EP2651438A1 - Vaccin - Google Patents

Vaccin

Info

Publication number
EP2651438A1
EP2651438A1 EP11807964.9A EP11807964A EP2651438A1 EP 2651438 A1 EP2651438 A1 EP 2651438A1 EP 11807964 A EP11807964 A EP 11807964A EP 2651438 A1 EP2651438 A1 EP 2651438A1
Authority
EP
European Patent Office
Prior art keywords
modified
dtxr
pseudotuberculosis
corynebacterium
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11807964.9A
Other languages
German (de)
English (en)
Inventor
Michael Fontaine
Caray Walker
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Moredun Research Institute
Original Assignee
Moredun Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Moredun Research Institute filed Critical Moredun Research Institute
Publication of EP2651438A1 publication Critical patent/EP2651438A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/05—Actinobacteria, e.g. Actinomyces, Streptomyces, Nocardia, Bifidobacterium, Gardnerella, Corynebacterium; Propionibacterium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants

Definitions

  • Trie present invention provides modified microorganisms for raising host immune responses as well as vaccines and vaccine compositions comprising the same.
  • the invention provides a modified Corynebacterium, for example Corynebacterium pseudotuberculosis, which may form the basis of an improved vaccine for treating and/or preventing diseases.
  • Antibiotic treatment Antibiotics registered for veterinary use do not penetrate sufficiently into the abscesses to result in clearing of the infection, and even if currently-unlicensed antibiotics could be used in the future, prolonged treatment could lead to the development of resistant isolates, delays in being able to sell the animal for consumption, or withdrawal of milk for human consumption.
  • Vaccination offers the farmer the only proactive approach to controlling C. pseudotuberculosis disease that does not lead to financial losses (from loss of animals). Immunity from vaccination can be acquired early in life and hence prevent infection occurring, rather than trying to treat the consequences of infection. Vaccination is the only credible solution and there are a number of vaccines already marketed for CLA. However, these vaccines are of variable efficacy.
  • an object of the present invention is to obviate one or more of the problems associated with the prior art.
  • the present invention is based on the finding that microorganisms can be modified such that when subjected to conditions which would be expected to suppress or reduce the expression, function and/or activity of certain factors, they exhibit increased (often significantly increased) expression, function and/or activity of those factors.
  • the factors may be virulence factors.
  • the modified microorganisms provided by this invention may find application as agents for generating or raising host immune responses and as vaccines or vaccine compositions to protect against a variety of diseases and/or conditions and/or to prevent or reduce host colonisation by one or more pathogens.
  • the present invention provides a modified microorganism capable of expressing at least one factor under conditions in which a wild-type (or unmodified) strain of the same microorganism, exhibits inhibited expression of the at least one factor.
  • the modified microorganism is a modified bacterium, for example a Gram positive bacteria or Actinobacteria.
  • the invention may provide a modified bacterium capable of expressing at least one factor under conditions in which a wild-type (or un-modified) strain of the same bacterium, exhibits inhibited expression of the at least one factor.
  • the modified bacterium is a modified Corynebacterium species.
  • the modified Corynebacterium species is a modified Corynebacterium pseudotuberculosis wherein, under environmental conditions suppressing or inhibiting the expression of a factor or factors in a wild-type C. pseudotuberculosis, the modified C. pseudotuberculosis expresses the factor or factors.
  • factors should be understood as encompassing proteinaceous compounds (for example proteins, peptides, amino acids and/or glycoproteins) as well as small organic compounds, lipids, nucleic acids and/or carbohydrates produced by microorganisms. Many of these factors are expressed internally - i.e. within the cytoplasm of a microorganism; such factors may be classed as "internal” or "cytoplasmic".
  • factors may also encompass microbial factors which are secreted from the cell and/or factors which are targeted to the microbial cell wall as membrane-bound or transmembrane factors.
  • factors may comprise microbial antigenic or immunogenic compounds which elicit or generate host immune responses. Such factors may include those collectively known as virulence determinants and/or pathogenicity factors.
  • virulence determinants and/or pathogenicity factors may comprise, for example, those which facilitate microbial attachment to host surfaces or cells and/or host cell invasion as well as those involved in toxin production and/or the toxins themselves.
  • factors may comprise microbial cell wall, membrane and/or transmembrane structures such as proteins or compounds which mediate or facilitate host adherence or colonisation, pili and/or secreted enzymes, compounds and/or toxins.
  • factors may further comprise compounds involved in iron acquisition.
  • wild-type microorganisms for example wild-type bacteria including Corynebacterium species such as C. pseudotuberculosis
  • the expression, function and/or activity of certain factor(s) may be directly or indirectly regulated by one or more exogenous and/or endogenous elements.
  • an endogenous element may directly or indirectly regulate the activity, expression and/or function of a microbial factor.
  • an endogenous regulatory element may take the form of a microbial factor which regulates the function, expression and/or activity of other microbial factors.
  • an "exogenous" regulatory element may comprise an element which is not produced by, or is not a product of, a microorganism, but which directly or indirectly regulates the expression, function and/or activity of a factor expressed by that microorganism.
  • the expression, function and/or activity of a microbial factor may be regulated by one or more endogenous and/or exogenous elements.
  • exogenous and/or endogenous regulatory elements of the type described herein act as global regulatory elements.
  • Global regulatory elements may regulate and/or control the expression, function and/or activity of a plurality of microbial factors.
  • the exogenous regulatory clement is an environmental element.
  • an environmental regulatory element may comprise a particular nutrient, compound, vitamin, metabolite, mineral, ion, electrolyte and/or salt. Additionally, or alternatively, an environmental regulatory element may take the form of a physical condition such as, for example, a particular temperature, gas ratio, osmolality and/or pH.
  • the presence and/or absence of one or more environmental regulatory elements may directly modulate the expression, function and/or activity of one or more microbial factor(s).
  • the presence and/or absence of one or more environmental regulatory element(s) may modulate the expression, function and/or activity of one or more endogenous microbial regulatory elements (for example a global microbial regulatory element) which in turn affects the expression, function and/or activity of one or more microbial factors.
  • the Modified microorganisms provided by this invention may lack one or more environmentally-sensitive or responsive regulatory/control elements such that one or more factors, the expression, function and/or activity of which is normally dependent on the expression, function and/or activity of said environmentally sensitive/responsive regulatory control elements, are expressed in environments which would normally suppress or inhibit the expression, function and/or activity of said factors.
  • the factors expressed by the modified microorganisms described herein may be factors, the expression, function and/or activity of which is normally associated with, controlled/regulated by, dependent on and/or sensitive to the presence and/or absence of metal ions such as, for example iron (Fe ).
  • metal ions such as, for example iron (Fe ).
  • such factors may comprise one or more Corynebacterium antigens/immunogens, said antigens and/or immunogens being capable of generating, raising and/or eliciting a host immune response.
  • an embodiment of the invention relates to a modified C. pseudotuberculosis strain, expressing at least one factor under conditions comprising iron concentrations which inhibit the expression of said factor in wild-type strains of the same organism.
  • the modified microorganisms provided by this invention may comprise one or more genetic modification(s) which directly and/or indirectly affect the expression, activity and/or function of one or more microbial regulatory elements (including global regulatory elements).
  • microbial regulatory elements including global regulatory elements.
  • a genetic modification which directly affects the expression, function and/or activity of a microbial regulatory element may comprise one or more mutations in the sequence of a gene encoding said regulatory element.
  • a genetic modification which indirectly affects the expression, function and/or activity of a microbial regulatory element may comprise one or more mutations in the sequence of a gene or genes which encode other elements or factors which themselves affect the activity, function and/or expression of the regulatory element.
  • the modified microorganism provided by this invention harbours one or more genetic modifications which directly and/or indirectly modulate the expression, function and/or activity of one or more microbial regulatory elements, including, for example, global regulatory element(s) controlling and/or regulating the expression of a plurality of microbial factors.
  • a genetic modification may comprise one or more alterations in a nucleic acid sequence.
  • a nucleic acid sequence may be modified by the addition, deletion, inversion and/or substitution of one or more nucleotides of a sequence.
  • a genetic modification may affect the expression, function and/or activity of the nucleic acid sequence harbouring the modification and/or the expression, function and/or activity of the protein or peptide encoded thereby.
  • modified microorganisms provided by this invention comprise genetic lesions resulting in the "in-frame" deletion of nucleic acid sequences.
  • the modified microorganisms of this invention lack exogenous nucleic acid - for example nucleic acids derived from vectors (for example plasmids and the like).
  • a modified microorganism for example a modified Corynebacterium
  • a modified microorganism of this invention is identical, except for the deletion of sequences encoding one or more regulatory elements.
  • a modified C. pseudotuberculosis strain provided by this invention may comprise a modified gene, wherein said gene encodes a homologue of the Diphtheria Toxin Repressor (DtxR) of Corynebacterium diphtheriae.
  • DtxR Diphtheria Toxin Repressor
  • C. pseudotuberculosis dtxR gene The sequence encoding C. pseudotuberculosis dtxR gene is provided as SEQ ID NO: 1, below.
  • the modified C. pseudotuberculosis is a fifc R-deficient strain, genetically modified to lack a functional dtxR gene or product (i.e. a functional "DtxR" protein). In this way, the modified C. pseudotuberculosis expresses factors
  • DtxR normally under the control of DtxR in a manner which is independent of the expression, function and/or activity of DtxR.
  • the function and/or activity of the DtxR protein is sensitive and/or responsive to environmental iron concentrations.
  • iron (Fe 2+ ) present in the environment combines and forms complexes with DtxR; in C. pseudotuberculosis, this results in a conformational change which allows DtxR to bind specific sequences within, or associated with the promoter regions of target genes - for example, genes encoding DtxR-regulated microbial (C. psuedotuberculosis) factors.
  • DtxR/Fe 2+ complexes and sequences for example DtxR-specific nucleic acid motifs in the vicinity of promoters sequences
  • DtxR regulated genes encoding C. pseudotuberculosis factors as described herein
  • transcription of these genes is modulated, in some cases inhibited, suppressed or prevented.
  • inienial aiiu oi " external microbial factors may b limited in iron-neb. environments, the growth of C. psuedotuberculosis is strong and vigorous.
  • DtxR does not complex with iron and remains in a conformation that is unable to bind some target sequences.
  • DtxR-regulated promoters are not impeded from initiating transcription.
  • microorganisms such as C. pseudotuberculosis may be able to express certain internal and/or external factors (for example virulence determinants) in environments where iron availability is low, microbial growth may be poor.
  • C. pseudotuberculosis dtxR-deficient strains such as those described herein, are able to express certain factors independently of environmental iron levels and are thus able to be cultured in iron rich environments so as to markedly improve growth.
  • standard laboratory culture conditions/media may be used to produce much higher amounts/ concentrations of virulence factors than would otherwise be possible through culture of wild-type C. pseudotuberculosis (i.e. dtxF l strains) under equivalent conditions.
  • the present invention provides modified C. pseudotuberculosis which, under standard laboratory conditions, is capable of expressing factors normally only expressed during an infection (i.e. in vivo).
  • standard laboratory conditions may include environmental conditions comprising iron and/or containing concentrations of iron, sufficient to form DtxR/iron complexes and inhibit or prevent expression of the factors described herein.
  • modified C. pseudotuberculosis of this invention can be grown in the presence of iron while still retaining the ability to express a number of virulence factors normally under the control of the DtxR protein. This is important as the presence of iron promotes strong growth of the modified C. pseudotuberculosis provided by this invention.
  • a modified C. pseudotuberculosis strain which can be grown under conditions which promote strong, vigorous growth, may be particularly well-suited to vaccine production where large amounts of microbial material are required to produce sufficient quantities of vaccine.
  • an embodiment of this invention provides a C. pseudotuberculosis dtxR- deficient strain, wherein said strain expresses factors normally under the control of the DtxR protein, under conditions which comprise iron concentrations sufficient to inhibit the expression of said factors in wild-type strains.
  • modified microorganisms provided by this invention in particular the modified C. pseudotuberculosis, may find application as strains from which vaccines may be produced.
  • a second aspect of this invention provides a modified microorganism of the invention for raising an immune response in an animal.
  • modified microorganisms described herein may be used to create vaccines for treating, preventing and/or controlling disease.
  • the invention provides vaccines for use in treating, preventing and/or controlling diseases caused and/or contributed to by Corynebacterium species.
  • the invention provides a C. pseudotuberculosis itoR-deficient strain for raising an immune response in an animal and/or for use as a vaccine.
  • animal may encompass mammalian animals including, for example, humans, equine, or ruminant (for example bovine, ovine and caprine) species, avian species and/or fish.
  • ruminant for example bovine, ovine and caprine
  • the vaccine provided by this invention is based on modified C. pseudotuberculosis, for example a C. pseduotuberculosis ⁇ 3 ⁇ 4tR-deficient strain
  • the vaccine may find particular application in the treatment, prevention and/or control of caseous lymphadenitis (CLA) in small ruminants, particularly, for example, sheep and goats.
  • CLA caseous lymphadenitis
  • vaccines provided by this invention may be used to treat, prevent or control other diseases caused or contributed to by Corynebacterium species - including C. pseudotuberculosis.
  • the modified microorganism for example a modified Corynebacterium, provided by this invention may be used as a whole-cell killed vaccine.
  • the vaccine may be prepared as a bacterin vaccine, comprising a suspension of killed modified microorganisms.
  • the vaccines may comprise portions and/or fragments of the modified Corynebacterium, the portions or fragments being generated by fragmentation/fractionation procedures/protocols such as, for example, sonication, freeze-thaw, osmotic lysis, and/or processes which isolate sub-cellular fractions, or factors secreted by the modified microorganisms into the extracellular milieu.
  • a further aspect of the invention provides a method of making any of the vaccines described herein, said method comprising the step of culturing a modified microorganism provided by this invention and preparing a vaccine composition therefrom.
  • Vaccine compositions according to this invention and/or prepared by methods described herein may otherwise be known as "immunogenic compositions" - such compositions being capable of eliciting host immune responses.
  • a method of making a C. pseudtuberculosis vaccine for use in treating, preventing and/or controlling occurrences of CLA in, for example, sheep may comprise culturing the ofct/i-deficient C. pseudotuberculosis strain described herein, under conditions which comprise iron or iron concentrations which would otherwise inhibit wild-type DtxR activity or function, and preparing a vaccine composition therefrom.
  • Vaccine compositions of this invention may comprise killed forms of any of the modified microorganisms described herein and/or fragments and/or portions derived from modified microorganisms of this invention, together, or in combination with, a pharmaceutically acceptable carrier, excipient and/or diluent.
  • Vaccines may be formulated and/or prepared for parenteral, mucosal, oral and/or transdermal administration. Vaccines and/or immunogenic compositions for parenteral administration may be administered intradermally, intraperitoneally, subcutaneously, intravenously or intramuscularly.
  • vaccines provided by this invention particularly vaccines comprising the modified C. pseudotuberculosis described above, have a number of advantages over existing vaccines.
  • vaccines comprising the modified C. pseudotuberculosis strain of this invention exhibit superior efficacy, as the enhanced expression of virulence factors improve immune reactions within the animal or human host and lead to improved protective immunity.
  • vaccine production is simple and requires established, defined and well understood (i.e. standard) culture conditions. Additionally, by avoiding the need to alter the culture conditions (relative to culture of, for example, a wild-type strain), vaccine production is safe, simple and rapid. Moreover, since the vaccine strain is used in a killed, whole-cell form, this further simplifies the production procedure and results in a safe vaccine which can readily be combined with other killed, whole-cell type vaccines, vaccines deriving from portions and/or fragments of other microorganisms (for example toxoid vaccines) as well as other forms of medicament.
  • animal vaccines are subject to withdrawal periods - i.e. the period of time an animal (or products from an animal such as milk) cannot enter the human food chain following vaccination. Withdrawal period can hinder normal farming practices and result in lost production. It is not expected that withdrawal period will be required with bacterin (comprising a suspension of killed wild-type or modified microorganisms) type vaccines
  • Bacterial microorganisms including wild-type C. pseudotuberculosis and the modified C. pseudotuberculosis strains described herein (in particular the dtxR- deficient strain), produce or express a number of factors (antigens) which may form the basis of detection/diagnosis tests. Such factors will be referred to hereinafter as "diagnostic factors".
  • C. pseudotuberculosis is known to produce the PLD antigen which may be used to detect the presence of this organism in samples provided by subjects. Since both the modified microorganisms provided by this invention and their wild-type equivalents may both express the same diagnostic factor(s), vaccinated (and not infected) subjects may yield false positive results in detection/diagnostic assays.
  • the invention provides a modified microorganism or vaccine comprising a microorganism or component thereof, which microorganism or component thereof does not comprise, produce or express at least one detectable factor.
  • the detectable factor is a secreted iiim.unogenic protein.
  • the detectable factor is one which forms the basis of a diagnostic test.
  • the invention provides a modified microorganism, or vaccine comprising a modified microorganism or component thereof, which modified microorganism (i) expresses at least one factor under conditions in which a wild-type strain of the same organism exhibits inhibited expression of said at least one factor and (ii) does not express at least one other detectable factor.
  • the at least one other detectable factor is a factor which can be detected by some means - for example by immunological assays (for example ELISA) or molecular detection assays (for example PCR-based assays), it is possible to use the presence or absence of such a factor from samples provided or obtained from subjects to be tested, as a means of determining whether or not that subject is infected with a wild-type form of the modified microorganism (which would be expected to express the detectable factor), or has been vaccinated with the modified strain (which would have been modified to exhibit inhibited (or ablated) expression of the detectable factor). Being able to make such a distinction is important as it prevents vaccinates being mis-diagnosed as infected subjects.
  • immunological assays for example ELISA
  • molecular detection assays for example PCR-based assays
  • the diagnostic factor may be a factor used to detect instances of infection and/or disease, caused and/or contributed to by wild-type strains of the modified microorganisms.
  • the diagnostic factor is an antigenic and/or immunogenic factor, and in some embodiments, the diagnostic factor may be a secreted factor.
  • the invention further provides modified C. pseudotuberculosis or vaccines/immunogenic compositions comprising modified C. pseudotuberculosis, which modified C. pseudotuberculosis (i) expresses at least one DtxR regulated factor under conditions which comprising iron or which comprise concentrations of iron sufficient to inhibit or prevent wild-type DtxR from regulating expression and (ii) does not express PLD.
  • modified C, pseudotuberculosis which lacks the ability to express functional DtxR and does not express PLD, may be referred to as a "DtxR PLD-deficient C. pseudotuberculosis strain".
  • the modified C. pseudotuberculosis strains potentially useful as vaccines may comprise modifications which render them incapable of producing detectable factors such as corynebacterial protease 40 (Cp40).
  • Cp40 corynebacterial protease 40
  • Other embodiments may encompass modified C. pseudotuberculosis which is both DtxR and Cp40-deficient as well as modified C. pseudotuberculosis which is DtxR/Cp40 and PLD-deficient.
  • microorganisms may be subjected to genetic modifications in order to render them incapable of expressing a particular factor. Additionally, or alternatively, genetic modification techniques may be used to induce expression of non-functional and/or inactive forms of said factor(s). Genetic modification techniques are described in detail below and may be used here to create modified organisms which lack PLD and/or other diagnostic factor(s).
  • a DtxR deficient C pseudotuberculosis strain being further deficient in its ability to express or produce at least one other detectable factor, for example a factor which might for the basis of a diagnostic assay.
  • a DtxR/PLD-deficient C. pseudotuberculosis strain a DtxR/Cp40- deficient C. pseudotuberculosis strain and/or a DtxR/PLD/Cp40 deficient C. pseudotuberculosis strain;
  • a vaccine and/or vaccine composition comprising a DtxR PLD- deficient C. pseudotuberculosis strain, the DtxR/Cp40-deficient C. pseudotuberculosis strain and/or the DtxR/PLD/Cp40-deficient C. pseudotuberculosis strain;
  • the modified microorganisms provided by this invention may further comprise one or more detectable marker or reporter elements. The presence of such elements may further serve to distinguish vaccine strains from wiid- type strains. Markers and/or reporter elements which are useful in this invention may include, for example, optically-detectable markers such as fluorescent proteins and the like.
  • Figure 1 Schematic representation of the C. pseudotuberculosis 3/99-5 chromosomal locus containing the ⁇ fc /?-homologue.
  • Figure 2 Clustal Wallace multiple alignment of the DtxR and DtxR-like proteins of C. pseudotuberculosis (cp), C, glutamicum, (eg) and C. diphtheriae (cd).
  • the predicted functional domains are labelled 1-3. Regions of amino acid sequence homology are indicated by a star. Light grey highlighting indicates homology between C. pseudotuberculosis and C. diphtheriae sequences only, slightly darker grey shading indicates homology between C. pseudotuberculosis and C. glutamicum sequences only and dark grey shading indicates homology between C. glutamicum and C. diphtheriae sequences only.
  • FIG. 4 Assessment of the iron-dependent regulation of the C. pseudotuberculosis fagA gene, which is known to be up-regulated in low-iron growth conditions, and putatively under the control of a DtxR-like regulator.
  • a promoter fusion assay was conducted using pCAW007 in wild-type C. pseudotuberculosis.
  • FIG. 5 Detection of a sigB- ixR-galE polycisuonie n R A in C. pseudotuberculosis wild-type and Cp-AdtxR strains.
  • Sample lanes correspond to 1 kb DNA ladder (L), a sigB-dtxR-galE transcript from wild-type cDNA with and without reverse transcriptase (Lanes 1 & 2 respectively), and a sigB-dtxR-galE transcript from Cp-AdtxR cDNA with and without reverse transcriptase (Lanes 3 & 4 respectively).
  • the transcript from the Cp-AdtxR mutant is approximately 0.7 kb shorter, corresponding to the deletion within the dtxR-like gene.
  • Figure 6 Assessment of the involvement of the C. pseudotuberculosis DtxR- homologue in the control of expression of the known iron-responsive gene, fagA.
  • a promoter fusion assay was conducted using pCAW007 in the Cp-AdtxR mutant strain.
  • FIG. 7 Visualisation and immunological detection of secreted proteins from C. pseudotuberculosis wild-type and Cp-AdtxR mutant strains.
  • Panel A Coomassie- stained 12% SDS-polyacrylamide gel of C. pseudotuberculosis exported proteins from cultures grown under high-iron conditions. Lane 1 , Cp-AdtxR/ Apld Lane 2, Wild-type Lane 3, SeeBlue plus 2 protein standard ladder (Invitrogen).
  • Panel B Western Blot of above gel probed with sera from sheep with CLA. Lane 1, Cp- AdtxRlApld Lane 2, Wild-type Lane 3, SeeBlue plus 2 protein standard ladder (Invitrogen).
  • Figure 8 The mean total lesion scores for animals in each treatment group along with standard error of mean for each.
  • Serum anti-C. pseudotuberculosis whole-cell IgG levels were determined by ELISA for each treatment group, and expressed as the mean and standard error of OD490 1 U T1 per group. Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following challenge with wild-type C. pseudotuberculosis at week 6.
  • Treatment groups are: unvaccinated control administered saline (Control), DtxR-deficient mutant vaccine (DtxR), DtxR/PLD-deficient mutant vaccine (DtxR/PLD), DtxR/Cp40-deficient mutant vaccine (DtxR/Cp40) and DtxR/PLD/Cp40-deifient mutant (DtxR/PLD/Cp40). All vaccinated animals produced anti-C. pseudotuberculosis IgG, while control animals did not.
  • Serum anti-phospholipase D (PLD) igG ieveis were determined by ELISA for the control group (administered saline), and are expressed as the mean and standard error of OD 4 5o nm - Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following challenge with wild-type C. pseudotuberculosis at week 6. No anti-PLD antibody response could be observed until after challenge.
  • PLD serum anti-phospholipase D
  • FIG. 1 Serum anti-phospholipase D (PLD) IgG levels were determined by ELISA for animals administered the DtxR/PLD vaccine, and are expressed as the OD4 5 onm value obtained for each animal. Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following bacterial challenge at week 6. No anti-PLD antibody response could be observed until after challenge with wild-type C pseudotuberculosis at week 6. The failure of several animals to seroconvert against PLD was due to the protection conferred by vaccination.
  • PLD serum anti-phospholipase D
  • E. coli DH5ct-E (Invitrogen) was used for routine cloning procedures, and was cultured at 37°C in Luria Bertanii (LB) medium, either static on solid LB agar or at 220 rpm in LB broth. Where required, LB medium was supplemented with erythromycin (to 300 pg/ml). The virulent, ovine-derived United Kingdom C.
  • pseudotuberculosis isolate 3/99-5 (2) was cultured at 37°C (or 26°C when transformed with a temperature-sensitive (TS) plasmid) in Brain Heart Infusion (BHI) medium, static on BHI agar plates or at 220 rpm in BHI broth containing 0.05 % (v/v) Tween 80 (BHIT).
  • BHI Brain Heart Infusion
  • BHIT Tween 80
  • C. pseudotuberculosis genomic DNA was harvested from cells from 5 ml overnight cultures. Cells were harvested by centrifugation at 3,893 ⁇ g for 15 min at 4°C and resuspended in 500 ul of TE buffer (50 mM Tris-HCl; 10 mM EDTA, pH 8.0) supplemented with 5 mg of lysozyme and 10 ⁇ g of RNAse A (from a 10 mg/ml solution). Cell suspensions were incubated at 37°C for at least 1 hr, transferred 1.5 ml tubes containing ca.
  • TE buffer 50 mM Tris-HCl; 10 mM EDTA, pH 8.0
  • DNA was extracted with 500 ⁇ of phenol.choloroform.isoamyl alcohol (25:24: 1), then with 500 ⁇ cholorofom:isoamyl alcohol (24:1).
  • DNA was precipitated by addition of 2 volumes of absolute ethanol and 0.1 volume of 3 M sodium acetate (pH 5.2) to each sample.
  • Precipitated DNA was harvested by centrifugation at 17,970 x g for 20 min at 4°C, and for each sample the resulting pellet was washed by addition of 500 ⁇ of 70 % (v/v) ethanol and centrifuging as before for 10 min. Finally, the ethanol was carefully decanted, and the DNA pellet was air-dried prior to re-suspension in 50-100 ⁇ of distilled water.
  • RNA was extracted and purified based upon a method described by Huser et al. (2003) which employs the RNeasy mini kit (Qiagen) with some modifications (3).
  • Southern hybridisation was carried out using Zeta-Probe Genomic Tested (GT) blotting membrane (Bio-Rad) using the standard capillary-transfer conditions recommended by the manufacturer. Labelling of DNA probes and immunological detection of hybridized probes was conducted using the DIG high prime labelling and detection starter kit (Roche), according to the manufacturer's instructions.
  • GT Zeta-Probe Genomic Tested
  • Bio-Rad Bio-Rad
  • genomic DNA was digested to completion with a suitable restriction endonuclease (as determined by Southern hybridisation). Subsequently, the digested DNA fragments were gel purified and circularised by self-ligation with T4 DNA ligase in a 20 ⁇ reaction containing 3 ⁇ g DNA. A total of 1 ⁇ of circularised genomic DNA was used as template in 50 ⁇ reactions. Thermal cycling was conducted for 30 cycles, using a primer annealing temperature of 56°C for 1 min and an extension temperature of 72°C for 2.5 min.
  • Promoter fusion assays were achieved using the plasmid pSPZ (5), containing a promoterless lacZ gene, a spectinomycin resistance gene and a stable pNG2 replication origin for C. diphtheriae.
  • Previously created pSPZ constructs were obtained from Prof. R. K. Holmes (University of Colorado at Denver and Health Sciences Centre, School of Medicine, Dept. of Microbiology, Aurora, Colorado, USA), which comprised the promoter-containing regions of the C. diphtheriae DtxR- regulated gene, tox (5) and irp3 (R. K. Holmes, personal communication) genes, cloned upstream of the promoterless lacZ gene in pSPZ.
  • pseudotuberculosis transformed with either construct was used to inoculate triplicate 5 ml volumes of CCDM containing spectinomycin (100 ⁇ g/ml), and the cultures were incubated overnight at 37°C ⁇ 225 rpm. Subsequently, cultures were diluted to an OD6o 0 nm of 0.1 , and incubated, as before, for ca. 6 hrs until mid log-phase had been reached. The OD of each culture was recorded, and a 100 ⁇ aliquot of each was then transferred to glass test tubes.
  • bacteria were lysed by the addition of 900 ⁇ of Z buffer (5), followed by 40 ⁇ of 0.1 % (w/v) SDS and 150 ⁇ of chloroform. The tubes were then sealed with Parafilm (Pechiney Plastic Packaging) and vortexed for 30 sec. To assess expression of the lacZ reporter gene, 200 ⁇ of a 4 mg/ml solution of o-nitrophenyl- ⁇ -Z -galactoside (ONPG) was added. Subsequently, tubes were incubated at room temperature to allow colour development for up to h hr depending on the speed of the colour change.
  • ONPG o-nitrophenyl- ⁇ -Z -galactoside
  • Enzymatic reactions were stopped by addition of 500 ⁇ 1 of 1 M Na 2 C0 3 to a final concentration of 0.5 M, and the length of incubation was recorded. Each reaction mixture was then transferred to 2 ml tubes and centrifuged at 17, 970 x g for 5 min at room temperature. Following centrifugation, the upper, aqueous phase of each sample was transferred to a cuvette and the OD42o, ul , was measured and recorded. Subsequently, the level of expression was determined, expressed in "Miller units", according to the following equation: 1000 x (A420nm-1 -75) ⁇ (length of incubation) x cell volume (0.1 ml) * Aeoonm- Statistical analyses
  • the membrane was incubated with the sheep sera for 1 hr at room temperature on a rotary shaker, and then washed three times in PBST, for 5 min on a rotary shaker. The membrane was then incubated in 15 ml of PBST containing a 1 :5,000 dilution of a horseradish peroxidise-conjugated mouse monoclonal anti-goat/sheep IgG antibody (clone GT-34; Sigma) for 1 hr, with shaking.
  • a horseradish peroxidise-conjugated mouse monoclonal anti-goat/sheep IgG antibody clone GT-34; Sigma
  • the membrane was washed twice with PBST, as before, then incubated in 3,3'-diaminobenzidine (DAB) substrate (prepared from a DAB tablet (Sigma) according to the manufacturer's instructions), at room temperature until bands became visible.
  • DAB 3,3'-diaminobenzidine
  • C. diphtheriae dtxR gene (acc. #M80338) and homologous genes from C. glutamicum ATCC 13032 (acc. #NC_003450, locus tag NCgl 1845) and C. efficiens YS-314 (acc. #NC_004369, locus tag CE1812) were aligned.
  • the C. efficiens gene was observed to share 74% homology with that of C. glutamicum, while 01716
  • Southern blot analysis revealed that the restriction endonucleases Kpnl, Hwdlll and Xbal generated genomic DNA fragments of ca. 0.9 kb, 3 kb and 6.5 kb respectively, all of which contained the fifc i?-homologue and which were considered to be of a suitable size for PCR amplification.
  • Southern blot analysis also confirmed the presence of a single copy of the dtxR-like gene within the C. pseudotuberculosis chromosome (data not shown).
  • Fresh genomic DNA was digested to completion with either Kpn ⁇ , H ndIII, and Xbal. Linearised fragments were circularised by ligation to create amplification templates and inverse PCR was conducted using the primers dtxRj (fwd) and dtxR_ inv (rev). Subsequently, amplified, blunt-ended DNA products were purified and cloned into pCR ® Blunt II TOPO ® to generate the recombinant plasmids pCAWOOl, pCAW002, and pCAW003 (for Kpnl, Hindlll and Jftel-derived fragments respectively).
  • pseudotuberculosis ccniig. revealed homology with C. diphtheriae (acc. # NC_002935) dtxR (locus tag DIP 1414), galE (locus tag DIP1415), and 2 conserved hypothetical proteins of C. diphtheriae.
  • a partial ORF sharing homology with the sigB (locus tag DIP1413) of C. diphtheriae was present upstream of the ORF encoding the DtxR homologue.
  • a partial ORF, which shared homology with a putative helicase of C. diphtheriae was identified at the 3'-end of the 6.5 kb contig.
  • the translated product of the sigB homologue shared 92% identity and 97% similarity with SigB of C. diphtheriae, and 89% identity and 95% similarity with that of C. glutamicum.
  • the DtxR-homologue of C. pseudotuberculosis shared 79% identity and 87% similarity with C. diphtheriae and 74% identity and 84% similarity with C. glutamicum.
  • the GalE homologue of C. pseudotuberculosis shared 81 % identity and 90% similarity with that of C. diphtheriae and 78% identity and 87% similarity with C. glutamicum.
  • the translated product of the C. pseudotuberculosis dtxR-VAae gene was aligned with the amino acid sequences of DtxR of C. diphtheriae and C. glutamicum ( Figure 2).
  • the sequence encoding the predicted DNA-binding domain (domain 1) lay within a region of generally-high sequence conservation, particularly between C. pseudotuberculosis and C. diphtheriae.
  • domain 2, required for dimerization of DtxR was also highly conserved between all three corynebacteria.
  • domain 3 was highly variable between all three species.
  • RT-PCR was conducted to confirm that the dtxR-M e gene was expressed in C. pseudotuberculosis.
  • the presence of a transcript corresponding to the 312 bp fragment amplified with the primers dtxR Ol and dtxR )3 was assessed in bacteria harvested in the exponential phase of growth.
  • the expected product was successfully amplified from reverse transcribed mRNA, but not in non-reverse-transcribed control reactions (data not shown).
  • the fagA gene which has been previously shown to be expressed under low-iron growth conditions (1), was used as a test subject.
  • Computational analysis of the fagA nucleotide sequence was performed, in order to determine whether it contained a putative DtxR-binding motif.
  • a putatiVc DixR-binding motif (TTAGTTTAGGCTAAACTGG) was identified 122 bp upstream of the first nucleotide of fagA.
  • a 511 bp fragment containing 300 bp of sequence immediately upstream of fagA was cloned into pSPZ to create the plasmid pCAW007.
  • the plasmid was used to transform wild-type C. pseudotuberculosis, and ⁇ -galactosidase production was measured under high- and low-iron growth conditions (Figure 4).
  • PCR with the primers AdtxR AE l and AdtxR_AE_2 (Table 2) was used to amplify a 1 ,022 bp fragment from immediately upstream of dtxR, which included the first 9 bp of the 5' end of the dtxR gene.
  • PCR using the primers AdtxR_AE_3 and AdtxR_AE_4 was used to amplify a 1,020 bp fragment from immediately downstream of dtxR, which included the last 3 bp of the 3' end of the dtxR gene. The two fragments were ligated (using the incorporated Xhol site), and the ca.
  • AdtxR 2 kb product was amplified by PCR using primers AdtxR_AE_ ⁇ and AdtxR_AE_4.
  • the resulting mutant gene, designated AdtxR comprising an in-frame deletion of the majority of the dtxR coding sequence, was cloned into Sa/I-digested pCARV (facilitated by primer- encoded restriction endonuclease recognition sites).
  • the recombinant plasmid, designated pCARV006 was used to transform C. pseudotuberculosis, and the wild- type chromosomal gene was replaced with the mutant derivative by allele- replacement mutagenesis.
  • the mutant C. pseudotuberculosis strain designated Cp-AdtxR (otherwise referred to within this document as DtxR-deficient strain or mutant), was assessed to ensure that the dtxR deletion was as expected.
  • Genomic DNA extracted from the wild-type or the Qp-AdtxR mutant was used as template in PCR reactions using the primers AcfoxR DCO F and AdtxR_DCO_R. As expected, these primers resulted in the amplification of a ca. 1.26 kb fragment from the wild-type strain; however, the equivalent PCR product for the AdtxR strain was ca. 0.7 kb shorter, confirming the deletion within the chromosomal dixR gene (data not shown).
  • E. coli electroMax DH5a-E F- (p80/acZAM15 A(/acZYA-argF) U169 recA 1 Invitrogen, UK endA 1 hsdRM (rk-, mk+) gal- phoA supE44 ⁇ - tki- 1 gyrA96 relA X)
  • AtffxK DCO F ATCTAATTTCACCACCATAAAA This study pstb dtxR locus
  • AdtxR DCO R GAAGAAAAGACCAAGTTTGTTA This study pstb dtxR locus
  • oligonucteotide-incorporated resinciion ertdonuciease recognition sites are indicated by lower-case letters and the suffixes a, b and c refer to Sail, Xho ⁇ and Xmal respectively.
  • fAcc. # refers to GenBank accession number of target nucleic acid sequence against which oligonucleotide primers were directed.
  • DIVA vaccines were constructed and each experimentally analysed; all vaccines were based upon the DtxR-deficient strain (Cp-AdtxR).
  • Cp-AdtxR DtxR-deficient strain
  • Table 1 the three vaccine strains are described in Table 1.
  • one DIVA vaccine strain was deficient in production of PLD.
  • a second strain was created by deletion of the cp40 gene encoding Cp40, a secreted serine protease, known to induce an immunological response in the host (8).
  • a third vaccine strain was created by deletion of both the pld and cp40 genes.
  • oligonucleotide primers used for the construction and screening of a Cp40-deficient mutant are described in Table 2.
  • PCR amplification of the 5'- and 3'- chromosomal regions flanking the cp40 gene of C. pseudotuberculosis strain 3/99-5 was conducted using the primers cpAEl + cpAE2 (Fragment 1) and cpAE3 + cpAE4 (Fragment 2).
  • Fragment 1 comprised 1,032 bp of upstream flanking sequence, including the first 30 bp of cp40, while Fragment 2 comprised 919 bp of downstream flanking sequence, containing the last 105 bp of cp40.
  • the two amplicons were digested with Xhol and ligated, and the ligation product was further amplified by PCR using the primers cpAEI + ⁇ cpAE4.
  • the resulting ca. 2.1 kb fragment (designated cp40), containing an in-frame deletion of 1,041 bp, was then cloned into Sall- digested pCARV (7) to create pC ARV005.
  • the DtxR-deficient C. pseudotuberculosis strain was transformed with pCARV005, and allele-replacement mutagenesis was conducted, in an equivalent maimer to that described (7).
  • bacteria were plated onto solid media and potential cp40 mutants were identified by PCR analysis of genomic DNA extracted from individual bacterial colonies using the primers Acp40 DCO_F + Acp40 DCO R. Successful amplification of a 292 bp product was indicative of the successful deletion of cp40.
  • One mutant was chosen for further screening.
  • the chromosomal region spanning Acp40 in this mutant was confirmed to be as expected by sequencing of the DNA product amplified by PCR with the primers cp40_seq_F + cp40_seq_R (data not shown).
  • CCDM CCDM.
  • CCDM CCDM containing 0.05 % (V/V) Tween 80, were inoculated with each of the vaccine strains. Following incubation overnight at 37°C and 200 rpm, these cultures were used to inoculate 300 ml volumes of CCDM without Tween 80 (Tween 80 was added to Corynebacterium cultures to prevent cell clumping, and enhance growth; hence, by including Tween in the starter culture, a uniform cell suspension was obtained, allowing more accurate quantification of the inocula used for the vaccine cultures). Cultures were incubated to the stationary- phase of growth, and then harvested to prepare vaccines. Each culture was centrifuged to pellet cells, and supernatants were decanted into separate, sterile Duran bottles. Preparation of supernatant vaccine fraction
  • Each bacterial cell pellet was suspended in 15 ml of saline in a 50 ml polypropylene tube. Twenty ⁇ 2 mm glass beads were added to each tube, and suspensions were placed on a vortex mixer for 5 min to disperse clumps; this resulted in a homogenous suspension. Formalin was then added to 0.3 % final concentration, and after overnight incubation at 4°C sterility checks were conducted by plating aliquots onto 5% (v/v) sheep blood agar plates and incubating at 37°C for 5 days incubation at 37°C, no bacterial growth was apparent. Each cell suspension was decanted into a fresh tube (without the glass beads), and cells were harvested by centrifugation. Supernatants were discarded (to remove formalin), and each suspension was resuspended in 12 ml of physiological saline. The number of cells/ml in each sample were determined using a Densimat. Formulation of vaccines
  • Each 1 ml dose of vaccine was formulated in sterile physiological saline to contain a 10* final concentration of inactivated supernatant, 5x1 O * ' bacterial cells and 0.75 % final concentration of 2.0 % aluminium hydroxide adjuvant (Alhydrogel).
  • a sufficient quantity to allow a primary immunization followed by a secondary boost was prepared in a single vial, and then split into two individual glass vaccine vials, which were stored at 4°C until required.
  • a cryopreserved stock of C. pseudotuberculosis 3/99-5 was revived by streaking onto a 5 % (v/v) sheep blood agar plate and incubating at 37°C for 48 hrs. A single colony was then picked and used to inoculate a further blood agar plate, which was incubated as before; the purpose of this repeated culture was to allow the organism to revive fully from cryostorage. All of the bacterial growth from the second plate was transferred into 5 ml of phosphate-buffered saline (PBS) using a sterile cotton-tip swab. Clumps of cells were disrupted by addition of 15 x 2 mm glass beads to the tube, and vortexing for 1 min.
  • PBS phosphate-buffered saline
  • Dilutions of the homogenised culture were prepared in PBS, and the approximate number of cells within the neat culture initially determined using a Densimat.
  • a Thoma chamber was used to accurately enumerate bacterial numbers.
  • a 50 ml cell suspension in PBS was prepared, containing exactly 2 l0 4 cells/ml. Individual syringes, sufficient for all animals, were each loaded with 1 ml of the inoculum.
  • Detection of anti-C. pseudotuberculosis IgG in ovine blood samples was conducted using either of two eri2yme-linked immunosorbent assays (ELISAs).
  • the first test employed C. pseudotuberculosis whole-cells to detect C. pseudotuberculosis- specific IgG and was carried out as follows: Killed, wild- type C. pseudotuberculosis 3/99-5 cells were prepared exactly as for the preparation of the whole-cell vaccine fractions obtained from the derivatives of the DtxR-deficient strain. Cells were diluted in ELISA plate coating buffer (bicarbonate buffer, pH 9.8) to an OD 60 onm coating concentration of 0.2.
  • ELISA plate coating buffer bicarbonate buffer, pH 9.8
  • the second test designated ELITEST CLA (purchased from Hyphen Biomed), employed ELISA plates coated with recombinant PLD antigen to determine serum anti-PLD IgG; the test was performed according to the manufacturer's supplied instructions, and antibody was determined based upon the values obtained following measurement at an optical density of 450nm.
  • a contingency table of treatment group and pattern was prepared and the differences in the proportion of animals having a particular pattern in the five treatment groups were tested using a two-sided Fisher's Exact test.
  • the total score data were analysed using a one-way analysis of variance (ANOVA) with treatment group as a factor. If an overall F-statistic from ANOVA was significant, then the two-sided probabilities were obtained for four treatment group comparisons (negative control group with four vaccinated groups). These probabilities were then adjusted using a False Discovery Rate (FDR) approach (1) to take into account the multiple comparisons of treatments.
  • ANOVA one-way analysis of variance
  • Animals were administered a primary vaccination (Day 0), and a booster vaccination was then administered 28 days later. Each 1 ml vaccine dose was administered sub-cutaneously in an equivalent position in the neck on the right hand side of each animal.
  • Each animal was administered a challenge inoculum containing 2 ⁇ 10 4 cells of C. pseudotuberculosis 3/99-5; this dose of this particular strain had previously been shown (4) to be suitable to recreate disease pathology identical to the naturally-encountered pathology of CLA.
  • blood samples were taken from each animal and serum was stored for downstream analysis.
  • the challenge inoculum was administered to animals, sub-cutaneously, approximately 2 inches behind the left ear, in a line caudal to the corner of the eye and the base of the ear.
  • Administering the challenge organism in this manner ensured that it passed the skin barrier, from where (depending on the immunological response) it could translocate from the site of inoculation to the local drainage lymph node, and from there to other sites within infected animals. Consequently, measurement of the extent of spread of disease within lymph nodes and other tissue was subsequently used to determine the extent of protection conferred to animals vaccinated with the different vaccines, as compared to unvaccinated control animals.
  • mice were housed in their respective groups for a further 12 weeks, during which time they were monitored frequently, and bloods taken at weekly intervals and banked for subsequent serological analyses.
  • animals were humanely euthanased and post-mortem tissue samples, including a number of superficial and internal lymph nodes and lung tissue, were collected for further analysis.
  • the tissues recovered for analysis had been determined over the course of numerous CLA experimental challenges conducted at the Moredun Research Institute in the past as being the most frequently affected in this experimental model of infection, and are as shown in Table 4.
  • Tissue samples were surface sterilised by flaming in industrial methylated spirit 74 O.P., then disrupted in PBS (10 ml per tissue) to release the contents of any lesions that were present within the tissue. Subsequently, samples of disrupted tissue were spread on blood agar plates to determine presence/absence of C. pseudotuberculosis. Bacteria which grew on plates after 48 hrs incubation at 37°C were assessed for phenotypic characteristics consistent with this organism. A random selection of isolates identified as C. pseudotuberculosis were further tested using the API Coryne diagnostic kit (bioMerieux), and in all cases the results corroborated the primary microbiological identification. The CLA lesions associated with each animal are presented in Table 5.
  • ndividual animals in each treatment group are numbered #1 -6
  • the tissues sampled are denoted down left-hand column
  • Table 6 Contingency table of treatment group and pattern and pattern of infection.
  • the mean total score values (and standard error of mean) for each treatment group is presented in Table 7 and Figure 8.
  • a comparison of the mean total score values between the control (group 1) and other vaccinated groups (groups 2 to 5) is presented in Table 8.
  • Table 7 The mean total score along with standard error (SE) of mean and 95% lower (LCL) and upper (UCL) confidence levels of different treatment groups.
  • SE standard error
  • the graph of Figure 9 plots the mean serum IgG antibody responses to C. psvuuuiuu r iua i /...1 ⁇ i A ⁇ ⁇ ⁇ ⁇
  • Anti-PLD IgG antibodies were detected in animals after challenge with wild- type C. pseudotuberculosis.
  • An example is presented in Figure 10, whereby animals in the control group (group 1, administered saline) showed no response to treatment, and only seroconverted to PLD after challenge.
  • the same phenomenon was observed for animals administered the DtxR/PLD-deficient vaccine (group 3), whereby no humoral response to PLD was observed following primary or secondary vaccination, yet a response was observed following challenge (Figure 1 1).
  • Figure 1 1 presents serological data for individual animals, rather than the group mean, since only two of the six animals were observed to seroconvert to PLD during the duration of the experiment; this was due to the protective efficacy of the vaccine.
  • the data presented in Figures 10 and 1 1 shows that sheep seroconvert to PLD during natural infection, and that vaccination with the DtxR/PLD-deficient vaccine does not cause a positive blood-test result, and hence the vaccine has proven DIVA capacity.
  • the DtxR/PLD vaccine appears to offer the greatest level of protection.
  • the DtxR/Cp40 vaccine appears to offer slightly lower protection, although statistically the difference may be minimal. It does appear, however, that the DtxR PLD/Cp40 vaccine is less protective. These results contrast with the generally held consensus that PLD is required for vaccine efficacy.
  • Vaccination confers significant protection of sheep against infection with a virulent United Kingdom strain of Corynebacterium pseudotuberculosis. Vaccine 24:5986-96.
  • R Development Core Team. 201 A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Release 2.13. http://www.R-project.org. Walker, C. A., W, Donachie, D. G. E. Smith, and M. C. Fontaine. 201 1. Targeted allele replacement mutagenesis of Corynebacterium pseudotuberculosis. Appl Environ Microbiol 77:3532-5.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des microorganismes modifiés destinés à éliciter des réponses immunitaires d'un hôte ainsi que des vaccins et des compositions vaccinales les comprenant. La présente invention concerne notamment des microorganismes bactériens modifiés qui, dans des conditions qui devraient abolir ou réduire l'expression, la fonction et/ou l'activité de certains facteurs, présentent une expression, une fonction et/ou une activité considérablement accrues de ces facteurs.
EP11807964.9A 2010-12-13 2011-12-13 Vaccin Withdrawn EP2651438A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201021096A GB201021096D0 (en) 2010-12-13 2010-12-13 Vaccine
PCT/GB2011/001716 WO2012080696A1 (fr) 2010-12-13 2011-12-13 Vaccin

Publications (1)

Publication Number Publication Date
EP2651438A1 true EP2651438A1 (fr) 2013-10-23

Family

ID=43567095

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11807964.9A Withdrawn EP2651438A1 (fr) 2010-12-13 2011-12-13 Vaccin

Country Status (4)

Country Link
EP (1) EP2651438A1 (fr)
AU (1) AU2011343008A1 (fr)
GB (1) GB201021096D0 (fr)
WO (1) WO2012080696A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201209014D0 (en) * 2012-05-22 2012-07-04 Moredun Res Inst Vaccine

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992007582A1 (fr) * 1990-10-25 1992-05-14 Commonwealth Scientific And Industrial Research Organisation Corynebacteries et autres organismes apparentes utilises comme vecteurs de vaccin
WO2001030384A1 (fr) * 1999-10-22 2001-05-03 Advanced Microbial Solutions Corporation Compositions de vaccin

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2012080696A1 *

Also Published As

Publication number Publication date
GB201021096D0 (en) 2011-01-26
WO2012080696A1 (fr) 2012-06-21
AU2011343008A1 (en) 2013-07-25

Similar Documents

Publication Publication Date Title
Theoret et al. The Campylobacter jejuni Dps homologue is important for in vitro biofilm formation and cecal colonization of poultry and may serve as a protective antigen for vaccination
US11717565B2 (en) Recombinant BCG overexpressing phoP-phoR
Malik-Kale et al. Characterization of genetically matched isolates of Campylobacter jejuni reveals that mutations in genes involved in flagellar biosynthesis alter the organism's virulence potential
Okwumabua et al. Identification of the gene encoding a 38-kilodalton immunogenic and protective antigen of Streptococcus suis
Huntley et al. Expression library immunization confers protection against Mycobacterium avium subsp. paratuberculosis infection
Aranda et al. Analysis of the protective capacity of three Streptococcus suis proteins induced under divalent-cation-limited conditions
Okuda et al. The toxR gene of Vibrio (Listonella) anguillarum controls expression of the major outer membrane proteins but not virulence in a natural host model
Wu et al. A Streptococcus suis LysM domain surface protein contributes to bacterial virulence
Fu et al. Display of ISKNV orf086 protein on the surface of Aeromonas hydrophila and its immunogenicity in Chinese perch (Siniperca chuatsi)
JP2016513078A (ja) 一段階または多段階のトリ型結核菌亜種副結核症サブユニット・ワクチン
Sahin et al. Key role of capsular polysaccharide in the induction of systemic infection and abortion by hypervirulent Campylobacter jejuni
Bull et al. A novel multi-antigen virally vectored vaccine against Mycobacterium avium subspecies paratuberculosis
Burgos et al. MG 428 is a novel positive regulator of recombination that triggers mgpB and mgpC gene variation in M ycoplasma genitalium
Chen et al. Immunogenicity and efficacy of two DNA vaccines encoding antigenic PspA and TerD against Nocardia seriolae in hybrid snakehead
CN104685054A (zh) Lsr2活性降低或敲除的改良BCG菌株及包含该菌株的药物组合物
CN108330142B (zh) 一种具有免疫保护作用的美人鱼发光杆菌溶血素Hlych蛋白
Fatehi et al. Oral vaccination with novel Lactococcus lactis mucosal live vector-secreting Brucella lumazine synthase (BLS) protein induces humoral and cellular immune protection against Brucella abortus
Chelliah et al. Potential DNA vaccine for haemorrhagic septiceamia disease
WO2012080696A1 (fr) Vaccin
Swain et al. Construction and evaluation of recombinant attenuated Edwardsiella piscicida vaccine (RAEV) vector system encoding ichthyophthirius multifiliis (ich) antigen IAG52B
WO2018022974A1 (fr) Souches sérovar typhimurium de salmonella modifiées, compositions de celles-ci et procédés d'utilisation
Bunde et al. Characterization of cellular immune response in hamsters immunized with recombinant vaccines against leptospirosis based on LipL32: LemA: LigAni chimeric protein
JP2011073990A (ja) 海産魚のノカルジア症に対するｄｎａワクチン及びｂｃｇワクチン
JP2019504636A (ja) Ｓｌａｍポリヌクレオチド及びポリペプチド、ならびにそれらの使用
GUO et al. Construction and virulence of filamentous hemagglutinin protein B1 mutant of Pasteurella multocida in chickens

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130628

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20150911

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20180424