through FXS cascade testing. To complete the dataset, blood spots of additional 34 FM and 60 PM tested in blood and saliva in Example 9, are retrieved from repositories for methylation testing. The methylation results for these 120 expansion v carriers (60 FM, 60 PM) in whole blood and saliva taken at the time of consent (greater than 5 years of age, detailed in Example 9) are compared to their results in newborn blood spots. The blood spot results will be also compared to neuropsychological assessments in these individuals as detailed in Example 9.
- the positive predictive values are determined through a retrospective analysis of 60 FM and 60 PM newborn bloodspots using FREE MALDI-TOF MS.
- the positive predictive values for FREE methylation analysis are calculated as the probability of methylation of specific CpG sites within FREE1 and/or FREE2 regions to provide a positive test result as determined using: (i) methylation analysis in venous blood and saliva DNA at greater than 5 years of age; (ii) neuropsychological assessments in affected subjects greater than 5 years of age.
- the positive methyiation thresholds for each clinical measure are determined using the receiver operating characteristic (ROC) curve analysis and the ability of the methyiation value at each CpG site to classify the affected and not affected classes for each clinical measure are determined as described.
- ROC receiver operating characteristic
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Medical Informatics (AREA)
- Evolutionary Biology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2011902500A AU2011902500A0 (en) | 2011-06-24 | Treatment and diagnosis of epigenetic disorders and conditions | |
| PCT/AU2012/000731 WO2012174610A1 (en) | 2011-06-24 | 2012-06-22 | Treatment and diagnosis of epigenetic disorders and conditions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2723902A1 true EP2723902A1 (de) | 2014-04-30 |
| EP2723902A4 EP2723902A4 (de) | 2015-02-18 |
Family
ID=47421923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP12803257.0A Withdrawn EP2723902A4 (de) | 2011-06-24 | 2012-06-22 | Behandlung und diagnose epigenetischer störungen und erkrankungen |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20140212873A1 (de) |
| EP (1) | EP2723902A4 (de) |
| AU (1) | AU2012272518A1 (de) |
| WO (1) | WO2012174610A1 (de) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013131981A1 (en) * | 2012-03-08 | 2013-09-12 | Novartis Ag | Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs) |
| US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
| KR20150030205A (ko) | 2012-05-16 | 2015-03-19 | 라나 테라퓨틱스, 인크. | Smn 유전자 패밀리 발현을 조절하기 위한 조성물 및 방법 |
| EP3033422A4 (de) | 2013-08-16 | 2017-08-02 | Rana Therapeutics Inc. | Oligonukleotide zum targeting von euchromatinregionen von genen |
| JP2016534035A (ja) | 2013-10-04 | 2016-11-04 | ラナ セラピューティクス インコーポレイテッド | 筋萎縮性側索硬化症を治療するための組成物及び方法 |
| KR101777367B1 (ko) | 2015-09-09 | 2017-09-12 | 연세대학교 산학협력단 | Fmr1 유전자를 타겟으로 하는 엔도뉴클레아제를 이용한 cgg 반복의 교정 |
| WO2017049192A1 (en) * | 2015-09-17 | 2017-03-23 | University Of Massachusetts | Compositions and methods for modulating fmr1 expression |
| EP3299456A1 (de) * | 2016-09-26 | 2018-03-28 | Université de Strasbourg | Rekombinante dgkk-gene für fragile x-syndrom-gentherapie |
| CA3106738C (en) * | 2017-07-25 | 2025-02-11 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | METHOD FOR MODULATING RNA SPLICING BY INDUCING A BASE MUTATION AT A SPLICE SITE OR A BASE SUBSTITUTION IN A POLYPYRIMIDIN REGION |
| GB201810897D0 (en) * | 2018-07-03 | 2018-08-15 | Chronomics Ltd | Phenotype prediction |
| CN109979530B (zh) * | 2019-03-26 | 2021-03-16 | 北京市商汤科技开发有限公司 | 一种基因变异识别方法、装置和存储介质 |
| EP4130297A1 (de) * | 2021-08-05 | 2023-02-08 | Beijing OriginPoly Bio-Tec Co., Ltd. | Marker, primer, sonden und kit für frühes screening und frühe diagnose von endometriumkrebs |
| KR20240133725A (ko) * | 2021-12-23 | 2024-09-04 | 유니버시티 오브 매사추세츠 | 취약 x 관련 장애의 치료용 치료제 |
| US20250059604A1 (en) * | 2021-12-23 | 2025-02-20 | University Of Massachusetts | Biomarkers and methods related to fragile x syndrome |
| EP4476360A1 (de) * | 2022-02-09 | 2024-12-18 | Laboratory Corporation of America Holdings | Verfahren und systeme zum nachweis der methylierung von fragilem x |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120094288A1 (en) * | 2009-02-17 | 2012-04-19 | Murdoch Childrens Research Institute | Assay for determining epigenetic profiles of markers of fragile x alleles |
| US20130210007A1 (en) * | 2010-08-11 | 2013-08-15 | Murdoch Childrens Research Institute | Treatment and diagnosis of epigenetic disorders and conditions |
-
2012
- 2012-06-22 AU AU2012272518A patent/AU2012272518A1/en not_active Abandoned
- 2012-06-22 US US14/128,319 patent/US20140212873A1/en not_active Abandoned
- 2012-06-22 EP EP12803257.0A patent/EP2723902A4/de not_active Withdrawn
- 2012-06-22 WO PCT/AU2012/000731 patent/WO2012174610A1/en not_active Ceased
Non-Patent Citations (7)
| Title |
|---|
| ANJA NAUMANN ET AL: "A Distinct DNA-Methylation Boundary in the 5'- Upstream Sequence of the FMR1 Promoter Binds Nuclear Proteins and Is Lost in Fragile X Syndrome", THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 85, 13 November 2009 (2009-11-13), pages 606-616, XP55029391, DOI: 10.1016/j.ajhg.2009.09.018.a2009 * |
| D. E. GODLER ET AL: "Fragile X Mental Retardation 1 (FMR1) Intron 1 Methylation in Blood Predicts Verbal Cognitive Impairment in Female Carriers of Expanded FMR1 Alleles: Evidence from a Pilot Study", CLINICAL CHEMISTRY, vol. 58, no. 3, 10 January 2012 (2012-01-10), pages 590-598, XP055160573, ISSN: 0009-9147, DOI: 10.1373/clinchem.2011.177626 * |
| D. KUMARI ET AL: "The distribution of repressive histone modifications on silenced FMR1 alleles provides clues to the mechanism of gene silencing in fragile X syndrome", HUMAN MOLECULAR GENETICS, vol. 19, no. 23, 14 September 2010 (2010-09-14), pages 4634-4642, XP55075963, ISSN: 0964-6906, DOI: 10.1093/hmg/ddq394 * |
| GODLER DAVID E ET AL: "FMR1 intron 1 methylation predicts FMRP expression in blood of female carriers of expanded FMR1 alleles", JOURNAL OF MOLECULAR DIAGNOSTICS,THE, AMERICAN SOCIETY FOR INVESTIGATIVE PATHOLOGY, US, vol. 13, no. 5, 1 September 2011 (2011-09-01), pages 528-536, XP008163367, ISSN: 1525-1578, DOI: 10.1016/J.JMOLDX.2011.05.006 * |
| NATALIA DOLZHANSKAYA ET AL: "Alternative Splicing Modulates Protein Arginine Methyltransferase-Dependent Methylation of Fragile X Syndrome Mental Retardation Protein +", BIOCHEMISTRY, vol. 45, no. 34, 1 August 2006 (2006-08-01), pages 10385-10393, XP055161181, ISSN: 0006-2960, DOI: 10.1021/bi0525019 * |
| PIETROBONO ROBERTA ET AL: "MOLECULAR DISSECTION OF THE EVENTS LEADING TO INACTIVATION OF THE FMR1", HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, SURREY, vol. 14, no. 2, 24 November 2004 (2004-11-24), pages 267-277, XP009085334, ISSN: 0964-6906, DOI: 10.1093/HMG/DDI024 * |
| See also references of WO2012174610A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20140212873A1 (en) | 2014-07-31 |
| WO2012174610A1 (en) | 2012-12-27 |
| EP2723902A4 (de) | 2015-02-18 |
| AU2012272518A1 (en) | 2014-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20140212873A1 (en) | Treatment and diagnosis of epigenetic disorders and conditions | |
| Godler et al. | Methylation of novel markers of fragile X alleles is inversely correlated with FMRP expression and FMR1 activation ratio | |
| US10138521B2 (en) | Treatment and diagnosis of epigenetic disorders and conditions | |
| AU2006224973B2 (en) | Markers for prenatal diagnosis and monitoring | |
| JP5219516B2 (ja) | 染色体異数性の検出方法 | |
| AU2010215061B2 (en) | Assay for determining epigenetic profiles of markers of Fragile X alleles | |
| JP2018533953A (ja) | 胎児と妊娠女性との間において差次的にメチル化されるdna領域を用いる胎児染色体異数性の検出 | |
| US20220228214A1 (en) | Assay for quantitating the extent of methylation of a target site | |
| Bachinski et al. | Most expression and splicing changes in myotonic dystrophy type 1 and type 2 skeletal muscle are shared with other muscular dystrophies | |
| Shah et al. | Differential methylation of the type 2 diabetes susceptibility locus KCNQ1 is associated with insulin sensitivity and is predicted by CpG site specific genetic variation | |
| US20210024999A1 (en) | Method of identifying risk for autism | |
| US20130338032A1 (en) | Assay for determining epigenetic profiles of markers of fragile x alleles | |
| Boonen et al. | Two maternal duplications involving the CDKN1C gene are associated with contrasting growth phenotypes | |
| Zhang et al. | Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study | |
| WO2014114922A1 (en) | Methods for estimating the size of disease-associated polynucleotide repeat expansions in genes | |
| KR101617612B1 (ko) | 한국인의 고혈압 예측용 snp 마커 | |
| KR20150092937A (ko) | 한국인의 고혈압 예측용 snp 마커 | |
| EP1664336A2 (de) | Erkennungsverfahren für autismus und verwandte krankheiten | |
| JP5263919B2 (ja) | メタボリック症候群の検査方法 | |
| van Dongen et al. | Discordant monozygotic twin studies of epigenetic mechanisms in mental health | |
| Lancaster | Integration of multi-omic platforms to understand the regulation of genes in human disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20131218 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: MURDOCH CHILDRENS RESEARCH INSTITUTE |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20150120 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12Q 1/68 20060101AFI20150114BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20150818 |