EP2016062A2 - Anti-viral agents that activate rnase l - Google Patents

Anti-viral agents that activate rnase l

Info

Publication number
EP2016062A2
EP2016062A2 EP07755981A EP07755981A EP2016062A2 EP 2016062 A2 EP2016062 A2 EP 2016062A2 EP 07755981 A EP07755981 A EP 07755981A EP 07755981 A EP07755981 A EP 07755981A EP 2016062 A2 EP2016062 A2 EP 2016062A2
Authority
EP
European Patent Office
Prior art keywords
alkyl
compound
independently
haloalkyl
substituted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP07755981A
Other languages
German (de)
French (fr)
Inventor
Robert Silverman
Paul Torrence
Babal Kant Jha
Paula Francom
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cleveland Clinic Foundation
Northern Arizona University
Original Assignee
Cleveland Clinic Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cleveland Clinic Foundation filed Critical Cleveland Clinic Foundation
Publication of EP2016062A2 publication Critical patent/EP2016062A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/38—Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381—Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/426—1,3-Thiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/30—Hetero atoms other than halogen
    • C07D333/36—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/38—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals

Definitions

  • RNase L pathway (Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA. Proc Natl Acad Sci USA. 2002 JuI 9;99(14):9322-7).
  • RNase L is activated during the interferon antiviral response by small, unusual oligoadenylates with 2',5'- internucleotide linkages (known as "2-5 A”) (Kerr IM, Brown RE Proc Natl Acad Sd USA.
  • RNase L participates in the anti-cell proliferation activity of IFTSI (Hassel BA, Zhou A, Sotomayor C, Maran A, Silverman RH. EMBO J. 1993 Aug; 12(8):3297-304). 2-5 A induces through RNase L the degradation of ribosomal RNA (rRNA) and messenger RNA (mRNA), thereby reducing levels of protein synthesis, properties that if applied to aortic smooth muscle cells, could prevent restenosis following angioplasty.
  • rRNA ribosomal RNA
  • mRNA messenger RNA
  • the invention is based on the discovery of a number of compounds which activate RNase L (see Example 3) (hereinafter the “disclosed RNase L activators"). These RNase L activators have antiviral activity (see Example 6) , including against Parainfluenza Virus 3 (HPIV3), Picornavirus and Encephalomyocarditis Virus (EMCV).
  • the disclosed activators of RNase L also inhibit smooth muscle cell proliferation in vitro (see Example 7), and therefore have utility in treating . restenosis. It has also unexpectedly been found that the disclose RNase activators are not cytotoxic (Example 5). Based on these discoveries, novel RNase L activators, pharmaceutical compositions comprising these RNase L activators and methods of treatment with these RNase L activators are disclosed herein.
  • Figures IA-I F are graphs showing the dose-response and kinetics of RNase L activation versus concentration in ⁇ M ( Figures 1 A-IC) or versus time in minutes ( Figures ID- IE) with 2-5 A or small molecule activators. Assays were by the RNase L FRET method and were performed at 22 0 C. (A 5 D) ppp(A2'p5'A) 2 , (B, E) Compound 1; and (C,F) Compound 2.
  • Figure 2 shows the structures of small molecule activators of RNase L (Compounds 1-12) and their ECso concentrations required for 50% degradation in the RNA FRET probe. NA means no activity.
  • Figures 6A-6B are graphs showing the cytotoxicity of Compounds 1 and 2 to HeIa M cells in an MTS conversion assay. The cytoxicity is measured by the absorbance at 490 nanometers versus concentration in ⁇ M on Day 1. The results for
  • FIG. 1 shows results for HeIa M cells expressing RNase L;
  • Figure 6B shows results for HeIa M cells expressing a nuclease-dead mutant of RNase L.
  • Figure 7 shows photographs under inverted fluorescence microscope showing that Compound 2 suppresses replication of HPIV3/GFP.
  • HeLa M cells deficient in RNase L were used as empty vector control cells, expressing wild type RNase L or in expressing a nuclease-dead mutant (R667A) RNase L. Pictures were captured using an inverted fluorescence microscope.
  • Figure 8 is a bar graph showing the antiviral effect of compound 2 at varying concentrations in ⁇ M against encephalomyocardutus virus (EMCV), as measured by the number of plagues x 10 " .
  • EMCV encephalomyocardutus virus
  • a "subject” is preferably a human but can also be a veterinary animal, farm animal or laboratory animal in need of treatment for a viral infection, cancer or restensosis.
  • Viral infections which can be treated with the disclosed RNase L activators include viruses with single-stranded RNA(s) for their genome.
  • examples include orthomyxoviruses (e.g. influenza viruses), paramyxoviruses (e.g. respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses (e.g. rubella virus and eastern equine encephalitis virus), picornaviruses (e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue virus, and hepatitis C virus), bunyaviruses (e.g.
  • orthomyxoviruses e.g. influenza viruses
  • paramyxoviruses e.g. respiratory syncytial virus & human parainfluenza virus-3
  • rhabdoviruses e.g. rab
  • the disclosed RNase L activators can also be used to treat infections from certain DNA viruses, including human papillomavirus, herpes simplex virus-1 and - 2, cytomegalovirus, and human herpesvirus-8. Additionally, the disclosed RNase L activators can also be used to treat infections from certain DNA viruses including Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6, human herpesvirus 7, B19 parvovirus, adeno-associated virus, BK virus, and JC virus as well.
  • Variola virus smallpox virus
  • Monkeypox virus Molluscum contagiosum virus
  • Epstein-Barr virus Epstein-Barr virus
  • adenovirus varicella-zoster virus
  • human herpesvirus 6, human herpesvirus 7, B19 parvovirus adeno-associated virus, BK virus, and JC virus as well.
  • cancers which can be treated with the disclosed RNase L activators include, but are not limited to, human sarcomas and carcinomas, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,
  • the disclosed RNase L activators are commonly used to treat prostate cancer, ovarian cancer, brain cancer or bone cancer. Restenosis is a condition which can develop in blood vessels which have undergone coronary procedures or peripheral procedures with PTCA balloon catheters (e.g. percutaneous transluminal angioplasty). Restenosis is the development of scar tissue from about three to six months after the procedure and results in narrowing of the blood vessel. Restenosis is caused excessive smooth muscle proliferation. Because the disclosed RNase L activators inhibit smooth muscle proliferation, it is believed that these compounds can be used to inhibit, treat and/or prevent restenosis.
  • aralkyl includes carbocyclic aromatic rings and heteroaryl rings.
  • aromatic group may be used interchangeably with the terms “aryl”, “aryl ring” “aromatic ring”, “aryl group” and “aromatic group”.
  • Aralkyl is an alkyl group substituted with an aromatic group.
  • Phenalkyl is an alkyl group substituted with a phenyl group.
  • a "monocyclic aromatic group” is an aromatic group with only one ring.
  • Carbocyclic aromatic ring groups have only carbon ring atoms and include monocyclic aromatic rings such as phenyl.
  • Examples of monocyclic heteroaryl groups include 2- furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3- isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-oxazolyl, A- oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2- pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3- pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl, tetrazolyl, 2- thienyl and 3-thienyl.
  • a “substitutable ring carbon atom” in an aromatic group is a ring carbon atom bonded to a hydrogen atom.
  • the hydrogen can be optionally replaced with a suitable substituent group.
  • the te ⁇ n "substitutable ring carbon atom” does not include ring carbon atoms which are shared when two rings are fused.
  • “substitutable ring carbon atom” does not include ring carbon atoms .when the structure depicts that they are already attached to a moiety other than hydrogen.
  • an aralkyl group has a certain number of carbon atoms
  • it is to be understood that it is the number of carbon atoms in the alkyl portion of the aralkyl that is being specified.
  • a C1-C2 aralkyl group has one or two carbon atoms in the alkyl portion.
  • Pharmaceutically acceptable salts include acid salts of a disclosed RNase L activator containing an amine or other basic group and can be obtained by reacting the compound with a suitable organic or inorganic acid, such as hydrogen chloride, hydrogen bromide, acetic acid, perchloric acid and the like.
  • salts include sulfates, methanesulfonates, nitrates, maleates, acetates, citrates, fumarates, tartrates [e.g. (+)-tartrates, (-)-tartrates or mixtures thereof including racemic mixtures], succinates, benzoates and salts with amino acids such as glutamic acid.
  • Salts of a disclosed RNase L activator containing a carboxylic acid or other acidic functional group can be prepared by reacting with a suitable base.
  • a suitable base which affords a pharmaceutically acceptable cation, which includes alkali metal salts (especially sodium and potassium), alkaline earth metal salts (especially calcium and magnesium), aluminum salts and ammonium salts, as well as salts made from physiologically acceptable organic bases such as trimethylamine, triethylamine, morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N,N'- dibenzylethylenediamine, 2-hydroxyethylamine, bis-(2-hydroxyethyl)amine, tri-(2- hydroxyethyl)amine, procaine, dibenzylpiperidine, N-benzyl- ⁇ -phenethylamine, dehydroabietylamine, N,N'-bisdehydroabietylamine, glucamine, N
  • Treatment or “treating” refers to both therapeutic and prophylactic treatment.
  • an “effective amount” is the quantity of a disclosed RNase L activator in which a beneficial clinical outcome (prophylactic or therapeutic) is achieved when the compound is administered to a subject in need of treatment.
  • a "beneficial clinical outcome” includes a reduction in the severity of the symptoms associated with the disease (e.g., fever), a reduction in the longevity of the disease and/or a delay in the onset of the symptoms associated with the disease compared with the absence of the treatment.
  • a beneficial clinical outcome includes a reduction in tumor mass, a reduction in the rate of tumor growth, a reduction in metastasis, a reduction in the severity of the symptoms associated with the cancer and/or an increase in the longevity of the subject compared with the absence of the treatment.
  • a "beneficial clinical outcome” includes a slowing or reduction in the narrowing of a blood vessel which has undergone angioplasty.
  • the precise amount of a disclosed RNase L activator administered to a subject will depend on the type and severity of the disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. Effective amounts of the disclosed RNase L activator typically range between about O.lmg/kg body weight per day and about 1000 mg/kg body weight per day, and preferably between 1 mg/kg body weight per day and 100 mg/kg body weight per day.
  • the disclosed RNase L activator or salts thereof can be combined with a suitable solid or liquid carrier or diluent to form capsules, tablets, pills, powders, syrups, solutions, suspensions and the like.
  • the tablets, pills, capsules, and the like contain from about 1 to about 99 weight percent of the active ingredient and a binder such as gum tragacanth, acacias, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose lactose or saccharin.
  • a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.
  • the disclosed RNase L activators or salts thereof can be combined with sterile aqueous or organic media to form injectable solutions or suspensions.
  • aqueous or organic media for example, solutions in sesame or peanut oil, aqueous propylene glycol and the like can be used, as well as aqueous solutions of water-soluble pharmaceutically-acceptable salts of the compounds.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the disclosed RNase L activators may also be formulated as a long acting formulation, such as a depot preparation.
  • Such long acting formulations may be administered by implantation, or, for example, subcutaneously by intramuscular injection.
  • RNase L activators or pharmaceutical formulations containing these compounds are in unit dosage form for administration to a mammal.
  • the unit dosage form can be any unit dosage form known in the art including, for example, a capsule, an IV bag, a tablet, or a vial.
  • the quantity of the disclosed RNase L activator in a unit dose of composition is an effective amount and may be varied according to the particular treatment involved. It may be appreciated that it may be necessary to make routine variations to the dosage depending on the age and condition of the patient.
  • the dosage will also depend on the route of administration which may be by a variety of routes including oral, aerosol, rectal, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal and intranasal.
  • Phosphonate compound XVIII will be prepared as shown in Scheme 4.
  • Commercially available 3-aminophenol (XIII) will be protected via Standard methodology with dibenzylpyrocarbonate in dioxane/H 2 0 (1 :1) with NaOH or Et 3 N (to yield XIV).
  • Deprotonation of the protected aminophenol with sodium hydride and coupling with the previously described p-toluenesulfonyloxymethane phosphonate in DMF to yield compound XV
  • is followed by removal of the benzyloxycarbonyl protective group by transfer hydrogenation to yield compound XVI).
  • the assay is based on fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • the method includes recombinant human RNase L produced in insect cells, from a baculovirus vector, and purified by FPLC (Thakur CS, Xu Z, Wang Z, Novince Z, Silverman RIi. A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2",5' oligoadenylates. Methods MoI Med 2005;116:103-13).
  • the cleavable RNA substrate is a 36-nucleotide synthetic oligoribonucleotide with a fluorophore (6-carboxyfluorescein, FAM) at the 5'-terminus and a quencher (black hole quencher-1, BHQl), at the 3'-terminus.
  • FAM 6-carboxyfluorescein
  • BHQl black hole quencher-1
  • the RNA sequence is from the intergenic region of the paramyxovirus, respiratory syncytial virus (RSV) genomic RNA.
  • the RSV sequence was chosen because it contains several cleavage sites for RNase L (UU or UA) in an optimal context for cleavage.
  • RNA cleavage reactions were performed in 96-well black microtiter plates containing RNase L, the cleavable FRET RNA substrate and 2-5A.
  • the EC 50 is routinely obtained (concentration of activator to give 50% maximum activation) of 0.3 nM with authentic trimer 2-5A [p3A(2'p5'A) 2 ] as the activator of RNase L (Fig. IA).
  • the dephosphorylated trimer, A(2'p5'A) 2 was unable to activate RNase L, consistent with prior findings (Fig. 1 A&D).
  • RNA substrates Two different P- labeled RNA substrates (Fig. 3A&B).
  • 25 ⁇ M of compound 1 (Fig. 3A, lanes 3&4)
  • 25 ⁇ M compound 2 (Fig. 3A, lanes 5&6) were incubated in the presence and absence of purified human RNase L with the synthetic RNA substrate GGACUUUUUUUCCCUUUUUUUCC-[ 32 P]pCp (SEQ ID NO.: 1).
  • RNase L activated by 2-5 A or compounds 1 or 2 cleaved the substrate on the 3' side of the UU dinucleotide sequence, consistent with our FRET assay findings.
  • RNase L activation by lead compounds 1 and 2 was further supported using a sequence specific substrate C 7 U 2 C 12 (Fig. 3B) (SEQ ID NO.: 2).
  • Compound 1 (25 ⁇ M) (lanes 4&5), and compound 2 (25 ⁇ M) (lanes 6&7) were separately incubated in the presence and absence of RNase L with the radiolabeled RNA substrate.
  • RNase L activated by 2-5 A, compound 1 or compound 2 cleaved the substrate on the 3 '-side of the UU dinucleotide sequence. In the absence of activator no product band was detected.
  • RNase L dimerization is a prerequisite for the nuclease activation.
  • protein cross-linking assays were performed (Fig. 3C).
  • the oligomeric state of RNase L was determined in western blots probed with monoclonal antibody against RNase L.
  • Monomer RNase L converted to dimer in the presence of 2-5 A, compound 1, or compound 2 (Fig. 3C).
  • Sensograms were recorded and the maximum resonance units (Rmax) at equilibrium were plotted as a function of the compound concentrations using Bia- evaluationTM software (Fig. 4). A dose-dependent decrease in the resonance response occurred with either compound 1 or 2. The data indicate that these compounds compete with 2-5 A for RNase L binding. Analysis of the data indicated that the binding constants (KJ) for compounds 1 and 2 are 18 ⁇ M and 12 ⁇ M, respectively.
  • Cytotoxicity of compounds 1 and 2 was evaluated by MTS (tetrazolium) conversion assays (Promega). Treatments with compound 1 at 50 ⁇ M for 3 days reduced cell viability to 76.3% and 98.2% of control (untreated) levels for DU145 and HeLa cells, respectively. Treatments with compound 2 (also at 50 ⁇ M for 3 d) reduced cell viability as a percentage of untreated cells to 95.2% and 86.5% for DU145 and HeLa cells, respectively. The results for DU145 cells are shown in Figure 5; and the results for HeIa M cells are shown in Figure 6. As can be seen from the results, these compounds lack significant cytotoxcity.
  • Example 6 Compound 2 Shows Antiviral Activity against Parainfluenza Virus 3,
  • Picornavirus and Encephalomyocarditis Virus To determine antiviral activity, cells were infected with a recombinant human parainfluenza virus 3 (HPIV3) in which green fluorescent protein (GFP) cDNA was inserted between the P and M genes (provided by collaborator A. Banerjee) (Fig. 7).
  • the cell lines used are HeLa M cells which are deficient in RNase L or HeLa M cells stably expressing either wild type RNase L or a nuclease-dead mutant (R667A) RNase L (from a CMV promoter in vector pcDNAneo). Cells were infected at an MOI of 0.1 with HPIV3/GFP in serum free medium (DMEM) for Ih.
  • DMEM serum free medium
  • the proliferation of the clonal cell line AlO was determined using the colorimetric CellTiter 96 ® AQ ueO us Cell Proliferation Assay as described (Promega).
  • This method uses the tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2H-tetrazolium, MTS] and phenazine methosulfate (PMS), an electron coupling reagent.
  • Immortalized mouse embryonic fibroblasts were grown in RPMI supplemented with 10% FBS and p/s.
  • Baby hamster kidney (BHK21) cells and african green monkey kidney cells (BSC40) were grown in Dulbecco's modified
  • MOI Vaccinia Virus (Western Reserve) 5 PFU using no media serum for infection (virus stock: lxl0 9 PFU/ml)
  • BHK21 cells were plated in 12 well plates, complete monolayer of the cells were infected with different dilutions of virus using serum free media. After 45min post infection, media was removed and the cells washed twice with PBS and replaced with Agar media [mix of 2% agarose + (2x MEM + 20%FBS)], after two days second layer of agar media was added with 0.05% neutral red in order to count the plaques.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pulmonology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Heterocyclic Compounds Containing Sulfur Atoms (AREA)
  • Thiazole And Isothizaole Compounds (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

RNase L Activators and methods of using the same are disclosed herein.

Description

ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L
GOVERNMENT SUPPORT
The invention was supported, in whole or in part, by a grant NIH (NCI) IROl CA044059-21 from National Institutes of Health. The Government has certain rights in the invention.
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 60/795,069, filed April 25, 2006, the entire teachings of which are incorporated herein by reference.
BACKGROUND OF THE INVENTION
Preclinical studies on RNase L, an antiviral enzyme in the interferon (IFN) system, have suggested that it is an important target for cancer therapeutics and antiviral agents (Adah SA, Bayly SF, Cramer H, Silverman RH, Torrence PF. (Curr Med Chem. 2001 Aug;8( 10): 1189-212). For example, the hereditary prostate cancer 1 (HPCl) susceptibility locus was recently mapped to the RNase L gene
(Carpten J, Nupponen N, Isaacs S, Sood R, Robbins C, Xu J, Faruque M, Moses T, Ewing C, Gillanders E, Hu P, Bujnovszky P, Makalwska I, Baffoe-Bonni A, Faith D, Smith J, Stepah D, Wiley K, Brownstein M, Gildea D, Kelly B, Jenkins R, Hostetter G, Matikainen M, Schleutker J, Klinger K, Conners T, Xiang Y, Wang Z, Demarzo A, Papdopoulos N, Kallioniemi O-P, Burk R, Meyers D, Gronberg H, Meltzer P, Silverman R, Bailey- Wilson J, Walsh P, Isaacs W, Trent J. Nature Genetics 2002, Jan 22). Also, the gene that confers resistance to flaviviruses including West Nile virus was mapped to a gene in the RNase L pathway (OASIb) (Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA. Proc Natl Acad Sci USA. 2002 JuI 9;99(14):9322-7). In nature, RNase L is activated during the interferon antiviral response by small, unusual oligoadenylates with 2',5'- internucleotide linkages (known as "2-5 A") (Kerr IM, Brown RE Proc Natl Acad Sd USA. 1978 Jan;75(l):256-60; Zhou A, Hassel BA, Silverman RH. Cell. 1993 Mar 12;72(5);753-65). In addition, it has been previously demonstrated that RNase L participates in the anti-cell proliferation activity of IFTSI (Hassel BA, Zhou A, Sotomayor C, Maran A, Silverman RH. EMBO J. 1993 Aug; 12(8):3297-304). 2-5 A induces through RNase L the degradation of ribosomal RNA (rRNA) and messenger RNA (mRNA), thereby reducing levels of protein synthesis, properties that if applied to aortic smooth muscle cells, could prevent restenosis following angioplasty. 2-5 A, however, has undesirable properties for a therapeutic agent in that: 1) it is unstable in serum and in cells due to the action of phosphodiesterases and phosphatases; and 2) it is an intracellular mediator which does not transit the cell membranes. Thus, there is a need for new activators of RNase L for clinical use.
SUMMARY OF THE INVENTION
The invention is based on the discovery of a number of compounds which activate RNase L (see Example 3) (hereinafter the "disclosed RNase L activators"). These RNase L activators have antiviral activity (see Example 6) , including against Parainfluenza Virus 3 (HPIV3), Picornavirus and Encephalomyocarditis Virus (EMCV). The disclosed activators of RNase L also inhibit smooth muscle cell proliferation in vitro (see Example 7), and therefore have utility in treating . restenosis. It has also unexpectedly been found that the disclose RNase activators are not cytotoxic (Example 5). Based on these discoveries, novel RNase L activators, pharmaceutical compositions comprising these RNase L activators and methods of treatment with these RNase L activators are disclosed herein.
The disclosed RNase activators, pharmaceutical compositions comprising the same and methods of treating using the same are described with particularity in the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures IA-I F are graphs showing the dose-response and kinetics of RNase L activation versus concentration in ~M (Figures 1 A-IC) or versus time in minutes (Figures ID- IE) with 2-5 A or small molecule activators. Assays were by the RNase L FRET method and were performed at 220C. (A5 D) ppp(A2'p5'A)2, (B, E) Compound 1; and (C,F) Compound 2.
Figure 2 shows the structures of small molecule activators of RNase L (Compounds 1-12) and their ECso concentrations required for 50% degradation in the RNA FRET probe. NA means no activity.
Figure 3 shows (A,B) Alternative ribonuclease assays and (C) RNase L dimerization assays for 2-5 A, compound 1 (C-I) and compound 2 (C-2). (A) 25 nM trimeric 2-5A (lanes 1, 2), 25 ~M C-I (lanes 3, 4), 25 ~M C-2 (lanes 5, 6) with or without 25nM RNase L in presence of the RNA substrate, GGACUUUUUUUCCCUUUUUUUCC[32P]pCp, at 220C for 30 min. (B) 25nM trimeric 2-5 A (lanes 2, 3), 25 ~M C-I (lanes 4, 5), 25 ~M C-2 (lanes 6, 7) was incubated with or without 25nM RNase L and RNA, C7U2C12-[32P]pCp, at 22°C for 30 min. The cleaved RNAs were separated in 20% acrylamide/7 M urea/TBE sequencing gels. (C) Covalent cross-linking of RNase L by dimethyl suberimidate (DMS). DMS was incubated with RNase L and trimer 2-5A (lanes 2 to 5), C-I (lanes 6 to 9), or C-2 (lanes 10 to 13). After SDS-polyacrylamide gel electrophoresis, the proteins were transferred to nitrocellulose and probed with monoclonal antibody against RNase L.
Figures 4A and 4B are graphs showing the displacement of 2-5A-biotin binding with RNase L by compounds 1 and 2 as determined by surface plasmon resonance. Biotinylated 2-5 A was immobilized on streptavidin biosensor chip (Biacore). RNase L (10 nM) in presence of varying concentration of either compound 1 (A) or compound 2 (B) was allowed to flow over the chip at a rate of 20 μl/min for five min. Sensograms were recorded and analyzed using Bia- evaluation™ software. Rmax in each case was plotted against the increasing concentration of the compound in ~M.
Figures 5A-5C are graphs showing the cytotoxicity of Compounds 1 and 2 to DUl 25 cells in an MTS conversion assay. The cytoxicity is measured by the absorbance at 490 nanometers versus concentration in ~M on Day 1 (Figure 5A), Day 2 (Figure 5B) and Day 3 (Figure 5C). The results for Compound 1 are represented with blue; and the results for Compound 2 are represented with red.
Figures 6A-6B are graphs showing the cytotoxicity of Compounds 1 and 2 to HeIa M cells in an MTS conversion assay. The cytoxicity is measured by the absorbance at 490 nanometers versus concentration in ~M on Day 1. The results for
Compound 1 are represented with blue; and the results for Compound 2 are represented with red. Figure 6A shows results for HeIa M cells expressing RNase L; Figure 6B shows results for HeIa M cells expressing a nuclease-dead mutant of RNase L. Figure 7 shows photographs under inverted fluorescence microscope showing that Compound 2 suppresses replication of HPIV3/GFP. HeLa M cells deficient in RNase L were used as empty vector control cells, expressing wild type RNase L or in expressing a nuclease-dead mutant (R667A) RNase L. Pictures were captured using an inverted fluorescence microscope. Figure 8 is a bar graph showing the antiviral effect of compound 2 at varying concentrations in ~M against encephalomyocardutus virus (EMCV), as measured by the number of plagues x 10" .
Figure 9 includes a bar graph showing the growth of MEF RL+/+ cells grown with 0, 25, and 50 μM of Compound 2. The bar graph shows the percentage of viral plaques obtained as compared to the control (0 μM compound 2, 100% = 2.5 x 104 PFU/mL). Increasing the concentration of compound 2 decreased the appearance of viral yield as determined by the plaque assay. Directly under each compound 2 concentration is the corresponding agar plate, stained with neutral red. Again, the plates indicate the decreased viral yield with increasing compound 2 concentration as determined by the plaque assay.
Figure 10 is a bar graph showing the percentage of viral plaques obtained for MEF RL+/+, BSC 40, and MEF RL ~'~ cells grown in the absence or presence of compound 2. Compound 2 inhibited the viral titer for MEF RL+/+ and BSC 40 cells. Cells lacking the RNase L gene were resistant to compound 2. (Untreated controls (0 μM compound 2 added) in PFU/mL counts at 100%: MEF RL+/+: 2.5 x 104; BSC 40: 2.5 x 104; and MEF RL "Λ: 3.5 x 104). Figure 11 is a photograph of treated (50 μM compound 2) and untreated ( 0 μM compound 2 added) MEF RL+/+ cells on agar plates stained with neutral red. Presence of compound 2 resulted in the decreased viral plaque count.
Figure 12: Table containing the actual viral plaque counts as determined by the plaque assay for both MEF RL+/+ and MEF RL"'" cells. Viral yield in MEF RL+/+ cells decreased in the presence of compound 2. Compound 2 did not decrease viral yield in MEF RL"'" cells. The viral dilution indicate that a 10-fold viral dilution resulted in a 10-fold decrease viral plaque count.
DETAILED DESCRIPTION OF THE INVENTION
A "subject" is preferably a human but can also be a veterinary animal, farm animal or laboratory animal in need of treatment for a viral infection, cancer or restensosis.
Viral infections which can be treated with the disclosed RNase L activators include viruses with single-stranded RNA(s) for their genome. Examples include orthomyxoviruses (e.g. influenza viruses), paramyxoviruses (e.g. respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses (e.g. rubella virus and eastern equine encephalitis virus), picornaviruses (e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift Valley fever virus & Hantavirus), retroviruses (e.g. the gammaretrovirus XMRV and the lentiviruses HIV-I & -2), filoviruses (e.g. Ebolavirus, hemorrhagic fever virus) or hepatitis B virus (a DNA virus with a genomic RNA intermediate).
The disclosed RNase L activators can also be used to treat infections from certain DNA viruses, including human papillomavirus, herpes simplex virus-1 and - 2, cytomegalovirus, and human herpesvirus-8. Additionally, the disclosed RNase L activators can also be used to treat infections from certain DNA viruses including Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6, human herpesvirus 7, B19 parvovirus, adeno-associated virus, BK virus, and JC virus as well. Transfection of PC3 or DU 145 cells with 2-5 A causes apoptosis (Xiang Y, Wang Z, Murakami J, Plummer S, Klein EA, Carpten JD, Trent JM, Isaacs WB, Casey G, Silverman RH. Cancer Res. 2003 Oct 15; 63(20):6795-801). Both DU145 and PC3, cell lines derived from metastatic brain and bone prostate cancer cases respectively, are wild type for RNase L. In addition, 2-5 A transfection causes caspase-dependent apoptosis in human ovarian carcinoma cells through a mitochondrial pathway (Rusch L, Zhou A, Silverman RH. J Interferon Cytokine Res. 2000 Dec;20(12):1091-100). Furthermore, 2-5A linked to antisense against telomerase RNA caused apoptosis and anti-tumor activities against DUl 45 tumors in nude mice (Kondo Y, Koga S, Komata T, Kondo S. Oncogene. 2000 Apr
27;19(18):2205-l 1). Based on the foregoing, the disclosed activators of RNase L can be used to treat cancers.
Examples of cancers which can be treated with the disclosed RNase L activators include, but are not limited to, human sarcomas and carcinomas, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma and retinoblastoma. The disclosed RNase L activators are commonly used to treat prostate cancer, ovarian cancer, brain cancer or bone cancer. Restenosis is a condition which can develop in blood vessels which have undergone coronary procedures or peripheral procedures with PTCA balloon catheters (e.g. percutaneous transluminal angioplasty). Restenosis is the development of scar tissue from about three to six months after the procedure and results in narrowing of the blood vessel. Restenosis is caused excessive smooth muscle proliferation. Because the disclosed RNase L activators inhibit smooth muscle proliferation, it is believed that these compounds can be used to inhibit, treat and/or prevent restenosis.
The term "alkyl" as used herein means saturated straight-chain or branched hydrocarbons. "Haloalkyl" is an alkyl substituted with one or more halogens. The term "halogen" means F, Cl, Br or I. Preferably the halogen in a haloalkyl or haloalkoxy is F. The term "aromatic group" used alone or as part of a larger moiety as in
"aralkyl", includes carbocyclic aromatic rings and heteroaryl rings. The term "aromatic group" may be used interchangeably with the terms "aryl", "aryl ring" "aromatic ring", "aryl group" and "aromatic group". "Aralkyl" is an alkyl group substituted with an aromatic group. "Phenalkyl" is an alkyl group substituted with a phenyl group.
A "monocyclic aromatic group" is an aromatic group with only one ring.
Carbocyclic aromatic ring groups have only carbon ring atoms and include monocyclic aromatic rings such as phenyl.
The term "heteroaryl", "heteroaromatic", "heteroaryl ring", "heteroaryl group" and "heteroaromatic group", used alone or as part of a larger moiety as in "hetero aralkyl" or "heteroarylalkoxy" refers to an aromatic group with one or more heteroatoms such as nitrogen, sulfur or oxygen as a ring atom. Monocylic heteroaryl groups have five or six members and one or more ring heteroatoms, such as nitrogen, oxygen and sulfur. Examples of monocyclic heteroaryl groups include 2- furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3- isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-oxazolyl, A- oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2- pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3- pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl, tetrazolyl, 2- thienyl and 3-thienyl.
A "substitutable ring carbon atom" in an aromatic group is a ring carbon atom bonded to a hydrogen atom. The hydrogen can be optionally replaced with a suitable substituent group. Thus, the teπn "substitutable ring carbon atom" does not include ring carbon atoms which are shared when two rings are fused. In addition, "substitutable ring carbon atom" does not include ring carbon atoms .when the structure depicts that they are already attached to a moiety other than hydrogen. Examples of suitable substituents on a substitutable ring carbon atom of an aryl (e.g., phenyl) group include halogen, R°, -OR°, -O(haloalkyl), -SR°, trialkylsilyl, boronate, alkylboronate, dialkylboronate, -NO2, -CN, -N(R')2, -NR5CO2R0, -NR5C(O)R0, -NR'NR'C(O)R°, -N(R')C(O)N(R')2, -NR5NR5C(O)N(R');,, -NR5NR5CO2R0, -C(O)C(O)R0, -C(O)CH2C(O)R0, -CO2R0, -C(O)R0, -C(O)N(R°)2, -OC(O)R0, -OC(O)N(R°)2, -S(O)2R0, -SO2N(R5^, -S(O)R0, -NR'SO2N(R')2, - NR5SO2R0, -C(=S)N(R')2, -NR5-C(=NH)-N(R')2 and -C(=NH)-N(R')2 or two adjacent ring carbon atoms may be substituted with 1 ,2-methylene-dioxy or 1,2- ethylene-dioxy.
Each R0 is independently hydrogen or an alkyl group. Each R5 is hydrogen or an alkyl group.
When specifying that an aralkyl group has a certain number of carbon atoms, it is to be understood that it is the number of carbon atoms in the alkyl portion of the aralkyl that is being specified. For example, a C1-C2 aralkyl group has one or two carbon atoms in the alkyl portion. Pharmaceutically acceptable salts include acid salts of a disclosed RNase L activator containing an amine or other basic group and can be obtained by reacting the compound with a suitable organic or inorganic acid, such as hydrogen chloride, hydrogen bromide, acetic acid, perchloric acid and the like. Other examples of such salts include sulfates, methanesulfonates, nitrates, maleates, acetates, citrates, fumarates, tartrates [e.g. (+)-tartrates, (-)-tartrates or mixtures thereof including racemic mixtures], succinates, benzoates and salts with amino acids such as glutamic acid.
Salts of a disclosed RNase L activator containing a carboxylic acid or other acidic functional group can be prepared by reacting with a suitable base. Such a pharmaceutically acceptable salt may be made with a base which affords a pharmaceutically acceptable cation, which includes alkali metal salts (especially sodium and potassium), alkaline earth metal salts (especially calcium and magnesium), aluminum salts and ammonium salts, as well as salts made from physiologically acceptable organic bases such as trimethylamine, triethylamine, morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N,N'- dibenzylethylenediamine, 2-hydroxyethylamine, bis-(2-hydroxyethyl)amine, tri-(2- hydroxyethyl)amine, procaine, dibenzylpiperidine, N-benzyl-β-phenethylamine, dehydroabietylamine, N,N'-bisdehydroabietylamine, glucamine, N- methylglucamine, collidine, quinine, quinoline, and basic amino acid such as lysine and arginine.
"Treatment" or "treating" refers to both therapeutic and prophylactic treatment.
An "effective amount" is the quantity of a disclosed RNase L activator in which a beneficial clinical outcome (prophylactic or therapeutic) is achieved when the compound is administered to a subject in need of treatment. For the treatment of a viral infection, a "beneficial clinical outcome" includes a reduction in the severity of the symptoms associated with the disease (e.g., fever), a reduction in the longevity of the disease and/or a delay in the onset of the symptoms associated with the disease compared with the absence of the treatment. For the treatment of cancer, a beneficial clinical outcome includes a reduction in tumor mass, a reduction in the rate of tumor growth, a reduction in metastasis, a reduction in the severity of the symptoms associated with the cancer and/or an increase in the longevity of the subject compared with the absence of the treatment. For restenosis, a "beneficial clinical outcome" includes a slowing or reduction in the narrowing of a blood vessel which has undergone angioplasty. The precise amount of a disclosed RNase L activator administered to a subject will depend on the type and severity of the disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. Effective amounts of the disclosed RNase L activator typically range between about O.lmg/kg body weight per day and about 1000 mg/kg body weight per day, and preferably between 1 mg/kg body weight per day and 100 mg/kg body weight per day. The disclosed RNase L activators and pharmaceutically acceptable salts, solvates and hydrates thereof can be used in pharmaceutical preparations in combination with a pharmaceutically acceptable carrier or diluent. Suitable pharmaceutically acceptable carriers include inert solid fillers or diluents and sterile aqueous or organic solutions. The disclosed RNase L activator will be present in such pharmaceutical compositions in amounts sufficient to provide the desired dosage amount in the range described herein. Techniques for formulation and administration of the compounds of the instant invention can be found in Remington: the Science and Practice of Pharmacy, 19th edition, Mack Publishing Co., Easton, PA (1995).
For oral administration, the disclosed RNase L activator or salts thereof can be combined with a suitable solid or liquid carrier or diluent to form capsules, tablets, pills, powders, syrups, solutions, suspensions and the like.
The tablets, pills, capsules, and the like contain from about 1 to about 99 weight percent of the active ingredient and a binder such as gum tragacanth, acacias, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose lactose or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.
Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. A syrup or elixir may contain, in addition to the active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavoring such as cherry or orange flavor.
For parental administration the disclosed RNase L activators or salts thereof can be combined with sterile aqueous or organic media to form injectable solutions or suspensions. For example, solutions in sesame or peanut oil, aqueous propylene glycol and the like can be used, as well as aqueous solutions of water-soluble pharmaceutically-acceptable salts of the compounds. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
In addition to the formulations described previously, the disclosed RNase L activators may also be formulated as a long acting formulation, such as a depot preparation. Such long acting formulations may be administered by implantation, or, for example, subcutaneously by intramuscular injection.
Preferably disclosed RNase L activators or pharmaceutical formulations containing these compounds are in unit dosage form for administration to a mammal. The unit dosage form can be any unit dosage form known in the art including, for example, a capsule, an IV bag, a tablet, or a vial. The quantity of the disclosed RNase L activator in a unit dose of composition is an effective amount and may be varied according to the particular treatment involved. It may be appreciated that it may be necessary to make routine variations to the dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration which may be by a variety of routes including oral, aerosol, rectal, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal and intranasal.
Synthetic Strategy:
Compounds of the generalized Formula III will be synthesized following the procedure described by Faull and Hull [Faull and Hull. "Some reactions of Ethyl 2- Anilino-4oxo-4,5-dihydrothiophen-3carboxylate." Perkin Transactions 1, 1981, 1078-1082 ]. Z2 in Formula I is either S (isothiocyanate) or O (isocyanate). Condensation with substituted benzaldehydes will generate compounds of the structure depicted in Formula IV. Modification of Ring A is achieved by selection of substituted aldehydes. Modification of Ring B is described in Scheme 3 and 4.
Scheme 1 :
The synthesis of Compound 1 follows this scheme directly. Isothiocyanatobenzene (V) will be coupled with ethyl 4-chloro-3-oxobutanoate (VI) under Faull and Hull conditions. Condensation of the 2,3-dihydrothiophene intermediate (VII) with 3- hydroxybenzaldehyde will yield compound 1.
Scheme 2:
Modification of the substituents on Ring B will be accomplished prior to the Faull- HuIl synthesis described in Scheme 1. A representative synthetic strategy to produce Compound XII is shown in Scheme 3. Readily available (E)-methyl 3-(3- nitrophenyl)acrylate (VIII) can be catalytically reduced the corresponding amine (IX). Formation of the isothiocyanate (X) via the coupling of the amine and carbon disulfide in the presence of DCC yields the starting reactant similar to I in Scheme 1. Production of Compound XII follows the subsequent Faull-Hull synthetic procedure.
Scheme 3:
BOH
h
XI Cora pound X Il
Phosphonate compound XVIII will be prepared as shown in Scheme 4. Commercially available 3-aminophenol (XIII) will be protected via Standard methodology with dibenzylpyrocarbonate in dioxane/H20 (1 :1) with NaOH or Et3N (to yield XIV). Deprotonation of the protected aminophenol with sodium hydride and coupling with the previously described p-toluenesulfonyloxymethane phosphonate in DMF (to yield compound XV) is followed by removal of the benzyloxycarbonyl protective group by transfer hydrogenation (to yield compound XVI). Conversion of the free amine to the isothiocyanate and condensation with ethyl 4-chloro-3-oxobutanoate to form the thiophene ring are directly analogous with synthesis of compound XII. Following the coupling of the thiophene ring with 3-hydroxybenzaldehyde, selective deprotection of the dimethyl phosphonate ester (XVII) is then accomplished with aqueous pyridine to produce compound XVIII.
Scheme 4:
Compound XVIII
The invention is illustrated by the following examples, which are not intended to be limiting in any way.
EXEMPLIFICATION Example 1 — Assay For Identifying Agents that Activate RNase L
The assay is based on fluorescence resonance energy transfer (FRET). The method includes recombinant human RNase L produced in insect cells, from a baculovirus vector, and purified by FPLC (Thakur CS, Xu Z, Wang Z, Novince Z, Silverman RIi. A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2",5' oligoadenylates. Methods MoI Med 2005;116:103-13). The cleavable RNA substrate is a 36-nucleotide synthetic oligoribonucleotide with a fluorophore (6-carboxyfluorescein, FAM) at the 5'-terminus and a quencher (black hole quencher-1, BHQl), at the 3'-terminus. The RNA sequence is from the intergenic region of the paramyxovirus, respiratory syncytial virus (RSV) genomic RNA. The RSV sequence was chosen because it contains several cleavage sites for RNase L (UU or UA) in an optimal context for cleavage. To demonstrate the effectiveness of the assay, RNA cleavage reactions were performed in 96-well black microtiter plates containing RNase L, the cleavable FRET RNA substrate and 2-5A. The EC50 is routinely obtained (concentration of activator to give 50% maximum activation) of 0.3 nM with authentic trimer 2-5A [p3A(2'p5'A)2] as the activator of RNase L (Fig. IA). The dephosphorylated trimer, A(2'p5'A)2, was unable to activate RNase L, consistent with prior findings (Fig. 1 A&D). Dong B, Xu L, Zhou A, Hassel BA, Lee X, Torrence PF, Silverman RH. Intrinsic molecular activities of the interferon-induced 2-5A-dependent RNase. J Biol Chem 1994;269(19): 14153-8. The inactive, dephosphorylated 2-5 A molecule is referred to as "core 2-5A". The signal- to-noise ratio was about 10:1 and the assay was very robust. There was no increase in the signal with time in reactions containing the RNA but lacking either RNase L or 2-5A.
Example 2 - Identification of RNase L Inhibitors
High throughput screening was performed as described in Example 1 on the ChemBridge DIVERset of 34,000 small molecules (ChemBridge Co., San Diego). Compounds providing at least 4-fold signals over background were chosen as potential positives for re-testing.
Seven "hits" were obtained (Fig. 2, compounds 1 to 7). The hits had molecular weights that range from 298 to 470 Da and were capable of activating
RNase L in micromolar range (ECso's between 22 and 99 ~M) (Figs. 1 and 2). The kinetics of RNA cleavage in the FRET assay show near maximal activation by pppA(2'p5'A)2 in 15 min, whereas compounds 1 and 2 required 60 to 90 min to achieve maximal level of RNA degradation (Fig. ID-F).
Other compounds related in structure to these activators were identified in
ChemBridge repository using a searchable database (http://www.hit21ead.com).
Two compounds related in structure to compound 1 , were either active (compounds 8-1 1) or inactive (compound 12) (Fig. 2). Example 3 — Compounds 1 and 2 Activate RNase L in Ribonuclease Assays with
Labeled Substrates
To verify that these compounds are in fact capable of activating RNase L, alternative, conventional ribonuclease assays were performed with two different P- labeled RNA substrates (Fig. 3A&B). In these assays, 25 μM of compound 1 (Fig. 3A, lanes 3&4), and 25 μM compound 2 (Fig. 3A, lanes 5&6) were incubated in the presence and absence of purified human RNase L with the synthetic RNA substrate GGACUUUUUUUCCCUUUUUUUCC-[32P]pCp (SEQ ID NO.: 1). RNase L activated by 2-5 A or compounds 1 or 2 cleaved the substrate on the 3' side of the UU dinucleotide sequence, consistent with our FRET assay findings.
RNase L activation by lead compounds 1 and 2 was further supported using a sequence specific substrate C7U2C12 (Fig. 3B) (SEQ ID NO.: 2). Compound 1 (25μM) (lanes 4&5), and compound 2 (25μM) (lanes 6&7) were separately incubated in the presence and absence of RNase L with the radiolabeled RNA substrate. RNase L activated by 2-5 A, compound 1 or compound 2 cleaved the substrate on the 3 '-side of the UU dinucleotide sequence. In the absence of activator no product band was detected.
RNase L dimerization is a prerequisite for the nuclease activation. To monitor dimerization of RNase L, protein cross-linking assays were performed (Fig. 3C). The oligomeric state of RNase L was determined in western blots probed with monoclonal antibody against RNase L. Monomer RNase L converted to dimer in the presence of 2-5 A, compound 1, or compound 2 (Fig. 3C). These data show that micromolar levels of compounds 1 & 2 activate RNase L and cause the enzyme to dimerize.
Example 4 — Compounds 1 and 2 Interact With the 2-5A Analog Binding Domain
Domain of RNase L
A 2-5A competition binding assay using surface plasmon resonance on a Biacore model 3000™ was used to determine if the activators interact with the 2-5 A binding domain of RNase L. 2-5 A analog used in these assays [p5'(A2'p)3A linked through its 2',3' terminal ribose to biotin] was generously provided for these efforts by Dr. H. Sawai (Gunma University, Japan). Streptavidin chips (Biacore Inc.) were pre-coated with 2-5A-biotin. Mixtures of RNase L (10 nM) and varying concentrations of compounds 1 or compound 2 or RNase L by itself were passed over the chips.
Sensograms were recorded and the maximum resonance units (Rmax) at equilibrium were plotted as a function of the compound concentrations using Bia- evaluation™ software (Fig. 4). A dose-dependent decrease in the resonance response occurred with either compound 1 or 2. The data indicate that these compounds compete with 2-5 A for RNase L binding. Analysis of the data indicated that the binding constants (KJ) for compounds 1 and 2 are 18μM and 12μM, respectively.
Example 5 — Compounds 1 and 2 Are Not Cytotoxic Based on Tetrazolium
Conversion Assay
Cytotoxicity of compounds 1 and 2 was evaluated by MTS (tetrazolium) conversion assays (Promega). Treatments with compound 1 at 50 ~M for 3 days reduced cell viability to 76.3% and 98.2% of control (untreated) levels for DU145 and HeLa cells, respectively. Treatments with compound 2 (also at 50 ~M for 3 d) reduced cell viability as a percentage of untreated cells to 95.2% and 86.5% for DU145 and HeLa cells, respectively. The results for DU145 cells are shown in Figure 5; and the results for HeIa M cells are shown in Figure 6. As can be seen from the results, these compounds lack significant cytotoxcity.
Example 6 — Compound 2 Shows Antiviral Activity Against Parainfluenza Virus 3,
Picornavirus and Encephalomyocarditis Virus To determine antiviral activity, cells were infected with a recombinant human parainfluenza virus 3 (HPIV3) in which green fluorescent protein (GFP) cDNA was inserted between the P and M genes (provided by collaborator A. Banerjee) (Fig. 7). The cell lines used are HeLa M cells which are deficient in RNase L or HeLa M cells stably expressing either wild type RNase L or a nuclease-dead mutant (R667A) RNase L (from a CMV promoter in vector pcDNAneo). Cells were infected at an MOI of 0.1 with HPIV3/GFP in serum free medium (DMEM) for Ih. Media was removed, cells were washed in PBS and complete media with 10% FBS in the absence or presence of 50 ~M compound 2 was added. At 24 h post-infection, cells were examined under an inverted fluorescence microscope. It is apparent that characteristic syncytia (green) were observed with HPIV3/GFP infection of both the treated and untreated RNase L-deficient HeLa M cells with vector alone or expressing mutant (R667A) RNase L. In contrast, compound 2 sharply inhibited virus growth and suppressed formation of syncytia in cells expressing the wild type RNase L. Fluorescence measurements indicated that compound 2 reduced viral growth by 8-fold in the wild type RNase L expressing cells, whereas there was only a 1.2-fold reduction in viral growth in the other two cell lines. In similar experiments, compound 1 also had antiviral activity. The antiviral activity of compound 2 was also obtained against the encephalomyocarditis virus (see Figure 8) and picomavirus (data not shown). Therefore, these compounds, which have low toxicity, could have general antiviral activity and are candidate antiviral drugs. Example 7 — The Disclosed Activators of RNase L Inhibit Smooth Muscle Cell Proliferation
The proliferation of the clonal cell line AlO (derived from the thoracic aorta of DBlX embryonic rat and possesses many of the properties characteristic of smooth muscle cells,) was determined using the colorimetric CellTiter 96® AQueOus Cell Proliferation Assay as described (Promega). This method uses the tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2H-tetrazolium, MTS] and phenazine methosulfate (PMS), an electron coupling reagent. Cells were seeded (3 x 104 cells/well) in 96 well culture plates and treated with different concentrations of the compounds for 24 h. CellTiter 96® AQUeous reagents (30% v/v dilution in PBS), 50 Φl, were added to each well. Plates were incubated at 37E C for 2 h and absorbance measured at 490 nm with a 96-well plate reader (Molecular Devices, model Spectra Max 340). Results demonstrate that smooth cell proliferation was inhibited thus indicating that these compounds may function as a new class of therapeutic agents for the prevention of restenosis. Compound 1 was tested. Example 8 - Compound 2 Shows Antiviral Activity Against Vaccinia Virus (Strain: Western Reserve (WR)), a DNA virus in the pox virus family.
Experimental Protocol:
Virus strain: Western Reserve (WR) Cells:
Immortalized mouse embryonic fibroblasts (MEFs) were grown in RPMI supplemented with 10% FBS and p/s. Baby hamster kidney (BHK21) cells and african green monkey kidney cells (BSC40) were grown in Dulbecco's modified
Eagle medium supplemented with 10% fetal bovine serum, p/s and 1-glu. Titer: BHK21 (baby hamster kidney cells) for plaque assays
MOI: Vaccinia Virus (Western Reserve) 5 PFU using no media serum for infection (virus stock: lxl09PFU/ml)
Compounds : compound 2 at 0, 25 and 5OuM in triplicates.
Infection: 24h post infection samples were collected from each sample. Method:
MEF (RNase L)RL+/+ , MEF (RNase L) RL 7" and BSC 40 cells were plated in 6 well plates, 80 — 85% confluent cells were infected with Vaccinia Virus (WR) at
5PFU/ml using serum free media. After 45min, cells were washed with PBS and cells re-fed with fresh media with compound 2. After 24hr post infection media was removed, the cells were scraped in PBS and frozen and thawed twice before the titers of the viruses were determined on BHK21 cells, the indicator cell line.
Plaque assay:
BHK21 cells were plated in 12 well plates, complete monolayer of the cells were infected with different dilutions of virus using serum free media. After 45min post infection, media was removed and the cells washed twice with PBS and replaced with Agar media [mix of 2% agarose + (2x MEM + 20%FBS)], after two days second layer of agar media was added with 0.05% neutral red in order to count the plaques.
The results are shown in Figures 9, 10, 11, and 12 and are described in the brief description of the figures section. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

What is claimed is: 1. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein:
Ring A and Ring B are optionally and independently substituted at any one or more substitutable ring carbon atoms;
Y is CH, N or N+-O";
Z1 and Z2 are independently O or S;
Z3 is CR1 or N;
R1 is -H, -C(O)H, -C(O)R20, -C(O)OR30 or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR30, -OC(O)H and -OC(O)R20 or R1 is a group represented by the following structural formula:
R2 is -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20; each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R ,30 ; is C1-C3 alkyl, C1-C3 haloalkyl or a group represented by a structural formula selected from:
2. The pharm aceutical composition of Claim 1 wherein Z1 is O and Z2 is S.
3. The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof. 4. The pharmaceutical composition of Claim 1 whereiin.
Ring A is substituted at any one or more substitulable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or Ring A is optionally substituted with a group represented by the following structural formula:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40, -OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21; each R21 is independently H, C1-C3 alkyl or C1-C3 haloalkyl R40 is -COOH, -PO3H2, -SO3H5 -PO2H or -SO2H.
5. The pharmaceutical composition of Claim 4 whereiin:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R 21 . each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
6. The pharmaceutical composition of Claim 4 or 5 wherein each R20 is independently C1-C3 alkyl, each R21 is independently C1-C3 alkyl, each R30 is independently C1-C3 alkyl and R2 is -H.
The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof.
8. The pharmaceutical composition of Claim 7 wherein:
Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or with a group represented by the following structural formula:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R >40 " or a C1-C3 alkyl group substituted with hydroxyl, -OR 21 keto, -C(O)OR .2"1, -OC(O)H or -OC(O)R » 2"1.; each'R21 is independently C1-C3 alkyl or C1 -C3 haloalkyl; and
R ,440U is -COOH, -PO3H2, -SO3H5 -PO2H or -SO2H.
9. The pharmaceutical composition of Claim 8 wherein each R is independently C1-C3 alkyl, and R2 is -H.
10. The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof.
11. The pharmaceutical composition of Claim 10 wherein:
Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or with a group represented by the following structural formula:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR2', -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 ; each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.
12. The pharmaceutical composition of Claim 11 wherein each R21 is independently C1-C3 alkyl and R2 is -H.
13. The pharmaceutical composition of Claim 1 wherein the compound is represented by a structural formula selected from:
or a pharmaceutically acceptable salt thereof.
14. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein: Z3 and Z4 are independently O or S; Ring C and Ring D are optionally and independently substituted at any one or more substitutable ring carbon atoms;
R3 is -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20; and each R20 is independently C1-C3 alkyl or haloalkyl.
15. The pharmaceutical composition of Claim 14 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof.
16. The pharmaceutical composition of Claim 15 wherein Ring C is optionally substituted at any one or more substitutable ring carbon atoms with C1-C3 alkyl, halogen, =O, hydroxyl or C1-C3 alkoxy.
17. The pharmaceutical composition of Claim 16 wherein Ring D is optionally substituted at any one or more substitutable carbon atoms with halogen, Cl- C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 and each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
18. The pharmaceutical composition of Claim 17 wherein R3 is -H.
19. The pharmaceutical composition of Claim 18 wherein Ring C is unsubstituted.
20. The pharmaceutical composition of Claim 14 wherein the compound is represented by a structural formula selected from:
or a pharmaceutically acceptable salt thereof.
21. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein:
Z5 and Z6 are independently O or S;
Ring E and Ring F are optionally and independently substituted at any one or more substitutable ring carbon atoms;
R6 is -H or a Cl -C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R7 and R8 are independently -H, a C1-C5 alkyl group or a C1-C5 haloalkyl group; and each R20 is independently C1-C3 alkyl or haloalkyl.
22. The pharmaceutical composition of Claim 21 wherein Z5 is S and Z6 is O.
23. The pharmaceutical composition of Claim 22 wherein Ring E and Ring F are optionally and independently substituted at any one or more substitutable carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21; and each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
24. The pharmaceutical composition of Claim 23 wherein R is — H.
25. The pharmaceutical composition of Claim 24 wherein R7 and R8 are independently — H or a methyl.
26. The pharmaceutical composition of Claim 21 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof.
27. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein:
X1 and X2 are independently CH2, NH or O;
X3 is -O-C(O)-, -O-C(S)-, -S-C(O)-, -S-C(S)-, -C(O)-, C(S)-, -CH2-, -CH(CH3)-, -NHC(O)-, -C(O)NH-, -NHC(S)- or -C(S)NH-;
Z8 and Z9 are independently S or O;
Ring G is optionally substituted at any one or more substitutable ring carbon atoms; R9 is a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR , nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R10 and R11 are independently — H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H5 -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R12 is -H; a C1-C5 alkyl group optionally substituted with one or more groups represented by R21; a monocyclic aromatic group optionally substituted at any one or more substitutable ring carbon atoms with a group represented by R22; or a monocyclic C1-C3 aralkyl group optionally substituted at any one or more substitutable ring carbon atoms with R23; each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; each R21 is independently halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20; each R22 and R23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or -OC(O)R24 and
R24 is C1-C3 alkyl or C1-C3 haloalkyl.
28. The pharmaceutical composition of Claim 27 wherein R12 is — H; a C1-C5 alkyl group optionally substituted with a group represented by R ; a phenyl group optionally substituted with a group represented by R22; or a C1-C3 phenalkyl group optionally substituted at any one or more substitutable ring carbon atoms with R23.
29. The pharmaceutical composition of Claim 28 wherein the compound is represented by the following structural formula.
or a pharmaceutically acceptable salt thereof.
30. The pharmaceutical composition of Claim 29 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein X is -O-C(O)- or -C(O)-.
31. The pharmaceutical composition of Claim 30 wherein wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof.
32. The pharmaceutical composition of Claim 31 wherein Ring G is optionally substituted at any one or more ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR25, -C(O)H, -C(O)R25, -C(O)OR25, -OC(O)H5 -OC(O)R25 or C1-C3 alkyl substituted with hydroxyl, -OR25, keto, -C(O)OR25, -OC(O)H or -OC(O)R25 and each R25 is independently C1-C3 alkyl or C1-C3 haloalkyl.
33. The pharmaceutical composition of Claim 32 wherein R9 is a C1-C5 alkyl group optionally substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy.
34. The pharmaceutical composition of Claim 33 wherein R12 is-H; an alkyl group optionally substituted with a group represented by R21; or a benzyl group optionally substituted at any one or more substitutable ring carbon atoms with R23;
R21 halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy; each R23 is independently Cl -C3 alkyl, Cl -C3 haloalkyl, nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or -OC(O)R24.
35. The pharmaceutical composition of Claim 34 wherein R10 is methyl, halomethyl or hydroxymethyl.
36. The pharmaceutical composition of Claim 35 wherein R9 is C1-C5 alkyl; R10 is -C(Cl)3; and R12 is C1-C5 alkyl or benzyl.
37. The pharmaceutical composition of Claim 27 wherein the compound is represented by a structural formula selected from:
or a pharmaceutically acceptable salt thereof.
38. A method of treating a subject with a viral infection, comprising administering an effective amount of the pharmaceutical composition of any one of Claims 1-37 to the subject.
39. The method of Claim 38 wherein the viral infection is caused by a virus with a single-stranded RNA(s) genome.
40. The method of Claim 38 wherein the virus is orthomyxoviruses (e.g. influenza viruses), paramyxoviruses (e.g. respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses (e-g- rubella virus and eastern equine encephalitis virus), picornaviruses (e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift Valley fever virus & Hantavirus), retroviruses (e.g. the gammaretrovirus XMRV and the lentiviruses HIV-I & -2), fϊloviruses (e.g. Ebolavirus, hemorrhagic fever virus) or hepatitis B virus (a DNA virus with a genomic RNA intermediate).
41. The method of Claim 38 wherein the viral infection is caused by a virus with a DNA genome.
42. The method of Claim 41 wherein the virus is human papillomavirus, herpes simplex virus- 1 and -2, cytomegalovirus, or human herpesvirus-8.
43. The method of Claim 41 wherein the virus is Variola virus (smallpox virus),
Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6, human herpesvirus
7, Bl 9 parvovirus, adeno-associated virus, BK virus, and JC virus, human papillomavirus, herpes simplex virus- 1 and -2, cytomegalovirus, or human herpesvirus-8.
44. A method for treating a subject with cancer comprising administering to the subject an effective amount of the pharmaceutical composition of any one of Claims 1-37.
45. The method of Claim 44 wherein the cancer is prostate cancer, ovarian cancer, brain cancer or bone cancer.
46. A method for treating restenosis in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of any one of Claims 1-37.
47. A compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein:
Ring A and Ring B are optionally and independently substituted at any one or more substitutable ring carbon atoms;
Z1 and Z2 are independently O or S;
Z3 is CR1 or N;
R1 is -H, -C(O)H, -C(O)R20, -C(O)OR30 or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR30, -OC(O)H and -OC(O)R20 or R1 is a group represented by the following structural formula:
R2 is -H or a C 1 -C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20; each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R30 is C1-C3 alkyl, C 1-C3 haloalkyl or a group represented by a structural formula selected from:
provided that the compound is not represented by a structural form ula selected from :
or a pharmaceutically acceptable salt thereof.
48. The compound of Claim 47 wherein Z1 is O and Z2 is S.
49. The compound of Claim 48 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof.
50. The compound of Claim 47 whereiin:
Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or Ring A is optionally substituted with a group represented by the following structural formula:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40, -OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21; each R21 is independently H, C1-C3 alkyl or C1-C3 haloalkyl; and
R ,4w0 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.
51. The compound of Cl aim 5 O whereiin :
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R 21. each R >21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
52. The compound of Claim 50 or 51 wherein each R20 is independently Cl -C3 alkyl, each R21 is independently C1-C3 alkyl, each R30 is independently Cl-
C3 alkyl and R2 is -H.
53. The compound of Claim 48 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof.
54. The compound of Claim 53 wherein:
Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or with a group represented by the following structural formula:
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21; each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R40 is -COOH, -PO3H2, -SO3H, -PO2H Or-SO2H.
55. The compound of Claim 54 wherein each R21 is independently C1-C3 alkyl, and R2 is -H.
56. The compound of Claim 48 wherein the compound is represented by the following Structural Formula:
or a pharmaceutically acceptable salt thereof.
57. The compound of Claim 56 wherein:
Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or with a group represented by the following structural formula:
;
Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CHj)3R40, -CH2OCH2R40 or a Cl -C3 alkyl group substituted with hydroxyl, -OR21 , keto, -C(O)OR21, -OC(O)H or -OC(O)R21 ; each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R40 is -COOH, -PO3H2, -SO3H, -PO2H Or-SO2H.
58. The compound of Claim 57 wherein each R21 is independently C1-C3 alkyl and R2 is -H.
59. A compound represented by the following structural formula: or a pharmaceutically acceptable salt thereof, wherein:
Z3 and Z4 are independently O or S;
Ring C and Ring D are optionally and independently substituted at any one or more substitutable ring carbon atoms;
R3 is -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20; and each R20 is independently C1-C3 alkyl or haloalkyl, provided that the compound is not represented by a structural formula selected from:
and
or a pharmaceutically acceptable salt thereof.
60. The compound of Claim 59 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof.
61. The compound of Claim 60 wherein Ring C is optionally substituted at any one or more substitutable ring carbon atoms with C1-C3 alkyl, halogen, =O, hydroxyl or C 1 -C3 alkoxy.
62. The compound of Claim 61 wherein Ring D is optionally substituted at any one or more substitutable carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 and each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
63. The compound of Claim 62 wherein R3 is — H.
64. The compound of Claim 63 wherein Ring C is unsubstituted.
65. A compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein:
Z5 and Z6 are independently O or S;
Ring E and Ring F are optionally and independently substituted at any one or more substitutable ring carbon atoms;
R6 is — H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R7 and R are independently — H, a C1-C5 alkyl group or a C1-C5 haloalkyl group; and each R20 is independently C1-C3 alkyl or haloalkyl, provided that the compound is represented by a structural formula other than:
or a pharmaceutically acceptable salt thereof.
66. The compound of Claim 65 wherein Z5 is S and Z6 is O.
67. The compound of Claim 66 wherein Ring E and Ring F are optionally and independently substituted at any one or more substitutable carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21; and each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
68. The compound of Claim 67 wherein R6 is -H.
69. The compound of Claim 68 wherein R7 and R8 are independently — H or a methyl.
70. A compound represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein: X1 and X2 are independently CH2, NH or O;
X3 is -O-C(O)-, -O-C(S)-, -S-C(O)-, -S-C(S)-, -C(O)-, C(S)-, -CH2-, -CH(CH3)-, -NHC(O)-, -C(O)NH-, -NHC(S)- or -C(S)NH-;
Z and Z are independently S or O;
Ring G is optionally substituted at any one or more substitutable ring carbon atoms;
R9 is a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20; R10 and R1' are independently -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR , nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R12 is -H; a C1-C5 alkyl group optionally substituted with one or more groups represented by R21; a monocyclic aromatic group optionally substituted at any one or more substitutable ring carbon atoms with a group represented by R22; or a monocyclic Cl -C3 aralkyl group optionally substituted at any one or more substitutable ring carbon atoms with R23; each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; each R21 is independently halogen, hydroxyl, -OR20, nitro, cyano,
-C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20; each R22 and R23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or -OC(O)R24 and
R24 is C1-C3 alkyl or C1-C3 haloalkyl, provided that the compound is not represented by a structural formula selected from:
or a pharmaceutically acceptable salt thereof.
The compound of Claim 70 wherein R12 is -H; a C 1 -C5 alkyl group optionally substituted with a group represented by R21; a phenyl group optionally substituted with a group represented by R22; or a C1-C3 phenalkyl group optionally substituted at any one or more substitutable ring carbon atoms with R23.
72. The compound of Claim 71 wherein the compound is represented by the following structural formula.
or a pharmaceutically acceptable salt thereof.
73. The compound of Claim 72 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof, wherein X3 is -O-C(O)- or -C(O)-.
74. The compound of Claim 73 wherein the compound is represented by the following structural formula:
or a pharmaceutically acceptable salt thereof.
75. The compound of Claim 74 wherein Ring G is optionally substituted at any one or more ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR25, -C(O)H, -C(O)R25, -C(O)OR25, -OC(O)H, -OC(O)R25 or C1-C3 alkyl substituted with hydroxyl, -OR25, keto, -C(O)OR25, -OC(O)H or -OC(O)R25 and each R25 is independently C1-C3 alkyl or C1-C3 haloalkyl.
76. The compound of Claim 75 wherein R9 is a C1-C5 alkyl group optionally substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy.
77. The compound of Claim 76 wherein R12 is— H; an alkyl group optionally substituted with a group represented by R2'; or a benzyl group optionally substituted at any one or more substitutable ring carbon atoms with R23;
R21 halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy; each R23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or -OC(O)R24.
78. The compound of Claim 77 wherein R10 is methyl, halomethyl or hydroxymethyl.
79. The compound of Claim 78 wherein R9 is Cl -C5 alkyl; R10 is -C(Cl)3; and R12 is C1-C5 alkyl or benzyl.
EP07755981A 2006-04-25 2007-04-25 Anti-viral agents that activate rnase l Withdrawn EP2016062A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US79506906P 2006-04-25 2006-04-25
PCT/US2007/009959 WO2007127212A2 (en) 2006-04-25 2007-04-25 Anti-viral agents that activate rnase l

Publications (1)

Publication Number Publication Date
EP2016062A2 true EP2016062A2 (en) 2009-01-21

Family

ID=38374152

Family Applications (1)

Application Number Title Priority Date Filing Date
EP07755981A Withdrawn EP2016062A2 (en) 2006-04-25 2007-04-25 Anti-viral agents that activate rnase l

Country Status (10)

Country Link
EP (1) EP2016062A2 (en)
JP (1) JP2009536622A (en)
KR (1) KR20090007609A (en)
CN (1) CN101460471A (en)
AU (1) AU2007243403A1 (en)
CA (1) CA2650028A1 (en)
IL (1) IL194890A0 (en)
MX (1) MX2008013668A (en)
RU (1) RU2008146422A (en)
WO (1) WO2007127212A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009123588A1 (en) * 2008-04-01 2009-10-08 The Cleveland Clinic Foundation Amides of 3, 5-substituted-is0xaz0le-4-carb0xylic acids for the treatment of viral infections, cancer and restenosis
US8569512B2 (en) * 2009-03-23 2013-10-29 Merck Sharp & Dohme Corp. P2X3 receptor antagonists for treatment of pain
WO2013020164A1 (en) * 2011-08-05 2013-02-14 Biota Scientific Management Pty Ltd Compounds for treating respiratory syncytial virus infections
RU2487708C1 (en) * 2012-03-12 2013-07-20 Государственное бюджетное образовательное учреждение высшего профессионального образования "Уральская государственная медицинская академия Министерства здравоохранения и социального развития Российской Федерации" (ГБОУ ВПО УГМА Минздравсоцразвития России) Method of treating parvoviral infection b19 in infants
TWI472518B (en) * 2014-01-02 2015-02-11 Univ China Medical Use of derivative of aniline in anti-virus application
CA3042849A1 (en) * 2016-11-04 2018-05-11 Carna Biosciences, Inc. Furanone derivates and methods of use thereof
WO2018151810A1 (en) 2017-02-17 2018-08-23 The Scripps Research Institute Defining rna-small molecule affinity landscapes enables design of a small molecular inhibitor of an oncogenic non-coding rna
CN109745311B (en) * 2019-02-22 2021-12-17 北京大学深圳研究生院 Application of RNase L enzyme inhibitor
CN112107679A (en) * 2020-09-28 2020-12-22 武汉愔紫生物科技有限公司 Application of macromolecular protein in anti-RNA virus disinfectant
CN112088903A (en) * 2020-09-28 2020-12-18 武汉愔紫生物科技有限公司 Application of macromolecular protein in antibacterial and antiviral disinfectant

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100579978C (en) * 2002-11-22 2010-01-13 史密丝克莱恩比彻姆公司 compound
US20050038051A1 (en) * 2003-06-09 2005-02-17 Jodi Nunnari Novel molecules for regulating cell death
US20050042213A1 (en) * 2003-08-14 2005-02-24 Insight Biopharmaceuticals Ltd. Methods and pharmaceutical compositions for modulating heparanase activation and uses thereof
WO2005051318A2 (en) * 2003-11-24 2005-06-09 Viropharma Incorporated Compounds, compositions and methods for treatment and prophylaxis of hepatitis c viral infections and associated diseases
WO2005082363A1 (en) * 2004-02-20 2005-09-09 Board Of Regents, The University Of Texas System Thiazolone compounds for treatment of cancer
EP1718642A4 (en) * 2004-02-25 2010-11-24 Glaxosmithkline Llc Novel chemical compounds

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007127212A2 *

Also Published As

Publication number Publication date
JP2009536622A (en) 2009-10-15
KR20090007609A (en) 2009-01-19
IL194890A0 (en) 2009-08-03
CA2650028A1 (en) 2007-11-08
WO2007127212A3 (en) 2008-03-27
MX2008013668A (en) 2009-01-27
AU2007243403A1 (en) 2007-11-08
RU2008146422A (en) 2010-05-27
WO2007127212A2 (en) 2007-11-08
CN101460471A (en) 2009-06-17

Similar Documents

Publication Publication Date Title
WO2007127212A2 (en) Anti-viral agents that activate rnase l
US10640492B2 (en) Tubulin inhibitor
JP2003525200A (en) Diketoacid derivatives as polymerase inhibitors
WO2022107745A1 (en) Therapeutic agent or prophylactic agent for covid-19
KR20110137941A (en) Novel thiourea or urea derivative, preparation method thereof and pharmaceutical composition for preventing or treating AIDS containing the same as an active ingredient
CN107200716B (en) Benzoxazine compound and preparation method and application thereof
CN111249283A (en) Pyrimidine derivatives having anticancer effect
Zhan et al. Arylazolyl (azinyl) thioacetanilide. Part 9: Synthesis and biological investigation of thiazolylthioacetamides derivatives as a novel class of potential antiviral agents
CN108283631B (en) Inhibitor of enterovirus and application thereof
CN113402414A (en) Benzoic acid derivative and preparation method and pharmaceutical application thereof
CN113912594B (en) Nitrothiophene methylamine optical isomer and medical application thereof
CN103183722B (en) Glyoxalase I inhibitor, preparation method and medical application thereof
US9428496B2 (en) Thiazolamine derivative and use thereof as anti-picornaviral infection medicament
CN111393421B (en) Butenolactone derivatives and preparation method and application thereof
CN108774161B (en) Preparation and application of six PARP1 inhibitors
CN119528841B (en) Capsid inhibitor and its preparation method and use
EP4635488A1 (en) Pharmaceutical composition for preventing or treating bone diseases
US9447047B2 (en) Inhibitors of protein phosphatase-1 and uses thereof
US20240376057A1 (en) 2,4-dioxo-1,2,3,4-tetrahydropyrimidine derivatives and their use in the treatment of tumors
US20240082235A1 (en) Method for treating or inhibiting cytomegalovirus infection using small molecules targeting protein phosphatase 1
CN121318778A (en) terephthaloyl compounds, their preparation methods, pharmaceutical compositions and applications
WO2025121418A1 (en) Hepatitis c virus inhibitor
WO2009123588A1 (en) Amides of 3, 5-substituted-is0xaz0le-4-carb0xylic acids for the treatment of viral infections, cancer and restenosis
CN111269167A (en) N-acyl sulfonamide salt FBPase inhibitor, preparation method, pharmaceutical composition and application thereof
CN114805233A (en) Phenyl tetrazole type XOR inhibitor and preparation method and application thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20081125

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NORTHERN ARIZONA UNIVERSITY

Owner name: THE CLEVELAND CLINIC FOUNDATION

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1122023

Country of ref document: HK

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20100412

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100824

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1122023

Country of ref document: HK