AU2007243403A1

AU2007243403A1 - Anti-viral agents that activate RNase L

Info

Publication number: AU2007243403A1
Application number: AU2007243403A
Authority: AU
Inventors: Paula Francom; Babal Kant Jha; Robert Silverman; Paul Torrence
Original assignee: Cleveland Clinic Foundation; Northern Arizona University
Current assignee: Cleveland Clinic Foundation; Northern Arizona University
Priority date: 2006-04-25
Filing date: 2007-04-25
Publication date: 2007-11-08
Also published as: WO2007127212A2; WO2007127212A3; JP2009536622A; CA2650028A1; CN101460471A; RU2008146422A; IL194890A0; MX2008013668A; KR20090007609A; EP2016062A2

Description

WO 2007/127212 PCT/US2007/009959 -1 ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L GOVERNMENT SUPPORT The invention was supported, in whole or in part, by a grant NIH (NCI) IR01 CA044059-21 from National Institutes of Health. The Government has 5 certain rights in the invention. RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 60/795,069, filed April 25, 2006, the entire teachings of which are incorporated herein by reference. 10 BACKGROUND OF THE INVENTION Preclinical studies on RNase L, an antiviral enzyme in the interferon (IFN) system, have suggested that it is an important target for cancer therapeutics and antiviral agents (Adah SA, Bayly SF, Cramer H, Silverman RH, Torrence PF. (Curr Med Chem. 2001 Aug;8(10):1189-212). For example, the hereditary prostate 15 cancer 1 (HPC1) susceptibility locus was recently mapped to the RNase L gene (Carpten J, Nupponen N, Isaacs S, Sood R, Robbins C, Xu J, Faruque M, Moses T, Ewing C, Gillanders E, Hu P, Bujnovszky P, Makalwska I, Baffoe-Bonni A, Faith D, Smith J, Stepah D, Wiley K, Brownstein M, Gildea D, Kelly B, Jenkins R, Hostetter G, Matikainen M, Schleutker J, Klinger K, Conners T, Xiang Y, Wang Z, 20 Demarzo A, Papdopoulos N, Kallioniemi O-P, Burk R, Meyers D, Gronberg H, Meltzer P, Silverman R, Bailey-Wilson J, Walsh P, Isaacs W, Trent J. Nature Genetics 2002, Jan 22). Also, the gene that confers resistance to flaviviruses including West Nile virus was mapped to a gene in the RNase L pathway (OAS 1 b) (Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA. Proc 25 Natl Acad Sci USA. 2002 Jul 9;99(14):9322-7). In nature, RNase L is activated during the interferon antiviral response by small, unusual oligoadenylates with 2',5'- WO 2007/127212 PCT/US2007/009959 -2 intemucleotide linkages (known as "2-5A") (Kerr IM, Brown RE Proc Nail AcadSci USA. 1978 Jan;75(1):256-60; Zhou A, Hassel BA, Silverman RH. Cell. 1993 Mar 12;72(5);753-65). In addition, it has been previously demonstrated that RNase L participates in the anti-cell proliferation activity of IFN (Hassel BA, Zhou 5 A, Sotomayor C, Maran A, Silverman RH. EMBO J 1993 Aug;12(8):3297-304). 2-5A induces through RNase L the degradation of ribosomal RNA (rRNA) and messenger RNA (mRNA), thereby reducing levels of protein synthesis, properties that if applied to aortic smooth muscle cells, cold prevent restenosis following angioplasty. 2-5A, however, has undesirable properties for a therapeutic agent in 10 that: 1) it is unstable in serum and in cells due to the action of phosphodiesterases and phosphatases; and 2) it is an intracellular mediator which does not transit the cell membranes. Thus, there is a need for new activators of RNase L for clinical use. SUMMARY OF THE INVENTION The invention is based on the discovery of a number of compounds which 15 activate RNase L (see Example 3) (hereinafter the "disclosed RNase L activators"). These RNase L activators have antiviral activity (see Example 6) , including against Parainfluenza Virus 3 (HPIV3), Picomavirus and Encephalomyocarditis Virus (EMCV). The disclosed activators of RNase L also inhibit smooth muscle cell proliferation in vitro (see Example 7), and therefore have utility in treating 20 restenosis. It has also unexpectedly been found that the disclose RNase activators are not cytotoxic (Example 5). Based on these discoveries, novel RNase L activators, pharmaceutical compositions comprising these RNase L activators and methods of treatment with these RNase L activators are disclosed herein. The disclosed RNase activators, pharmaceutical compositions comprising the 25 same and methods of treating using the same are described with particularity in the claims. BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1F are graphs showing the dose-response and kinetics of RNase L activation versus concentration in -M (Figures IA-1 C) or versus time in minutes 30 (Figures 1D-1E) with 2-5A or small molecule activators. Assays were by the RNase WO 2007/127212 PCT/US2007/009959 -3 L FRET method and were performed at 22 0 C. (A, D) ppp(A2'p5'A)2; (B, E) Compound 1; and (C,F) Compound 2. Figure 2 shows the structures of small molecule activators of RNase L (Compounds 1-12) and their EC 50 concentrations required for 50% degradation in 5 the RNA FRET probe. NA means no activity. Figure 3 shows (A,B) Alternative ribonuclease assays and (C) RNase L dimerization assays for 2-5A, compound 1 (C-1) and compound 2 (C-2). (A) 25 nM trimeric 2-5A (lanes 1, 2), 25 -M C-1 (lanes 3, 4), 25 -. M C-2 (lanes 5, 6) with or without 25nM RNase L in presence of the RNA substrate, 10 GGACUUUUUUUCCCUUUUUUUCC[ 32 P]pCp, at 22 0 C for 30 min. (B) 25nM trimeric 2-5A (lanes 2, 3), 25 --M C-I (lanes 4, 5), 25 -M C-2 (lanes 6, 7) was incubated with or without 25nM RNase L and RNA, CTU 2 Ci 2 -[1 32 P]pCp, at 22 0 C for 30 min. The cleaved RNAs were separated in 20% acrylamide/7 M urea/TBE sequencing gels. (C) Covalent cross-linking of RNase L by dimethyl suberimidate 15 (DMS). DMS was incubated with RNase L and trimer 2-5A (lanes 2 to 5), C-1 (lanes 6 to 9), or C-2 (lanes 10 to 13). After SDS-polyacrylamide gel electrophoresis, the proteins were transferred to nitrocellulose and probed with monoclonal antibody against RNase L. Figures 4A and 4B are graphs showing the displacement of 2-5A-biotin 20 binding with RNase L by compounds 1 and 2 as determined by surface plasmon resonance. Biotinylated 2-5A was immobilized on streptavidin biosensor chip (Biacore). RNase L (10 nM) in presence of varying concentration of either compound I (A) or compound 2 (B) was allowed to flow over the chip at a rate of 20 gl/min for five min. Sensograms were recorded and analyzed using Bia 25 evaluationTM software. Rmax in each case was plotted against the increasing concentration of the compound in -M. Figures 5A-5C are graphs showing the cytotoxicity of Compounds 1 and 2 to DUI 25 cells in an MTS conversion assay. The cytoxicity is measured by the absorbance at 490 nanometers versus concentration in -- M on Day 1 (Figure 5A), WO 2007/127212 PCT/US2007/009959 -4 Day 2 (Figure 5B) and Day 3 (Figure 5C). The results for Compound I are represented with blue; and the results for Compound 2 are represented with red. Figures 6A-6B are graphs showing the cytotoxicity of Compounds 1 and 2 to Hela M cells in an MTS conversion assay. The cytoxicity is measured by the 5 absorbance at 490 nanometers versus concentration in -M on Day 1. The results for Compound 1 are represented with blue; and the results for Compound 2 are represented with red. Figure 6A shows results for Hela M cells expressing RNase L; Figure 6B shows results for Hela M cells expressing a nuclease-dead mutant of RNase L. 10 Figure 7 shows photographs under inverted fluorescence microscope showing that Compound 2 suppresses replication of HPIV3/GFP. HeLa M cells deficient in RNase L were used as empty vector control cells, expressing wild type RNase L or in expressing a nuclease-dead mutant (R667A) RNase L. Pictures were captured using an inverted fluorescence microscope. 15 Figure 8 is a bar graph showing the antiviral effect of compound 2 at varying concentrations in -M against encephalomyocardutus virus (EMCV), as measured by the number of plagues x 10 7. Figure 9 includes a bar graph showing the growth of MEF RL* ' cells grown with 0, 25, and 50 tM of Compound 2. The bar graph shows the percentage of viral 20 plaques obtained as compared to the control (0 jtM compound 2, 100% = 2.5 x 104 PFU/mL). Increasing the concentration of compound 2 decreased the appearance of viral yield as determined by the plaque assay. Directly under each compound 2 concentration is the corresponding agar plate, stained with neutral red. Again, the plates indicate the decreased viral yield with increasing compound 2' concentration 25 as determined by the plaque assay. Figure 10 is a bar graph showing the percentage of viral plaques obtained for MEF RL + + , BSC 40, and MEF RL -'- cells grown in the absence or presence of compound 2. Compound 2 inhibited the viral titer for MEF RL

+

'

+ and BSC 40 cells. Cells lacking the RNase L gene were resistant to compound 2. (Untreated controls 30 (0 pM compound 2 added) in PFU/mL counts at 100%: MEF RL+/+: 2.5 x 10 4 ; BSC 40:2.5 x 10 4 ; and MEF RL -/-: 3.5 x 104).

WO 2007/127212 PCT/US2007/009959 -5 Figure 11 is a photograph of treated (50 pM compound 2) and untreated ( 0 pM compound 2 added) MEF RL

+

'

+ cells on agar plates stained with neutral red. Presence of compound 2 resulted in the decreased viral plaque count. Figure 12: Table containing the actual viral plaque counts as determined by 5 the plaque assay for both MEF RL

+

' and MEF RL-' cells. Viral yield in MEF RIL + + cells decreased in the presence of compound 2. Compound 2 did not decrease viral yield in MEF RL

-

- cells. The viral dilution indicate that a 10-fold viral dilution resulted in a 10-fold decrease viral plaque count. 10 DETAILED DESCRIPTION OF THE INVENTION A "subject" is preferably a human but can also be a veterinary animal, farm animal or laboratory animal in need of treatment for a viral infection, cancer or restensosis. Viral infections which can be treated with the disclosed RNase L activators 15 include viruses with single-stranded RNA(s) for their genome. Examples include orthomyxoviruses (e.g. influenza viruses), paramrnyxoviruses (e.g. respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses (e.g. rubella virus and eastern equine encephalitis virus), picornaviruses (e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue .20 virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift Valley fever virus & Hantavirus), retroviruses (e.g. the gammaretrovirus XMRV and the lentiviruses HIV-1 & -2), filoviruses (e.g. Ebolavirus, hemorrhagic fever virus) or hepatitis B virus (a DNA virus with a genomic RNA intermediate). The disclosed RNase L activators can also be used to treat infections from 25 certain DNA viruses, including human papillomavirus, herpes simplex virus-1 and 2, cytomegalovirus, and human herpesvirus-8. Additionally, the disclosed RNase L activators can also be used to treat infections from certain DNA viruses including Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6, human 30 herpesvirus 7, B19 parvovirus, adeno-associated virus, BK virus, and JC virus as well.

WO 2007/127212 PCT/US2007/009959 -6 Transfection of PC3 or DU145 cells with 2-5A causes apoptosis (Xiang Y, Wang Z, Murakami J, Plunmmer S, Klein EA, Carpten JD, Trent JM, Isaacs WB, Casey G, Silverman RH. Cancer Res. 2003 Oct 15; 63(20):6795-801). Both DU145 and PC3, cell lines derived from metastatic brain and bone prostate cancer 5 cases respectively, are wild type for RNase L. In addition, 2-5A transfection causes caspase-dependent apoptosis in human ovarian carcinoma cells through a mitochondrial pathway (Rusch L, Zhou A, Silverman RH. JInterferon Cytokine Res. 2000 Dec;20(12):1091-100). Furthermore, 2-5A linked to antisense against telomerase RNA caused apoptosis and anti-tumor activities against DU145 tumors 10 in nude mice (Kondo Y, Koga S, Komata T, Kondo S. Oncogene. 2000 Apr 27;19(18):2205-11). Based on the foregoing, the disclosed activators of RNase L can be used to treat cancers. Examples of cancers which can be treated with the disclosed RNase L activators include, but are not limited to, human sarcomas and carcinomas, e.g., 15 fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell 20 carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder 25 carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendrogliomna, meningioma, melanoma, neuroblastoma and retinoblastoma. The disclosed RNase L activators are commonly used to treat prostate cancer, ovarian cancer, brain cancer or bone cancer. 30 Restenosis is a condition which can develop in blood vessels which have undergone coronary procedures or peripheral procedures with PTCA balloon catheters (e.g. percutaneous transluminal angioplasty). Restenosis is the WO 2007/127212 PCT/US2007/009959 -7 development of scar tissue from about three to six months after the procedure and results in narrowing of the blood vessel. Restenosis is caused excessive smooth muscle proliferation. Because the disclosed RNase L activators inhibit smooth muscle proliferation, it is believed that these compounds can be used to inhibit, treat 5 and/or prevent restenosis. The term "alkyl" as used herein means saturated straight-chain or branched hydrocarbons. "Haloalkyl" is an alkyl substituted with one or more halogens. The term "halogen" means F, Cl, Br or I. Preferably the halogen in a haloalkyl or haloalkoxy is F. 10 The term "aromatic group" used alone or as part of a larger moiety as in "aralkyl", includes carbocyclic aromatic rings and heteroaryl rings. The term "aromatic group" may be used interchangeably with the terms "aryl", "aryl ring" "aromatic ring", "aryl group" and "aromatic group". "Aralkyl" is an alkyl group substituted with an aromatic group. "Phenalkyl" is an alkyl group substituted with a 15 phenyl group. A "monocyclic aromatic group" is an aromatic group with only one ring. Carbocyclic aromatic ring groups have only carbon ring atoms and include monocyclic aromatic rings such as phenyl. The term "heteroaryl", "heteroaromatic", "heteroaryl ring", "heteroaryl 20 group" and "heteroaromatic group", used alone or as part of a larger moiety as in "heteroaralkyl" or "heteroarylalkoxy" refers to an aromatic group with one or more heteroatoms such as nitrogen, sulfur or oxygen as a ring atom. Monocylic heteroaryl groups have five or six members and one or more ring heteroatoms, such as nitrogen, oxygen and sulfur. Examples of monocyclic heteroaryl groups include 2 25 furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3 isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-oxazolyl, 4 oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2 pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3 pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl, tetrazolyl, 2 30 thienyl and 3-thienyl. A "substitutable ring carbon atom" in an aromatic group is a ring carbon atom bonded to a hydrogen atom. The hydrogen can be optionally replaced with a WO 2007/127212 PCT/US2007/009959 -8 suitable substituent group. Thus, the term "substitutable ring carbon atom" does not include ring carbon atoms which are shared when two rings are fused. In addition, "substitutable ring carbon atom" does not include ring carbon atoms.when the structure depicts that they are already attached to a moiety other than hydrogen. 5 Examples of suitable substituents on a substitutable ring carbon atom of an aryl (e.g., phenyl) group include halogen, R 0 , -ORo, -O(haloalkyl), -SRo, trialkylsilyl, boronate, alkylboronate, dialkylboronate, -NO 2 , -CN, -N(R')2, -NR' CO 2 Ro, -NR'C(O)R, -NR'NR'C(O)Ro, -N(R')C(O)N(R') 2 , -NR'NR'C(O)N(R') 2 ,

-NR'NR'CO

2 Ro, -C(O)C(O)Ro, -C(O)CH 2 C(O)Ro, -CO 2 Ro, -C(O)Ro, -C(O)N(Ro) 2 , 10 -OC(O)Ro, -OC(O)N(Ro) 2 , -S(O) 2 Ro, -SO 2

N(R')

2 , -S(O)Ro, -NR'SO 2

N(R')

2 , NR'S0 2 Ro, -C(=S)N(R') 2 , -NR'-C(=NH)-N(R') 2 and -C(=NH)-N(R') 2 or two adjacent ring carbon atoms may be substituted with 1,2-methylene-dioxy or 1,2 ethylene-dioxy. Each Ro is independently hydrogen or an alkyl group. 15 Each R' is hydrogen or an alkyl group. When specifying that an aralkyl group has a certain number of carbon atoms, it is to be understood that it is the number of carbon atoms in the alkyl portion of the aralkyl that is being specified. For example, a C 1-C2 aralkyl group has one or two carbon atoms in the alkyl portion. 20 Pharmaceutically acceptable salts include acid salts of a disclosed RNase L activator containing an amine or other basic group and can be obtained by reacting the compound with a suitable organic or inorganic acid, such as hydrogen chloride, hydrogen bromide, acetic acid, perchloric acid and the like. Other examples of such salts include sulfates, methanesulfonates, nitrates, maleates, acetates, citrates, 25 fumarates, tartrates [e.g. (+)-tartrates, (-)-tartrates or mixtures thereof including racemic mixtures], succinates, benzoates and salts with amino acids such as glutamic acid. Salts of a disclosed RNase L activator containing a carboxylic acid or other acidic functional group can be prepared by reacting with a suitable base. Such a 30 pharmaceutically acceptable salt may be made with a base which affords a pharmaceutically acceptable cation, which includes alkali metal salts (especially sodium and potassium), alkaline earth metal salts (especially calcium and WO 2007/127212 PCT/US2007/009959 -9 magnesium), aluminum salts and ammonium salts, as well as salts made from physiologically acceptable organic bases such as trimethylamine, triethylamine, morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N,N' dibenzylethylenediamine, 2-hydroxyethylamine, bis-(2-hydroxyethyl)amine, tri-(2 5 hydroxyethyl)amine, procaine, dibenzylpiperidine, N-benzyl-3-phenethylamine, dehydroabietylamine, N,N'-bisdehydroabietylamine, glucamine, N methylglucamine, collidine, quinine, quinoline, and basic amino acid such as lysine and arginine. "Treatment" or "treating" refers to both therapeutic and prophylactic 10 treatment. An "effective amount" is the quantity of a disclosed RNase L activator in which a beneficial clinical outcome (prophylactic or therapeutic) is achieved when the compound is administered to a subject in need of treatment. For the treatment of a viral infection, a "beneficial clinical outcome" includes a reduction in the severity 15 of the symptoms associated with the disease (e.g., fever), a reduction in the longevity of the disease and/or a delay in the onset of the symptoms associated with the disease compared with the absence of the treatment. For the treatment of cancer, a beneficial clinical outcome includes a reduction in tumor mass, a reduction in the rate of tumor growth, a reduction in metastasis, a reduction in the severity of the 20 symptoms associated with the cancer and/or an increase in the longevity of the subject compared with the absence of the treatment. For restenosis, a "beneficial clinical outcome" includes a slowing or reduction in the narrowing of a blood vessel which has undergone angioplasty. The precise amount of a disclosed RNase L activator administered to a subject will depend on the type and severity of the 25 disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. Effective amounts of the disclosed RNase L activator typically range between about 0.1mg/kg 30 body weight per day and about 1000 mg/kg body weight per day, and preferably between 1 mg/kg body weight per day and 100 mg/kg body weight per day.

WO 2007/127212 PCT/US2007/009959 -10 The disclosed RNase L activators and pharmaceutically acceptable salts, solvates and hydrates thereof can be used in pharmaceutical preparations in combination with a pharmaceutically acceptable carrier or diluent. Suitable pharmaceutically acceptable carriers include inert solid fillers or diluents and sterile 5 aqueous or organic solutions. The disclosed RNase L activator will be present in such pharmaceutical compositions in amounts sufficient to provide the desired dosage amount in the range described herein. Techniques for formulation and administration of the compounds of the instant invention can be found in Remington: the Science and Practice ofPharmacy, 19' h edition, Mack Publishing 10 Co., Easton, PA (1995). For oral administration, the disclosed RNase L activator or salts thereof can be combined with a suitable solid or liquid carrier or diluent to form capsules, tablets, pills, powders, syrups, solutions, suspensions and the like. The tablets, pills, capsules, and the like contain from about 1 to about 99 15 weight percent of the active ingredient and a binder such as gum tragacanth, acacias, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose lactose or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above 20 type, a liquid carrier such as a fatty oil. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. A syrup or elixir may contain, in addition to the active ingredient, suctrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavoring 25 such as cherry or orange flavor. For parental administration the disclosed RNase L activators or salts thereof can be combined with sterile aqueous or organic media to form injectable solutions or suspensions. For example, solutions in sesame or peanut oil, aqueous propylene glycol and the like can be used, as well as aqueous solutions of water-soluble 30 pharmaceutically-acceptable salts of the compounds. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof in oils. Under WO 2007/127212 PCT/US2007/009959 -11 ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In addition to the formulations described previously, the disclosed RNase L activators may also be formulated as a long acting formulation, such as a depot 5 preparation. Such long acting formulations may be administered by implantation, or, for example, subcutaneously by intramuscular injection. Preferably disclosed RNase L activators or pharmaceutical formulations containing these compounds are in unit dosage form for administration to a mammal. The unit dosage form can be any unit dosage form known in the art 10 including, for example, a capsule, an IV bag, a tablet, or a vial. The quantity of the disclosed RNase L activator in a unit dose of composition is an effective amount and may be varied according to the particular treatment involved. It may be appreciated that it may be necessary to make routine variations to the dosage depending on the age and condition of the patient. The dosage will also depend on the route of 15 administration which may be by a variety of routes including oral, aerosol, rectal, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal and intranasal. Synthetic Strategy: 20 Compounds of the generalized Formula III will be synthesized following the procedure described by Faull and Hull [Faull and Hull. "Some reactions of Ethyl 2 Anilino-4oxo-4,5-dihydrothiophen-3carboxylate." Perkin Transactions 1, 1981, 1078-1082 ]. Z 2 in Formula I is either S (isothiocyanate) or O (isocyanate). Condensation with substituted benzaldehydes will generate compounds of the 25 structure depicted in Formula IV. Modification of Ring A is achieved by selection of substituted aldehydes. Modification of Ring B is described in Scheme 3 and 4. Scheme 1: WO 2007/127212 PCT/US2007/009959 -12 N\B/ NaH I D~~ME 2z2 + / R 2 piperidine / R 2 EtOH ao o DR .0 OR 0 0 o 0 II Ill IV The synthesis of Compound 1 follows this scheme directly. Isothiocyanatobenzene (V) will be coupled with ethyl 4-chloro-3-oxobutanoate (VI) under Faull and Hull conditions. Condensation of the 2,3-dihydrothiophene intermediate (VII) with 3 5 hydroxybenzaldehyde will yield compound 1. Scheme 2: NN NaH DME , /O it NH 0- NH + /piperidine / EtOHi 0 0 0 o 0 VI VII Compound I Modification of the substituents on Ring B will be accomplished prior to the Faull Hull synthesis described in Scheme 1. A representative synthetic strategy to 10 produce Compound XII is shown in Scheme 3. Readily available (E)-methyl 3-(3 nitrophenyl)acrylate (VIII) can be catalytically reduced the corresponding amine (IX). Formation of the isothiocyanate (X) via the coupling of the amine and carbon disulfide in the presence of DCC yields the starting reactant similar to I in Scheme 1. Production of Compound XII follows the subsequent Faull-Hull synthetic procedure. 15 Scheme 3: WO 2007/127212 PCT/US2007/009959 - 13 0 0 0 Pd/C; Atm H 2

-

CSn; DCC /): I MeOH/To| 0 2 N HN 8 C VII I Ix x I Piperidine. EtOH 0 A; 4h HO OH S S5 bk I HH U0. NH 2. NaCN; HMPA s C O75"C; 24 h o 0 o 0 0 0 XI Co.poun.d X II Phosphonate compound XVIII will be prepared as shown in Scheme 4. Commercially available 3-aminophenol (XIII) will be protected via standard 5 methodology with dibenzylpyrocarbonate in dioxane/H 2 0 (1:1) with NaOH or Et 3 N (to yield XIV). Deprotonation of the protected aminophenol with sodium hydride and coupling with the previously described p-toluenesulfonyloxymethane phosphonate in DMF (to yield compound XV).is followed by removal of the benzyloxycarbonyl protective group by transfer hydrogenation (to yield compound 10 XVI). Conversion of the free amine to the isothiocyanate and condensation with ethyl 4-chloro-3-oxobutanoate to form the thiophene ring are directly analogous with synthesis of compound XII. Following the coupling of the thiophene ring with 3-hydroxybenzaldehyde, selective deprotection of the dimethyl phosphonate ester (XVII) is then accomplished with aqueous pyridine to produce compound XVIII. 15 Scheme 4: WO 2007/127212 PCT/US2007/009959 -14 (PhCH 2 OCOOpM 0 Dioxane, H 2 0 NaIDT1"M Dioxan, HzO NaH/DMF CbzN 0 P

H

2 N H NaOH or Et 3 N CbzN OH OMe XI . XIV XV HO Pd/C NPyridine; rt o P EtOH 2. NaH t ONe DME; rt S / NH OMe XVI OMe HO XVII o o 0 oo HO Aq. Pyridine H I O OH NH OH OO 0 0 0 Compound XVIII The invention is illustrated by the following examples, which are not intended to be limiting in any way. 5 EXEMPLIFICATION Example 1 - Assay For Identifying Agents that Activate RNase L The assay is based on fluorescence resonance energy transfer (FRET). The method includes recombinant human RNase L produced in insect cells, from a 10 baculovirus vector, and purified by FPLC (Thakur CS, Xu Z, Wang Z, Novince Z, Silverman RH. A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2',5' oligoadenylates. Methods Mol Med 2005;116:103-13). The cleavable RNA substrate is a 36-nucleotide synthetic oligoribonucleotide with a fluorophore (6-carboxyfluorescein, FAM) at the 5'-terminus and a quencher (black 15 hole quencher-1, BHQ1), at the 3'-terminus. The RNA sequence is from the intergenic-region of the paramyxovirus, respiratory syncytial virus (RSV) genomic WO 2007/127212 PCT/US2007/009959 - 15 RNA. The RSV sequence was chosen because it contains several cleavage sites for RNase L (UU or UA) in an optimal context for cleavage. To demonstrate the effectiveness of the assay, RNA cleavage reactions were performed in 96-well black microtiter plates containing RNase L, the cleavable FRET RNA substrate and 2-5A. 5 The EC 50 is routinely obtained (concentration of activator to give 50% maximum activation) of 0.3 nM with authentic trimer 2-5A [p 3 A(2'p5'A) 2 ] as the activator of RNase L (Fig. 1 A). The dephosphorylated trimer, A(2'p5'A) 2 , was unable to activate RNase L, consistent with prior findings (Fig. 1A&D). Dong B, Xu L, Zhou A, Hassel BA, Lee X, Torrence PF, Silverman RH. Intrinsic molecular activities of the 10 interferon-induced 2-5A-dependent RNase. JBiol Chem 1994;269(19):14153-8. The inactive, dephosphorylated 2-5A molecule is referred to as "core 2-5A". The signal to-noise ratio was about 10:1 and the assay was very robust. There was no increase in the signal with time in reactions containing the RNA but lacking either RNase L or 2-5A. 15 Example 2 - Identification ofRNase L Inhibitors High throughput screening was performed as described in Example 1 on the ChemBridge DIVERset of 34,000 small molecules (ChemBridge Co., San Diego). Compounds providing at least 4-fold signals over background were chosen as 20 potential positives for re-testing. Seven "hits" were obtained (Fig. 2, compounds 1 to 7). The hits had molecular weights that range from 298 to 470 Da and were capable of activating RNase L in micromolar range (ECso's between 22 and 99 -M) (Figs. I and 2). The kinetics of RNA cleavage in the FRET assay show near maximal activation by 25 pppA(2'p5'A)2 in 15 min, whereas compounds 1 and 2 required 60 to 90 min to achieve maximal level of RNA degradation (Fig. ID-F). Other compounds related in structure to these activators were identified in ChemBridge repository using a searchable database (http://www.hit21ead.com). Two compounds related in structure to compound 1, were either active (compounds 30 8-11) or inactive (compound 12) (Fig. 2).

WO 2007/127212 PCT/US2007/009959 -16 Example 3 - Compounds 1 and 2 Activate RNase L in Ribonuclease Assays with Labeled Substrates To verify that these compounds are in fact capable of activating RNase L, alternative, conventional ribonuclease assays were performed with two different 32p_ 5 labeled RNA substrates (Fig. 3A&B). In these assays, 25 pM of compound 1 (Fig. 3A, lanes 3&4), and 25 tM compound 2 (Fig. 3A, lanes 5&6) were incubated in the presence and absence of purified human RNase L with the synthetic RNA substrate

GGACUUUUUUUCCCUUUUUUUCC-[

3 2 P]pCp (SEQ ID NO.: 1). RNase L activated by 2-5A or compounds 1 or 2 cleaved the substrate on the 3' side of the 10 UU dinucleotide sequence, consistent with our FRET assay findings. RNase L activation by lead compounds 1 and 2 was further supported using a sequence specific substrate C 7

U

2 Cl2 (Fig. 3B) (SEQ ID NO.: 2). Compound 1 (25piM) (lanes 4&5), and compound 2 (25p.M) (lanes 6&7) were separately incubated in the presence and absence of RNase L with the radiolabeled RNA 15 substrate. RNase L activated by 2-5A, compound I or compound 2 cleaved the substrate on the 3'-side of the UU dinucleotide sequence. In the absence of activator no product band was detected. RNase L dimerization is a prerequisite for the nuclease activation. To monitor dimerization of RNase L, protein cross-linking assays were performed (Fig. 3C). 20 The oligomeric state of RNase L was determined in western blots probed with monoclonal antibody against RNase L. Monomer RNase L converted to dimer in the presence of 2-5A, compound 1, or compound 2 (Fig. 3C). These data show that micromolar levels of compounds 1 & 2 activate RNase L and cause the enzyme to dimerize. 25 Example 4 - Compounds 1 and 2 Interact With the 2-5A Analog Binding Domain Domain of RNase L A 2-5A competition binding assay using surface plasmon resonance on a Biacore model 3000 T m was used to determine if the activators interact with the 2-5A binding 30 domain of RNase L. 2-5A analog used in these assays [p5'(A2'p)3A linked through its 2',3' terminal ribose to biotin] was generously provided for these efforts by Dr. H. Sawai (Gunma University, Japan). Streptavidin chips (Biacore Inc.) were pre-coated WO 2007/127212 PCT/US2007/009959 -17 with 2-5A-biotin. Mixtures of RNase L (10 nM) and varying concentrations of compounds 1 or compound 2 or RNase L by itself were passed over the chips. Sensograms were recorded and the maximum resonance units (Rma) at equilibrium were plotted as a function of the compound concentrations using Bia 5 evaluation T M software (Fig. 4). A dose-dependent decrease in the resonance response occurred with either compound 1 or 2. The data indicate that these compounds compete with 2-5A for RNase L binding. Analysis of the data indicated that the binding constants (Kd) for compounds 1 and 2 are 18p.M and 12jiM, respectively. 10 Example 5 - Compounds 1 and 2 Are Not Cytotoxic Based on Tetrazolium Conversion Assay Cytotoxicity of compounds 1 and 2 was evaluated by MTS (tetrazolium) conversion assays (Promega). Treatments with compound 1 at 50 -M for 3 days 15 reduced cell viability to 76.3% and 98.2% of control (untreated) levels for DU145 and HeLa cells, respectively. Treatments with compound 2 (also at 50 ~M for 3 d) reduced cell viability as a percentage of untreated cells to 95.2% and 86.5% for DU145 and HeLa cells, respectively. The results for DU145 cells are shown in Figure 5; and the results for Hela M cells are shown in Figure 6. As can be seen 20 from the results, these compounds lack significant cytotoxcity. Example 6 - Compound 2 Shows Antiviral Activity Against Parainfluenza Virus 3, Picornavirus and Encephalomyocarditis Virus To determine antiviral activity, cells were infected with a recombinant human 25 parainfluenza virus 3 (HPIV3) in which green fluorescent protein (GFP) cDNA was inserted between the P and M genes (provided by collaborator A. Banerjee) (Fig. 7). The cell lines used are HeLa M cells which are deficient in RNase L or HeLa M cells stably expressing either wild type RNase L or a nuclease-dead mutant (R667A) RNase L (from a CMV promoter in vector pcDNAneo). Cells were infected at an 30 MOI of 0.1 with HPIV3/GFP in serum free medium (DMEM) for lh. Media was removed, cells were washed in PBS and complete media with 10% FBS in the WO 2007/127212 PCT/US2007/009959 -18 absence or presence of 50 -M compound 2 was added. At 24 h post-infection, cells were examined under an inverted fluorescence microscope. It is apparent that characteristic syncytia (green) were observed with HPIV3/GFP infection of both the treated and untreated RNase L-deficient HeLa M cells with vector alone or 5 expressing mutant (R667A) RNase L. In contrast, compound 2 sharply inhibited virus growth and suppressed formation of syncytia in cells expressing the wild type RNase L. Fluorescence measurements indicated that compound 2 reduced viral growth by 8-fold in the wild type RNase L expressing cells, whereas there was only a 1.2-fold reduction in viral growth in the other two cell lines. In similar 10 experiments, compound 1 also had antiviral activity. The antiviral activity of compound 2 was also obtained against the encephalomyocarditis virus (see Figure 8) and picornavirus (data not shown). Therefore, these compounds, which have low toxicity, could have general antiviral activity and are candidate antiviral drugs. Example 7 - The Disclosed Activators of RNase L Inhibit Smooth Muscle Cell 15 Proliferation The proliferation of the clonal cell line AO10 (derived from the thoracic aorta of DB IX embryonic rat and possesses many of the properties characteristic of smooth muscle cells,) was determined using the colorimetric CellTiter 96® AQueous Cell Proliferation Assay as described (Promega). This method uses the tetrazolium 20 compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4 sulfophenyl)-2H-tetrazolium, MTS] and phenazine methosulfate (PMS), an electron coupling reagent. Cells were seeded (3 x 10 4 cells/well) in 96 well culture plates and treated with different concentrations of the compounds for 24 h. CellTiter 960 AQueous reagents (30% v/v dilution in PBS), 50 01, were added to each well. Plates 25 were incubated at 37E C for 2 h and absorbance measured at 490 nm with a 96-well plate reader (Molecular Devices, model Spectra Max 340). Results demonstrate that smooth cell proliferation was inhibited thus indicating that these compounds may function as a new class of therapeutic agents for the prevention of restenosis. Compound I was tested. 30 WO 2007/127212 PCT/US2007/009959 -19 Example 8 - Compound 2 Shows Antiviral Activity Against Vaccinia Virus (Strain: Western Reserve (WR)), a DNA virus in the pox virus family. Experimental Protocol: Virus strain: Western Reserve (WR) 5 Cells: Immortalized mouse embryonic fibroblasts (MEFs) were grown in RPMI supplemented with 10% FBS and p/s. Baby hamster kidney (BHK21) cells and african green monkey kidney cells (BSC40) were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum, p/s and l-glu. 10 Titer: BHK21 (baby hamster kidney cells) for plaque assays MOI: Vaccinia Virus (Western Reserve) 5 PFU using no media serum for infection (virus stock: 1x10 9 PFU/ml) Compounds : compound 2 at 0, 25 and 50uM in triplicates. Infection: 24h post infection samples were collected from each sample. 15 Method: MEF (RNase L)RL

+

' , MEF (RNase L) RL 4 - and BSC 40 cells were plated in 6 well plates, 80 - 85% confluent cells were infected with Vaccinia Virus (WR) at 5PFU/ml using serum free media. After 45min, cells were washed with PBS and cells re-fed with fresh media with compound 2. 20 After 24hr post infection media was removed, the cells were scraped in PBS and frozen and thawed twice before the titers of the viruses were determined on BHK21 cells, the indicator cell line. Plaque assay: BHK21 cells were plated in 12 well plates, complete monolayer of the cells were 25 infected with different dilutions of virus using serum free media. After 45min post infection, media was removed and the cells washed twice with PBS and replaced with Agar media [mix of 2% agarose + (2x MEM + 20%FBS)], after two days second layer of agar media was added with 0.05% neutral red in order to count the plaques. 30 The results are shown in Figures 9, 10, 11, and 12 and are described in the brief description of the figures section.

WO 2007/127212 PCT/US2007/009959 - 20 While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the 5 scope of the invention encompassed by the appended claims.

Claims

2. The pharmaceutical composition of Claim I wherein Z i is O and Z 2 is S.
3. The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula: WO 2007/127212 PCT/US2007/009959 - 23 0 0 R30--R N 7 B A or a pharmaceutically acceptable salt thereof.
4. The pharmaceutical composition of Claim 1 whereiin: Ring A is substituted at any one or more substitutable ring carbon atoms with 5 halogen, C1-C3 alkyl, C 1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 \,or a C 1-C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 2 1 , -OC(O)H or -OC(O)R 2 or Ring A is optionally substituted with a group represented by the following structural formula: o 0 0 J.' 0 H o oo O O COOH O N o o 10 OH Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 -C(O)H, -C(O)R 2 1 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 ', -(CH 2 ) 3 R 4 0 , 15 -CH 2 OCH 2 R 4 0 , -OCH 2 R 4 0 or a C1 -C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 ; WO 2007/127212 PCT/US2007/009959 - 24 each R 2 1 is independently H, C I-C3 alkyl or C1-C3 haloalkyl R 4 0 is -COOH, -PO 3 H 2 , -SO 3 H, -PO 2 H or -SO 2 H.
5. The pharmaceutical composition of Claim 4 whereiin: 5 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 1 , -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 1 , -(CH 2 ) 3 R 4 0 , -CH 2 OCH 2 R 40 or a C 1-C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 ; 10 each R 21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
6. The pharmaceutical composition of Claim 4 or 5 wherein each R20 is independently C1-C3 alkyl, each R 2 1 is independently C1-C3 alkyl, each R 30 Sis independently C1-C3 alkyl and R 2 is -H. 15
7. The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula: 0 N R 2 N S AY A or a pharmaceutically acceptable salt thereof. 20
8. The pharmaceutical composition of Claim 7 wherein: Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, Cl -C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 2 1 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 ' or a C1-C3 WO 2007/127212 PCT/US2007/009959 - 25 alkyl group substituted with hydroxyl, -OR 2 1 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 2 1 or with a group represented by the following structural formula: 0 OH 0 0 0 00COOH 0 N 0 .0 5 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 21 , -C(O)OR 1 , -OC(O)H, -OC(O)R 21 , -(CH 2 ) 3 R 40 , -CH 2 0CH 2 R40 or a C l-C3 alkyl group substituted with hydroxyl, -OR 2 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 2 1 ; 10 each'R 21 is independently C1-C3 alkyl or C1 -C3 haloalkyl; and R 40 is -COOH, -PO3H 2 , -SO 3 H, -PO 2 H or -SO 2 H.
9. The pharmaceutical composition of Claim 8 wherein each R 21 is independently C1-C3 alkyl, and R 2 is -H. 15
10. The pharmaceutical composition of Claim 2 wherein the compound is represented by the following Structural Formula; O N ryS A or a pharmaceutically acceptable salt thereof. WO 2007/127212 PCT/US2007/009959 - 26
11. The pharmaceutical composition of Claim 10 wherein: Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C I-C3 alkyl, C1 -C3 haloalkyl, nitro, cyano, hydroxy, 5 -OR 21 , -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 ' or a C1-C3 alkyl group substituted with hydroxyl, -OR 2 1 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 2 or with a group represented by the following structural formula: o0 N S o o 0 0 OH O COOH 0 N I ;o o OH 10 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C l-C3 alkyl, C l-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 1 , -C(O)H, -C(O)R 21 , -C(O)OR 2 1 , -OC(O)H, -OC(O)R 2 1 , -(CH 2 ) 3 R 4 , -CH 2 OCH 2 R 40 or a C 1-C3 alkyl group substituted with hydroxyl, -OR 2 1 15 keto, -C(O)OR 21 , -OC(O)H or -OC(O)RE; each R 2 1 is independently C1 -C3 alkyl or C1 -C3 haloalkyl; and R 40 is -COOH, -PO3H 2 , -SO 3 H, -PO 2 H or -SO 2 H.
12. The pharmaceutical composition of Claim 11 wherein each R21 is 20 independently C1-C3 alkyl and R 2 is -H.
13. The pharmaceutical composition of Claim 1 wherein the compound is represented by a structural formula selected from: WO 2007/127212 PCT/US2007/009959 -27 0\ 0 0 0 0 NH NH OH OH 0 0N N > NH C1 NH C1 OH ;and NO 2 or a pharmnaceutically acceptable salt thereof. 5 14. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural formula: z4 R3 N C /\ / D or a pharmaceutically acceptable salt thereof, wherein: 10 Z 3 and Z 4 are independently 0 or S; WO 2007/127212 PCT/US2007/009959 -28 Ring C and Ring D are optionally and independently substituted at any one or more substitutable ring carbon atoms; R 3 is -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 20 , nitro, cyano, -C(O)H, 5 -C(O)R 20 , -C(O)OR 2 0, -OC(O)H and -OC(O)R 20 ; and each R20 is independently CI-C3 alkyl or haloalkyl.
15. The pharmaceutical composition of Claim 14 wherein the compound is represented by the following structural formula: 0 R3 N 10 or a pharmaceutically acceptable salt thereof.
16. The pharmaceutical composition of Claim 15 wherein Ring C is optionally substituted at any one or more substitutable ring carbon atoms with C 1-C3 15 alkyl, halogen, =0, hydroxyl or Cl -C3 alkoxy.
17. The pharmaceutical composition of Claim 16 wherein Ring D is optionally substituted at any one or more substitutable carbon atoms with halogen, C l C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 21 20 -C(O)OR 2 1 , -OC(O)H, -OC(O)R 2 1 or a C 1-C3 alkyl group substituted with halogen, hydroxyl, -OR 21 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 and each R 2 1 is independently C1-C3 alkyl or C1-C3 haloalkyl.
18. The pharmaceutical composition of Claim 17 wherein R 3 is -H. 25
19. The pharmaceutical composition of Claim 18 wherein Ring C is unsubstituted. WO 2007/127212 PCT/US2007/009959 - 29 20. The pharmaceutical composition of Claim 14 wherein the compound is represented by a structural formula selected from: OO 0 N H OH S N H N H SN OH ; and 0 OO NH NO2 5 S or a pharmaceutically acceptable salt thereof,
21. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound represented by the following structural 10 formula: WO 2007/127212 PCT/US2007/009959 -30 R8 R 7 N R 6 or a pharmaceutically acceptable salt thereof, wherein: Z s and Z 6 are independently O or S; Ring E and Ring F are optionally and-independently substituted at 5 any one or more substitutable ring carbon atoms; R 6 is -H or a Cl -C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 2 , nitro, cyano, -C(O)H, -C(O)R 2 0 , -C(O)OR 20 , -OC(O)H and -OC(O)R 2 0 ; R 7 and R 8 are independently -H, a CI-C5 alkyl group or a C1-C5 10 haloalkyl group; and each R 20 is independently C1-C3 alkyl or haloalkyl.
22. The pharmaceutical composition of Claim 21 wherein Z s is S and Z 6 is O. 15 23. The pharmaceutical composition of Claim 22 wherein Ring E and Ring F are optionally and independently substituted at any one or more substitutable carbon atoms with halogen, C l-C3 alkyl, C l-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 2 1 , -C(O)OR 2 1 , -OC(O)H, -OC(O)R 2 1 or a C1 -C3 alkyl group substituted with halogen, hydroxyl, -OR 21 , keto, 20 -C(O)OR 21 , -OC(O)H or -OC(O)R 2 1 ; and each R 2 1 is independently Cl -C3 alkyl or Cl -C3 haloalkyl.
24. The pharmaceutical composition of Claim 23 wherein R 6 is -H. WO 2007/127212 PCT/US2007/009959 -31 25. The pharmaceutical composition of Claim 24 wherein R 7 and R 8 are independently -H or a methyl.
26. The pharmaceutical composition of Claim 21 wherein the compound is 5 represented by the following structural formula: O CI N N S HN 6O or a pharmaceutically acceptable salt thereof.
27. A pharmaceutical composition comprising a pharmaceutically acceptable 10 carrieror diluent and a compound represented by the following structural formula: Ru Z * 7 G ~NR 1 R 0 R x3( G xI \ro x 2 z 8 or a pharmaceutically acceptable salt thereof, wherein: X' and X 2 are independently CH 2 , NH or O; 15 X 3 is -O-C(0)-, -O-C(S)-, -S-C(0)-, -S-C(S)-, -C(0)-, C(S)-, -CH 2 -, -CH(CH 3 )-, -NHC(0)-, -C(0)NH-, -NHC(S)- or -C(S)NH-; Z 8 and Z 9 are independently S or O; Ring G is optionally substituted at any one or more substitutable ring carbon atoms; WO 2007/127212 PCT/US2007/009959 -32 R 9 is a Cl-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 20 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR20, -OC(O)H and -OC(O)R20; R1 0 and R" 1 are independently-H or a C 1-C5 alkyl group optionally 5 substituted with one or more groups selected from halogen, hydroxyl, -OR 2 0 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR20, -OC(O)H and -OC(0)R20 R 1 2 is -H; a C1-C5 alkyl group optionally substituted with one or more groups represented by R 21 ; a monocyclic aromatic group optionally substituted at any one or more substitutable ring carbon atoms with a group 10 represented by R 22 ; or a monocyclic C l-C3 aralkyl group optionally. substituted at any one or more substitutable ring carbon atoms with R23 each R20 is independently C 1-C3 alkyl or C1-C3 haloalkyl; each R 21 is independently halogen, hydroxyl, -OR 2 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 20 , -OC(O)H or -OC(O)R20 15 each R 22 and R 23 is independently CI1-C3 alkyl, CI1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 24 , -C(O)H, -C(O)R 24 , -C(O)OR 24 , -OC(O)H, -OC(O)R 24 or C1-C3 alkyl substituted with hydroxyl, -OR 24 , keto, -C(O)OR 24 , -OC(O)H or -OC(O)R 24 and R 24 is C1-C3 alkyl or C1-C3 haloalkyl. 20
28. The pharmaceutical composition of Claim 27 wherein R 1 2 is -H; a Cl-C5 alkyl group optionally substituted with a group represented by R 21 ; a phenyl group optionally substituted with a group represented by R 2 2 ; or a C1-C3 phenalkyl group optionally substituted at any one or more substitutable ring 25 carbon atoms with R 23 .
29. The pharmaceutical composition of Claim 28 wherein the compound is represented by the following structural formula. WO 2007/127212 PCT/US2007/009959 - 33 Ri2 Z9 R 9 R1 0 Rx 3 G NH -NH S or a pharmaceutically acceptable salt thereof.
30. The pharmaceutical composition of Claim 29 wherein the compound is 5 represented by the following structural formula: R 9 NH-NR' 1 R 0 RO1 NR NH S or a pharmaceutically acceptable salt thereof, wherein X 3 is -O-C(O)- or -C(O)-. 10 31. The pharmaceutical composition of Claim 30 wherein wherein the compound is represented by the following structural formula: R" 0 RRIO RN HN R X3 G Rio NH S or a pharmaceutically acceptable salt thereof. 15 32. The pharmaceutical composition of Claim 31 wherein Ring G is optionally substituted at any one or more ring carbon atoms with halogen, Cl -C3 alkyl, WO 2007/127212 PCT/US2007/009959 -34 C 1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 5 , -C(O)H, -C(O)R 25 , -C(O)OR 2 5 , -OC(O)H, -OC(O)R 25 or C1-C3 alkyl substituted with hydroxyl, -OR 25 , keto, -C(O)OR 25 , -OC(O)H or -OC(O)R 25 and each R 25 is independently C1-C3 alkyl or C1-C3 haloalkyl. 5
33. The pharmaceutical composition of Claim 32 wherein R 9 is a C1-C5 alkyl group optionally substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy. 10 34. The pharmaceutical composition of Claim 33 wherein R 1 2 is-H; an alkyl group optionally substituted with a group represented by R 21 ; or a benzyl group optionally substituted at any one or more substitutable ring carbon atoms with R23 R 2 1 halogen, hydroxyl, Cl -C3 alkoxy or C1-C3 haloalkoxy; 15 each R 23 is independently C l-C3 alkyl, C1 -C3 haloalkyl, nitro, cyano, hydroxy, -OR 24 , -C(O)H, -C(O)R 24 , -C(O)OR 24 , -OC(O)H, -OC(O)R 24 or C 1-C3 alkyl substituted with hydroxyl, -OR 24 , keto, -C(O)OR 24 , -OC(O)H or -OC(O)R24 20 35. The pharmaceutical composition of Claim 34 wherein R' 0 is methyl, halomethyl or hydroxymethyl.
36. The pharmaceutical composition of Claim 35 wherein R 9 is C1-C5 alkyl; R' 0 is -C(C1) 3 ; and R I 2 is Cl-C5 alkyl or benzyl. 25
37. The pharmaceutical composition of Claim 27 wherein the compound is represented by a structural formula selected from: WO 2007/127212 PCT/US2007/009959 -35 0 CI /N HN NH O NH HN . O - NH s ; and 0 S Y0 or a pharmaceutically acceptable salt thereof. 5
38. A method of treating a subject with a viral infection, comprising administering an effective amount of the pharmaceutical composition of any one of Claims 1-37 to the subject. NH ci 0 NH 10 39. The method of Claim 38g wherein the viral infection is caused by a virus with a single-stranded RNA(s) genome. S ;and CI o0\ N HN CI NH S> or a pharmaceutically acceptable salt thereof. 5 38. A method of treating a subject with a viral infection, comprising administering an effective amount of the pharmaceutical composition of any one of Claims 1-37 to the subject. 10 39. The method of Claim 38 wherein the viral infection is caused by a virus with a single-stranded RNA(s) genome. WO 2007/127212 PCT/US2007/009959 -36
40. The method of Claim 38 wherein the virus is orthomyxoviruses (e.g. influenza viruses), paramyxoviruses (e.g. respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses 5 (e.g. rubella virus and eastern equine encephalitis virus), picomaviruses (e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift Valley fever virus & Hantavirus),.retroviruses (e.g. the gammaretrovirus XMRV and the lentiviruses HIV-1 & -2), filoviruses (e.g. Ebolavirus, hemorrhagic fever 10 virus) or hepatitis B virus (a DNA virus with a genomic RNA intermediate).
41. The method of Claim 38 wherein the viral infection is caused by a virus with a DNA genome. 15 42. The method of Claim 41 wherein the virus is human papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus, or human herpesvirus-8.
43. The method of Claim 41 wherein the virus is Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus, 20 adenovirus, varicella-zoster virus, human herpesvirus 6, human herpesvirus 7, B 19 parvovirus, adeno-associated virus, BK virus, and JC virus, human papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus, or human herpesvirus-8. 25 44. A method for treating a subject with cancer comprising administering to the subject an effective amount of the pharmaceutical composition of any one of Claims 1-37.
45. The method of Claim 44 wherein the cancer is prostate cancer, ovarian 30 cancer, brain cancer or bone cancer. WO 2007/127212 PCT/US2007/009959 -37
46. A method for treating restenosis in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of any one of Claims 1-37. 5 47. A compound represented by the following structural formula: Zi Z3 R2 \ N Z2 A or a pharmaceutically acceptable salt thereof, wherein: Ring A and Ring B are optionally and independently substituted at any one or more substitutable ring carbon atoms; 10 Y is CH, N or N -O-; Z' and Z 2 are independently O or S; Z 3 is CR' or N; R' is -H, -C(O)H, -C(O)R 20 , -C(O)OR 3 0 or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, 15 hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 30 , -OC(O)H and -OC(O)R 2 0 or R' is a group represented by the following structural formula: 0 H N HN N N R 2 is -H or a Cl -C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 2 0, nitro, cyano, -C(O)H, 20 -C(O)R 20 , -C(O)OR 20 , -OC(O)H or -OC(O)R 20 ; each R 2 0 is independently C1 -C3 alkyl or Cl -C3 haloalkyl; and WO 2007/127212 PCT/US2007/009959 -38 R 30 is C 1-C3 alkyl, C 1-C3 haloalkyl or a group represented by a structural formula selected from: N OH / / OH F N C(O)CH 3 OH OH F /N F F OH OH provided that the compound is not represented by a structural formula 5 selected from: 0 o O O NH NH KNH OH OH WO 2007/127212 PCT/US2007/009959 -39 o 0 NH CI s NH -S ci o OH OH : and 0 NH NO 2 or a pharmaceutically acceptable salt thereof. 5 48. The compound of Claim 47 wherein Z' is O and Z 2 is S.
49. The compound of Claim 48 wherein the compound is represented by the following Structural Formula: WO 2007/127212 PCT/US2007/009959 -40 R?O O O O ,. R2 N A or a pharmaceutically acceptable salt thereof.
50. The compound of Claim 47 whereiin: 5 Ring A is substituted at any one or more.substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 21 or a C1-C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR' 1 , -OC(O)H or -OC(O)R 21 or Ring A is optionally substituted with a group represented by 10 the following structural formula: o N S;OK 0 0 OO 0 o o OH Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 1 , -(CH 2 ) 3 R 40 , 15 -CH 2 OCH 2 R 40 , -OCH 2 R 40 o r a C1-C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 2 1 , -OC(O)H or -OC(O)R 21 ; WO 2007/127212 PCT/US2007/009959 -41 each R 21 is independently H, C I-C3 alkyl or C I-C3 haloalkyl; and R 4 o is -COOH, -PO 3 H 2 , -SO 3 H, -PO2H or -SO 2 H.
51. The compound of Claim 50 whereiin: 5 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 -C(O)H, -C(O)R 21 , -C(O)OR 2 1, -OC(O)H, -OC(O)R21, -(CH 2 ) 3 R 4 0 , -CH 2 OCH 2 R 4 or a CI-C3 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 ; 10 each R 21 is independently C1 -C3 alkyl or CI-C3 haloalkyl.
52. The compound of Claim 50 or 51 wherein eachR 20 is independently C1 -C3 alkyl, each R 2 1 is independently C1-C3 alkyl, each R 30 is independently Cl 15 C3 alkyl and R 2 is -H.
53. The compound of Claim 48 wherein the compound is represented by the following Structural Formula: 0 N R2 N IA 20 or a pharmaceutically acceptable salt thereof
54. The compound of Claim 53 wherein: Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, 25 -OR 2 1 , -C(O)H, -C(O)R 2 1 , -C(O)OR 2 1 , -OC(O)H, -OC(O)R 2 1 or a C 1-C3 WO 2007/127212 PCT/US2007/009959 -42 alkyl group substituted with hydroxyl, -OR 21 , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 or with a group represented by the following structural formula: 0 o o ,J OH Y N Y SKA 0. 0 0 0H COOH O N 0 0 I ;o o OH 5 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 1 , -C(O)H, -C(O)R 2' , -C(O)OR 2' , -OC(O)H, -OC(O)R 21 , -(CH 2 ) 3 Ra , 40 21 -CH 2 OCH 2 R 4 0 or a Cl -C3 alkyl group substituted with hydroxyl, -OR , keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 2 1 ; 10 each R 2 1 is independently Cl 1-C3 alkyl or C1-C3 haloalkyl; and R 40 is -COOH, -PO 3 H 2 , -SO 3 H, -PO 2 H or -SO2H.
55. The compound of Claim 54 wherein each R 2 1 is independently C1-C3 alkyl, and R 2 is -H. 15
56. The compound of Claim 48 wherein the compound is represented by the following Structural Formula: 0 NR2 N A or a pharmaceutically acceptable salt thereof. WO 2007/127212 PCT/US2007/009959 -43 57. The compound of Claim 56 wherein: Ring A is substituted at any one or more substitutable ring carbon atoms with halogen, C 1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, 5 -OR 2 1, -C(O)H, -C(O)R 2 1 , -C(O)OR 21 , -OC(O)H, -OC(O)R 2 ' or a C 1 -C3 alkyl group substituted with hydroxyl, -OR 21 , keto,.-C(O)OR 2 1 , -OC(O)H or -OC(O)R 21 or with a group represented by the following structural formula: 0 0 COOH 0 N 1 o 0 OH 10 Ring B is substituted at any one or more substitutable ring carbon atoms with halogen, C1-C3 alkyl, C l-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R 21 , -C(O)OR 21 , -OC(O)H, -OC(O)R 21 , -(CH 2 ) 3 R 40 40 21 -CH 2 OCH 2 R 4 or a C1-C3 alkyl group substituted with hydroxyl, -OR 21 15 keto, -C(O)OR 21 , -OC(O)H or -OC(O)R 21 ; each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and R 40 is -COOH, -PO3H 2 , -SO 3 H, -PO 2 H or -SO 2 H.
58. The compound of Claim 57 wherein each R 2 1 is independently C1-C3 alkyl 20 and R 2 is-H.
59. A compound represented by the following structural formula: WO 2007/127212 PCT/US2007/009959 -44 Z4 R3 N CD ga N or a pharmaceutically acceptable salt thereof, wherein: Z 3 and Z 4 are independently O or S; Ring C and Ring D are optionally and independently substituted at 5 any one or more substitutable ring carbon atoms; R 3 is -H or a C1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 2 0, nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 2 0 , -OC(O)H and -OC(O)R 2 0 ; and each R 20 is independently C1-C3 alkyl or haloalkyl, provided that the 10 compound is not represented by a structural formula selected from: 0 H N H O H S N O 0 NH S N . OH an ; and O NH NO2 S N WO 2007/127212 PCT/US2007/009959 - 45 or a pharmaceutically acceptable salt thereof.
60. The compound of Claim 59 wherein the compound is represented by the following structural formula: o R3 N C 5 8 or a pharmaceutically acceptable salt thereof.
61. The compound of Claim 60 wherein Ring C is optionally substituted at any one or more substitutable ring carbon atoms with C1-C3 alkyl, halogen, =0, 10 hydroxyl or C I-C3 alkoxy.
62. The compound of Claim 61 wherein Ring D is optionally substituted at any one or more substitutable carbon atoms with halogen, C1-C3 alkyl, C 1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 21 , -C(O)H, -C(O)R' 1 , -C(O)OR 21 , 15 -OC(O)H, -OC(O)R 21 or a C1-C3 alkyl group substituted with halogen, hydroxyl, -OR 21 , keto, -C(O)OR 2 1 , -OC(0)H or -OC(0)R 21 and each R 2 1 is independently Cl -C3 alkyl or C 1-C3 haloalkyl.
63. The compound of Claim 62 wherein R 3 is -H. 20
64. The compound of Claim 63 wherein Ring C is unsubstituted.
65. A compound represented by the following structural formula: WO 2007/127212 PCT/US2007/009959 - 46 RB R 7 Z6 N Z5--N R 6 or a pharmaceutically acceptable salt thereof, wherein: Z 5 and Z 6 are independently O or S; Ring E and Ring F are optionally and independently substituted at 5 any one or more substitutable ring carbon atoms; R 6 is -H or a C 1-C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 20 , nitro, cyano, -C(O)H, -C(0)R 20 , -C(O)OR20, -OC(O)H and -OC(O)R20; R7 and R 8 are independently -H, a C1-C5 alkyl group or a Cl-C5 10 haloalkyl group; and each R 20 is independently C1-C3 alkyl or haloalkyl, provided that the compound is represented by a structural formula other than: O CI N N S HN 15 or a pharmaceutically acceptable salt thereof.
66. The compound of Claim 65 wherein Z 5 is S and Z 6 is O. WO 2007/127212 PCT/US2007/009959 -47
67. The compound of Claim 66 wherein Ring E and Ring F are optionally and independently substituted at any one or more substitutable carbon atoms with 21 halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 1 5 -C(O)H, -C(O)R 2 1 , -C(O)OR 2 1 , -OC(O)H, -OC(O)R 2 1 or a C l-C3 alkyl group substituted with halogen, hydroxyl, -OR 21 , keto, -C(O)OR 2 1 , -OC(O)H or -OC(O)R 21 ; and each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl. 10 68. The compound of Claim 67 wherein R 6 is -H.
69. The compound of Claim 68 wherein R and R are independently -H or a methyl. 15 70. A compound represented by the following structural formula: R 1 Z 9 R 9 NR 1 3 G~ Rio x 2 Z 8 or a pharmaceutically acceptable salt thereof, wherein: X1 and X 2 are independently CH 2 , NH or O; X, is -O-C(O)-, -O-C(S)-, -S-C(O)-, -S-C(S)-, -C(O)-, C(S)-, -CH 2 -, 20 -CH(CH 3 )-, -NHC(O)-, -C(O)NH-, -NHC(S)- or -C(S)NH-; Z 8 and Z 9 are independently S or O; Ring G is optionally substituted at any one or more substitutable ring carbon atoms; R 9 is a C 1-C5 alkyl group optionally substituted with one or more 25 groups selected from halogen, hydroxyl, -OR 2 0 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 2 0 , -OC(O)H and -OC(O)R 20 ; WO 2007/127212 PCT/US2007/009959 -48 R1 0 and R" are independently -H or a C1 -C5 alkyl group optionally substituted with one or more groups selected from halogen, hydroxyl, -OR 2 0 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 20 , -OC(O)H and -OC(O)R 2 o; R 1 2 is -H; a C1-C5 alkyl group optionally substituted with one or 5 more groups represented by R 21 ; a monocyclic aromatic group optionally substituted at any one or more substitutable ring carbon atoms with a group represented by R 22 ; or a monocyclic C1 -C3 aralkyl group optionally substituted at any one or more substitutable ring carbon atoms with R23; each R 20 is independently CI-C3 alkyl or CI-C3 haloalkyl; 10 each R 2 1 is independently halogen, hydroxyl, -OR 2 , nitro, cyano, -C(O)H, -C(O)R 20 , -C(O)OR 2 0 , -OC(O)H or -OC(O)R20 each R 22 and R is independently C1 -C3 alkyl, C1 -C3 haloalkyl, nitro, cyano, hydroxy, -OR 24 , -C(O)H, -C(O)R 24 , -C(O)OR 24 , -OC(O)H, -OC(O)R 24 or C1 -C3 alkyl substituted with hydroxyl, -OR24, keto, 15 -C(O)OR 24 , -OC(O)H or -OC(O)R 24 and R 24 is Cl -C3 alkyl or C 1-C3 haloalkyl, provided that the compound is not represented by a structural formula selected from: WO 2007/127212 PCT/US2007/009959 -49 0 c HN C NH CI 0 NH 09 S 0 Cl O NH H CI NH ONH s ;and yoI 0 HN CI 0 S or a pharmaceutically acceptable salt thereof. 5
71. The compound of Claim 70 wherein R 1 2 is -H; a CI-C5 alkyl group optionally substituted with a group represented by R 2 '; a phenyl group optionally substituted with a group represented by R 22 ; or a C1-C3 phenalkyl group optionally substituted at any one or more substitutable ring carbon 10 atoms with R 2 . WO 2007/127212 PCT/US2007/009959 -50
72. The compound of Claim 71 wherein the compound is represented by the following structural formula. R 12 Z9 NR RIO X. G NH r NH S or a pharmaceutically acceptable salt thereof. 5
73. The compound of Claim 72 wherein the compound is represented by the following structural formula: /0 R 9 NR' Ri R 3 G NH NH --- N H S N or a pharmaceutically acceptable salt thereof, wherein X 3 is -O-C(O)- or 10 -C(O)-.
74. The compound of Claim 73 wherein the compound is represented by the following structural formula: R" O " R 9 HN 3 G RNHIO NH S 15 or a pharmaceutically acceptable salt thereof. WO 2007/127212 PCT/US2007/009959 -51 75. The compound of Claim 74 wherein Ring G is optionally substituted at any one or more ring carbon atoms with halogen, C 1-C3 alkyl, C 1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 25 , -C(O)H, -C(O)R 2 1, -C(O)OR 2 5 , -OC(O)H, -OC(O)R 2 5 or C 1-C3 alkyl substituted with hydroxyl, -OR 25 , keto, 5 -C(O)OR 2 5 , -OC(O)H or -OC(O)R 2s and each R 25 is independently C1-C3 alkyl or C1-C3 haloalkyl.
76. The compound of Claim 75 wherein R 9 is a C1-C5 alkyl group optionally substituted with halogen, hydroxyl, C 1-C3 alkoxy or C 1-C3 haloalkoxy. 10
77. The compound of Claim 76 wherein R I 2 is-H; an alkyl group optionally substituted with a group represented by R 2 1 ; or a benzyl group optionally substituted at any one or more substitutable ring carbon atoms with R 23 ; R 2 1 halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy; 15 each R 23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR 2 4 , -C(O)H, -C(O)R 24 , -C(O)OR 24 , -OC(O)H, -OC(O)R2 4 or C 1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR 24 , -OC(O)H or -OC(O)R 24 . 20 78. The compound of Claim 77 wherein R1o is methyl, halomethyl or hydroxymethyl.
79. The compound of Claim 78 wherein R 9 is Cl-C5 alkyl; R i o is -C(C1) 3 ; and R 12 is Cl-C5 alkyl or benzyl.