EP2651438A1 - Vaccine - Google Patents

Abstract

The present invention provides modified microorganisms for raising host immune responses as well as vaccines and vaccine compositions comprising the same. In particular, the invention provides modified bacterial microorganisms that under conditions which would be expected to suppress or reduce the expression, function and/or activity of certain factors, exhibit significantly increased expression, function and/or activity of those factors.

Description

VACCINE

FIELD OF THE INVENTION

Trie present invention provides modified microorganisms for raising host immune responses as well as vaccines and vaccine compositions comprising the same. In particular, the invention provides a modified Corynebacterium, for example Corynebacterium pseudotuberculosis, which may form the basis of an improved vaccine for treating and/or preventing diseases.

BACKGROUND OF THE INVENTION

Listed below are a number of methods available to farmers to help control the spread and symptoms of infections associated with Corynebacterium pseudotuberculosis .

• Drain abscesses. Subcutaneous absences may be drained by a farmer or veterinarian. This obviously is a labour-intensive process and could lead to inadvertent transmission of the bacterium, unless rigorous hygienic procedures are maintained. Deeper abscesses will obviously not be accessible. Although draining an abscess will reduce the bacterial count, this procedure will not eliminate all bacterial cells, even if combined with an antiseptic treatment, such as iodine.

• Antibiotic treatment. Antibiotics registered for veterinary use do not penetrate sufficiently into the abscesses to result in clearing of the infection, and even if currently-unlicensed antibiotics could be used in the future, prolonged treatment could lead to the development of resistant isolates, delays in being able to sell the animal for consumption, or withdrawal of milk for human consumption.

· Test and cull. Currently, only one diagnostic test for CLA is commercially- available, this being the PLD-based test developed by Moredun, which allows serological identification of infected animals. If these animals are removed from a flock (by culling), no onward transmission of disease will be possible. This obviously has considerable financial implications for a farmer, and will not help control disease until after a diagnosis has been made.

• Vaccination. Vaccination offers the farmer the only proactive approach to controlling C. pseudotuberculosis disease that does not lead to financial losses (from loss of animals). Immunity from vaccination can be acquired early in life and hence prevent infection occurring, rather than trying to treat the consequences of infection. Vaccination is the only credible solution and there are a number of vaccines already marketed for CLA. However, these vaccines are of variable efficacy.

Accordingly, an object of the present invention is to obviate one or more of the problems associated with the prior art.

SUMMARY OF INVENTION

The present invention is based on the finding that microorganisms can be modified such that when subjected to conditions which would be expected to suppress or reduce the expression, function and/or activity of certain factors, they exhibit increased (often significantly increased) expression, function and/or activity of those factors. In one embodiment the factors may be virulence factors.

The modified microorganisms provided by this invention may find application as agents for generating or raising host immune responses and as vaccines or vaccine compositions to protect against a variety of diseases and/or conditions and/or to prevent or reduce host colonisation by one or more pathogens.

In a first aspect, the present invention provides a modified microorganism capable of expressing at least one factor under conditions in which a wild-type (or unmodified) strain of the same microorganism, exhibits inhibited expression of the at least one factor.

In one embodiment, the modified microorganism is a modified bacterium, for example a Gram positive bacteria or Actinobacteria.

As such, the invention may provide a modified bacterium capable of expressing at least one factor under conditions in which a wild-type (or un-modified) strain of the same bacterium, exhibits inhibited expression of the at least one factor.

In one embodiment, the modified bacterium is a modified Corynebacterium species. In a yet further embodiment, the modified Corynebacterium species is a modified Corynebacterium pseudotuberculosis wherein, under environmental conditions suppressing or inhibiting the expression of a factor or factors in a wild-type C. pseudotuberculosis, the modified C. pseudotuberculosis expresses the factor or factors.

The term "factors" should be understood as encompassing proteinaceous compounds (for example proteins, peptides, amino acids and/or glycoproteins) as well as small organic compounds, lipids, nucleic acids and/or carbohydrates produced by microorganisms. Many of these factors are expressed internally - i.e. within the cytoplasm of a microorganism; such factors may be classed as "internal" or "cytoplasmic". The term "factors" may also encompass microbial factors which are secreted from the cell and/or factors which are targeted to the microbial cell wall as membrane-bound or transmembrane factors.

Additionally or alternatively, the term "factors" may comprise microbial antigenic or immunogenic compounds which elicit or generate host immune responses. Such factors may include those collectively known as virulence determinants and/or pathogenicity factors. One of skill will appreciate that microbial factors which are also virulence determinants and/or pathogenicity factors may comprise, for example, those which facilitate microbial attachment to host surfaces or cells and/or host cell invasion as well as those involved in toxin production and/or the toxins themselves.

In view of the above, the term "factors" as used herein may comprise microbial cell wall, membrane and/or transmembrane structures such as proteins or compounds which mediate or facilitate host adherence or colonisation, pili and/or secreted enzymes, compounds and/or toxins. The term "factors" may further comprise compounds involved in iron acquisition.

One of skill will appreciate that in wild-type microorganisms, for example wild-type bacteria including Corynebacterium species such as C. pseudotuberculosis, the expression, function and/or activity of certain factor(s) may be directly or indirectly regulated by one or more exogenous and/or endogenous elements.

One of skill will appreciate that an endogenous element may directly or indirectly regulate the activity, expression and/or function of a microbial factor. For example, an endogenous regulatory element may take the form of a microbial factor which regulates the function, expression and/or activity of other microbial factors. In contrast, an "exogenous" regulatory element may comprise an element which is not produced by, or is not a product of, a microorganism, but which directly or indirectly regulates the expression, function and/or activity of a factor expressed by that microorganism.

In some embodiments, the expression, function and/or activity of a microbial factor may be regulated by one or more endogenous and/or exogenous elements. One of skill will appreciate that in some cases, exogenous and/or endogenous regulatory elements of the type described herein act as global regulatory elements. Global regulatory elements may regulate and/or control the expression, function and/or activity of a plurality of microbial factors.

in one embodiment, the exogenous regulatory clement is an environmental element. One of skill will appreciate that an environmental regulatory element may comprise a particular nutrient, compound, vitamin, metabolite, mineral, ion, electrolyte and/or salt. Additionally, or alternatively, an environmental regulatory element may take the form of a physical condition such as, for example, a particular temperature, gas ratio, osmolality and/or pH.

One of skill will readily understand that the presence and/or absence of one or more environmental regulatory elements may directly modulate the expression, function and/or activity of one or more microbial factor(s). In other cases, the presence and/or absence of one or more environmental regulatory element(s) may modulate the expression, function and/or activity of one or more endogenous microbial regulatory elements (for example a global microbial regulatory element) which in turn affects the expression, function and/or activity of one or more microbial factors.

The Modified microorganisms provided by this invention may lack one or more environmentally-sensitive or responsive regulatory/control elements such that one or more factors, the expression, function and/or activity of which is normally dependent on the expression, function and/or activity of said environmentally sensitive/responsive regulatory control elements, are expressed in environments which would normally suppress or inhibit the expression, function and/or activity of said factors.

In one embodiment, the factors expressed by the modified microorganisms described herein may be factors, the expression, function and/or activity of which is normally associated with, controlled/regulated by, dependent on and/or sensitive to the presence and/or absence of metal ions such as, for example iron (Fe ). Advantageously, and where the invention relates to, for example, modified Corynebacterium, such factors may comprise one or more Corynebacterium antigens/immunogens, said antigens and/or immunogens being capable of generating, raising and/or eliciting a host immune response.

Accordingly, an embodiment of the invention relates to a modified C. pseudotuberculosis strain, expressing at least one factor under conditions comprising iron concentrations which inhibit the expression of said factor in wild-type strains of the same organism.

The modified microorganisms provided by this invention may comprise one or more genetic modification(s) which directly and/or indirectly affect the expression, activity and/or function of one or more microbial regulatory elements (including global regulatory elements). One of skill will appreciate that a genetic modification which directly affects the expression, function and/or activity of a microbial regulatory element may comprise one or more mutations in the sequence of a gene encoding said regulatory element. In contrast, a genetic modification which indirectly affects the expression, function and/or activity of a microbial regulatory element may comprise one or more mutations in the sequence of a gene or genes which encode other elements or factors which themselves affect the activity, function and/or expression of the regulatory element.

In one embodiment, the modified microorganism provided by this invention harbours one or more genetic modifications which directly and/or indirectly modulate the expression, function and/or activity of one or more microbial regulatory elements, including, for example, global regulatory element(s) controlling and/or regulating the expression of a plurality of microbial factors.

A genetic modification may comprise one or more alterations in a nucleic acid sequence. For example, a nucleic acid sequence may be modified by the addition, deletion, inversion and/or substitution of one or more nucleotides of a sequence. One of skill will appreciate that a genetic modification may affect the expression, function and/or activity of the nucleic acid sequence harbouring the modification and/or the expression, function and/or activity of the protein or peptide encoded thereby.

Advantageously, modified microorganisms provided by this invention comprise genetic lesions resulting in the "in-frame" deletion of nucleic acid sequences. Furthermore, the modified microorganisms of this invention lack exogenous nucleic acid - for example nucleic acids derived from vectors (for example plasmids and the like). As such, when compared to isogenic, wild-type parent strains, a modified microorganism (for example a modified Corynebacterium) of this invention is identical, except for the deletion of sequences encoding one or more regulatory elements.

A modified C. pseudotuberculosis strain provided by this invention may comprise a modified gene, wherein said gene encodes a homologue of the Diphtheria Toxin Repressor (DtxR) of Corynebacterium diphtheriae. Hereinafter, said gene is designated the "dtxR" gene.

The sequence encoding C. pseudotuberculosis dtxR gene is provided as SEQ ID NO: 1, below.

SEQ ID NO: 1

1 atgaaagatt tggtcgatac cacagaaatg tatctgcgga ccatctacga gctggaagaa

61 gagggagtaa ctccccttcg cgcacgcatc gccgaacgcc tcgatcagtc aggccctaca

121 gtcagccaaa cagttgcccg catggaacgt gacgggctcg ttgtagttgc gtctgaccgt

181 agtcttcaaa tgacgcccac tgggcgcgct ttagccaccg ccgtaatgcg taaacatcgc

241 ctcgcagagc gcctccttac agacattatt ggcttagata tccacaaggt gcacgatgaa

301 gcatgccgct gggagcacgt catgagcgac gaagtagagc ggcggcttgt tgatgtcctc

361 gaggacgtca cccgctcccc ctttggcaac ccaatcccag gtctcgatga acttggcgtc

421 tccataaaaa agaaggaagg accgggcaaa cgtgccgtgg atgtagcccg tgccaccccc

481 agagacgtaa agattgttca aatcaacgag atattgcaag tagattctga ccagtttcag

541 gctctgatcg acgcaggcat tagaattgga acgaccgtca cgctcagcga tgtagacggt

601 cgcgtgatta ttacgcacgg tgaaaaaaca gtagaactta tcgacgacct agctcacgca

661 gtacgaatcg aagaaatcta a

In one embodiment, the modified C. pseudotuberculosis is a fifc R-deficient strain, genetically modified to lack a functional dtxR gene or product (i.e. a functional "DtxR" protein). In this way, the modified C. pseudotuberculosis expresses factors

(for example virulaence factors) normally under the control of DtxR in a manner which is independent of the expression, function and/or activity of DtxR.

The sequence of the C. pseudotuberculosis DtxR protein is given below as

SEQ ID NO: 2.

SEQ ID NO: 2

1 mkdlvdttem ylrtiyelee egvtplrari aerldqsgpt vsgtvarmer dglwvasdr

61 slqmtptgra latavmrkhr laerlltdii gldihkvhde acr ehvmsd everrlvdvl

121 edvtrspfgn pipgldelgv sikkkegpgk ravdvaratp rdvkivqine ilqvdsdqfq

181 alidagirig ttvtlsdvdg rviithgekt veliddlaha vrieei

The function and/or activity of the DtxR protein is sensitive and/or responsive to environmental iron concentrations. Without wishing to be bound by theory, iron (Fe²⁺) present in the environment, combines and forms complexes with DtxR; in C. pseudotuberculosis, this results in a conformational change which allows DtxR to bind specific sequences within, or associated with the promoter regions of target genes - for example, genes encoding DtxR-regulated microbial (C. psuedotuberculosis) factors. As a result of the binding between DtxR/Fe²⁺ complexes and sequences (for example DtxR-specific nucleic acid motifs in the vicinity of promoters sequences) associated with DtxR regulated genes (encoding C. pseudotuberculosis factors as described herein), transcription of these genes is modulated, in some cases inhibited, suppressed or prevented. While the production of inienial aiiu oi^" external microbial factors may b limited in iron-neb. environments, the growth of C. psuedotuberculosis is strong and vigorous.

In contrast, in environments where iron is unavailable or where iron concentrations are low, DtxR does not complex with iron and remains in a conformation that is unable to bind some target sequences. As such, in the absence of iron, DtxR-regulated promoters are not impeded from initiating transcription. However, while microorganisms such as C. pseudotuberculosis may be able to express certain internal and/or external factors (for example virulence determinants) in environments where iron availability is low, microbial growth may be poor.

The inventors have discovered that C. pseudotuberculosis dtxR-deficient strains, such as those described herein, are able to express certain factors independently of environmental iron levels and are thus able to be cultured in iron rich environments so as to markedly improve growth. In this way, standard laboratory culture conditions/media may be used to produce much higher amounts/ concentrations of virulence factors than would otherwise be possible through culture of wild-type C. pseudotuberculosis (i.e. dtxF l strains) under equivalent conditions.

In view of the above, the present invention provides modified C. pseudotuberculosis which, under standard laboratory conditions, is capable of expressing factors normally only expressed during an infection (i.e. in vivo).

It should be understood that the term "standard laboratory conditions" may include environmental conditions comprising iron and/or containing concentrations of iron, sufficient to form DtxR/iron complexes and inhibit or prevent expression of the factors described herein.

Furthermore, modified C. pseudotuberculosis of this invention can be grown in the presence of iron while still retaining the ability to express a number of virulence factors normally under the control of the DtxR protein. This is important as the presence of iron promotes strong growth of the modified C. pseudotuberculosis provided by this invention. Furthermore, one of skill will appreciate that a modified C. pseudotuberculosis strain which can be grown under conditions which promote strong, vigorous growth, may be particularly well-suited to vaccine production where large amounts of microbial material are required to produce sufficient quantities of vaccine. Thus, an embodiment of this invention provides a C. pseudotuberculosis dtxR- deficient strain, wherein said strain expresses factors normally under the control of the DtxR protein, under conditions which comprise iron concentrations sufficient to inhibit the expression of said factors in wild-type strains.

One of skill will appreciate that the modified microorganisms provided by this invention, in particular the modified C. pseudotuberculosis, may find application as strains from which vaccines may be produced.

Accordingly, a second aspect of this invention provides a modified microorganism of the invention for raising an immune response in an animal.

Moreover, the modified microorganisms described herein may be used to create vaccines for treating, preventing and/or controlling disease.

In one embodiment, the invention provides vaccines for use in treating, preventing and/or controlling diseases caused and/or contributed to by Corynebacterium species. In one embodiment, the invention provides a C. pseudotuberculosis itoR-deficient strain for raising an immune response in an animal and/or for use as a vaccine.

It should be understood that the term "animal" may encompass mammalian animals including, for example, humans, equine, or ruminant (for example bovine, ovine and caprine) species, avian species and/or fish.

Where the vaccine provided by this invention is based on modified C. pseudotuberculosis, for example a C. pseduotuberculosis <¾tR-deficient strain, the vaccine may find particular application in the treatment, prevention and/or control of caseous lymphadenitis (CLA) in small ruminants, particularly, for example, sheep and goats. However, it should be understood that vaccines provided by this invention may be used to treat, prevent or control other diseases caused or contributed to by Corynebacterium species - including C. pseudotuberculosis.

One of skill will appreciate that the modified microorganism, for example a modified Corynebacterium, provided by this invention may be used as a whole-cell killed vaccine. In this embodiment, the vaccine may be prepared as a bacterin vaccine, comprising a suspension of killed modified microorganisms. In other embodiments, the vaccines may comprise portions and/or fragments of the modified Corynebacterium, the portions or fragments being generated by fragmentation/fractionation procedures/protocols such as, for example, sonication, freeze-thaw, osmotic lysis, and/or processes which isolate sub-cellular fractions, or factors secreted by the modified microorganisms into the extracellular milieu.

Otic of skill will appreciate that the general strategy of preparing a (bacicnn) vaccine using a microorganism modified so as to increase the expression of virulence factors when cultured, for example, under standard laboratory conditions (in the case of Corynebacterium, such conditions comprising quantities of iron sufficient to enhance or encourage growth), is somewhat at odds with routine protocols which aim to down regulate microbial virulence factors before a microorganism is provided as a live attenuated (not killed) vaccine.

A further aspect of the invention provides a method of making any of the vaccines described herein, said method comprising the step of culturing a modified microorganism provided by this invention and preparing a vaccine composition therefrom. Vaccine compositions according to this invention and/or prepared by methods described herein may otherwise be known as "immunogenic compositions" - such compositions being capable of eliciting host immune responses.

In one embodiment, a method of making a C. pseudtuberculosis vaccine for use in treating, preventing and/or controlling occurrences of CLA in, for example, sheep, may comprise culturing the ofct/i-deficient C. pseudotuberculosis strain described herein, under conditions which comprise iron or iron concentrations which would otherwise inhibit wild-type DtxR activity or function, and preparing a vaccine composition therefrom.

Vaccine compositions of this invention may comprise killed forms of any of the modified microorganisms described herein and/or fragments and/or portions derived from modified microorganisms of this invention, together, or in combination with, a pharmaceutically acceptable carrier, excipient and/or diluent.

Vaccines may be formulated and/or prepared for parenteral, mucosal, oral and/or transdermal administration. Vaccines and/or immunogenic compositions for parenteral administration may be administered intradermally, intraperitoneally, subcutaneously, intravenously or intramuscularly.

The inventors have determined that the vaccines provided by this invention, particularly vaccines comprising the modified C. pseudotuberculosis described above, have a number of advantages over existing vaccines. In particular, vaccines comprising the modified C. pseudotuberculosis strain of this invention, exhibit superior efficacy, as the enhanced expression of virulence factors improve immune reactions within the animal or human host and lead to improved protective immunity.

Moreover, production of the vaccine is simple and requires established, defined and well understood (i.e. standard) culture conditions. Additionally, by avoiding the need to alter the culture conditions (relative to culture of, for example, a wild-type strain), vaccine production is safe, simple and rapid. Moreover, since the vaccine strain is used in a killed, whole-cell form, this further simplifies the production procedure and results in a safe vaccine which can readily be combined with other killed, whole-cell type vaccines, vaccines deriving from portions and/or fragments of other microorganisms (for example toxoid vaccines) as well as other forms of medicament.

One of skill will appreciate that animal vaccines are subject to withdrawal periods - i.e. the period of time an animal (or products from an animal such as milk) cannot enter the human food chain following vaccination. Withdrawal period can hinder normal farming practices and result in lost production. It is not expected that withdrawal period will be required with bacterin (comprising a suspension of killed wild-type or modified microorganisms) type vaccines

Following vaccination with a whole-cell killed microbe-derived vaccine, it is often difficult to distinguish vaccinated and infected subjects. This is particularly true where both the vaccine and wild-type strains of a particular microorganism secrete an antigen which may be used to detect the microorganism or diagnose an infection therewith.

Bacterial microorganisms, including wild-type C. pseudotuberculosis and the modified C. pseudotuberculosis strains described herein (in particular the dtxR- deficient strain), produce or express a number of factors (antigens) which may form the basis of detection/diagnosis tests. Such factors will be referred to hereinafter as "diagnostic factors". By way of example, C. pseudotuberculosis is known to produce the PLD antigen which may be used to detect the presence of this organism in samples provided by subjects. Since both the modified microorganisms provided by this invention and their wild-type equivalents may both express the same diagnostic factor(s), vaccinated (and not infected) subjects may yield false positive results in detection/diagnostic assays.

Accordingly, in a further embodiment, the invention provides a modified microorganism or vaccine comprising a microorganism or component thereof, which microorganism or component thereof does not comprise, produce or express at least one detectable factor.

In one embodiment, the detectable factor is a secreted iiim.unogenic protein. Advantageously, the detectable factor is one which forms the basis of a diagnostic test.

In a further embodiment, the invention provides a modified microorganism, or vaccine comprising a modified microorganism or component thereof, which modified microorganism (i) expresses at least one factor under conditions in which a wild-type strain of the same organism exhibits inhibited expression of said at least one factor and (ii) does not express at least one other detectable factor.

One of skill will appreciate that provided the at least one other detectable factor is a factor which can be detected by some means - for example by immunological assays (for example ELISA) or molecular detection assays (for example PCR-based assays), it is possible to use the presence or absence of such a factor from samples provided or obtained from subjects to be tested, as a means of determining whether or not that subject is infected with a wild-type form of the modified microorganism (which would be expected to express the detectable factor), or has been vaccinated with the modified strain (which would have been modified to exhibit inhibited (or ablated) expression of the detectable factor). Being able to make such a distinction is important as it prevents vaccinates being mis-diagnosed as infected subjects.

In one embodiment, the diagnostic factor may be a factor used to detect instances of infection and/or disease, caused and/or contributed to by wild-type strains of the modified microorganisms. Advantageously the diagnostic factor is an antigenic and/or immunogenic factor, and in some embodiments, the diagnostic factor may be a secreted factor.

In view of the above, the invention further provides modified C. pseudotuberculosis or vaccines/immunogenic compositions comprising modified C. pseudotuberculosis, which modified C. pseudotuberculosis (i) expresses at least one DtxR regulated factor under conditions which comprising iron or which comprise concentrations of iron sufficient to inhibit or prevent wild-type DtxR from regulating expression and (ii) does not express PLD. Modified C, pseudotuberculosis which lacks the ability to express functional DtxR and does not express PLD, may be referred to as a "DtxR PLD-deficient C. pseudotuberculosis strain".

In other embodiments, the modified C. pseudotuberculosis strains potentially useful as vaccines, may comprise modifications which render them incapable of producing detectable factors such as corynebacterial protease 40 (Cp40). Other embodiments may encompass modified C. pseudotuberculosis which is both DtxR and Cp40-deficient as well as modified C. pseudotuberculosis which is DtxR/Cp40 and PLD-deficient.

As stated above, microorganisms may be subjected to genetic modifications in order to render them incapable of expressing a particular factor. Additionally, or alternatively, genetic modification techniques may be used to induce expression of non-functional and/or inactive forms of said factor(s). Genetic modification techniques are described in detail below and may be used here to create modified organisms which lack PLD and/or other diagnostic factor(s).

Accordingly, the invention provides

a DtxR deficient C, pseudotuberculosis strain being further deficient in its ability to express or produce at least one other detectable factor, for example a factor which might for the basis of a diagnostic assay.

a DtxR/PLD-deficient C. pseudotuberculosis strain; a DtxR/Cp40- deficient C. pseudotuberculosis strain and/or a DtxR/PLD/Cp40 deficient C. pseudotuberculosis strain;

a vaccine and/or vaccine composition comprising a DtxR PLD- deficient C. pseudotuberculosis strain, the DtxR/Cp40-deficient C. pseudotuberculosis strain and/or the DtxR/PLD/Cp40-deficient C. pseudotuberculosis strain; and

methods of making vaccines for preventing and/or controlling diseases and or conditions caused or contributed to by C. pseudotuberculosis, comprising the step of culturing a DtxR/ detectable factor, DtxR PLD, DtxR/CP40 and/or DtxR/PLD/Cp40-deficient C. pseudotuberculosis strain under conditions in which concentrations of iron are sufficient to inhibit or prevent wild-type DtxR function, and making a vaccine composition therefrom. In one embodiment, the modified microorganisms provided by this invention may further comprise one or more detectable marker or reporter elements. The presence of such elements may further serve to distinguish vaccine strains from wiid- type strains. Markers and/or reporter elements which are useful in this invention may include, for example, optically-detectable markers such as fluorescent proteins and the like.

DETAILED DESCRIPTION

The present invention will now be described in detail and with reference to the following figures which show:

Figure 1. Schematic representation of the C. pseudotuberculosis 3/99-5 chromosomal locus containing the <fc /?-homologue.

Figure 2. Clustal Wallace multiple alignment of the DtxR and DtxR-like proteins of C. pseudotuberculosis (cp), C, glutamicum, (eg) and C. diphtheriae (cd). The predicted functional domains are labelled 1-3. Regions of amino acid sequence homology are indicated by a star. Light grey highlighting indicates homology between C. pseudotuberculosis and C. diphtheriae sequences only, slightly darker grey shading indicates homology between C. pseudotuberculosis and C. glutamicum sequences only and dark grey shading indicates homology between C. glutamicum and C. diphtheriae sequences only.

Figure 3. Assessment of the affect of environmental iron concentration on the expression of tox and irp3 promoter/1 acZ fusions in C. pseudotuberculosis. Promoter fusion assays were undertaken to determine whether the expression of C. diphtheriae genes known to be regulated by DtxR in an iron-dependent manner, were similarly controlled in C. pseudotuberculosis. Statistical analyses using a paired t-test confirmed that environmental iron concentration was exerting a highly significant effect upon the level of expression of irp3 (p= 0.01 1), while tox also appeared to be affected by iron concentration albeit to a lesser extent (p= 0.068). Bars correspond to low-iron (■ ), and high-iron (□ ).

Figure 4. Assessment of the iron-dependent regulation of the C. pseudotuberculosis fagA gene, which is known to be up-regulated in low-iron growth conditions, and putatively under the control of a DtxR-like regulator. A promoter fusion assay was conducted using pCAW007 in wild-type C. pseudotuberculosis. A paired t-test confirmed that fagA is differentially expressed in response to environmental iron concentrations (p=0.013), with expression increasing with decreasing iron concentration. Bars correspond to low-iron (■ ), and high-iron (□ ).

Figure 5. Detection of a sigB- ixR-galE polycisuonie n R A in C. pseudotuberculosis wild-type and Cp-AdtxR strains. Sample lanes correspond to 1 kb DNA ladder (L), a sigB-dtxR-galE transcript from wild-type cDNA with and without reverse transcriptase (Lanes 1 & 2 respectively), and a sigB-dtxR-galE transcript from Cp-AdtxR cDNA with and without reverse transcriptase (Lanes 3 & 4 respectively). The transcript from the Cp-AdtxR mutant is approximately 0.7 kb shorter, corresponding to the deletion within the dtxR-like gene.

Figure 6. Assessment of the involvement of the C. pseudotuberculosis DtxR- homologue in the control of expression of the known iron-responsive gene, fagA. A promoter fusion assay was conducted using pCAW007 in the Cp-AdtxR mutant strain. A paired t-test revealed no difference between fagA expression under high- and low- iron growth conditions (p=0.086), confirming the role of the C. pseudotuberculosis DtxR-homologue in the control of expression of this gene. Bars correspond to low- iron (■) and high-iron (□) growth conditions.

Figure 7. Visualisation and immunological detection of secreted proteins from C. pseudotuberculosis wild-type and Cp-AdtxR mutant strains. Panel A- Coomassie- stained 12% SDS-polyacrylamide gel of C. pseudotuberculosis exported proteins from cultures grown under high-iron conditions. Lane 1 , Cp-AdtxR/ Apld Lane 2, Wild-type Lane 3, SeeBlue plus 2 protein standard ladder (Invitrogen). Panel B - Western Blot of above gel probed with sera from sheep with CLA. Lane 1, Cp- AdtxRlApld Lane 2, Wild-type Lane 3, SeeBlue plus 2 protein standard ladder (Invitrogen).

Figure 8. The mean total lesion scores for animals in each treatment group along with standard error of mean for each.

Figure 9. Serum anti-C. pseudotuberculosis whole-cell IgG levels were determined by ELISA for each treatment group, and expressed as the mean and standard error of OD490₁U_T1 per group. Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following challenge with wild-type C. pseudotuberculosis at week 6. Treatment groups are: unvaccinated control administered saline (Control), DtxR-deficient mutant vaccine (DtxR), DtxR/PLD-deficient mutant vaccine (DtxR/PLD), DtxR/Cp40-deficient mutant vaccine (DtxR/Cp40) and DtxR/PLD/Cp40-deifient mutant (DtxR/PLD/Cp40). All vaccinated animals produced anti-C. pseudotuberculosis IgG, while control animals did not.

Figure 10. Serum anti-phospholipase D (PLD) igG ieveis were determined by ELISA for the control group (administered saline), and are expressed as the mean and standard error of OD₄5o_nm- Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following challenge with wild-type C. pseudotuberculosis at week 6. No anti-PLD antibody response could be observed until after challenge.

Figure 1 1. Serum anti-phospholipase D (PLD) IgG levels were determined by ELISA for animals administered the DtxR/PLD vaccine, and are expressed as the OD4₅onm value obtained for each animal. Samples were taken following primary and secondary vaccinations (weeks 0 and 3 respectively) and at intervals over 12 weeks following bacterial challenge at week 6. No anti-PLD antibody response could be observed until after challenge with wild-type C pseudotuberculosis at week 6. The failure of several animals to seroconvert against PLD was due to the protection conferred by vaccination.

EXAMPLES

In order to save valuable cellular resources, all bacteria are able to sense their immediate environment, and produce only those factors that they need in order to allow them to colonise their particular environmental niche. This is no different during infection, when a variety of specific proteins are produced in order to allow the organism to colonise and persist within the infected animal.

We have determined a novel means of creating enhanced vaccines against bacterial diseases of animals and humans. In order to show proof-of-concept of this new approach, we have in the first instance used it to create a vaccine for the ovine disease, caseous lymphadenitis (CLA), which is caused by the bacterium

Corynebacterium pseudotuberculosis.

Specifically, we have created a genetically-modified derivative of C. pseudotuberculosis, in which the gene encoding the regulatory protein, DtxR, has been removed. As a direct consequence of this mutation, under normal laboratory growth conditions our mutant C. pseudotuberculosis strain produces those proteins that would normally only be produced during an infection within an animal. We have proposed to exploit this important aspect in order to produce an 'enriched' vaccine, since we believe that inclusion of these proteins within a vaccine will provide significant protection against subsequent infection with C. pseudotuberculosis.

EXAMPLE 1

MATERIALS AND METHODS

Bacterial strains, plasmids and growth conditions

The bacterial strains and plasmids used and created in this study are presented in Table 1. E. coli DH5ct-E (Invitrogen) was used for routine cloning procedures, and was cultured at 37°C in Luria Bertanii (LB) medium, either static on solid LB agar or at 220 rpm in LB broth. Where required, LB medium was supplemented with erythromycin (to 300 pg/ml). The virulent, ovine-derived United Kingdom C. pseudotuberculosis isolate, 3/99-5 (2) was cultured at 37°C (or 26°C when transformed with a temperature-sensitive (TS) plasmid) in Brain Heart Infusion (BHI) medium, static on BHI agar plates or at 220 rpm in BHI broth containing 0.05 % (v/v) Tween 80 (BHIT). A chemically-defined medium suitable for propagation of C pseudotuberculosis (CCDM) was developed as part of this study, and contained 10.38 g 1 RPMI-1640 (Sigma, R 8755), 86 raM L-glutamic acid and 10 % (w/v) glucose. Media components were dissolved in 900 ml ddH₂0 prior to adjusting the pH to 4.0 and supplementing with NaHC0₃ to 23 μΜ final concentration. The pH was then adjusted to 7.1 prior to the medium being made up to a final volume of 1 1, then stored at 4°C, protected from light. Prior to use, the CCDM was supplemented with 0.05 % (v/v) filter-sterilized Tween 80^®. Where required, C. pseudotuberculosis growth media were supplemented with antibiotics to the following concentrations: erythromycin (0.05 μg/ml), kanamycin (50 μg/ml), and spectinomycin (100 g ml). General molecular biological techniques and targeted allele replacement mutagenesis

Routine molecular biological manipulations were conducted as described (6). Transformation of E. coli with plasmid DNA was conducted according to the competent cell vendor's (Invitrogen) supplied instructions, while transformation of C. pseudotuberculosis was conducted as described (9). Subsequently, targeted allele replacement mutagenesis of C. pseudotuberculosis was performed as described (9). Preparation of nucleic acids

C. pseudotuberculosis genomic DNA was harvested from cells from 5 ml overnight cultures. Cells were harvested by centrifugation at 3,893 ^χ g for 15 min at 4°C and resuspended in 500 ul of TE buffer (50 mM Tris-HCl; 10 mM EDTA, pH 8.0) supplemented with 5 mg of lysozyme and 10 μg of RNAse A (from a 10 mg/ml solution). Cell suspensions were incubated at 37°C for at least 1 hr, transferred 1.5 ml tubes containing ca. 500 μΐ of i 0 μπι diameter zirconium beads, and homogenized for 3 x 20 sec at a speed rating of 5.5 in a FastPrep® instrument (Q.Biogene). The tubes were then centrifuged briefly in at 17, 970 x g in a microcentrifuge and the supernatants transferred to fresh 1.5 ml microcentrifuge tubes. Then, 5 mg proteinase K and 50 μΐ of a 10 % (v/v) solution of N-lauryl-sarcosine were added to the supernatants, prior to a further overnight incubation at 55°C. Subsequently, DNA was extracted with 500 μΐ of phenol.choloroform.isoamyl alcohol (25:24: 1), then with 500 μΐ cholorofom:isoamyl alcohol (24:1). DNA was precipitated by addition of 2 volumes of absolute ethanol and 0.1 volume of 3 M sodium acetate (pH 5.2) to each sample. Precipitated DNA was harvested by centrifugation at 17,970 x g for 20 min at 4°C, and for each sample the resulting pellet was washed by addition of 500 μΐ of 70 % (v/v) ethanol and centrifuging as before for 10 min. Finally, the ethanol was carefully decanted, and the DNA pellet was air-dried prior to re-suspension in 50-100 μΐ of distilled water.

C. pseudotuberculosis total RNA was extracted and purified based upon a method described by Huser et al. (2003) which employs the RNeasy mini kit (Qiagen) with some modifications (3).

Southern Hybridisation

Southern hybridisation was carried out using Zeta-Probe Genomic Tested (GT) blotting membrane (Bio-Rad) using the standard capillary-transfer conditions recommended by the manufacturer. Labelling of DNA probes and immunological detection of hybridized probes was conducted using the DIG high prime labelling and detection starter kit (Roche), according to the manufacturer's instructions.

Inverse PCR

An 'inverse PCR' technique (4) was used to amplify unknown regions of DNA flanking a known portion of the C. pseudotuberculosis dtxR-M e gene. Briefly, genomic DNA was digested to completion with a suitable restriction endonuclease (as determined by Southern hybridisation). Subsequently, the digested DNA fragments were gel purified and circularised by self-ligation with T4 DNA ligase in a 20 μΐ reaction containing 3 μg DNA. A total of 1 μΐ of circularised genomic DNA was used as template in 50 μΐ reactions. Thermal cycling was conducted for 30 cycles, using a primer annealing temperature of 56°C for 1 min and an extension temperature of 72°C for 2.5 min. For inverse PCR amplification of larger DNA fragments, following circularisation of genomic template DNA, long-range PCR was carried out using the Expand Long Template PCR sysiem following the manufacturer's instructions (Roche Diagnostics Ltd., West Sussex, UK.). For the work described here, the supplied 'Buffer 1 ' was used, which is optimised for amplification of DNA fragments of <9 kb. Long-range inverse PCR was performed in 50 μΐ reactions, containing 20 μΐ of circularised DNA as template, 0.2 raM each of dATP, dTTP, dCTP and dGTP, 0.3 μΜ ^_inv(fwd) primer, 0.3 μΜ dtxR nv (rev) (Table 2), l Buffer 1 and 0.75 μΐ polymerase mix (3.75 U). Following a preliminary denaturation step at 94°C for 2 min, thermal cycling was conducted for 25 cycles, comprising a 94°C denaturation step for 10 sec, a 30 sec annealing step at 55.5°C and a 68°C extension step for 8 min. Promoter fusion assays

Promoter fusion assays were achieved using the plasmid pSPZ (5), containing a promoterless lacZ gene, a spectinomycin resistance gene and a stable pNG2 replication origin for C. diphtheriae. Previously created pSPZ constructs were obtained from Prof. R. K. Holmes (University of Colorado at Denver and Health Sciences Centre, School of Medicine, Dept. of Microbiology, Aurora, Colorado, USA), which comprised the promoter-containing regions of the C. diphtheriae DtxR- regulated gene, tox (5) and irp3 (R. K. Holmes, personal communication) genes, cloned upstream of the promoterless lacZ gene in pSPZ. A single colony of C. pseudotuberculosis, transformed with either construct was used to inoculate triplicate 5 ml volumes of CCDM containing spectinomycin (100 μg/ml), and the cultures were incubated overnight at 37°C ^χ 225 rpm. Subsequently, cultures were diluted to an OD6o₀nm of 0.1 , and incubated, as before, for ca. 6 hrs until mid log-phase had been reached. The OD of each culture was recorded, and a 100 μΐ aliquot of each was then transferred to glass test tubes. For each culture aliquot, bacteria were lysed by the addition of 900 μΐ of Z buffer (5), followed by 40 μΐ of 0.1 % (w/v) SDS and 150 μΐ of chloroform. The tubes were then sealed with Parafilm (Pechiney Plastic Packaging) and vortexed for 30 sec. To assess expression of the lacZ reporter gene, 200 μΐ of a 4 mg/ml solution of o-nitrophenyl-^-Z -galactoside (ONPG) was added. Subsequently, tubes were incubated at room temperature to allow colour development for up to h hr depending on the speed of the colour change. Enzymatic reactions were stopped by addition of 500μ1 of 1 M Na₂C0₃ to a final concentration of 0.5 M, and the length of incubation was recorded. Each reaction mixture was then transferred to 2 ml tubes and centrifuged at 17, 970 ^x g for 5 min at room temperature. Following centrifugation, the upper, aqueous phase of each sample was transferred to a cuvette and the OD42o,_ul, was measured and recorded. Subsequently, the level of expression was determined, expressed in "Miller units", according to the following equation: 1000 x (A420nm-1 -75) ÷ (length of incubation) x cell volume (0.1 ml) * Aeoonm- Statistical analyses

Data was analysed and graphs were drawn using Microsoft^® Office Excel 2003 (Microsoft^®; CA. USA). Significant differences were assessed by the Student's t- test and ANOVA, which were performed using the Minitab^® 15.1 software (Minitab™, UK). Error bars presented in figures correspond to the standard deviation of the mean.

Western blotting

Following separation by SDS-PAGE, proteins were immediately transferred to a nitrocellulose membrane (BioRad). The transfer was performed at 400 mA for 30 min using a Bio-Rad Mini Trans-Blot™ apparatus. Following transfer, the nitrocellulose membrane to which proteins were bound was blocked in 1 % (w/v) Top-Block™ (Fluka Chemical Corp.) for 1 hr. The Top-Block™ was then replaced with 15 ml of PBS containing 0.05 % (v/v) Tween 20 (PBST) containing CLA- positive sheep sera diluted 1 :500. The membrane was incubated with the sheep sera for 1 hr at room temperature on a rotary shaker, and then washed three times in PBST, for 5 min on a rotary shaker. The membrane was then incubated in 15 ml of PBST containing a 1 :5,000 dilution of a horseradish peroxidise-conjugated mouse monoclonal anti-goat/sheep IgG antibody (clone GT-34; Sigma) for 1 hr, with shaking. The membrane was washed twice with PBST, as before, then incubated in 3,3'-diaminobenzidine (DAB) substrate (prepared from a DAB tablet (Sigma) according to the manufacturer's instructions), at room temperature until bands became visible.

RESULTS

Identification of a dtxR -horaologue in C pseudotuberculosis

In order to attempt the PCR amplification of a dtxR homologue from C. pseudotuberculosis, the C. diphtheriae dtxR gene (acc. #M80338) and homologous genes from C. glutamicum ATCC 13032 (acc. #NC_003450, locus tag NCgl 1845) and C. efficiens YS-314 (acc. #NC_004369, locus tag CE1812) were aligned. The C. efficiens gene was observed to share 74% homology with that of C. glutamicum, while 01716

20

C. diphtheriae dtxR shared 62% and 66% homology with C. efficiens and C. glutamicum, respectively. In addition to divergence of the coding sequences (frequently resulting only in silent mutations), slight rearrangement between the 3 sequences was observed between bp 461 to 482 and bp 668 to the end of the genes (data not shown). Oligonucleotide primers were designed according to the most highly-conserved regions that could be identified between the 3 genes (although none were of sufficient length to allow optimal primer design). Of the primers tested, only one pair (dtxR#0l and dtxRW , Table 2) resulted in the amplification of an expected 312 bp fragment from both C. pseudotuberculosis and the control strains (C. glutamicum and C. efficiens) (data not shown). The C. pseudotuberculosis PCR fragment was cloned into pPCR-SCRIPT, and the resulting plasmid designated pMMF014. Subsequent sequencing of the cloned insert using the vector-specific T3 and T7 universal primers confirmed that a C. pseudotuberculosis DNA fragment sharing homology with C. diphtheriae dtxR had been cloned.

In order to determine the sequence of the rest of the <fc ?-homologue and its flanking regions, inverse PCR was employed. Southern blot analysis revealed that the restriction endonucleases Kpnl, Hwdlll and Xbal generated genomic DNA fragments of ca. 0.9 kb, 3 kb and 6.5 kb respectively, all of which contained the fifc i?-homologue and which were considered to be of a suitable size for PCR amplification. Significantly, Southern blot analysis also confirmed the presence of a single copy of the dtxR-like gene within the C. pseudotuberculosis chromosome (data not shown). Fresh genomic DNA was digested to completion with either Kpn\, H ndIII, and Xbal. Linearised fragments were circularised by ligation to create amplification templates and inverse PCR was conducted using the primers dtxRj (fwd) and dtxR_ inv (rev). Subsequently, amplified, blunt-ended DNA products were purified and cloned into pCR^®Blunt II TOPO^® to generate the recombinant plasmids pCAWOOl, pCAW002, and pCAW003 (for Kpnl, Hindlll and Jftel-derived fragments respectively). Each construct was then sequenced, using the vector-specific Ml 3 forward and reverse primers in the first instance, and further sequencing primers were synthesized as new DNA sequences became available (Table 2). From the sequencing data obtained, the region of the C. pseudotuberculosis chromosome surrounding the original 312 bp ΛχΛ-homologous sequence was assembled (Figure 1). The DNA sequences amplified by inverse PCR from Kpnl- and Hwdlll-digested DNA were all present within the larger 6.5kb Xbal PCR product, and by sequencing all 3 plasmid constructs the integrity of the assembled chromosomal region was confirmed. Open reading frames (ORFs) were identified within the sequences and subsequent BLAST analysis of ihe 6.5 kb C. pseudotuberculosis ccniig. revealed homology with C. diphtheriae (acc. # NC_002935) dtxR (locus tag DIP 1414), galE (locus tag DIP1415), and 2 conserved hypothetical proteins of C. diphtheriae. In addition, a partial ORF sharing homology with the sigB (locus tag DIP1413) of C. diphtheriae was present upstream of the ORF encoding the DtxR homologue. Additionally, a partial ORF, which shared homology with a putative helicase of C. diphtheriae (locus tag DIP1418) was identified at the 3'-end of the 6.5 kb contig.

The translated products of the C. pseudotuberculosis ORFs were compared with the equivalent proteins from C. diphtheriae and C. glutamicum. Significantly, during the time that this work was being conducted, a C. pseudotuberculosis 3/99-5 genome sequencing project was initiated as part of a separate project in our laboratory (to be published separately) and one of the several contiguous sequences that became available was found (by BLAST analysis) to contain the sequence corresponding to the dtxR region amplified by inverse PCR. Subsequently, it was possible to obtain the 5 '-region of the sigB homologue of C. pseudotuberculosis which was lacking in the 6.5 kb inverse PCR fragment. The translated product of the sigB homologue shared 92% identity and 97% similarity with SigB of C. diphtheriae, and 89% identity and 95% similarity with that of C. glutamicum. The DtxR-homologue of C. pseudotuberculosis shared 79% identity and 87% similarity with C. diphtheriae and 74% identity and 84% similarity with C. glutamicum. The GalE homologue of C. pseudotuberculosis shared 81 % identity and 90% similarity with that of C. diphtheriae and 78% identity and 87% similarity with C. glutamicum.

The translated product of the C. pseudotuberculosis dtxR-VAae gene was aligned with the amino acid sequences of DtxR of C. diphtheriae and C. glutamicum (Figure 2). The sequence encoding the predicted DNA-binding domain (domain 1) lay within a region of generally-high sequence conservation, particularly between C. pseudotuberculosis and C. diphtheriae. Similarly, domain 2, required for dimerization of DtxR, was also highly conserved between all three corynebacteria. Interestingly, however, domain 3 was highly variable between all three species.

RT-PCR was conducted to confirm that the dtxR-M e gene was expressed in C. pseudotuberculosis. The presence of a transcript corresponding to the 312 bp fragment amplified with the primers dtxR Ol and dtxR )3 was assessed in bacteria harvested in the exponential phase of growth. The expected product was successfully amplified from reverse transcribed mRNA, but not in non-reverse-transcribed control reactions (data not shown).

DtxR-mediated, iron-dependent gene expression in G pseudotuberculosis

Having confirmed the expression of the ifctR-homologue by RT-PCR, an experiment was conducted to determine whether C. pseudotuberculosis produced a regulatory protein that would function in a similar manner to C. diphtheriae DtxR. This was achieved using the plasmid pSPZ (5), containing a promoterless lacZ gene, a spectinomycin resistance gene and a stable pNG2 replication origin for C. diphtheriae, to study the outcome of environmental iron concentrations on the expression of known C. diphtheriae DtxR-regulated genes by measurement of β- galactosidase production. Previously created pSPZ constructs were obtained from Prof. R. K. Holmes (University of Colorado at Denver and Health Sciences Centre, School of Medicine, Dept. of Microbiology, Aurora, Colorado, USA), which comprised the promoter-containing regions of the tox (5) and irp3 (R. K. Holmes, personal communication) genes cloned upstream of the promoterless lacZ gene in pSPZ. These constructs were introduced into wild-type C. pseudotuberculosis by electroporation, and promoter activity was assessed by measuring β-galactosidase activity under high- and low-iron culture conditions (Figure 3). Significantly, lacZ expression was found to be up-regulated under conditions of low-environmental iron for both the tox and irp3 promoters in C. pseudotuberculosis (the data shown is representative of 3 distinct experiments). The data was statistically analysed using a paired t-test, the outcome of which confirmed that environmental iron concentration was exerting a highly significant effect upon the level of expression of irp3 (p=0.01 1). Furthermore, the expression of tox also appeared to be affected by iron concentration (albeit to a lesser extent than irp3), although variability in the data over subsequent experiments resulted in fairly large error-bars, with the result that statistical analysis only suggested a trend towards significance (p=0.068). Furthermore, it was considered possible that reduced expression of the toxP product might be as a result of variation in the function of the C. pseudotuberculosis DtxR-homologue.

A further experiment was conducted to determine the involvement of a C. pseudotuberculosis regulator in the control of expression of C. pseudotuberculosis genes in response to environmental iron. The fagA gene, which has been previously shown to be expressed under low-iron growth conditions (1), was used as a test subject. Computational analysis of the fagA nucleotide sequence was performed, in order to determine whether it contained a putative DtxR-binding motif. Significantly, and as reported previously, a putatiVc DixR-binding motif (TTAGTTTAGGCTAAACTGG) was identified 122 bp upstream of the first nucleotide of fagA.

To conduct promoter fusion assays, a 511 bp fragment containing 300 bp of sequence immediately upstream of fagA was cloned into pSPZ to create the plasmid pCAW007. The plasmid was used to transform wild-type C. pseudotuberculosis, and β-galactosidase production was measured under high- and low-iron growth conditions (Figure 4). As expected, fagA was found to be expressed in an iron-dependent manner (p=0.013).

While these results of the promoter fusion assays confirmed the presence of a DtxR-like regulator in C. pseudotuberculosis, they only circumstantially implicated the product of the dtxR-like gene in this process. Therefore, to address this question, a DtxR-deficient derivative of C. pseudotuberculosis was created. An in-frame deletion within the C. pseudotuberculosis dtxRAike, gene was constructed in vitro. PCR with the primers AdtxR AE l and AdtxR_AE_2 (Table 2) was used to amplify a 1 ,022 bp fragment from immediately upstream of dtxR, which included the first 9 bp of the 5' end of the dtxR gene. Likewise, PCR using the primers AdtxR_AE_3 and AdtxR_AE_4 was used to amplify a 1,020 bp fragment from immediately downstream of dtxR, which included the last 3 bp of the 3' end of the dtxR gene. The two fragments were ligated (using the incorporated Xhol site), and the ca. 2 kb product was amplified by PCR using primers AdtxR_AE_\ and AdtxR_AE_4. The resulting mutant gene, designated AdtxR, comprising an in-frame deletion of the majority of the dtxR coding sequence, was cloned into Sa/I-digested pCARV (facilitated by primer- encoded restriction endonuclease recognition sites). The recombinant plasmid, designated pCARV006, was used to transform C. pseudotuberculosis, and the wild- type chromosomal gene was replaced with the mutant derivative by allele- replacement mutagenesis.

The mutant C. pseudotuberculosis strain, designated Cp-AdtxR (otherwise referred to within this document as DtxR-deficient strain or mutant), was assessed to ensure that the dtxR deletion was as expected. Genomic DNA extracted from the wild-type or the Qp-AdtxR mutant was used as template in PCR reactions using the primers AcfoxR DCO F and AdtxR_DCO_R. As expected, these primers resulted in the amplification of a ca. 1.26 kb fragment from the wild-type strain; however, the equivalent PCR product for the AdtxR strain was ca. 0.7 kb shorter, confirming the deletion within the chromosomal dixR gene (data not shown). In addition, Southern blot analysis of HVndlll-digested genomic DNA (generating a fragment containing the dtxR and galE genes), using a g<3/£-specific probe, revealed a hybridization product for the mutant ca. 0.7 kb smaller than that for the wild-type strain (data not shown). Furthermore, a Southern blot using a probe corresponding to the erythromycin- resistance gene of pCARV failed to detect the presence of the plasmid in the mutant strain, confirming that it had been successfully lost from the cell during the mutagenesis process (data not shown).

In order to ensure that the transcription of other genes in the sigB-dtxR-galE operon was unaltered, RT-PCR analysis was carried out to detect the presence of a sigB-dtxR-galE transcript (since all 3 genes are co-transcribed in C. pseudotuberculosis; data not shown). RNA was extracted from exponential -phase cultures of the wild-type and DtxR-deficient strains, and RT-PCR was conducted using the primers sigBJS_F and galE_ a_R. In both cases the presence of a transcript was confirmed in reverse transcribed samples, however, the transcript in the DtxR- deficient strain was ca. 0.7 kb smaller than that of the wild-type, corresponding to the size of the deletion within the ΛχΛ-homologue (Figure 5). Furthermore, sequencing of the region spanning the deletion within Cp-MtxR was conducted following amplification of that region by PCR using the primers dtxR_seq_F and dtxR_seq_K. As expected, the genomic region spanning the mutant gene was unchanged in comparison to the wild-type, and the mutant dtxR gene contained an in- frame deletion of the expected size (data not shown).

In order to unequivocally determine the involvement of the C. pseudotuberculosis DtxR-like protein in the iron-dependent regulation of target genes, a promoter fusion assay was carried out using the Cp-AdtxR mutant strain as a host for pCAW007 (containing the fagA promoter). Differences in the level of β-galactosidase production under high- and low-iron growth conditions, was determined (Figure 6), and it was apparent that the absence of the DtxR-homologue prevented repression of fagA expression in high-iron growth medium, since there was no significant difference between the observed level of expression under both conditions (paired t- test result of p=0.086). Furthermore, statistical comparison (by ANOVA) of fagA promoter activity (from pCAW007) in the wild-type C. pseudotuberculosis strain compared to the Cp- dtxR mutant, both under high- and low-iron growth conditions, provided evidence that under high- and low-iron conditions there was a significant difference in the levels of expression of fagA in the wild-type compared to the Cp- AdtxR mutant (p=0.004), confirming that the absence of DtxR had an impact upon iron-dependent regulation of expression of fagA (data not shown).

Immunological detection of C. pseudotuberculosis proteins by ovine immune sera In order to determine whether the abrogation of production of the DtxR-like protein in the Cp-AdtxR mutant affected the production, in vitro, of proteins normally produced in vivo during infection, a Western blot was performed using pooled sera from several sheep with CLA. The Qp- dtxR mutant and the wild-type parent strain were both cultured in CCDM supplemented with 10 μΜ (final concentration) of FeCl₃. Once mid-logarithmic growth-phase was reached, culture volumes were normalized by OD6oonm then cells were harvested by centrifugation, and supernatants were retained for further analysis. Initially, proteins were separated by electrophoresis through an SDS-polyacrylamide gel and visualised by staining with Coomassie (Figure 7, Panel A). Differences between the secreted protein profiles of the 2 strains was apparent. Furthermore, Western blot analysis of the secreted protein preparations confirmed that numerous proteins were produced by the Cp-A-foR mutant that were recognized by serum IgG antibodies in sheep with CLA (Figure 7, Panel B). In contrast, the equivalent proteins were not recognised in supernatants derived from the wild-type strain. It was therefore concluded that the abrogation of production of the DtxR-like protein in C. pseudotuberculosis allows un-restricted expression of genes normally only expressed under the low-iron conditions experienced in vivo.

Table 1. Bacterial Strains

Bacterial strain Genotype Source/Reference

E. coli electroMax DH5a-E (F- (p80/acZAM15 A(/acZYA-argF) U169 recA 1 Invitrogen, UK endA 1 hsdRM (rk-, mk+) gal- phoA supE44 λ- tki- 1 gyrA96 relA X)

One shot® TOP 10 (F- mcrA Aimrr-hsd&MS-mcrBC) <p80focZAM 15 Invitrogen, UK chemically competent cells AlacX14 recA 1 araD\7>9 A(ara-leu) 7697 galU

galKrpsL (StrR) endA\ nupG) C. pseudotuberculosis

3/99-5 Nitrate-negative virulent field isolate (2)

Cp- AdtxR Diphtheria toxin repressor (dtxR) deletion This study derivative of C. pstb 3/99-5

Table 2. Oligonucleotide Primers

Primer Sequence (5'-3')^* Target Reference¹

bp 2091-2106 C.

dtxRjm (fwd) TCGTAGATGGTCCGCA This study pstb dtxR locus

bp 2326-2345 C.

dtxRjm (rev) TGGCTTAGATATCCACAAGG This study pstb dtxR locus

bp 1006-1025 C.

AdtxR AE 1 gtcgacAGGACTCAGAAGAACCACTA" This study pstb dtxR locus

bp 2045-2065 C.

AcW?AE 2 ctcgagATCTTTCA I I 1 I CAACCTCTT" This study pstb dtxR locus

bp 2735-2756 C.

AcftxR AE 3 ctcgagTAAAGGGTACCCACATGAAACT" This study pstb dtxR locus

bp 3777-3795 C.

AdtxR AE 4 gtcgacGAGAAAACGAATGCAGCAG³ This study pstb dtxR locus

bp 1788-1809 C.

AtffxK DCO F ATCTAATTTCACCACCATAAAA This study pstb dtxR locus

bp 3068-3089 C.

AdtxR DCO R GAAGAAAAGACCAAGTTTGTTA This study pstb dtxR locus

Degenerate

dfxf?_01 GTGAAGGATCTGGTCGATACC This study primers

Degenerate

dtxR_03 CCAGCGGCAGGCTTCGTCGTG This study primers

bp 3303-3322

Ermjarobe F TGGAAATAAGACTTAGAAGC This study pCA V

bp 4156-

Erm_probe R CGACTCATAGAATTATTTCC This study

4175pCARV

bp 452-475

TOPO Blunt 13 F CGCCAGGG I I 1 1 CCCAGTCACGAC inverse PCR

(Invitrogen) product

bp 185-208

TOPO Blunt

M13 R GAGCGGATAACAATTTCACACAGG inverse PCR

(Invitrogen) product

pCAW004 1.0 AGCATAACACCGAATTG This study bp 2740-2759 C.

pCAW004 2.0 GGTACCCACATGAAACTCCT This study pstb dtxR locus bp 1188-1205 C.

pCAW004 1.1 TTCCATGGCTCGGATAAG This study psfb dtxR locus

bp 3256-3272 C.

This study pstb dtxR locus

bp 7193-721 1 C.

pCAW004 1.2 TCACCGATCTCTTGCACAA This study pstb tiixR locus

3786-3804 bp C.

pCAW004 2.2 TCGTTTTCTCATCATGACA This study psto ftxR locus

bp 6660-6678 C.

pCA 004 1.3 GAA! Γ Γ 1 1 CGCTAACAAGC This study pstb dtxR locus

bp 4337-4353 C.

pCAW004 2.3 AAAGCTTCCCCACGGCT This study pstb dtxR locus

bp 6114-6133 C.

pCAW004 1.4 AGCAAGAAATTTCTCGAACT This study psfb o?x locus

bp 4870-4886 C.

pCAW004 2.4 TGGATAGCGCGTCATGC This study psffo /fxR locus

bp 5598-5617 C.

pCAW004 1.5 ACCAAAGCGTTCTACGAGGT This study psfb tffxR locus

bp 5381-5397 C.

pCAW004 2.5 CTTGAGCACAGGCCAGT This study psfb dfxR locus

fagA P F agatctTGGGATCTGGATGGAATAGAG" bp 2774-2794 Acc. #

fagA gene AF401634 fagA P R gtcgacACCCAAAGCGTGCTTAAC" bp 3268-3285 Acc. #

fagA gene AF401634 sigB B F CTTCCTTGCGACACTCTGACAT bp 1564-1585 C. This study pstb dtxR locus

galE a R GGCCTAAAGCAACTTGGAGAATT bp 3315-3337 C. This study pstb dtxR locus

oligonucteotide-incorporated resinciion ertdonuciease recognition sites are indicated by lower-case letters and the suffixes a, b and c refer to Sail, Xho\ and Xmal respectively.

fAcc. # refers to GenBank accession number of target nucleic acid sequence against which oligonucleotide primers were directed.

REFERENCES

1. BUIington, S. J., P. A. Esmay, J. G. Songer, and B. H. Jost. 2002.

Identification and role in virulence of putative iron acquisition genes from Corynebacterium pseudotuberculosis. FEMS Microbiol Lett 208:41-5.

2. Connor, K. M., M. M. Quirie, G. Baird, and W. Donachie. 2000.

Characterization of United Kingdom isolates of Corynebacterium pseudotuberculosis using pulsed-field gel electrophoresis. J Clin Microbiol 38:2633-7. 3. Huser, A. T., A. Becker, I. Brune, M. Dondrup, J. Kalinowski, J. Plassmeier, A. Puhler, I. Wiegrabe, and A. Tauch. 2003. Development of a Corynebacterium glutamicum DNA microarray and validation by genorne- wide expression profiling during growth with propionate as carbon source. J Biotechnol 106:269-86.

4. 4. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-3.

5. Oram, D. M., A. D. Jacobson, and R. K. Holmes. 2006. Transcription of the contiguous sigB, dtxR, and galE genes in Corynebacterium diphtheriae: evidence for multiple transcripts and regulation by environmental factors. J

Bacteriol 188:2959-73.

6. Sambrook, J. a. R., D. W. 2001. Molecular Cloning A Laboratory Manual, Third ed. Cold Spring Harbour Laboratory Press.

EXAMPLE 2

Additionally, we have further engineered our vaccine strain such that (upon administration of the vaccine derived from the vaccine strain) we are able to Differentiate between Infected animals and Vaccinated Animals (DIVA). Diagnosis of CLA may currently be achieved through use of a commercially-available diagnostic blood test, ELITEST CLA, which detects serum IgG specific for phospholipase D (PLD), a secreted toxin produced by C. pseudotuberculosis during infection. To complement this test, the vaccine strain has been engineered such that the pld gene, encoding PLD, has been deleted, and thus the protein is no longer produced by the mutant strain. Consequently, vaccination of animals with our PLD- deficient vaccine will not raise an immune response against PLD (since the protein is not a component of the vaccine), and therefore a negative blood test result would be expected. In contrast, animals which are infected with C. pseudotuberculosis will produce antibodies against PLD (since the naturally-encountered organism produces this antigen), and these are detected by the diagnostic test.

There has been a significant body of research focused upon the use of PLD as a vaccine antigen, whereby immunisation with the chemically or genetically inactivated form of the protein has been shown to confer protection against infection with C. pseudotuberculosis (e.g. 2-5). As a result, this protein is considered one of the major protective antigens produced by the organism. Consequently, it was unclear whether removal of PLD from our vaccine strain would reduce the efficacy of a resulting vaccine, detrimentally affecting the level of protection achieved against subsequent infection. This specification describes the creation of a DIVA vaccine by abrogating expression of a suitable secreted protein, ihe exemplar being PLD. However, three distinct DIVA vaccines were constructed and each experimentally analysed; all vaccines were based upon the DtxR-deficient strain (Cp-AdtxR). For reference, the three vaccine strains are described in Table 1. As described above, one DIVA vaccine strain was deficient in production of PLD. A second strain was created by deletion of the cp40 gene encoding Cp40, a secreted serine protease, known to induce an immunological response in the host (8). A third vaccine strain was created by deletion of both the pld and cp40 genes. In addition to the 3 DIVA vaccines, we also recognised that the DtxR-deficient strain itself (in which the genes encoding PLD and/or Cp40 had not been removed) would be suitable for use as a vaccine, although it would not permit a DIVA approach to be taken. Vaccines derived from all strains were assessed using a sheep experimental model of C. pseudotuberculosis infection. Table 1. Description of vaccine strains.

Vaccine strain Description

Over-produces virulence-associated proteins.

1 DtxR-deficient mutant

Does not have DIVA capacity

Over-produces virulence-associated proteins.

2 DtxR/PLD-deficient mutant

Does not produce PLD. Has DIVA capacity Over-produces virulence-associated proteins.

3 DtxR/Cp40-deficient mutant

Does not produce Cp40. Has DIVA capacity Over-produces virulence-associated proteins. DtxR/PLD/Cp40-deficient

4 Does not produce PLD or Cp40. Has

mutant

enhanced DIVA capacity

MATERIALS & METHODS FOR EXAMPLE 2.

Construction of a DtxR/Cp40-deficient mutant of C. pseudotuberculosis

The oligonucleotide primers used for the construction and screening of a Cp40-deficient mutant are described in Table 2. PCR amplification of the 5'- and 3'- chromosomal regions flanking the cp40 gene of C. pseudotuberculosis strain 3/99-5 was conducted using the primers cpAEl + cpAE2 (Fragment 1) and cpAE3 + cpAE4 (Fragment 2). Fragment 1 comprised 1,032 bp of upstream flanking sequence, including the first 30 bp of cp40, while Fragment 2 comprised 919 bp of downstream flanking sequence, containing the last 105 bp of cp40. The two amplicons were digested with Xhol and ligated, and the ligation product was further amplified by PCR using the primers cpAEI +^■ cpAE4. The resulting ca. 2.1 kb fragment (designated cp40), containing an in-frame deletion of 1,041 bp, was then cloned into Sall- digested pCARV (7) to create pC ARV005.

The DtxR-deficient C. pseudotuberculosis strain was transformed with pCARV005, and allele-replacement mutagenesis was conducted, in an equivalent maimer to that described (7). Following the two-step mutagenesis procedure, bacteria were plated onto solid media and potential cp40 mutants were identified by PCR analysis of genomic DNA extracted from individual bacterial colonies using the primers Acp40 DCO_F + Acp40 DCO R. Successful amplification of a 292 bp product was indicative of the successful deletion of cp40. One mutant was chosen for further screening. The chromosomal region spanning Acp40 in this mutant was confirmed to be as expected by sequencing of the DNA product amplified by PCR with the primers cp40_seq_F + cp40_seq_R (data not shown).

Table 2. Oligonucleotide primers used for the construction and screening of the cp40- deficient C. pseudotuberculosis strain.

Primer name Sequence (5'-3')' Target^T

cp AE 1 GTCGACGCGGACTTTGTAAAGTTTGC^b bp 332-351 cp AE 2 CTCGAGGCGTGAGACTGATCGAGG⁰ bp 1374-1357 cp AE 3 CTCGAGTTCACCACACTCAAACCGAC⁰ bp 2380-2399

cp AE 4 GTCGACGACC I I 1 1 I GTTACCGTGC^b bp 3420-3402

Acp40 DCO F CTTGCCCAGGATTAAATGC bp 1272-1290

Acp40 DCO R CGCCCGTGAGATTATTTTT bp 2571-2553

cp40_seq_F CGGCAACATCTAGCTGC bp 1088-1104 cp40_seq_R GCTAAAACAAAACGGCG bp 2739-2723

Restriction endonuclease recognition sites are underlined, and the suffixes a, b and c refer to Xmal, Sa/I and Xhol, respectively.

All primers are specific for GenBank accession number JF299259.

Construction of a DtxR/PLD/Cp40 deficient mutant of pseudotuberculosis The pCARV005 vector was introduced into the DtxR/PLD-deficient strain by electroporation, and used to create a mutation in the cp40 gene, exactly as described

Preparation of vaccines

CCDM. Aliquots of CCDM containing 0.05 % (V/V) Tween 80, were inoculated with each of the vaccine strains. Following incubation overnight at 37°C and 200 rpm, these cultures were used to inoculate 300 ml volumes of CCDM without Tween 80 (Tween 80 was added to Corynebacterium cultures to prevent cell clumping, and enhance growth; hence, by including Tween in the starter culture, a uniform cell suspension was obtained, allowing more accurate quantification of the inocula used for the vaccine cultures). Cultures were incubated to the stationary- phase of growth, and then harvested to prepare vaccines. Each culture was centrifuged to pellet cells, and supernatants were decanted into separate, sterile Duran bottles. Preparation of supernatant vaccine fraction

Formalin was added to each supernatant to a final concentration of 0.3 %. Following incubation at 4°C overnight, supernatants was filter-sterilised through a 0.2 μπι filter, and small volumes spread onto 5% (v/v) sheep blood agar plates and incubated at 37°C for 5 days to ensure sterility. Having observed no unexpected microbial growth on blood plates, the inactivated supernatants wereconcentrated 20- fold through 5kDa molecular weight cut-off centrifugal filters, ready for blending in the final vaccine preparation.

Preparation of whole-cell vaccine fraction

Each bacterial cell pellet was suspended in 15 ml of saline in a 50 ml polypropylene tube. Twenty χ 2 mm glass beads were added to each tube, and suspensions were placed on a vortex mixer for 5 min to disperse clumps; this resulted in a homogenous suspension. Formalin was then added to 0.3 % final concentration, and after overnight incubation at 4°C sterility checks were conducted by plating aliquots onto 5% (v/v) sheep blood agar plates and incubating at 37°C for 5 days incubation at 37°C, no bacterial growth was apparent. Each cell suspension was decanted into a fresh tube (without the glass beads), and cells were harvested by centrifugation. Supernatants were discarded (to remove formalin), and each suspension was resuspended in 12 ml of physiological saline. The number of cells/ml in each sample were determined using a Densimat. Formulation of vaccines

Each 1 ml dose of vaccine was formulated in sterile physiological saline to contain a 10* final concentration of inactivated supernatant, 5x1 O^*' bacterial cells and 0.75 % final concentration of 2.0 % aluminium hydroxide adjuvant (Alhydrogel). For each vaccine, a sufficient quantity to allow a primary immunization followed by a secondary boost was prepared in a single vial, and then split into two individual glass vaccine vials, which were stored at 4°C until required.

Preparation of inoculum for challenge experiment

A cryopreserved stock of C. pseudotuberculosis 3/99-5 was revived by streaking onto a 5 % (v/v) sheep blood agar plate and incubating at 37°C for 48 hrs. A single colony was then picked and used to inoculate a further blood agar plate, which was incubated as before; the purpose of this repeated culture was to allow the organism to revive fully from cryostorage. All of the bacterial growth from the second plate was transferred into 5 ml of phosphate-buffered saline (PBS) using a sterile cotton-tip swab. Clumps of cells were disrupted by addition of 15 x 2 mm glass beads to the tube, and vortexing for 1 min. Dilutions of the homogenised culture were prepared in PBS, and the approximate number of cells within the neat culture initially determined using a Densimat. In addition, a Thoma chamber was used to accurately enumerate bacterial numbers. Subsequently, a 50 ml cell suspension in PBS was prepared, containing exactly 2 l0⁴ cells/ml. Individual syringes, sufficient for all animals, were each loaded with 1 ml of the inoculum.

Serology

Detection of anti-C. pseudotuberculosis IgG in ovine blood samples was conducted using either of two eri2yme-linked immunosorbent assays (ELISAs). The first test employed C. pseudotuberculosis whole-cells to detect C. pseudotuberculosis- specific IgG and was carried out as follows: Killed, wild- type C. pseudotuberculosis 3/99-5 cells were prepared exactly as for the preparation of the whole-cell vaccine fractions obtained from the derivatives of the DtxR-deficient strain. Cells were diluted in ELISA plate coating buffer (bicarbonate buffer, pH 9.8) to an OD₆₀onm coating concentration of 0.2. Adjusted cells were aliquoted (100 μΐ/well) into each well on 96-well ELISA plates (Nunc, Maxisorb) and each plate was incubated overnight at 4°C. Subsequently, plates were washed 3 times (200 μΐ/well) in TBST wash buffer (Tris-buffered saline (TBS) + 0.05% (v/v) Tween 20; Sigma-Aldrich) before being blocked in blocking buffer (TBST + 1% (w/v) casein) for 1 hour at 37°C. Plates were washed 3 times as before and then test and control sera, both diluted 1 in in i uj i y. jj /u vv / v ujvui, vv v_ uuusAi iu iv ci i i i laiw vv ^11 i uiv miv

(100 μΐ/well) and incubated for 1 hour at 37°C. Plates were again washed 3 times before adding the secondary antibody (HRP conjugated-mouse anti-sheep/goat IgG monoclonal; Sigma) diluted 1 in 10,000 in TBST + 0.05% (w/v) casein (100 μΐ/well). Plates were incubated for 1 hour at 37°C, then washed as before. Colourimetric substrate (OPD; Sigma-Aldrich) was added to each well (200 μΐ/well) on each plate and allowed to develop for 30 min at room temperature in the dark. Reactions were stopped with 3 M H2SO4 (50 μΐ/well) and plates were read at an absorbance of 490 nm. The second test, designated ELITEST CLA (purchased from Hyphen Biomed), employed ELISA plates coated with recombinant PLD antigen to determine serum anti-PLD IgG; the test was performed according to the manufacturer's supplied instructions, and antibody was determined based upon the values obtained following measurement at an optical density of 450nm.

Statistical analyses

A total score was obtained for each animal indicating the total number of tissues being infected following introduction of infection. Also, a pattern of infection was defined and each animal was clustered into one of the following three categories of pattern: Pattern 1 (no tissue was infected); Pattern 2 (only one tissue was infected) and Pattern 3 (two or more tissues were infected); these patterns were chosen to highlight the spread of infection within animals, with a greater number of affected tissues indicating more-extensive infection.

A contingency table of treatment group and pattern was prepared and the differences in the proportion of animals having a particular pattern in the five treatment groups were tested using a two-sided Fisher's Exact test.

The total score data were analysed using a one-way analysis of variance (ANOVA) with treatment group as a factor. If an overall F-statistic from ANOVA was significant, then the two-sided probabilities were obtained for four treatment group comparisons (negative control group with four vaccinated groups). These probabilities were then adjusted using a False Discovery Rate (FDR) approach (1) to take into account the multiple comparisons of treatments.

All statistical analyses were carried out using the R software version 2.13.1 (6).

RESULTS Assessment of vaccine efficacy

Culture of the DtxR-deficient strain in a simple laboratory growth medium (CCDM, described in Materials and Methods section of Example 1) resulted in an altered expression of immunogenic proteins to that of the wild-type parent strain (see Figure 7 of Example 1). The CCDM did not contain any complex proteins or other molecules. Consequently, following culture of the vaccine strains, the culture supernatant could be safely used as a component of the vaccine since the major component would be bacterial secreted proteins. Using inactivated whole-cells and culture supernatant proteins, an inactivated bacterin vaccine was prepared from each strain.

An ovine experimental model of C. pseudotuberculosis was used to assess vaccine efficacy. Approximately 6 month old Scottish Blackface cross sheep were obtained from a single flock with no history of CLA, and their CLA-free status was confirmed by clinical examination and by serology using the ELITEST CLA diagnostic ELISA. Subsequently, 5 groups of 6 animals (determined to provide sufficient power to permit statistical interpretation of results) were randomly picked, and housed within secure pens (1 group per pen). Animals were housed for 2 weeks to acclimatise to their new accommodation. Subsequently, each group was assigned a treatment, as described in Table 3. A placebo vaccine control group was included in the experiment, where each animal was administered 1 ml of sterile physiological saline.

Table 3. Treatments assigned to each group of animals.

Group Vaccine

1 Saline (placebo)

2 DtxR mutant

3 DtxR/PLD mutant

4 DtxR/Cp40 mutant

5 DtxR/PLD/Cp40 mutant

Animals were administered a primary vaccination (Day 0), and a booster vaccination was then administered 28 days later. Each 1 ml vaccine dose was administered sub-cutaneously in an equivalent position in the neck on the right hand side of each animal. Three weeks after the booster vaccination, each animal was administered a challenge inoculum containing 2 <10⁴ cells of C. pseudotuberculosis 3/99-5; this dose of this particular strain had previously been shown (4) to be suitable to recreate disease pathology identical to the naturally-encountered pathology of CLA. Immediately pnor to vaccination and challenge, blood samples were taken from each animal and serum was stored for downstream analysis.

Immediately following its preparation, the challenge inoculum was administered to animals, sub-cutaneously, approximately 2 inches behind the left ear, in a line caudal to the corner of the eye and the base of the ear. Administering the challenge organism in this manner ensured that it passed the skin barrier, from where (depending on the immunological response) it could translocate from the site of inoculation to the local drainage lymph node, and from there to other sites within infected animals. Consequently, measurement of the extent of spread of disease within lymph nodes and other tissue was subsequently used to determine the extent of protection conferred to animals vaccinated with the different vaccines, as compared to unvaccinated control animals.

The animals were housed in their respective groups for a further 12 weeks, during which time they were monitored frequently, and bloods taken at weekly intervals and banked for subsequent serological analyses. At the end of the experiment, animals were humanely euthanased and post-mortem tissue samples, including a number of superficial and internal lymph nodes and lung tissue, were collected for further analysis. The tissues recovered for analysis had been determined over the course of numerous CLA experimental challenges conducted at the Moredun Research Institute in the past as being the most frequently affected in this experimental model of infection, and are as shown in Table 4.

Table 4. Post-mortem tissue samples.

Abbreviation used in

Tissue

Table 5

Right hand side parotid lymph node R.p

Left hand side parotid lymph node L.p

Right hand side prescapular lymph node R.ps

Left hand side prescapular lymph node L.ps

Right hand side submandibular lymph node R.sub

Left hand side submandibular lymph node L.sub

Right hand side retropharyngeal lymph node R.ret Left hand side retropharyngeal lymph node L.ret

Mediastinal lymph node Med

Lung tissue Lung

Tissue samples were surface sterilised by flaming in industrial methylated spirit 74 O.P., then disrupted in PBS (10 ml per tissue) to release the contents of any lesions that were present within the tissue. Subsequently, samples of disrupted tissue were spread on blood agar plates to determine presence/absence of C. pseudotuberculosis. Bacteria which grew on plates after 48 hrs incubation at 37°C were assessed for phenotypic characteristics consistent with this organism. A random selection of isolates identified as C. pseudotuberculosis were further tested using the API Coryne diagnostic kit (bioMerieux), and in all cases the results corroborated the primary microbiological identification. The CLA lesions associated with each animal are presented in Table 5. In the control animals, administered saline (Groups 1), the disease lesions were numerous and disseminated through multiple sites in the body. In contrast, there were fewer lesions associated with animals immunised with the genetically-modified DtxR vaccine (Group 2), or the DtxR/PLD vaccine (Group 3), or the DtxR/Cp40 vaccine (Group 4), with the DtxR/PLD vaccine group manifesting the smallest number of affected tissues.

Table 5. Bacteriological analysis of post-mortem tissue samples from challenged animals^†.

Gp 1. Saline control Gp 2. DtxR

#1 #2 #3 #4 #5 #6 #i n #3 m #6

*

* * * *

* * * *

*

*

* *

*

* *

* * *

Gp 3. DtxR/PLD Gp 4. DtxR/Cp40 Gp 5. DtxR/PLD/Cp40

#1 #2 #3 #4 #5 #6 #1 #2 #3 m #5 #6 n #3 its #6 * * * * * *

*

* *

ndividual animals in each treatment group are numbered #1 -6

Positive detection of C. pseudotuberculosis within a tissue sample is denoted by *

The tissues sampled are denoted down left-hand column

From the data presented in Table 5, a contingency table representing the total number of animals for each treatment group and their associated patterns of infection (Pl=no infected sites, P2= one infected site P3=two or more infected sites) was constructed (Table 6).

Table 6: Contingency table of treatment group and pattern and pattern of infection.

Pattern

Group^† PI P2 P3

1 0 1 5

2 4 1 1

3 5 1 0

4 3 3 0

5 3 1 2

Treatment groups are as presented in Table 3.

Fisher's Exact test was applied, and results showed that the difference in proportions of animals with different patterns of infection among the five treatment groups was statistically significant (p = 0.019). The contingency table showed that the proportion of animals having two or more tissues affected (pattern 3) was the highest in the control group 1 (83.33%) while no animal in treatment groups 3 and 4 showed this pattern. Furthermore, group 3 had the maximum proportion of animals (83.33%) with no tissue affected (pattern 1) while this pattern was not observed in group 1. Analysis of variance (ANOVA) was conducted, and the effect of treatment group was statistically significant (p < 0.001) on the total score. The mean total score

_ r „ 1 o i n 1 n n n ui givuy i .. OJ y.ti ) ννω οιαι ιι αιι · ai^iiiii aiin uign i (i\L i\.-_<aujuai,cu ^ VJ.U I ) than the mean total score value of group 2 (0.50 ± 0.41), group 3 (0.17 ± 0.41 ), group 4 (0.50 ± 0.41) and group 5 (0.83 ± 0.41). It was also observed that the mean total scores of vaccinated groups were not significantly different from zero.

The mean total score values (and standard error of mean) for each treatment group is presented in Table 7 and Figure 8. A comparison of the mean total score values between the control (group 1) and other vaccinated groups (groups 2 to 5) is presented in Table 8.

Table 7. The mean total score along with standard error (SE) of mean and 95% lower (LCL) and upper (UCL) confidence levels of different treatment groups.

Table 8. Comparison of mean total scores of control (Gl) with other vaccinated groups along with adjusted FDR probabilities.

Taken as a whole, the results of statistical analyses show that for all vaccinated animals (groups 2-5) the outcome of infection with C. pseudotuberculosis was significantly different (i.e. less) than that of the control unvaccinated animals. Furthermore, while all vaccines were effective to some degree, the vaccine derived from the DtxR/PLD-deficient strain appeared to offer the greatest level of protection against experimental challenge. Serological analyses of experimental animals

The graph of Figure 9 plots the mean serum IgG antibody responses to C. psvuuuiuu r iua i /...1ιΛ~ i A _Λΐ Λ_Λ

wiiuic-tcua ^wuu assu icuGU siouuaiu iw ui m mvauj

treatment group. Despite an obvious response to vaccination in all animals administered any of the DtxR-deficient mutant-derived vaccines (as determined by increasing anti-C pseudotuberculosis IgG levels post-primary and secondary immunisations at weeks 0 and 3), there was no response in the control group until some time after bacterial challenge.

Anti-PLD IgG antibodies were detected in animals after challenge with wild- type C. pseudotuberculosis. An example is presented in Figure 10, whereby animals in the control group (group 1, administered saline) showed no response to treatment, and only seroconverted to PLD after challenge. The same phenomenon was observed for animals administered the DtxR/PLD-deficient vaccine (group 3), whereby no humoral response to PLD was observed following primary or secondary vaccination, yet a response was observed following challenge (Figure 1 1). It should be noted that Figure 1 1 presents serological data for individual animals, rather than the group mean, since only two of the six animals were observed to seroconvert to PLD during the duration of the experiment; this was due to the protective efficacy of the vaccine. Together, the data presented in Figures 10 and 1 1 shows that sheep seroconvert to PLD during natural infection, and that vaccination with the DtxR/PLD-deficient vaccine does not cause a positive blood-test result, and hence the vaccine has proven DIVA capacity.

DISCUSSION

The DtxR/PLD vaccine appears to offer the greatest level of protection. The DtxR/Cp40 vaccine appears to offer slightly lower protection, although statistically the difference may be minimal. It does appear, however, that the DtxR PLD/Cp40 vaccine is less protective. These results contrast with the generally held consensus that PLD is required for vaccine efficacy.

The experimental system used to assess the vaccines is probably the most extreme test of efficacy, since a large number of challenge bacteria were delivered directly into the animal, through the skin, by injection. In a natural setting, animals would be unlikely to be exposed to such a large inoculum and the exposure would be further confounded by the fact that the bacteria would need to find a way into the body through a break in the skin. Combined with the fact that CLA is a chronic disease that spreads relatively slowly, our vaccine may be even more effective in the field than it is under experimental settings.

We have trialled 3 DIVA vaccines against a vaccine derived from the DtxH strain with no DIVA capacity. We have shown that all of our vaccines offer a high level of protection, and that (in particular) the DtxR/PLD vaccine is particularly efficacious, despite the removal of a supposedly important protective antigen. We have also proven that we can differentiate between infected and vaccinated animals. Using the DtxR/PLD deficient vaccine as an exemplar, we have shown that vaccination did not induce an humoral immunological response against the diagnostic antigen (PLD), while following challenge with live, wild-type C. pseudotuberculosis, the production of specific anti-PLD antibodies was observed.

REFERENCES

1. Benjamin., Y. and Y. Hochberg. 1995. Controlling the False Discovery Rate - A practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B-Methodological 57:289-300.

2. Eggleton D.G., C. V. Doidge, H. D. Middleton, and D. W. Minty. 1991.

Immunisation against ovine caseous lymphadenitis: efficacy of momocomponent Corynebacterium pseudotuberculosis toxoid vaccine and combined clostridial- corynebacterial vaccines. Aust Vet J 68:320-1.

3. Eggleton D.G., J. A. Haynes, H. D. Middleton, and J. C. Cox. 2005.

Immunisation against ovine caseous lymphadentitis: correlation between Corynebacterium pseudotuberculosis toxoid content and protective efficacy in combined clostridial-corynebacterial vaccines. Aust Vet J 68:322-5.

4. Fontaine, M. C, G. Baird, K. M. Connor, K. Rudge, J. Sales and W.

Donachie. 2006. Vaccination confers significant protection of sheep against infection with a virulent United Kingdom strain of Corynebacterium pseudotuberculosis. Vaccine 24:5986-96.

. Hodgson A.L., K. Carter, M. Tachedjian, J. Krywult, L. A. Corner, M.

McColI, and A. Cameron. 19999. Efficacy of an ovine caseous lymphadenitis vaccine formulated using a genetically inactive form of the Corynebacterium pseudotuberculosis phospholipase D. Vaccine 17:802-8.

. R Development Core Team. 201 1. A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Release 2.13. http://www.R-project.org. Walker, C. A., W, Donachie, D. G. E. Smith, and M. C. Fontaine. 201 1. Targeted allele replacement mutagenesis of Corynebacterium pseudotuberculosis. Appl Environ Microbiol 77:3532-5.

Walker, J., H.J. Jackson, and D.G. Eggleton. 1994. Identification of a novel antigen from Corynebacterium pseudotuberculosis that protects sheep against caseous lymphadenitis. Infect Immun 62:2562-67.

Claims

Claims

1. A modified microorganism capable of expressing at least one factor under conditions in which a wild-type or un-modified strain of the same microorganism exhibits inhibited expression of the at least one factor.

2. The modified microorganism of claim 1 , wherein the modified microorganism comprises one or more genetic modification(s) which directly and/or indirectly affect the expression, activity and/or function of one or more microbial regulatory elements.

3. The modified microorganism of claim 2, wherein the one or more microbial regulatory elements comprise an environmentally sensitive or responsive regulatory control element.

4. The modified microorganism of any preceding claim, wherein the at least factor is a virulence factor.

5. The modified microorganism of any preceding claims, wherein the modified microorganism exhibits increased expression of one or more virulence factors.

6. The modified microorganism of any preceding claim, wherein the microorganism is a bacterium.

7. The modified microorganism of any preceding claim, wherein the modified microorganism does not express at least one detectable factor.

8. The modified microorganism of claim 7, wherein the at least one detectable factor is one which forms the basis of a diagnostic test.

9. The modified microorganism of any preceding claim, wherein the modified microorganism lacks exogenous nucleic acid.

10. The microorganism of any preceding claim, wherein the microorganism is a Gram positive bacteria or an Actinobacteria

11. The microorganism of any preceding claim, wherein the microorganism is a Corynebacterium .

12. The modified Corynebacterium of claim 11 , wherein the modified Corynebacterium is a modified Corynebacterium pseudotuberculosis.

13. The modified Corynebacterium of claims 11-12, wherein the modified Corynebacterium comprises a modified Diphtheria Toxin Repressor (dtxR) gene.

14. The modified Corynebacterium of claims 11-13, wherein the modified Corynebacterium is a <&x/?-deficient strain lacking a functional dtxR gene or product.

15. A modified Corynebacterium capable of expressing at least one factor under conditions in which the wild-type or un-modified Corynebacterium exhibits inhibited expression of the at least one factor, wherein the modified Corynebacterium does not express at least one detectable factor.

16. The modified Corynebacterium of claim 15, wherein the at least one detectable factor is one which forms the basis of a diagnostic test.

17. The modified Corynebacterium of claims 15 or 16, wherein the detectable factor is phospholipase D (PLD) antigen and/or corynebacterial protease 40 (Cp40).

18 A DtxR and PLD and/or Cp40 deficient C. pseudotuberculosis.

19. The C. pseudotuberculosis of claim 18, wherein DtxR is a homologue of the Diphtheria Toxin Repressor (DtxR) of Corynebacterium diphtheriae.

20. The modified microorganism or Corynebacterium of any one of claims 1 - 17 or C. pseudotuberculosis of claims 18 or 19, for use in raising an immune response in an animal and/or for use as a vaccine for treating, preventing and/or controlling disease.

21. A method of raising an immune response in an animal and/or for treating, preventing and/or controlling a disease, said method comprising administering an animal an immunogenic amount of the modified microorganism or Corynebacterium according to any one of claims 1 - 17 or a C. pseudotuberculosis of claims 18 or 19.

22. The modified microorganism or Corynebacterium for use of claim 20 or method of claim 21 , wherein the disease is caseous lymphadenitis (CLA).

23. The modified microorganism or Corynebacterium for use of claim 20 or method of claim 21, wherein the modified microorganism or Corynebacterium is provided as a killed or inactivated formulation.

24. A method of making a C. pseudtuberculosis vaccine for use in treating, preventing and/or controlling CLA, said method comprising culturing a cfex:/?-deficient C. pseudotuberculosis strain under conditions which comprise iron or iron concentrations which would otherwise inhibit wild-type DtxR activity or function, and preparing a vaccine composition therefrom.

25. The method of claim 24, wherein the step of preparing a vaccine composition comprises killing or inactivating the C. pseudotuberculosis.