EP2061500A2 - Composition pharmaceutique et écran solaire comprenant de la caspase-14 - Google Patents

Composition pharmaceutique et écran solaire comprenant de la caspase-14

Info

Publication number
EP2061500A2
EP2061500A2 EP07803078A EP07803078A EP2061500A2 EP 2061500 A2 EP2061500 A2 EP 2061500A2 EP 07803078 A EP07803078 A EP 07803078A EP 07803078 A EP07803078 A EP 07803078A EP 2061500 A2 EP2061500 A2 EP 2061500A2
Authority
EP
European Patent Office
Prior art keywords
caspase
skin
mice
gene
epidermis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP07803078A
Other languages
German (de)
English (en)
Inventor
Wim Declercq
Geertrui Denecker
Peter Vandenabeele
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universiteit Gent
Vlaams Instituut voor Biotechnologie VIB
Original Assignee
Universiteit Gent
Vlaams Instituut voor Biotechnologie VIB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universiteit Gent, Vlaams Instituut voor Biotechnologie VIB filed Critical Universiteit Gent
Priority to EP07803078A priority Critical patent/EP2061500A2/fr
Publication of EP2061500A2 publication Critical patent/EP2061500A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/4873—Cysteine endopeptidases (3.4.22), e.g. stem bromelain, papain, ficin, cathepsin H
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66—Enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/02—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings containing insect repellants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/04—Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations

Definitions

  • the present invention relates to the field of sunscreen compositions for preventing or treating the harmful effects of solar radiation in skin. More particularly the invention provides sunscreen compositions comprising caspase-14 as an ingredient.
  • compositions are known in the art for providing cosmetic and/or pharmacological benefits to human skin.
  • Benefits sought include, for example, prevention, treatment or amelioration of environmental or age-related damage or deterioration of the skin, improved appearance by modifying surface characteristics, improved feel by moisturizing, and prevention or treatment of specific skin disorders.
  • UV radiation can have adverse health consequences, sometimes not appearing until several years following the exposure.
  • Sunburn is a burn to the skin produced by overexposure to ultraviolet (UV) radiation, commonly from the sun's rays.
  • a similar burn can be produced by overexposure to other sources of UV such as from tanning lamps, or occupationally, such as from welding arcs. Exposure of the skin to lesser amounts of UV will often produce a suntan.
  • Sunburn can be life-threatening and is a leading cause of cancer.
  • the risk of sunburn increases with proximity to the earth's equator. It can also be increased by pharmaceutical products that sensitized some users to UV radiation. Certain antibiotics, contraceptives, and tranquillizers have this effect. People with red hair and/or freckles generally have a greater risk of sunburn than others because of their lighter skin tone.
  • Suntans which naturally develop in some individuals as a protective mechanism against the sun, are viewed by many in the Western world as desirable. This has led to increases in sunburn incidences and in solarium popularity as individuals attempt to tan.
  • sunscreens A wide variety of commercial preparations are available that block UV light, known as sunscreens.
  • Typical sunscreen product formulations are lotions, creams, ointments, or gels containing chemical and/or physical barriers to ultraviolet transmission. These vary considerably in their abilities to protect the skin against the physical and biochemical effects of ultraviolet radiation. Earlier sunscreen formulations were designed to protect against sunburn from a limited solar exposure period, while transmitting sufficient radiation to permit skin tanning.
  • FIG. 1 Targeting of embryonic stem cells.
  • a mouse 129/SvJ genomic DNA BAC library (Genome Systems) was PCR-screened for clones containing the mouse caspase-14 gene. The correct clone was identified using primers targeting exon 3 (forward primer: TGGTACTCATGGCACATGGT, reverse primer: CAAGCCTGGATGATGTACAC).
  • Several caspase-14 genomic DNA fragments were subcloned and sequenced.
  • For construction of the targeting vector a large homology domain of 3863 bp upstream of exon 3 was generated by PCR (forward primer: CGGGGJACCTGCACTCACATACACACAATGT, reverse primer: TGCTTACTTGCAGAGGTCTCAG, the Kpnl restriction site is underlined), digested with
  • FIG. 3 Caspase-14 deficient mice are more prone to the induction of parakeratotic plaques upon topical imiquimod (AldaraTM) treatment. Numbers of large parakeratotic plaques were scored microscopically by two independent persons. Numbers represented indicate numbers of large parakeratotic plaques per cm of skin slice.
  • FIG. 5 Caspase-14 deficient mice are more prone to the development of parakeratosis upon repeated skin barrier disruption by means of tape stripping. Numbers of large parakeratotic plaques were scored microscopically by two independent persons. Numbers represented indicate numbers of large parakeratotic plaques per cm of skin slice. 4 mice in each group.
  • Caspase-14 belongs to a conserved family of aspartate-specific proteinases. It is a short prodomain caspase which expression is almost exclusively restricted to the suprabasal layers
  • the nucleotide sequence of human caspase-14 is depicted in SEQ ID NO: 1
  • the amino acid sequence of human caspase-14 is depicted in SEQ ID NO: 2.
  • Procaspases consist of a prodomain, a large subunit (p20) and a small subunit (p10) and activation of caspases is induced by dimerisation, (auto-)proteolytic cleavage at Asp residues and/or conformational changes.
  • caspase-14 proteolytic maturation of caspase-14 in its p20 and p10 subunit was only consistently observed in cornifying epithelia such as the epidermis and the rodent forestomach (Lippens et al., 2000).
  • the activation of caspase-14 in the epidermis remains enigmatic as caspase-14 is not processed at an aspartate residu like other caspases, but at Ne 152 in human and presumably at Leu 167 in murine caspase-14, respectively.
  • caspase-14 deficient mice we generated caspase-14 deficient mice.
  • Typical sunscreen compositions include organic or inorganic compounds which reduce the ultraviolet radiation that reaches the skin by scattering or absorbing ultraviolet rays.
  • Commercial formulations are usually in the form of a lotion to be spread over the exposed skin. These lotions usually contain more than one active agent, and are designed to protect skin against various wavelengths of light. In addition, commercial formulations frequently contain further components which provide other desirable properties, such as fragrance and/or moisturizers, such as aloe vera.
  • UV radiation with a wavelength of approximately 290-400 nanometres (nm) has long been known to have harmful effects on human skin.
  • UV-B radiation is produced between 290-320 nm and UV-A radiation between 320-400 nm.
  • UV-C radiation which is generally defined as radiation with a wavelength of less than approximately 290 nm, is absorbed by the atmosphere and is therefore not considered to be of general concern.
  • UV radiation damage to human skin may result in damage to the dermal infrastructure that, in its most extreme form, may result in malignancies. UV radiation falling within the range of 290-320 nm may cause erythema and oedema associated with sunburn.
  • the present invention shows that when a composition comprising caspase-14 is applied to skin - that upon UV-B-irradiation - less cyclobutane pyrimidine dimers are formed which leads to a reduced level of UV-B-induced apoptosis.
  • the present invention is directed to a composition for a sunscreen comprising caspase-14 designed for topical application to skin, in particular human skin. More particularly, the present invention is directed to the use of a sunscreen composition comprising caspase-14 to protect skin against harmful UV radiation, particularly UV-A or UV-B or UV-A and UV-B radiation.
  • said caspase-14 is procaspase-14.
  • said caspase-14 is reverse caspase-14.
  • said caspase-14 is mixture of recombinantly expressed p20 and p10 catalytic subunits of caspase-14.
  • the terms procaspase-14 and reverse caspase-14 are further explained in the examples.
  • This pro-caspase-14 can be applied to human skin, speculating on the fact that the endogenous caspase-14-processing factor present in the skin will convert the procaspase-14 to its enzymatically active form.
  • a second strategy is the generation of reverse caspase-14 in which the p10 subunit is placed amino-terminal to the p20 subunit in a colinear polypeptide chain. It is believed that the structure of reverse caspases mimic structure of proteolytically activated caspases and this strategy has been successfully applied for caspase-3, -6 en -7 (Srinivasula SM et al (1998) MoI Cell 1 , 949-957). This reverse caspase-14 does no longer require proteolytic processing and is thus as such enzymatically active.
  • caspase-14 is a recombinant protein.
  • the recombinant protein may be manufactured using recombinant expression systems comprising bacterial cells, yeast cells, animal cells, insect cells, plant cells or transgenic animals or plants.
  • the recombinant protein may be purified by any conventional protein purification procedure close to homogeneity and/or be mixed with additives.
  • combinations of two or more sunscreen ingredients are used in a formulation to achieve higher levels of ultraviolet absorption or to provide useful absorption over a wider range of ultraviolet wavelengths than can be attained with a single active component.
  • a sunscreen composition preferentially includes both UV-A and UV-B filters to prevent most of the sunlight within the full range of about 280 nm to about 400 nm from damaging human skin.
  • This sunscreen composition preferably also comprises a suitable carrier for topical application to human skin.
  • a variety of UV absorbers is known in the art and has varying effectiveness at absorbing different parts of the UV spectrum.
  • a preferred embodiment of the present invention would include a UV absorber component that has activity in both the UVA and UVB ranges.
  • UV absorbers encompassed by this invention include, but are not limited to, the use of one or more of the following: benzophenone derivatives (such as benzophenone-1 , benzophenone-2 or benzophenone-3 [also known as oxybenzone], benzophenone-4, benzophenone-6, benzophenone-8, benzophenone-12, alkyl and aryl cinnamate derivatives (such as DEA methoxycinnamate, octyl methoxycinnamate), aminobenzoate derivatives (such as p-aminobenzoic acid, ethyl dihydroxypropyl p-amino benzoic acid glyceryl p-aminobenzoic acid, octyl dimethyl p-aminobenzoic acid
  • the amount of UV absorber employed will depend on its effectiveness, alone or in combination with other UV absorbers, but in any event will be sufficient to block a measurable quantity of UV radiation, preferably that UV radiation generated naturally, such as by the sun, or generated by man-made UV radiation generating sources, such as electric lamps and beams.
  • the sunscreen compositions comprising caspase-14 of the invention can, in some embodiments of the present invention, further be combined with known moisturizers, emollients, solvents, lubricants, emulsifiers and/or other common cosmetic formulation ingredients which may enhance the solubility of the compound, produce emulsification, provide thickening, and/or provide other skin enhancement properties known in the art.
  • compositions of the present invention can be produced as a lotion, as a gel, in solid stick form, as an emulsion, as an aerosol, and in other forms.
  • emulsions emulsifiers
  • moisturizers emollients
  • humectants dry feel modifiers
  • waterproofing agents e.g., water
  • insect repellents emulsifiers
  • anti-microbial preservatives e.g., anti-microbial preservatives, antioxidant chelating agents
  • fragrances and pH modifiers emulsions/Emulsifiers:
  • the compositions and sunscreen compositions comprising caspase-14 is in the form of an emulsion.
  • this emulsion comprises a hydrophobic component which imparts film forming and waterproofing characteristics to the emulsion.
  • hydrophobic components are copolymers derived of octadecene-1 and maleic anhydride, polyanhydride resin and a copolymer of vinyl pyrrolidone and eicosene monomers.
  • a stable emulsion is a mixture of two immiscible liquids, i.e. liquids that are not mutually soluble, but which can form a fluid in which very small droplets of one component are stably dispersed throughout the other liquid, giving the mixture the appearance of a homogeneous fluid.
  • Emulsions can include particulate materials and materials which are solid or solid-like at room temperature, but which will liquefy at higher temperatures used during formation of the emulsion.
  • the presence of an emulsifier enhances the ability of one of the immiscible liquids to remain in a continuous form, while allowing the other immiscible liquid to remain in a dispersed droplet form.
  • one function of an emulsifier, a stabilizing compound is to assist in the production of a stable emulsion.
  • a secondary function of emulsifiers is to provide a thickening or "bodying" to an emulsion.
  • emulsifiers are molecules with non-polar and polar parts that are able to reside at the interface of the two immiscible liquids.
  • the term "emulsion” shall be used herein to identify oil-in-water (o/w) or water-in-oil (w/o) type dispersion formulations intended for application to the skin, particularly lotions and creams providing cosmetic or therapeutic benefits. Techniques for forming o/w and w/o emulsions are very well known in the art. The present invention is not dependent upon any particular formulation technique, it being recognized that the choice of specific formulation components may well make necessary some specific formulation procedure.
  • Suitable emulsifiers for one aspect of the invention are those known in the art for producing oil-in-water and/or water-in-oil type emulsions.
  • An aqueous external phase is preferred by many people for skin contact, since it is not as likely to produce an oily or greasy sensation when it is being applied, as is an emulsion having an oil external phase.
  • Water is employed in amounts effective to form the emulsion. It is generally preferred to use water which has been purified by processes such as deionization or reverse osmosis, to improve the batch-to-batch formulation inconsistencies which can be caused by dissolved solids in the water supply.
  • the amount of water in the emulsion or composition can range from about 15 to 95 weight percent, preferably from about 45 to 75 percent.
  • compositions or sunscreen compositions of the present invention include moisturizers, such as guanidine, glycolic acid, glycolate salts such as ammonium and quaternary alkyl ammonium, lactic acid and lactate salts, aloe vera in any of its variety of forms, polyhydroxy alcohols such as sorbitol, glycerol, hexanetriol, propylene glycol, butylene glycol, hexylene glycol, polyethylene glycols, sugars and starches, sugar and starch derivatives, hyaluronic acid, lactamide monoethanolamine, acetamide monoethanolamine and mixtures thereof.
  • moisturizers such as guanidine, glycolic acid, glycolate salts such as ammonium and quaternary alkyl ammonium, lactic acid and lactate salts, aloe vera in any of its variety of forms, polyhydroxy alcohols such as sorbitol, glycerol, hexanetriol, propylene glycol, butylene glyco
  • compositions or sunscreen compositions of the present invention may contain a wide range of additional, optional components.
  • CTFA Cosmetic Ingredient Handbook, Seventh Edition, 1997 and the Eighth Edition, 2000 describes a wide variety of cosmetic and pharmaceutical ingredients commonly used in skin care compositions, which are suitable for use in the compositions of the present invention.
  • Examples of these functional classes disclosed in this reference include: absorbents, abrasives, anticaking agents, antifoaming agents, antioxidants, binders, biological additives, buffering agents, bulking agents, chelating agents, chemical additives, colorants, cosmetic astringents, cosmetic biocides, denaturants, drug astringents, external analgesics, film formers, fragrance components, humectants, opacifying agents, pH adjusters, plasticizers, preservatives, propellants, reducing agents, skin bleaching agents, skin-conditioning agents (emollient, humectants, miscellaneous, and occlusive), skin protectants, solvents, foam boosters, hydrotropes, solubilizing agents, suspending agents (nonsurfactant), sunscreen agents, ultraviolet light absorbers, waterproofing agents, and viscosity increasing agents (aqueous and nonaqueous).
  • Emollients An emollient is an oleaginous or oily substance that helps to smooth and soften the skin, and may also reduce its roughness, cracking or irritation.
  • suitable emollients include mineral oil having a viscosity in the range of 50 to 500 centipoise (cps), lanolin oil, coconut oil, cocoa butter, olive oil, almond oil, macadamia nut oil, aloe extracts such as aloe vera lipoquinone, synthetic jojoba oils, natural sonora jojoba oils, safflower oil, corn oil, liquid lanolin, cottonseed oil and peanut oil.
  • cps centipoise
  • Humectants A humectant is a moistening agent that promotes retention of water due to its hygroscopic properties. Suitable humectants include glycerin, polymeric glycols such as poyethylene glycol and polypropylene glycol, mannitol and sorbitol. One or more humectants can optionally be included in the in the sunscreen in amounts from about 1 to 10 weight percent.
  • Dry-feel Modifier A dry-feel modifier is an agent which when added to an emulsion, imparts a "dry feel" to the skin when the emulsion dries.
  • Dry feel modifiers can be used in addition to the epichlorohydrin cross-linked glyceryl starch used in the formulation of the present invention. Dry feel modifiers can include talc, kaolin, chalk, zinc oxide, silicone fluids, inorganic salts such as barium sulfate, surface treated silica, precipitated silica, fumed silica such as an Aerosil available from Degussa Inc. of New York, N.Y. U.S.A. Waterproofing Agents: A waterproofing or water resistance agent is a hydrophobic material that imparts film forming and waterproofing characteristics to an emulsion.
  • a suitable waterproofing agent is a copolymer of vinyl pyrollidone and eicosene and dodecane monomers such as Ganex V 220 and Ganex V 216 Polymers, respectively, trade names of ISP Inc. of Wayne, NJ. U.S.A.
  • Still other suitable waterproofing agents include polyurethane polymer, such as Performa V 825 available from New Phase Technologies and polyanhydride resin No. 18 available under the trade name PA-18 from Chevron.
  • the waterproofing agent is used in amounts effective to allow the sunscreen to remain effective on the skin after exposure to circulating water for at least 40 minutes for water resistance and at least 80 minutes for waterproofing using the procedures described by the U.S. Food and Drug Administration in "Sunscreen Drug Products for OTC Human Use," Federal Register, Vol. 43, Aug. 25, 1978, Part 2, pp. 38206 38269.
  • Insect Repellants are often used in sunscreening emulsions, since the emulsions are normally used primarily by persons engaged in outdoor activities.
  • the most widely used active agent for personal care products is N,N-Diethyl-m-toluamide, frequently called "DEET" and available in the form of a concentrate containing at least about 95 percent DEET.
  • Other synthetic chemical repellents include dimethyl phthalate, ethyl hexanediol, indalone, di-n-propylisocinchoronate, bicycloheptene, dicarboximide and tetrahydrofuraldehyde.
  • Certain plant-derived materials also have insect repellent activity, including citronella oil and other sources of citronella (including lemon grass oil), limonene, rosemary oil and eucalyptus oil. Choice of an insect repellent for incorporation into the sunscreen emulsion will frequently be influenced by the odor of the repellent.
  • Antimicrobial Preservative is a substance or preparation which destroys, or prevents or inhibits the proliferation of, microorganisms in the sunscreen composition, and which may also offer protection from oxidation. Preservatives are frequently used to make self-sterilizing, aqueous based products such as emulsions.
  • Typical preservatives include the lower alkyl esters of parahydroxybenzoates (parabens), especially methylparaben, propylparaben, isobutylparaben and mixtures thereof, benzyl alcohol, phenyl ethyl alcohol and benzoic acid.
  • parabens parahydroxybenzoates
  • An antioxidant is a natural or synthetic substance added to the sunscreen to protect from or delay its deterioration due to the action of oxygen in the air (oxidation).
  • antioxidants prevent oxidative deterioration which may lead to the generation of rancidity and nonenyzymatic browning reaction products.
  • suitable antioxidants include propyl, octyl and dodecyl esters of gallic acid, butylated hydroxyanisole (BHA, usually purchased as a mixture of ortho and meta isomers), butylated hydroxytoluene (BHT), nordihydroguaiaretic acid, Vitamin A, Vitamin E and Vitamin C.
  • Chelating agents are substances used to chelate or bind metallic ions, such as with a heterocylic ring structure so that the ion is held by chemical bonds from each of the participating rings.
  • Suitable chelating agents include ethylene diaminetetraacetic acid (EDTA), EDTA disodium, calcium disodium edetate, EDTA trisodium, EDTA tetrasodium and EDTA dipotassium.
  • Fragrances are aromatic substances which can impart an aesthetically pleasing aroma to the sunscreen composition. Typical fragrances include aromatic materials extracted from botanical sources (i.e., rose petals, gardenia blossoms, jasmine flowers, etc.) which can be used alone or in any combination to create essential oils. Alternatively, alcoholic extracts may be prepared for compounding fragrances. However, due to the relatively high costs of obtaining fragrances from natural substances, the modem trend is to use synthetically prepared fragrances, particularly in high-volume products.
  • pH Modifier A pH modifier is a compound that will adjust the pH of a formulation to a lower, e.g., more acidic pH value, or to a higher, e.g., more basic pH value. The selection of a suitable pH modifier is well within the ordinary skill of one in the art.
  • a composition comprising caspase-14 can be used for the manufacture of a medicament to treat sunburn.
  • said composition is a sunscreen composition.
  • Topical application of a sunscreen comprising caspase-14 to treat sunburn comprises the topical administration of the compositions and formulation of the invention.
  • Topical application “Topical application”, “applied topically”, “topical administration” and “administered topically”, are used interchangeably to mean the process of applying or spreading one or more compositions or sunscreen compositions according to the instant invention onto the surface of the skin of a subject in need thereof.
  • Topical formulations may be comprised of oil-in-water and/or water-in-oil type emulsions but are not limited in this respect.
  • Topical formulations contemplated by the present invention may include delayed release compositions capable of producing a slow release of the sunscreen active agent.
  • the topical formulations of caspase-14 i.e.
  • the procaspase-14 protein or the reverse caspase-14 protein or the p10 and p20 catalytic subunits of caspase-14) include those pharmaceutical forms in which the composition is applied externally by direct contact with the skin surface to be treated.
  • a conventional pharmaceutical form for topical application includes a soak, an ointment, a cream, a lotion, a paste, a gel, a stick, a spray, an aerosol, a bath oil, a solution and the like.
  • Topical therapy is delivered by various vehicles, the choice of vehicle can be important and generally is related to whether it is applied to prevent sunburn or whether it is applied to treat sunburn (i.e. when it is applied as an aftersun composition).
  • a sunburn can be treated with aqueous drying preparations, whereas in order to prevent sunburn hydrating preparations can be used.
  • Soaks are the easiest method of drying acute moist eruptions.
  • Lotions prowder in water suspension
  • solutions medications dissolved in a solvent
  • Ointments or water-in-oil emulsions are the most effective hydrating agents, appropriate for dry scaly eruptions, but are greasy and depending upon the site of the lesion sometimes undesirable.
  • they can be applied in combination with a bandage, particularly when it is desirable to increase penetration of the caspase-14 composition into a sunburn lesion.
  • Creams or oil-in-water emulsions and gels are absorbable and are the most cosmetically acceptable to the patient. (Guzzo et al, in Goodman & Gilman's Pharmacological Basis of Therapeutics, 9 th Ed., p. 1593-15950 (1996)).
  • Cream formulations generally include components such as petroleum, lanolin, polyethylene glycols, mineral oil, glycerin, isopropyl palmitate, glyceryl stearate, cetearyl alcohol, tocopheryl acetate, isopropyl myristate, lanolin alcohol, simethicone, carbomen, methylchlorisothiazolinone, methylisothiazolinone, cyclomethicone and hydroxypropyl methylcellulose, as well as mixtures thereof.
  • components such as petroleum, lanolin, polyethylene glycols, mineral oil, glycerin, isopropyl palmitate, glyceryl stearate, cetearyl alcohol, tocopheryl acetate, isopropyl myristate, lanolin alcohol, simethicone, carbomen, methylchlorisothiazolinone, methylisothiazolinone, cyclomethicone and hydroxypropyl methylcellulose, as well
  • compositions for topical application include shampoos, soaps, shake lotions, and the like, particularly those formulated to leave a residue on the underlying skin, such as the scalp (Arndt et al, in Dermatology In General Medicine 2:2838 (1993)).
  • concentration of the caspase-14 protein (procaspase-14, the reverse caspase-14 or a mixture of p20 and p10 caspase-14 subunits) in the topical formulation is in an amount of about 0.05 to 50% by weight of the composition, preferably about 0.1 to 5%, more preferably about 0.5-2%.
  • the concentration used can be in the upper portion of the range initially, as treatment continues, the concentration can be lowered or the application of the formulation may be less frequent.
  • Topical applications are often applied twice daily. However, once-daily application of a larger dose or more frequent applications of a smaller dose may be effective.
  • the stratum corneum may act as a reservoir and allow gradual penetration of a drug into the viable skin layers over a prolonged period of time.
  • a sufficient amount of caspase-14 must penetrate a patient's skin in order to obtain a desired pharmacological effect. It is generally understood that the absorption of drug into the skin is a function of the nature of the drug, the behaviour of the vehicle, and the skin.
  • a topical formulation which exerts a high in vitro skin penetration is effective in vivo.
  • a skin penetration enhancer which is dermatologically acceptable and compatible with caspase-14 can be incorporated into the formulation to increase the penetration of caspase-14 from the skin surface into epidemal keratinocytes. Skin penetration enhancers are well known in the art.
  • dimethyl sulfoxide U.S. Pat. No. 3,711 ,602
  • oleic acid 1 ,2-butanediol surfactant
  • looper J. Pharm. ScL, 73:1 153-1 156 (1984)
  • a combination of ethanol and oleic acid or oleyl alcohol EP 267,617), 2-ethyl-1 ,3-hexanediol (WO 87/03490); decyl methyl sulphoxide and Azone.RTM.
  • Hadgraft Eur. J. Drug. Metab.
  • caspase- 14 composition levels of penetration of an caspase- 14 composition can be determined by techniques known to those of skill in the art. For example, radiolabeling of caspase-14, followed by measurement of the amount of radiolabeled caspase-14 absorbed by the skin enables one of skill in the art to determine levels of the composition absorbed using any of several methods of determining skin penetration of the test compound. For some applications, it is preferable to administer a long acting form of caspase- 14 composition using formulations known in the arts, such as polymers.
  • Caspase-14 can be incorporated into a dermal patch (Thacharodi et al, in Biomaterials 16:145-148 (1995) or a bandage according to methods known in the arts, to increase the efficiency of delivery of the drug to the sunburned areas to be treated.
  • the invention provides a pharmaceutical composition comprising caspase-14.
  • Said caspase-14 can be pro-caspase-14, reverse caspase-14 or a mixture of the catalytic p20 and p10 subunits of caspase-14.
  • a pharmaceutical composition comprising caspase-14 is used for the treatment of disorders involving parakeratosis.
  • the term 'parakeratosis' refers to the retention (or a persistence) of the nuclei in the stratum corneum of the epidermis of the skin. Examples of diseases (or disorders) in which parakeratosis is involved are psoriasis, basal cell carcinoma and basal cell carcinoma.
  • the term 'medicament to treat' relates to a composition comprising caspase-14 and a pharmaceutically acceptable carrier or excipient (both terms can be used interchangeably) to prevent diseases involving parakeratosis.
  • Suitable carriers or excipients known to the skilled man are saline, Ringer's solution, dextrose solution, Hank's solution, fixed oils, ethyl oleate, 5% dextrose in saline, substances that enhance isotonicity and chemical stability, buffers and preservatives.
  • Other suitable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids and amino acid copolymers.
  • the 'medicament' may be administered by any suitable method within the knowledge of the skilled man.
  • caspase-14 is delivered via transdermal delivery into the skin using transdermal delivery technology described herein before and transdermal delivery technology known to the person skilled in the art.
  • the dosage and mode of administration will depend on the individual.
  • the medicament is administered so that the caspase-14 of the present invention is given at a dose between 1 ⁇ g/kg and 100 mg/kg, preferably between 10 ⁇ g/kg and 10 mg/kg, more preferably between 0.1 and 5 mg/kg.
  • the invention provides a transgenic, non-human animal characterised by having an endogenous nucleic acid sequence encoding a non-functional caspase-14 expression.
  • the invention provides a transgenic, non-human animal characterised by having an endogenous nucleic acid sequence encoding a non-functional caspase-14 expression wherein said non-functional caspase-14 expression is in a specific tissue or in a specific organ. More specifically, the present invention provides a transgenic non-human animal whose genome comprises a disruption in the caspase-14 gene, wherein the transgenic animal exhibits a decreased level of functional caspase-14 protein relative to wild-type.
  • the non- human animal may be any suitable animal (e.g., cat, cattle, dog, horse, goat, rodent, and sheep), but is preferably a rodent. More preferably, the non-human animal is a rat or a mouse.
  • caspase-14 gene refers herein to a nucleic acid sequence encoding caspase-14 protein, and any allelic variants thereof. Due to the degeneracy of the genetic code, the caspase-14 gene of the present invention includes a multitude of nucleic acid substitutions which will also encode a caspase-14 protein. An "endogenous" caspase-14 gene is one that originates or arises naturally, from within an organism. Additionally, as used herein, "caspase-14 protein” includes a "caspase-14 protein analogue”.
  • a “caspase-14 analogue” is a functional variant of the "caspase-14 protein", having a caspase-14-protein biological activity, that has 60% or greater (preferably, 70% or greater) amino-acid-sequence homology with a caspase-14 protein, as well as a fragment of the caspase-14 protein having a caspase-14 protein biological activity.
  • the term “transgene” refers to a nucleic acid (e.g., DNA or a gene) that has been introduced into the genome of an animal by experimental manipulation, wherein the introduced gene is not endogenous to the animal, or is a modified or mutated form of a gene that is endogenous to the animal.
  • the modified or mutated form of an endogenous gene may be produced through human intervention (e.g., by introduction of a point mutation, introduction of a frameshift mutation, deletion of a portion or fragment of the endogenous gene, insertion of a selectable marker gene, insertion of a termination codon, insertion of recombination sites, etc.).
  • a transgenic non-human animal may be produced by several methods involving human intervention, including, without limitation, introduction of a transgene into an embryonic stem cell, newly fertilized egg, or early embryo of a non-human animal; integration of a transgene into a chromosome of the somatic and/or germ cells of a non-human animal; and any of the methods described herein.
  • the transgenic animal of the present invention has a genome in which the caspase-14 gene has been selectively inactivated, resulting in a disruption in its endogenous caspase-14 gene in at least one tissue or organ.
  • a "disruption” refers to a mutation (i.e., a permanent, transmissible change in genetic material) in the caspase-14 gene that prevents normal expression of functional caspase-14 protein (e.g., it results in expression of a mutant caspase-14 protein; it prevents expression of a normal amount of caspase-14 protein; or it prevents expression of caspase-14 protein).
  • a disruption examples include, without limitation, a point mutation, introduction of a frameshift mutation, deletion of a portion or fragment of the endogenous gene, insertion of a selectable marker gene, and insertion of a termination codon.
  • mutant is used herein to refer to a gene (or its gene product), which exhibits at least one modification in its sequence (or its functional properties) as compared with the wild-type gene (or its gene product).
  • wild-type refers to the characteristic genotype (or phenotype) for a particular gene (or its gene product), as found most frequently in its natural source (e.g., in a natural population).
  • a wild-type animal expresses functional caspase-14.
  • Selective inactivation of a gene in a transgenic non-human animal may be achieved by a variety of methods, and may result in either a heterozygous disruption (wherein one caspase- 14 gene allele is disrupted, such that the resulting transgenic animal is heterozygous for the mutation) or a homozygous disruption (wherein both caspase-14 gene alleles are disrupted, such that the resulting transgenic animal is homozygous for the mutation).
  • the endogenous caspase-14 gene of the transgenic animal is disrupted through homologous recombination with a nucleic acid sequence that encodes a region common to the caspase-14 gene product.
  • the disruption through homologous recombination may generate a knockout mutation in the caspase-14 gene, particularly a knockout mutation wherein at least one deletion has been introduced into at least one exon of the caspase-14 gene.
  • the knockout mutation is generated in a coding exon of the caspase-14 gene.
  • a disruption in the caspase-14 gene may result from insertion of a heterologous selectable marker gene into the endogenous caspase-14 gene.
  • the term “selectable marker gene” refers to a gene encoding an enzyme that confers upon the cell or organism in which it is expressed a resistance to a drug or antibiotic, such that expression or activity of the marker can be selected for (e.g., a positive marker, such as the neo gene) or against (e.g., a negative marker, such as the dt gene).
  • a positive marker such as the neo gene
  • a negative marker such as the dt gene
  • heterologous selectable marker gene refers to a selectable marker gene that, through experimental manipulation, has been inserted into the genome of an animal in which it would not normally be found.
  • the term "caspase-14 targeting vector” refers to an oligonucleotide sequence that comprises a portion, or all, of the caspase-14 gene, and is sufficient to permit homologous recombination of the targeting vector into at least one allele of the endogenous caspase-14 gene within the recipient cell.
  • the targeting vector further comprises a positive or negative heterologous selectable marker gene (e.g., the positive selection gene, neo).
  • the targeting vector may be a replacement vector (i.e., the selectable marker gene replaces an endogenous target gene). Such a disruption is referred to herein as a "null" or "knockout" mutation.
  • the caspase- 14 targeting vector comprises recombination sites (e.g. loxP sites or FRT sites) which do not interrupt the coding region of the caspase-14 gene.
  • the caspase-14 targeting vector of the present invention may be introduced into the recipient cell by any in vivo or ex vivo means suitable for gene transfer, including, without limitation, electroporation, DEAE Dextran transfection, calcium phosphate transfection, lipofection, monocationic liposome fusion, polycationic liposome fusion, protoplast fusion, creation of an in vivo electrical field, DNA- coated microprojectile bombardment, injection with recombinant replication-defective viruses, homologous recombination, viral vectors, and naked DNA transfer, or any combination thereof.
  • Recombinant viral vectors suitable for gene transfer include, but are not limited to, vectors derived from the genomes of viruses such as retrovirus, HSV, adenovirus, adeno-associated virus, Semiliki Forest virus, cytomegalovirus, and vaccinia virus.
  • the treated recipient cell then may be introduced into a blastocyst of a non-human animal of the same species (e.g., by injection or microinjection into the blastocoel cavity), to produce a treated blastocyst.
  • the treated blastocyst may be introduced (e.g., by transplantation) into a pseudopregnant non-human animal of the same species, for expression and subsequent germline transmission to progeny.
  • the treated blastocyst may be allowed to develop to term, thereby permitting the pseudopregnant animal to deliver progeny comprising the homologously recombined vector, wherein the progeny may exhibit decreased expression of caspase-14 relative to corresponding wild-type animals of the same species. It then may be possible to identify a transgenic non-human animal whose genome comprises a disruption in its endogenous caspase-14 gene.
  • the identified transgenic animal then may be interbred with other founder transgenic animals, to produce heterozygous or homozygous non-human animals exhibiting decreased expression of functional caspase-14 protein relative to corresponding wild-type animals of the same species.
  • a type of recipient cell for transgene introduction is the embryonal stem cell (ES).
  • ES cells may be obtained from pre-implantation embryos cultured in vitro. Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection or by retrovirus- mediated transduction. The resultant transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The introduced ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • a “targeted gene” or “knock-out” is a DNA sequence introduced into the germline or a non-human animal by way of human intervention, including but not limited to, the methods described herein.
  • the targeted genes of the invention include DNA sequences which are designed to specifically alter cognate endogenous alleles.
  • recombinant DNA and cloning methods which are well known to those skilled in the art, may be utilized (see Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, NY).
  • appropriate caspase-14 coding sequences may be generated from genomic clones using restriction enzyme sites that are conveniently located at the relevant positions within the caspase-14 sequence.
  • site directed mutagenesis techniques involving, for example, either the use of vectors such as M13 or phagemids, which are capable of producing single stranded circular DNA molecules, in conjunction with synthetic oligonucleotides and specific strains of Escherichia coli (E. coli) (Kunkel, T. A. et al., 1987, Meth. Enzymol.
  • a non-human, transgenic animal comprising a targeting vector which further comprises recombination sites (e.g. Lox sites, FRT sites) can be crossed with a non-human, transgenic animal comprising a recombinase (e.g. Cre recombinase, FLP recombinase) under control of a particular promoter.
  • a recombinase e.g. Cre recombinase, FLP recombinase
  • Cre/Lox and FLP/FRT systems there may be mentioned the Cre/Lox and FLP/FRT systems.
  • the strategy normally used consists in inserting the loxP (or FRT) sites into the chromosomes of ES cells by homologous recombination, or by conventional transgenesis, and then in delivering Cre (or FLP) for the latter to catalyze the recombination reaction.
  • the recombination between the two loxP (or FRT) sites may be obtained in ES cells or in fertilized eggs by transient expression of Cre or using a Cre transgenic mouse.
  • Cre or FLP
  • a second strategy consists in controlling the expression of recombinases over time so as to allow temporal control of somatic recombination.
  • the expression of the recombinases is controlled by inducible promoters such as the interferon-inducible promoter, for example.
  • Initial screening of the transgenic animals may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place.
  • the level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include but are not limited to Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of for example skin may be evaluated immunocytochemically using antibodies specific for caspase-14.
  • the transgenic, non-human animal of the present invention can be used for the testing of compounds for parakeratosis disorders, and more specifically for the testing of compounds for psoriatic skin diseases (e.g. psoriasis).
  • Drug screening assays in general suitable for use with transgenic animals are known.
  • the transgenic animals may be used as a model system for human parakeratosis disorders and/or to generate cell lines (e.g. keratinocytes) that can be used as cell culture models for these disorders.
  • the transgenic animal model systems for parakeratosis disorders may be used as a test substrate to identify drugs, pharmaceuticals, therapies and interventions which may be effective in treating such disorders.
  • the response of the animals to the treatment may be monitored by assessing the reversal of one or more symptoms associated with parakeratosis disorders. Dosages of test agents may be determined by deriving dose-response curves.
  • corneocytes are specialized form of cell death that does not involve the
  • caspase-14 deficient mice To analyze the role of caspase-14 during terminal keratinocyte differentiation, we generated caspase-14 deficient mice by homologous recombination. We used a targeting vector to replace exons 3 and 4, containing the active catalytic site (QACRG).
  • caspase-1 epidermal extracts from caspase-14 deficient mice, in contrast to wild-type mice, did not reveal WEHD-amc cleavage activity. This indicates that in homeostatic conditions all detectable proteolytic activity on WEHD in the epidermis is due to caspase-14.
  • caspases 3 and 7 remained unprocessed during terminal keratinocyte differentiation, also indicated by the absence of DEVDase activity in the epidermis, confirming that the apoptotic proteolytic cascade is not activated during
  • caspase-14 homeostatic programmed cell death in the epidermis .
  • Extensive immunohistochemical analysis of different tissues confirmed that caspase-14 is expressed only in cornifying epithelia, such as the epidermis and Hassall's bodies.
  • caspase-14 was also expressed in the forestomach, which is cornified in rodents. Caspase-14 expression was
  • 1,3,4 corneum, where caspase-14 is proteolytically activated also showed no histological abnormalities.
  • the distribution and expression level of differentiation markers, both early (K5, K14) and late (K1 , K10, loricrin, involucrin and filaggrin) was not different in the two genotypes. This could be expected because caspase-14 gets activated only during cornification, and differences between wild-type and caspase-14 deficient epidermis are expected mainly in the cornified layers. Indeed, scanning microscopic analysis
  • caspase-14 is at least partially involved in the desquamation process. This agrees with the observation that some caspase-14 protein was
  • F-granules are stores of profilaggrin, a major epidermal histidine-rich protein.
  • profilaggrin (-500 kDa) consists of tandem repeats of filaggrin and is processed into mature filaggrin units that assist the formation of macrofibril
  • CE 11 localized with the F-granules , we isolated CE from newborn mice to examine their shape and morphology.
  • the CEs prepared from caspase-14 deficient skin did not differ in shape or size from wild-type when examined by phase contrast microscopy.
  • caspase-14 is proteolytically activated during embryonic development from day E16.5-17.5 on, which coincides with stratum corneum formation, profilaggrin processing, and the formation of
  • profilaggrin degradation generates the free amino acids that act as natural moisturising factors involved in the hydration of the stratum
  • UVB induces direct DNA damage by causing formation of cyclobutane pyrimidine dimers (CPDs). This DNA damage is
  • caspase-14 deficient skin had a large number of sunburn cells with pyknotic nuclei.
  • active caspase-3 positive cells were identified using an antibody recognizing the active cleaved form of caspase-3.
  • UVB-irradiated epidermis from caspase-14 deficient mice contains at least 2 to 3 times more active caspase-3 positive cells than wild-type epidermis.
  • TUNEL-positive cells were present in caspase-14 than in caspase-14 epidermis. These experiments were done in neonatal mice (5.5 days after birth) and confirmed in adult mice (Fig.
  • caspase-14 is involved in the biochemical processes that are required to protect the skin against UVB induced apoptosis.
  • the epidermis of caspase-14 deficient mice is more sensitive to apoptosis induced by UVB.
  • keratinocytes of caspase- 14 deficient mice may be more sensitive to UVB-induced apoptosis.
  • the UVB scavenging capacity of the stratum corneum may be diminished.
  • PULSinTM Polyplus Transfection, San Marcos, USA
  • carbopol containing gels or other liposome formulations have been shown to be able to deliver proteins to the epidermis (Felipe P et al (1999) MoI Med 5, 517-525 & Wolf P et al (2000) J Invest Dermatol 114, 149-156).
  • caspase-14 deficient mice are treated and the caspase-14 protein occurrence in the epidermis is determined by means of immunohistochemistry, western blotting and measuring its enzymatic activity. Then UVB irradiation is applied to these mice and the UVB-induced damage is analysed. DNA damage is analysed immediately after irradiation by immunohistochemistry using a CPD (cyclobutane pyrimidine dimer) -specific antibody. In addition, the occurrence of apoptotic sunburn cells is analysed using histological analysis, TUNEL-assay and immunohistochemistry with an anti- active caspase-3 antibody.
  • CPD cyclobutane pyrimidine dimer
  • wild type mice are treated with the composition comprising caspase-14 and the effect of the protection to sunburn is evaluated. Also sunburned wild type mice are treated with compositions comprising caspase-14 (and with mock compositions without caspase-14) to evaluate the aftersun effect on the skin.
  • Caspase-14 -/- mice are more prone towards the induction of parakeratosis upon application of barrier disrupting treatments or topical application of imiquimod.
  • the imiquimod model The compound imiquimod (1-(2-methylpropyl)-1 H-imidazo[4,5]quinoline-4-amine) is a proprietary molecule of 3M Pharmaceuticals (St. Paul, MN), and the structure of this molecule has been described previously (Tomai et al., 1995). Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment. Female mice (4 mice in each group) were used between 8-12 weeks of age. 5 % imiquimod cream formulation (AldaraTM) was applied once daily on the shaved back of the mice for 6 to 8 consecutive days. Each mouse received a total dose of 3,125 mg imiquimod per day.
  • AldaraTM imiquimod cream formulation
  • mice were killed by cervical dislocation and skin tissue was harvested for further processing. Paraffin embedded skin was sliced and scored for epidermal thickness (cfr hyperproliferation) and parakeratosis. There was no difference in the epidermal thickness between Aldara-treated caspase-14+/+ and caspase-14-/- mice. However there was a marked increase in the number of large parakeratotic plaques in caspase-14-/- mice as compared to wild-type mice (see fig. 3).
  • Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment.
  • Female mice were used between 8-12 weeks of age. The shaved back of the mice were treated 4 times with fresh acetone-soaked cotton tissues. This procedure induced mild disruption of the epidermal barrier (TEWL levels of approximately 15 g/cm 2 per h) and was applied twice daily (morning and evening) for 7-8 days.
  • Control mice were either left untreated or treated with 0,9 % NaCI solution soaked cotton tissues.
  • mice were killed by cervical dislocation and tissue was harvested for further processing in a similar way as described for the imiquimod model. The number of large parakeratotic plaques was determined.
  • Caspase-14 deficient mice were shaved at their backs two to three days before the start of the treatment.
  • Female mice were used between 8-12 weeks of age. The shaved back of the mice were tape stripped twice with Scotch tape (3M, St. Paul, MN). This procedure induced mild disruption of the barrier (TEWL levels of approximately 15 g/cm 2 per h) and was applied twice daily (morning and evening) for 7-8 days. Control mice were left untreated. At the end of the treatment mice were killed by cervical dislocation and tissue was harvested for further processing in a similar way as described for the imiquimod model.
  • TX-WES cell culture medium Thromb-X N.V., Leuven, Belgium.
  • Cells were kept on neomycin resistant, mitomycin C inactivated feeder cells at 39°C, and subjected to positive/negative selection with 150 ⁇ g/ml G418 (Invitrogen Corp.) and 2 ⁇ M gancyclovir (Sigma-Aldrich, St. Louis, MO, USA), respectively.
  • ES cells Correctly targeted ES cells were identified by Southern-blot screening of EcoRV-digested genomic DNA using a radioactively labelled 3' probe, injected into host Swiss Webster blastocysts, and reimplanted in pseudopregnant Swiss Webster females (Taconic, Germantown, NY, USA). Resulting chimeric animals were mated to Swiss Webster mice to generate heterozygous germline offspring, which were intercrossed to obtain caspase-14-/- mice. This work was approved by the local ethics committee.
  • Epidermal extracts from wild-type and knock-out mice were prepared in grinding buffer without NP40 and tested for caspase activity by incubating 50 ⁇ g of extract in caspase-14 assay buffer (10 mM Pipes pH 7.5, 10 % sucrose, 100 mM NaCI, 1.3 M sodium citrate, 0.1 mM EDTA, 10 mM DTT) and 50 ⁇ M WEHD-amc or DEVD-amc (Peptide Institute, Inc., Japan). Fluorescence was monitored for 50 min with a Cytofluor Multiwell Reader series 4000 at 37 0 C (Perseptive Biosystems, Cambridge, MA).
  • mice caspase-3 and -14 Primary antibodies used were directed against: mouse caspase-3 and -14 , mouse Keratin 1 (K1 ), K5, K10, filaggrin, loricrin and involucrin (all Covance), active caspase-3 (Bio-Connect) and cyclobutane pyrimidine dimers (CPD) (Kamiya Biomedical Company).
  • the UVB irradiation source was equipped with TL20W/12RS Philips UV lamps (peak emission at 310 nm). A plastic lid was used to block UVC emission.
  • the UVB dose was monitored with an IL1700 radiometer equipped with a SED005/TLS312/W detector (International Light). The backs of wild-type and caspase-14 deficient mice were irradiated at a dose rate of 0.7
  • TUNEL assay was performed on 5 ⁇ m paraffin sections from skin with the in situ cell death detection kit, TMR red (Roche), according to the manufacturers instructions. The stained sections were mounted with Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA).
  • Genomic DNA was isolated from epidermis and 0.5 ⁇ g was used for southwestern dot blot analysis using the anti-CPD antibody,
  • K-SFM K-SFM supplemented with keratinocyte growth supplement (Gibco, 10784-015), lnsuline - Hydrocortisone - hEGF (Clonetics), 1 ng/ml Cholera toxin (Sigma,), Gentamycine (50 ⁇ g/ml), 100 ⁇ g/ml Penicilin/Streptomycin and 10% LPS-free FCS) in a humified incubator at 34 ° C with 7,5 % CO2. Next day cells were refreshed with complete K-SFM without FCS.
  • K-SFM Keratinocyte growth supplemented with keratinocyte growth supplement (Gibco, 10784-015), lnsuline - Hydrocortisone - hEGF (Clonetics), 1 ng/ml Cholera toxin (Sigma,), Gentamycine (50 ⁇ g/ml), 100 ⁇ g/ml Penicilin/Streptomycin and 10% LPS-free
  • the column was washed with 20 mM Tris-HCI (pH 7.5), 10 % glycerol, 1 mM glutathion, 250 mM NaCI en 15 mM imidazol. Subsequently, caspase-14 was eluted from the Ni-NTA column with 20 mM Tris-HCI (pH 7.5), 10 % glycerol, 1 mM glutathion, 50 mM NaCI and 100 mM imidazol. Caspase-14 containing fractions were pooled, 0.1 % CHAPS was added and the preparation was incubated for 3 hours at 4 0 C.
  • This material was loaded on a Source Q column in 20 mM Tris-HCI (pH 8.0), 10 % glycerol, 1 mM glutathion, 50 mM NaCI and 0.1 % CHAPS. Proteins were eluted with a saltgradient from 50 mM to 500 mM NaCI. Using Coomassie staining the procaspase-14 fractions were identified.
  • Inclusion bodies were washed several times with washbuffer 1 (50 mM Tris HCL pH 8.0, 100 mM NaCI, 5 mM EDTA, 1 mM PMSF and 0.1 % Triton-X100) and finally once washed with washbuffer 2 (50 mM Tris HCL pH 8.0, 100 mM NaCI).
  • washbuffer 2 50 mM Tris HCL pH 8.0, 100 mM NaCI.
  • the inclusion bodies where denaturated in 5OmM Tris pH8.0; 10OmM NaCI; 6M guanidine HCI; 1OmM beta-mercapto-ethanol.
  • Equimolar amounts of the p20 and p10 human caspase-14 subunits were mixed in refolding buffer (10OmM Hepes pH7.5; 20% sucrose; 1 OmM DTT).
  • This material has enzymatic activity in the presence of kosmotropic salts (KZ) and has retained the native caspase-14 peptide-substrate preference for WEHD-amc.
  • KZ kosmotropic salts

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Birds (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Cosmetics (AREA)

Abstract

La présente invention a trait au domaine des compositions d'écran solaire destinées à prévenir ou à traiter les effets nocifs du rayonnement solaire sur la peau. L'invention concerne plus particulièrement des compositions d'écran solaire comprenant de la caspase-14 comme ingrédient.
EP07803078A 2006-09-01 2007-08-30 Composition pharmaceutique et écran solaire comprenant de la caspase-14 Withdrawn EP2061500A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP07803078A EP2061500A2 (fr) 2006-09-01 2007-08-30 Composition pharmaceutique et écran solaire comprenant de la caspase-14

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP06119971 2006-09-01
EP06126387 2006-12-18
PCT/EP2007/059069 WO2008025830A2 (fr) 2006-09-01 2007-08-30 Compositions d'écran solaire
EP07803078A EP2061500A2 (fr) 2006-09-01 2007-08-30 Composition pharmaceutique et écran solaire comprenant de la caspase-14

Publications (1)

Publication Number Publication Date
EP2061500A2 true EP2061500A2 (fr) 2009-05-27

Family

ID=38983406

Family Applications (1)

Application Number Title Priority Date Filing Date
EP07803078A Withdrawn EP2061500A2 (fr) 2006-09-01 2007-08-30 Composition pharmaceutique et écran solaire comprenant de la caspase-14

Country Status (5)

Country Link
EP (1) EP2061500A2 (fr)
AU (1) AU2007291199A1 (fr)
CA (1) CA2661668A1 (fr)
IL (1) IL197273A0 (fr)
WO (1) WO2008025830A2 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2942231B1 (fr) 2009-02-19 2015-03-20 Lfb Biotechnologies Acides nucleiques se liant specifiquement au facteur vii/viia humain, et utilisations
FR2948664B1 (fr) 2009-07-31 2013-11-01 Lfb Biotechnologies Procede pour la purification de proteines de la coagulation a domaine gla
FR2948665B1 (fr) 2009-07-31 2011-09-23 Lfb Biotechnologies Procede pour la purification de proteines de la coagulation a domaine gla actives
FR2956115B1 (fr) 2010-02-05 2012-04-06 Isp Investments Inc Nouveaux peptides activateurs de la caspase-14 et compositions les comprenant
US8383167B2 (en) 2011-03-08 2013-02-26 Elc Management, Llc Method for cosmetically treating caspase-14 deficiency
FR2983212A1 (fr) 2011-11-28 2013-05-31 Lfb Biotechnologies Aptameres anti-fh, procede pour leur obtention et utilisations
FR2987743B1 (fr) 2012-03-12 2016-03-18 Isp Investments Inc Utilisation cosmetique d'un extrait d'avoine en tant qu'agent activateur de la caspace-14
FR3011250A1 (fr) 2013-09-30 2015-04-03 Lab Francais Du Fractionnement Acides nucleiques se liant specifiquement au facteur ix/ixa humain, et utilisations

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2308112A1 (fr) * 1997-10-30 1999-05-14 Human Genome Sciences, Inc. Polypeptides de caspase-14
EP1100933A1 (fr) * 1998-07-17 2001-05-23 Vlaams Interuniversitair Instituut voor Biotechnologie vzw. Nouvel homologue de caspase
AU1521501A (en) * 1999-11-10 2001-06-06 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Use of caspase-14 and caspase-14 modulators to diagnose and/or treat skin, eye and brain disorders
AU2001255773A1 (en) * 2000-04-27 2001-11-07 Knoll Gmbh Human caspase-14 compositions
AU2002311981A1 (en) * 2001-05-18 2002-12-03 Spectrx, Inc. System and method for monitoring or treating a health condition
AU2003297840A1 (en) * 2002-12-10 2004-06-30 Stephen Hsu Chemopreventive and therapeutic aspects of polyphenolic compositions and assays

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2008025830A3 *

Also Published As

Publication number Publication date
CA2661668A1 (fr) 2008-03-06
AU2007291199A1 (en) 2008-03-06
WO2008025830A3 (fr) 2008-05-02
IL197273A0 (en) 2011-08-01
WO2008025830A2 (fr) 2008-03-06

Similar Documents

Publication Publication Date Title
WO2008025830A2 (fr) Compositions d'écran solaire
Kümin et al. Peroxiredoxin 6 is a potent cytoprotective enzyme in the epidermis
US20080069791A1 (en) Means for stimulation and activation of hair growth by il-15
Sánchez‐Más et al. Agonist‐independent, high constitutive activity of the human mela‐nocortin 1 receptor
CN109248310B (zh) 利用θ-防御素的炎性蛋白酶的阻断
KR20210075098A (ko) 피부 노화 및 광 노화 치료 및 예방에 사용하기 위한 펩타이드
US8257753B2 (en) Use of an active principle originating from flax in a composition intended to reinforce the barrier function of the skin and to protect the skin and the appendages against external aggressions
US8440615B2 (en) Pharmaceutical and/or cosmetic composition containing active-principle activators of aconitase
US8318803B2 (en) EC SOD and use thereof
JP4891083B2 (ja) Ｅｃｓｏｄ及び細胞侵透性ｅｃｓｏｄとこれらの用途
DE60203172T2 (de) Verwendung von alpha-1 antichymotrypsin zur herstellung von einer zusammensetzung zur behandlung, vorbeugung oder diagnose von schwerheilenden diabätische wunden
ES2404053T3 (es) Composición cosmética y/o farmacéutica que comprende un principio activo capaz de activar el citocromo c
US8440789B2 (en) Pharmaceutical and/or cosmetic composition containing an active antioxydant principle and cell energy activator
ES2534513T3 (es) Péptidos derivados de HMG-CoA reductasa y composición cosmética y/o farmacéutica que los contienen
FR2915394A1 (fr) Composition pharmaceutique et/ou cosmetique contenant des peptides
FR2915396A1 (fr) Composition pharmaceutique et/ou cosmetique contenant des peptides
FR2915395A1 (fr) Composition pharmaceutique et/ou cosmetique contenant des peptides
Steinhoff et al. Proteinase‐activated receptor‐2 mediates itch: a novel pathway for pruritus in human skin
Bowen Sigma receptors as novel target structures for cancer chemotherapeutics
Barsh et al. The role of accessory proteins in melanocortin receptor signaling
Kim et al. Cytotoxicity of capsaicin on cultured human skin fibroblast
Fischer et al. NMDA receptors influence the intracellular calcium concen‐tration and the expression of differentiation markers in HaCaT cells
Geppetti The TRPV1: a possible role in GERD, asthma and migraine
Steinhoff et al. Evidence for a proinflammatory role of proteinase‐activated receptor‐2 during cutaneous inflammation in vivo
Wei Novel agonists for cold receptors on sensory neurons

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20090326

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20091211

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100622