KR20090007609A - Anti-viral agents that activate rnase l - Google Patents

Abstract

RNase L Activators and methods of using the same are disclosed herein.

Description

ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L} Activating RNSA L

Preclinical studies of antiviral enzymes in RNase L, the interferon (IFN) system, suggest that these enzymes are important targets for cancer and antiviral agents (Adah SA, Bayly SF, Cramer H, Silverman RH, Torrence PF. (Curr Med Chem. 2001 Aug; 8 (10): 1189-212) For example, hereditary prostate cancer 1 (HPC1) sensitive locus has recently been mapped to RNase L (Carpten J, Nupponen N, Isaacs S, Sood). R, Robbins C, Xu J, Faruque M, Moses T, Ewing C, Gillanders E, Hu P, Bujnovszky P, Makalwska I, Baffoe-Bonni A, Faith D, Smith J, Stepah D, Wiley K, Brownstein M, Gildea D, Kelly B, Jenkins R, Hostetter G, Matikainen M, Schleutker J, Klinger K, Conners T, Xiang Y, Wang Z, Demarzo A, Papdopoulos N, Kallioniemi OP, Burk R, Meyers D, Gronberg H, Meltzer P, Silverman R, Bailey-Wilson J, Walsh P, Isaacs W, Trent J. Nature Genetics 2002, Jan 22). in addition, resistance to flaviviruses including West Nile virus Gene which imparts was mapped to a gene in the RNase L paths (OASlb) (Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA Proc 25 Natl Acad Sci USA 2002 Jul 9;.. 99 (14) In fact, RNase L is activated during the interferon antiviral response by small abnormal oligoadenylides (known as “2-5 A”) to 2 ′, 5′-nucleotide linkages (Kerr IM, Brown RE Proc Nall Acad Sci USA. 1978 Jan; 75 (l): 256-60; Zhou A, Hassel BA, Silverman RH. Cell. 1993 Mar 12; 72 (5); 753-65). In addition, RNase L has already been demonstrated to be involved in the anti-cell proliferative activity of IFN (Hassel BA, Zhou A, Sotomayor C, Maran A, Silverman RH. EMBO J. 1993 Aug; 12 (8): 3297-304) . 2-5A induces degradation of ribosomal RNA (rRNA) and messenger RNA (mRNA) via RNase L, which lowers the level of protein synthesis and, when applied to aortic smooth muscle cells, prevents restenosis after angioplasty. Can be. However, 2-5A is 1) unstable in serum and cells due to the action of phosphodiesterase and phosphatase; 2) It has certain undesirable characteristics as a therapeutic agent in that it is an intracellular mediator that does not cross cell membranes. Thus, there is a need for new activators of RNase L for clinical use.

Summary of the Invention

The present invention is based on the discovery of many compounds that activate RNase L (see Example 3) (hereinafter, “lightened RNase L activators”). These RNase L activators have antiviral activity, including antiviral activity against Paraflufluenza Virus 3 (HPIV3), Picornavirus and Encephalomaiocarditis Virus (EMCV). (See Example 6). The found RNase L activators also inhibit lotus root cell proliferation in vitro (see Example 7) and are therefore useful for treating the restenosis layer. In addition, the RNase L activators found were surprisingly found not to be cytotoxic (Example 5). Based on these findings, novel RNase L activators, pharmaceutical compositions comprising such RNase L activators, and methods of treatment with these RNase L activators are described.

The identified RNase activators, pharmaceutical compositions comprising them and methods of treatment using the same are specifically described in the claims.

Brief description of the drawings

1A-1F are graphs showing dose-response and kinetics of RNase L activation versus ˜M concentration (FIGS. 1A-1C) or time (minutes) (FIGS. 1D-1E) for 2-5A or small molecule activators. The assay was by the RNase L FRET method and was performed at 22 ° C. (A, D) ppp (A2'p5'A) ₂ ; (B, E) compound 1; And (C, F) compound 2.

Figure 2 shows the structure of the small molecule activator of RNase L (Compounds 1-12) and EC ₅₀ , the concentration required for 50% degradation in RNA FRET probes.

Figure 3 shows (A, B) alternative ribonuclease assays and RNase L dimerization assays for (C) 2-5A, Compound 1 (C-1) and Compound 2 (C-2). (A) 25 nM Trimmer 2-5A (lanes 1, 2), 25-M C-1 (lane 3, in the presence or absence of 25 nM RNase L in the presence of RNA substrate GGACUUUUUUUCCCUUUUUUUCC [ ³² P] pCp for 30 minutes at 22 ° C. 4), 25-M C-2 (lanes 5, 6). (B) 25 nM Trimmer 2-5A (lanes 2, 3), 25-M C-1 (lanes 4, 5), 25-M C-2 (lanes 6, 7) at 25 ° C. for 30 minutes at 25 nM RNase L And incubation with or without RNA, C ₇ U ₂ C _12- [ ³² P] pCp. Cleaved RNA was isolated on 20% acrylamide / 7M urea / TBE sequencing gel. (C) covalent crosslinking of RNase L by dimethyl subsulimate (DMS). DMS was incubated with RNase L and trimer 2-5A (lanes 2-5), C-1 (lanes 6-9), or C-2 (lanes 10-13). After SDS-polyacrylamide gel electrophoresis, proteins were transferred to nitrocellulose and probed with monoclonal antibodies against RNase L.

4A and 4B are graphs showing the substitution of 2-4A-biotin bonds with RNase L by Compounds 1 and 2 as measured by surface plasmon resonance. Biotinylated 2-5A was immobilized on streptavidin biosensor chip (Biacore). RNase L (10 nM) was allowed to flow over the chip at a rate of 20 μl / min for 5 minutes in the presence of various concentrations of Compound 1 (A) or Compound 2 (B). Sensograms were recorded and analyzed using Bia-evaluation ^™ software. R _max in each case was plotted against increasing compound concentration ˜M.

5A-5C are graphs showing the cytotoxicity of Compounds 1 and 2 against DU125 cells in the MTS conversion assay. Cytotoxicity was measured by absorbance versus concentration ˜M at 490 nanometers on day 1 (FIG. 5A), day 2 (FIG. 5B) and day 3 (FIG. 5C). The result of compound 1 is shown in blue; The results for compound 2 are shown in red.

6A-6B are graphs showing the cytotoxicity of Compounds 1 and 2 against Hela M cells in the MTS conversion assay. Cytotoxicity was measured by absorbance versus concentration ˜M at 490 nanometers per day. The results for compound 1 are shown in blue; The results for compound 2 are shown in red. 6A shows the results for Hela M cells expressing RNase L; 6B shows the results for Hela M cells expressing the nuclease-lethal variant of RNase L.

7 shows a photograph under an inverted fluorescence microscope showing that Compound 2 inhibits replication of HPIV3 / GFP. Hela M cells lacking RNase L were used as empty vector control cells expressing wild type RNase L or expressing nuclease-lethal variant (R667A) RNase L. Photos were captured using an inverted fluorescence microscope.

FIG. 8 is a bar graph showing the antiviral effect of Compound 2 at various concentrations -M on Encephalomaiocarditis virus (EMCV), as measured by plaque count x 10 ^-7 .

9 includes bar graphs showing the growth of MEF RL ^{+ / +} cells grown with 0, 25, and 50 μΜ of Compound 2. FIG. The bar graph shows the percentage of virus plaques obtained in comparison to the control (0 μM Compound 2, 100% = 2.5 × 10 ⁴ PFU / mL). Increasing the concentration of compound 2 lowered virus yield as measured by plaque assay. Directly below each compound 2 concentration is the corresponding agar plate stained in medium red. The plate also shows that Compound 2 concentration increases as virus yield decreases as measured by plaque assay.

10 is a bar graph showing the percentage of virus plaques obtained for MEF RL ^{+ / +} , BSC 40 and MEF RL ^{− / −} cells grown in the absence or presence of Compound 2. FIG. Compound 2 inhibited viral titers on MEF RL ^{+ / +} and BSC 40 cells. Cells lacking the RNase L gene are resistant to Compound 2. (PFU / mL untreated control (0 μM compound 2 added) counted at 100%: MEF RL ^{+ / +} : 2.5 × 10 ⁴ ; BSC 40: 2.5 × 10 ⁴ ; and MEF RL ^{− / −} : 3.5 x 10 ⁴ ).

FIG. 11 is a photograph of MEF RF ^{+ / +} cells treated (50 μM Compound 2) and untreated (0 μM Compound 2 added) in agar plates stained with medium red. The presence of compound 2 lowered the number of viral plaques.

12: Table with substantial viral plaque counts as determined by plaque probes for MEF RL ^{+ / +} and MEF RL ^{− / −} cells. Virus yield in MEF RL ^{+ / +} cells decreased in the presence of compound 2. Compound 2 did not lower virus yield in MEF RL ^{− / −} cells. Virus dilution indicates that a 10-fold virus dilution leads to a 10-fold decrease in viral plaque counts.

A "subject" is preferably a human, livestock, farm animal or laboratory animal in need of treatment for a viral infection, cancer or restenosis.

Viral infections that can be treated with the identified RNase L activators include viruses with single-stranded RNA (s) in their genome. Examples include orthomyxoviruses (eg influenza viruses), paramyxoviruses (eg respiratory syncytial virus & human parainfluenza virus-3), rhabdoviruses (eg For example, rabies virus, togaviruses (e.g., rubella virus and eastern equine encephalitis virus), picornaviruses ) (Eg, poliovirus & Coxsackieviruses), flaviviruses (eg, West Nile virus, Dengue virus, and C) Hepatitis virus), bunyaviruses (eg, LaCrosse virus, Rift Valley fever virus & hanta) (Hantavirus), retroviruses (e.g. gammaretrovirus XMRV and lentivirus HIV-1 & -2), filoviruses (e.g. ebolavirus, hemorhagic fever virus )) Or hepatitis B virus (a DNA virus with a genomic RNA mediator).

The RNase L activators found can be used to treat infections from certain DNA viruses, including human papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus and human herpesvirus-8. In addition, the RNase L activators that have been found also include Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6, human herpes virus 7, B19 parvovirus, adeno-associated virus ( adeno-associated virus), BK virus, and JC virus, and can be used to treat infections from certain DNA viruses.

Transfection of PC3 or DU145 cells to 2-5A results in apoptosis (Xiang Y, Wang Z, Murakami J, Plummer S, Klein EA, Carpten JD, Trent JM, Isaacs WB, Casey G, Silverman RH. Cancer Res 2003 Oct 15; 63 (20): 6795-801). Cell lines derived from metastatic brain and bone, prostate cancer, DU145 and PC3 are wild type for RNase L, respectively. In addition, 2-5A transfection results in caspase-dependent apoptosis in human ovarian carcinoma cells via the mitochondrial pathway (Rusch L, Zhou A, Silverman RH. Jlnterferon Cytokine Res. 2000 Dec; 20 (12): 1091-100). In addition, 2-5A linked to antisense against telomerase RNA results in apoptosis and anti-tumor activity against DU145 tumors in nude mice (Kondo Y, Koga S, Komata T, Kondo S. Oncogene. 2000 Apr 27; 19 (18): 2205-11). Based on the above, the identified activators of RNase L can be used to treat cancer.

Examples of cancers that can be treated with the disclosed RNase L activators include, but are not limited to, human sarcoma and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, and chondroitin. Sarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangiosarcoma, lymphangiosarcoma Lymphangioendotheliosarcoma, synovioma, mesothelioma, wing's tumor, leiomyosarcoma, rhabdomiosarcoma, colon hammoma carcinoma), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, adenocarcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystic carcinoma, medulla carcinoma, Gi Supportive carcinoma, renal cell carcinoma, liver cancer, cholangiocarcinoma, choriocarcinoma, testicular carcinoma, germ carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial cell carcinoma, glioma Cell tumors, medulloblastomas, craniocytomas, epidermoid tumors, pineal carcinoma, hemangioblastoma, auditory neuroma, oligodendrocyte, meningioma, melanoma, neuroblastoma and retinoblastoma. The identified RNase L activators are commonly used to treat prostate cancer, ovarian cancer, brain cancer or bone cancer.

Restenosis is a disease that can occur in blood vessels that have been coronally or peripherally treated (eg, percutaneous coronary angioplasty) with a PTCA balloon catheter. Restenosis is the development of tissue wounds for about three to six months after treatment, resulting in narrowing of blood vessels. Restenosis causes excessive lotus root growth. Since the RNase L activators found inhibit lotus root proliferation, it is believed that these compounds can be used to inhibit, treat and / or prevent restenosis.

The term "alkyl" as used herein refers to a saturated straight or branched chain hydrocarbon. "Haloalkyl" is alkyl substituted with one or more halogens. The term "halogen" means F, Cl, Br or I. Preferably, the halogen in haloalkyl or haloalkoxy is F.

The term "aromatic group" used alone or as part of a larger moiety as in "aralkyl" includes carboxylic aromatic rings and heteroaryl rings. The term "aromatic group" can be used interchangeably with the terms "aryl", "aryl ring", "aromatic ring", "aryl group" and "aromatic group". "Aralkyl" is an alkyl group substituted with an aromatic group. "Penalkyl" is an alkyl group substituted with a phenyl group.

A "monocyclic aromatic group" is an aromatic group having only one ring.

Carboxylic acid aromatic ring groups have only carbon ring atoms and include monocyclic aromatic rings such as phenyl.

The terms “heteroaryl”, “heteroaromatic”, “heteroaryl ring”, “heteroaryl group” and “used alone or as part of a larger portion, such as in“ heteroaralkyl ”or“ heteroarylalkoxy ” Heteroaromatic group "refers to an aromatic group having one or more heteroatoms such as nitrogen, sulfur or oxygen as ring atoms. Monocyclic heteroaryl groups have 5 or 6 members and 1 or more ring heteroatoms such as nitrogen, oxygen and sulfur. Examples of monocyclic heteroaryl groups include 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4 Isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxazozolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1- Pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3-pyrida Genyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl, tetrazolyl, 2-thienyl and 3-thienyl.

A "substitutable ring carbon atom" in an aromatic group is a ring carbon atom bonded to a hydrogen atom. Hydrogen may be optionally substituted with a suitable substituent. Thus, the term "substitutable ring carbon atom" does not include ring carbon atoms that are shared when two rings are fused. "Substitutable ring carbon atoms" do not include ring carbon atoms when the structures are already depicted as being attached to a moiety other than hydrogen.

Examples of suitable substituents for the substitutable ring carbon atoms of the aryl (eg phenyl) group include halogen, R °, -OR °, -O (haloalkyl), -SR °, trialkylsilyl, boronate, alkyl Boronate, dialkylboronate, —NO _2, —CN, —N (R ′) ₂ , -NR'C0 ₂ R °, -NR'C (O) R °, -NR'NR'C (O) R °, -N (R ') C (O) N (R') ₂ , -NR 'NR'C (O) N (R ') ₂ , -NR'NR'C0 ₂ R °, -C (O) C (O) R °, -C (O) CH ₂ C (O) R °,- C0 ₂ R °, -C (0) R °, -C (O) N (R °) ₂ , -OC (O) R °, -OC (O) N (R °) ₂ , -S (0) ₂ R °, -SO ₂ N (R ') ₂ , -S (O) R °, -NR'SO ₂ N (R') ₂ ,-NR'S0 ₂ R °, -C (= S) N ( R ') ₂ , -NR'-C (= NH) -N (R') ₂ and -C (= NH) -N (R ') ₂ or 1,2-methylene-dioxy or 1,2-ethylene It includes two adjacent ring carbon atoms which may be substituted with deoxy.

Each R ° is independently hydrogen or an alkyl group.

Each R 'is Hydrogen or an alkyl group.

When an aralkyl group is characterized as having a certain number of carbon atoms, it is to be understood that it is the number of carbon atoms in the alkyl portion of the aralkyl specified. For example, a C1-C2 aralkyl group has one or two carbon atoms in the alkyl moiety.

Pharmaceutically acceptable salts include acidic salts of known RNase L activators containing amines or other basic groups, which can be obtained by reacting the compound with a suitable organic or inorganic acid such as hydrogen chloride, hydrogen bromide, acetic acid, perchloric acid, and the like. have. Other examples of such salts include sulfates, methanesulfonates, nitrates, malates, acetates, citrates, fumarates, tartrates [eg, (+)-tartrates, (-)-tartrates or racemate mixtures. Mixtures thereof, succinates, benzoates and salts with amino acids such as glutamic acid.

Salts of the known RNase L activators containing carboxylic acids or other acidic functionalities can be prepared by reaction with a suitable base. Such pharmaceutically acceptable salts may be prepared with bases that provide pharmaceutically acceptable cations, which include alkali metal salts (particularly sodium and potassium), alkaline earth metal salts (particularly calcium and magnesium), aluminum salts and Ammonium salts and trimethylamine, triethylamine, morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N, N'-dibenzylethylenediamine, 2-hydroxyethylamine, bis- (2- Hydroxyethyl) amine, tri- (2-hydroxyethyl) amine, procaine, dibenzylpiperidine, N-benzyl-β-phenethylamine, dehydroabiethylamine, N, N'-bisdehydro Salts prepared from physiologically acceptable organic bases such as abiethylamine, glucamine, N-methylglucamine, collidine, quinine, quinoline and basic amino acids such as lysine and arginine.

"Treatment" or "treating" means both therapeutic and prophylactic treatment.

An "effective amount" is the amount of RNase L activator found to be beneficial when the compound is administered to a subject in need of treatment (prophylactic or therapeutic). In the treatment of viral infections, "beneficial clinical outcome" includes a reduction in the severity of symptoms associated with the disease (eg, fever), a reduction in the duration of the disease and / or a delay in the onset of symptoms associated with the absence of treatment. do. In the treatment of cancer, beneficial clinical outcomes include lower tumor mass, lower tumor growth rate, lower metastasis, lower severity of symptoms associated with cancer and / or increased lifespan of the subject as compared to without treatment. In restenosis, "beneficial clinical outcome" includes the delay or slowing of narrowing of blood vessels in which angioplasty has been performed. The exact amount of RNase L activator found to be administered to a subject will depend on the type or severity of the disease or condition and the characteristics of the subject, such as general health, age, sex, weight and resistance to the drug. It will also depend on the extent or severity and type of disease or condition. Those skilled in the art will be able to determine suitable dosages that depend on these and other factors. The effective amount of RNase L activator found is typically about 0.1 mg / kg body weight per day to about 1000 mg / kg body weight per day, preferably 1 mg / kg per day to 100 mg / kg body weight per day.

The identified RNase L activators and their pharmaceutically acceptable salts, solvates and hydrates can be used in pharmaceutical preparations with pharmaceutically acceptable carriers or excipients. Suitable pharmaceutically acceptable carriers include inert solid fillers or diluents and sterile aqueous or organic solutions. The RNase L activators found will be present in such pharmaceutical compositions in amounts sufficient to provide the desired dosages in the ranges described herein. Formulations and administration techniques for the compounds of the invention are described in Remington: the Science and Practice of Pharmacy, 19 ^th edition, Mack Publishing Co., Easton, PA (1995).

For oral administration, the identified RNase L activators or salts thereof can be mixed with a suitable solid or liquid carrier or diluent to form capsules, tablets, dragees, powders, syrups, solutions, suspensions and the like.

Tablets, dragees, capsules and the like may comprise from about 1 to about 99% by weight of active ingredient and binder such as gum tragacanth, acacia, corn starch or gelatin; Excipients such as dicalcium phosphate; Disintegrants such as corn starch, potato starch, alginic acid; Lubricants such as magnesium stearate; And sweetening agents such as sucrose lactose or saccharin. When the dosage unit form is a capsule, it may contain a liquid carrier such as fatty oil in addition to the above types of substances.

Various other materials may be present as coatings or to modify the physical form of the dosage unit. For example, tablets may be coated with shellac, sugar or both. Syrups or elixirs may contain, in addition to the active ingredient, sucrose as a sweetener, methyl and propylparabens as preservatives, dyes and flavoring agents such as cherry or orange flavors.

For oral administration, the identified RNase L activators or salts thereof can be mixed with sterile aqueous or organic media to form injectable solutions or suspensions. For example, an aqueous solution of a solution in sesame or peanut oil, aqueous propylene glycol, and the like and a water-soluble pharmaceutically acceptable salt of the compound can be used. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Under ordinary conditions for storage and use, these preparations contain a preservative to inhibit microbial growth.

In addition to the formulations described previously, the disclosed RNase L activators can be formulated as long-term active formulations such as dipot preparations. Such long acting formulations may be administered subcutaneously by implantation or, for example, intramuscular injection.

Preferably, the identified RNase L activators or pharmaceutical formulations containing such compounds are in unit dosage form for administration to a mammal. The unit dosage form can be a unit dosage form known in the art and includes, for example, capsules, IV bags, tablets or vials. The amount of RNase L activator found in the unit dosage composition is an effective amount and may vary depending on the particular treatment involved. It will be appreciated that routine changes in dosage may be necessary depending on the age and condition of the patient. The dosage will depend on the route of administration, which can be a variety of routes including oral, aerosol, rectal, intradermal, subcutaneous, intravenous, intramuscular, intraperitoneal and intramuscular.

Synthetic Therapy:

Compounds of general structure III are described by Faull and Hull. "Some reactions of Ethyl 2-Anilino-4oxo-4,5-dihydrothiophen-3carboxylate." Perkin Transactions 1, 1981, 1078-1082. Z ² in formula (I) is S (isothiocyanate) or 0 (isocyanate). Condensation with substituted benzaldehydes will yield compounds having the structure of formula IV. Modification of ring A is accomplished by selecting a substituted aldehyde. The modification of ring B is described in Schemes 3 and 4:

Scheme 1:

Synthesis of Compound 1 is according to the following scheme. Isothiocyanatobenzene (V) will be combined with ethyl 4-chloro-3-oxobutanoate (VI) under conditions of Fall and Hull. Condensation of 2,3-dihydrothiophene intermediate (VII) with 3-hydroxybenzaldehyde will yield Compound 1.

Scheme 2:

Modification of the substituents on ring B will be accomplished before the pole and hu synthesis methods described in Scheme 1. Representative synthesis methods for producing Compound XII are shown in Scheme 3. Easily available (E) -methyl 3- (3-nitrophenyl) acrylate (VIII) can be catalytically reduced to the corresponding amine (IX). Formulation of isothiocyanate (X) through the combination of amine and carbon disulfide in the presence of DCC produced a starting reactant similar to I in Scheme 1. The production of compound XII depends on the subsequent pole-huls synthesis process.

Scheme 3:

Phosphonate compound XVIII will be prepared as shown in Scheme 4. Commercially available 3-aminophenol (XIII) will be protected via standard methods with dibenzylpyrocarbonate in dioxane / H ₂ O (1: 1) with NaOH or Et ₃ N (XIV production). Deprotection of the protected aminophenol with sodium hydride and binding to p-tolueneselfonyloxymethane phosphonate in DMF described above (compound XV production) followed by hydrogenation transfer removes the benzyloxycarbonyl protecting group. (Compound XVI generation). The conversion of free amines to isothiocyanates and condensation with ethyl 4-chloro-3-oxobutanoate to produce thiophene rings is similar to the synthesis of compound XII. After association of the thiophene ring with 3-hydroxybenzaldehyde, selective deprotection of dimethyl phosphonate ester (XVII) was achieved with aqueous pyridine to yield compound XVIII.

Scheme 4:

The invention is illustrated in the following examples, which are not intended to limit the invention in any way.

Example 1 Assay to Identify Agents Activating RNase L

The assay is based on fluorescence resonance energy transfer (FRET). Such methods include recombinant human RNase L produced in insect cells from baculovirus vectors and purified by FPLC (Thakur CS, Xu Z, Wang Z, Novince Z, Silverman RH. A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2 ', 5' oligoadenylates.Methods Mol Med 2005; 116: 103-13). Cleavable RNA substrates are 36-nucleotide synthetic oligoribonucleotides having a phosphor at the 5'-end (6-carboxyfluororesin, FAM) and a quencher at the 3 'end (black hole quencher-1, BHQ1). The RNA sequence is from the intergenic region into paramyxovirus, respiratory syncytial virus (RSV) genomic RNA. The RSV sequence was chosen because it contains several cleavage sites for RNase L (UU or UA) in the optimal situation for cleavage. To demonstrate the validity of the assay, RNA cleavage reactions were performed in 96-well black microtiter plates containing RNase L, cleavable FRET RNA substrates and 2-5A. EC ₅₀ was consistently obtained at 0.3 nM when using reliable trimer 2-5A [p ₃ A (2'5'A) ₂ ] as RNase L activator (concentration of activator providing 50% maximum activation) (FIG. 1A). The dephosphorylated trimer A (2'p5'A) ₂ was unable to activate RNase L, which is consistent with previous findings (FIGS. 1A & D). Dong B, Xu L, Zhou A, Hassel BA, Lee X, Torrence PF, Silverman RH. Intrinsic molecular activities of the interferon-induced 2-5A-dependent RNase. J Biol Chem 1994; 269 (19): 14153-8]. Inactive dephosphorylated 2-5A molecules are referred to as "cores 2-5A". The signal-to-noise ratio was about 10: 1, and the test was very robust. No signal increase over time was observed in reactions containing RNA but with RNase L or 2-5A.

Example 2 Identification of RNase L Inhibitors

High throughput screening was performed as described in Example 1 on a 34,000 small molecular weight ChemBridge DIVERset (ChemBridge Co., San Diego). Compounds that provide signals four times more than background were selected as potential positives for re-testing.

Seven “hits” were obtained (FIG. 2, Compounds 1-7). The heat has a molecular weight of 298 to 470 Da, and can activate RNase L in the micromolar range (EC ₅₀ ′ of 22 to 99 to M) (FIGS. 1 and 2). The kinetics of RNA cleavage in the FRET assay shows nearly maximal activation by pppA (2'p5'A) ₂ within 15 minutes, while compounds 1 and 2 require 60 to 90 minutes to achieve maximum levels of RNA degradation ( 1D-F).

Other structurally related compounds for these activators were identified in the ChemBridge repository using a searchable database (http://www.hit2lead.com). Two compounds structurally related to compound 1 are active (compound 8-11) or inactive (compound 12) (FIG. 2).

Example 3 Compounds 1 and 2 Activate RNase L in a Ribonuclease Assay with a Labeled Substrate

To demonstrate that these compounds can actually activate RNase L, alternatively conventional ribonuclease assays were performed with two different ³² P-labeled RNA substrates (FIG. 3A & B). In these assays, 25 μM of Compound 1 (FIG. 3A, lanes 3 & 4) and 25 μM Compound 2 (FIG. 3A, lanes 5 & 6) were purified from human RNase L and synthetic RNA substrate GGACUUUUUUUCCCUUUUUUUUCC- [ ³² P] pCp (SEQ ID NO .: 1 Incubation with and without). RNase L activated by 2-5A or Compound 1 or 2 cleaved the substrate on the 3 'side of the UU dinucleotide sequence, which is consistent with the results of the FRET assay.

Sequence specific substrate C ₇ U ₂ C ₁₂ (FIG. 3B) (SEQ ID NO .: 2) was used to support RNase L activation by inducible compounds 1 and 2. Compound 1 (25 μM) (lanes 4 & 5), and compound 2 (25 μM) (lanes 6 & 7) were incubated with and without the radiolabeled RNA substrate and RNase L, respectively. RNase L activated by 2-5A, Compound 1 or Compound 2 cleaves the substrate on the 3'-side of the UU dinucleotide sequence. In the absence of an activator, no product bands were detected.

RNase L dimerization is essential for nuclease activation. To monitor dimerization of RNase L, a protein crosslinking assay was performed (FIG. 3C). The oligomeric state of RNase L was determined by Western blot probed with monoclonal antibodies against RNase L. Monomer RNase L was converted to dimers in the presence of 2-5A, Compound 1 or Compound 2 (FIG. 3C). These data show that micromolar levels of Compounds 1 & 2 activate RNase L and dimerize enzymes.

Example 4 Compounds 1 and 2 interact with the domain of RNase L, a 2-5A analog binding domain.

A 2-5A competitive binding assay using surface plasmon resonance techniques for the Biacore model 3000 ^™ was used to determine whether the activator interacts with the 2-5A binding domain of RNase L. The 2-5A analogs used in these assays [p5 '(A2'p) ₃ A] linked to biotin via 2', 3 'terminal ribose are generally referred to the doctor. H. Provided by Dr. H. Sawai; Gunma University, Japan (Gunma University, Japan). Streptavidin chips (Biacore Inc.) were precoated with 2-5A-biotin. A mixture of RNase L (10 nM) and various concentrations of Compound 1 or Compound 2 or RNase L itself was transferred onto the chip.

Sensograms were recorded and the maximum resonance units (R _max ) in parallel were plotted as a function of compound concentration using the Via-Elevation ^™ software (FIG. 4). Dose dependent reduction occurred in the resonance response to Compound 1 or 2. The data show that these compounds compete with 2-5A for RNase L binding. Data analysis showed that the binding constants (K _d ) for compounds 1 and 2 were 18 μM and 12 μM, respectively.

Compound 5—Compounds 1 and 2 are not cytotoxic based on the tetrazolium conversion assay.

Cytotoxicity of Compounds 1 and 2 was assessed with the MTS (tetrazolium) conversion assay (Promega). Treatment of 50-M of Compound 1 for 3 days lowered cell viability to 76.3% and 98.2% of control (untreated) levels in DU145 and HeLa cells, respectively. Treatment with Compound 2 (also 50-M for 3 days) lowered cell viability to 95.2% and 86.5% as a percentage of untreated cells for DU145 and HeLa cells, respectively. The results for DU145 are shown in FIG. 5, and the results for Hela M cells are shown in FIG. 6. As can be seen from these results, these compounds lack significant cytotoxicity.

Example 6 Compound 2 exhibits antiviral activity against Parainfluenza Virus 3, Picornavirus and Encephalomaiocardis virus.

To measure antiviral activity, cells are infected with recombinant human parainfluenza virus 3 (HPIV3) and green fluorescent protein (GFP) cDNA is provided between the P and M genes (provided by collaborator A. Bannerner). Inserted (FIG. 7). The cell line used is HeLa M cells lacking RNase L or HeLa M cells stably expressing wild type RNase L or nuclease-lethal variant (R667A) RNase L (from the CMV promoter in vector pcDNAneo). Cells were infected at 0.1 MOI with HPIV3 / GFP for 1 hour in serum free medium (DMEM). The medium was removed, cells were washed with PBS and complete medium with 10% FBS with or without 50-M compounds was added. 24 hours after infection, cells were tested under inert fluorescence microscopy. Characteristic fusion cells (green) were observed with HPIV3 / GFP infection of treated and untreated RNase L-deficient HeLa M cells with the vector alone or expressing variant (R667A) RNase L. In contrast, compound 2 rapidly inhibited virus growth and inhibited the formation of fusion cells in cells expressing wild type RNase L. Fluorescence measurements showed that Compound 2 reduced viral growth by 8-fold in wild-type RNase L expressing cells, while only 1.2-fold decreased viral growth in the other two cell lines. In a similar experiment, compound 1 also has antiviral activity. Antiviral activity of Compound 2 was obtained against Encephalomaiocardis virus (see FIG. 8) and Picornavirus (data not shown). Thus, these compounds with low toxicity have general antiviral activity and are candidate antiviral drugs.

Example 7 Revealed RNase L Activators Inhibit Lotus Root Proliferation

Proliferation of the clonal cell line A10 (derived from the thoracic artery of DB1X embryonic rats and having many characteristic propensities of lotus root cells) using a colorimetric cell _titer 96 ^® AQ _ueous (CellTiter 96 ^® AQ _ueous ) cell proliferation assay Measured by (Promega). Tetrazolium compounds in this method [3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium, MTS] And penazine methosulfate (PMS), an electron binding reagent. Cells were seeded (3 × 10 ⁴ cells / well) in 96 well culture plates and treated with different concentrations of compound for 24 hours. Celta data 96 ^® AQ _ueous reagent (30% v / v dilution in PBS), was added to each well 50 Φ1. Plates were incubated at 37E C for 2 hours and absorbance measured at 490 nm with 96-well plate reader (Molecular Devices, model Spectra Max 340). The results show that lotus root cell proliferation is inhibited, indicating that these compounds can act as a new class of therapeutics for the prevention of restenosis. Compound 1 was tested.

Compound 8-Compound 2 exhibits antiviral activity against vaccinia virus (Westtern Reserve (WR)), DNA virus of the pox virus family.

Experiment protocol:

Virus Strains : Western Reserve (WR)

Cells :

Immortalized mouse embryo fibroblasts (MEF) were grown in RPMI supplemented with 10% FBS and p / s. Baby hamster kidney (BHK21) cells and African green monkey kidney cells (BSC40) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, p / s and 1-glu.

Titer : BHK21 (Little Hamster Kidney Cells) for Plaque Assay

MOI : Vaccania virus ( Western Reserve ) 5 PFU without serum medium for infection ( viral stock: 1 x 10 ⁹ PFU / ml )

Compound : Compound 2 at triple 0, 25 and 50 uM

Infection : Samples from each sample were collected after 24 h infection.

Way:

Plate MEF (RNase L) RL ^{+ / +} , MEF (RNase L) RL ^{− / −} and BSC40 cells in 6-well plates, and 80-85% confluent cells in 5 PFU / ml using serum free medium. Was infected with Vaccania virus (WR). After 45 minutes, cells were washed with PBS and the cells were reloaded with fresh medium with Compound 2.

After 24 hours of infection, the medium was removed, the cells scraped in PBS, frozen and thawed twice, and viral titers measured in BHK21 cells, an indicator cell line.

Plaque Black:

BHK21 cells were plated in 12 well plates and complete monolayers of cells were infected with different virus dilutions using serum free medium. After 45 min infection, the medium was removed, cells were washed twice with PBS, replaced with agar medium [mix of 2% agarose + (2x MEM + 20% FBS)], and after two days, a second of agar medium The layer was added 0.05% neutral red to count plaques.

The results are shown in FIGS. 9, 10, 11 and 12 and described in the brief description of the drawings.

While the invention has been particularly shown and described with reference to preferred embodiments, it will be apparent to those skilled in the art that changes in various forms and details may occur without departing from the scope of the invention as defined in the appended claims.

                                SEQUENCE LISTING <110> The Cleveland Clinic Foundation       Silverman, Robert <120> ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L    <130> 3786.1018002 <140> PCT / US07 / 009959 <141> 2007-04-25 <150> US 60 / 795,069 <151> 2006-04-25 <160> 2 FastSEQ for Windows Version 4.0 <210> 1 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> synthetic, 32P labeled with T4 RNA ligase <220> <221> misc_feature <222> (23) ... (24) <223> Radiolabeled nucleotide <400> 1 ggacuuuuuu ucccuuuuuu uccc 24 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> synthetic, 32P labeled with T4 RNA ligase <220> <221> misc_feature <222> (21) ... (22) <223> Radiolabeled nucleotide <400> 2 cccccccuuc cccccccccc cc 22  

Claims (79)

A pharmaceutical composition comprising a compound having the formula: or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or diluent:

Where Ring A and Ring B are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; Y is CH, N or N ⁺ -O ^-, and; Z ¹ and Z ² are independently 0 or S; Z ³ is CR ¹ or N; R ¹ is —H, —C (O) H, —C (O) R ²⁰ , —C (O) OR ³⁰ or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, Or a C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -C (O) R ²⁰ , -C (O) OR ³⁰ , -OC (O) H and -OC (O) R ²⁰ ; R ¹ is a group having the structure

R ² is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H or A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ ; Each R ²⁰ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ³⁰ is C1-C3 alkyl, C1-C3 haloalkyl or a group having a structure selected from:

2. The pharmaceutical composition of claim 1, wherein Z ¹ is O and Z ² is S. The pharmaceutical composition of claim 2, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

The compound of claim 1, wherein ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) at one or more substitutable ring carbon atoms. H, -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ , or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ Is substituted with a C1-C3 alkyl group substituted with -OC (O) H or -OC (O) R ²¹ , or Ring A is unsubstituted or substituted by a group having the formula:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ , -OCH ₂ R ⁴⁰ or Substituted with a C1-C3 alkyl group substituted with hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is independently H, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl, R ⁴⁰ is Pharmaceutical composition wherein -COOH, -P0 ₃ H ₂ , -SO ₃ H, -PO ₂ H or -SO ₂ H. 5. The ring B of claim 4, wherein ring B has one or more substitutable ring carbon atoms selected from halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H. , -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ or hydrate Substituted with a C1-C3 alkyl group substituted with a hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is independently C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 6. The compound of claim 4, wherein each R ²⁰ is independently C 1 -C 3 alkyl, each R ²¹ is independently C 1 -C 3 alkyl, and each R ³⁰ is independently, C 1 -C 3 alkyl And R ² is -H. The pharmaceutical composition of claim 2, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

The method of claim 7, wherein Ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H Or a C1-C3 alkyl group substituted with -OC (O) R ²¹ or a group having the structure:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ or hydroxyl, -OR ²¹ Is substituted with a C1-C3 alkyl group substituted with keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ⁴⁰ is -COOH, -P0 ₃ H ₂ , -SO ₃ H, -PO ₂ H or -SO ₂ H. The pharmaceutical composition of claim 8, wherein each R ²¹ is independently C 1 -C 3 alkyl and R ² is —H. The pharmaceutical composition of claim 2, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

The method of claim 10, Ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H Or a C1-C3 alkyl group substituted with OC (O) R ²¹ or a group having the structure:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , CH ₂ OCH ₂ R ⁴⁰ or hydroxyl, -OR ²¹ , keto Is substituted with a C1-C3 alkyl group substituted with -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ⁴⁰ is -COOH, -P0 ₃ H ₂ , -SO ₃ H, -PO ₂ H or -SO ₂ H. The pharmaceutical composition of claim 11, wherein each R ²¹ is independently C 1 -C 3 alkyl and R ² is —H. The pharmaceutical composition of claim 1, wherein the compound is a compound having a structural formula selected from: or a pharmaceutically acceptable salt thereof:

A pharmaceutical composition comprising a compound having the formula: or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or diluent:

Where Z ³ and Z ⁴ are independently 0 or S; Ring C and Ring D are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; R ³ is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H and A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ , Each R ²⁰ is, independently, C 1 -C 3 alkyl or haloalkyl. The pharmaceutical composition according to claim 14, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

The pharmaceutical composition of claim 15, wherein ring C is unsubstituted or substituted with C 1 -C 3 alkyl, halogen, = 0, hydroxyl or C 1 -C 3 alkoxy at one or more substitutable ring carbon atoms. The compound of claim 16, wherein ring D is halogen, C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, —OR ²¹ , —C (O) at one or more substitutable ring carbon atoms. ) H, -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or halogen, hydroxyl, -OR ²¹ , keto, -C (O) Or unsubstituted with a C1-C3 alkyl group substituted with OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is independently C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 18. The pharmaceutical composition of claim 17, wherein R ³ is -H. The pharmaceutical composition of claim 18, wherein ring C is unsubstituted. The pharmaceutical composition of claim 14, wherein the compound is a compound having a structure selected from: or a pharmaceutically acceptable salt thereof.

A pharmaceutical composition comprising a compound having the structure or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or diluent:

Where Z ⁵ and Z ⁶ are independently 0 or S; Ring E and Ring F are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; R ⁶ is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H and A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ ; R ⁷ and R ⁸ are independently —H, a C1-C5 alkyl group or a C1-C5 haloalkyl group; Each R ²⁰ is, independently, C 1 -C 3 alkyl or haloalkyl. The pharmaceutical composition of claim 21, wherein Z ⁵ is S and Z ⁶ is O. ²³ . The compound of claim 22, wherein ring E and ring F are independently halogen, C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, —OR ²¹ , at one or more substitutable carbon atoms. -C (O) H, -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or halogen, hydroxyl, -OR ²¹ , keto,- Unsubstituted or substituted with a C1-C3 alkyl group substituted with C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is independently C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. The pharmaceutical composition of claim 23, wherein R ⁶ is —H. The pharmaceutical composition of claim 24, wherein R ⁷ and R ⁸ are independently —H or methyl. The pharmaceutical composition of claim 21, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

A pharmaceutical composition comprising a compound having the structure or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or diluent:

Where X ¹ and X ² are independently CH ₂ , NH or 0; X ³ is -OC (O)-, -OC (S)-, -SC (O)-, -SC (S)-, -C (O)-, C (S)-, -CH ₂ -,- CH (CH ₃ ) —, —NHC (O) —, —C (O) NH—, —NHC (S) — or —C (S) NH—; Z ⁸ and Z ⁹ are independently S or 0; Ring G is substituted or unsubstituted at one or more substitutable ring carbon atoms; R ⁹ is halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ , -OC (O) H and -OC ( O) a C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from R ²⁰ ; R ¹⁰ and R ¹¹ are independently -H or halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ ,- A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from OC (O) H and -OC (O) R ²⁰ ; R ¹² is -H; C1-C5 alkyl groups unsubstituted or substituted with one or more R ²¹ ; One or more substitutable ring carbon atoms with R ²² Substituted or unsubstituted monocyclic aromatic groups; Or R ²³ at one or more substitutable ring carbon atoms Substituted or unsubstituted monocyclic C1-C3 aralkyl group; Each R ²⁰ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; Each R ²¹ is independently halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ , -OC (O) H or -OC (O) R ²⁰ ; Each of R ²² and R ²³ is independently C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, —OR ²⁴ , —C (O) H, —C (O) R ²⁴ , — C (O) OR ²⁴ , -OC (O) H, -OC (O) R ²⁴ or hydroxyl, -OR ²⁴ , keto, -C (O) OR ²⁴ , -OC (O) H or -OC (O C1-C3 alkyl substituted with R ²⁴ ; R ²⁴ is C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. The compound of claim 27, wherein R ¹² is —H; C 1 -C 5 alkyl group unsubstituted or substituted with R ²¹ ; Phenyl group unsubstituted or substituted with R ²² ; Or a C1-C3 phenalkyl group unsubstituted or substituted with R ²³ at one or more substitutable ring carbon atoms _. The pharmaceutical composition of claim 28, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

The pharmaceutical composition of claim 29, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

Where X ³ is -OC (O)-or -C (O)-. The pharmaceutical composition of claim 30, wherein the compound is a compound having the structure: or a pharmaceutically acceptable salt thereof.

32. The compound of claim 31, wherein ring G is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²⁵ , -C (O) H, at one or more ring carbon atoms, -C (O) R ²⁵ , -C (O) OR ²⁵ , -OC (O) H, -OC (O) R ²⁵ or hydroxyl, -OR ²⁵ , keto, -C (O) OR ²⁵ , -OC Unsubstituted or substituted by C1-C3 alkyl substituted with (O) H or -OC (O) R ²⁵ ; Each R ²⁵ is, independently, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 33. The pharmaceutical composition of claim 32, wherein R ⁹ is a C1-C5 alkyl group unsubstituted or substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloal cooxy. The compound of claim 33, wherein R ¹² is —H; Alkyl groups unsubstituted or substituted with R ²¹ ; Or a benzyl group unsubstituted or substituted with R ²³ at one or more substitutable ring carbon atoms; R ²¹ is halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy; Each R ²³ is independently C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, -OR ²⁴ , -C (O) H, -C (O) R ²⁴ , -C (O ) OR ²⁴ , -OC (O) H, -OC (O) R ²⁴ or hydroxyl, -OR ²⁴ , keto, -C (O) OR ²⁴ , -OC (O) H or -OC (O) R ²⁴ Pharmaceutical composition wherein the composition is substituted with C1-C3 alkyl. The pharmaceutical composition of claim 34, wherein R ¹⁰ is methyl, halomethyl or hydroxymethyl. 36. The compound of claim 35, wherein R ⁹ is C1-C5 alkyl; R ¹⁰ is -C (Cl) ₃ ; R ¹² is C 1 -C 5 alkyl or benzyl. The pharmaceutical composition of claim 27, wherein the compound is a compound having a structure selected from: or a pharmaceutically acceptable salt thereof.

A method of treating a subject with a viral infection, comprising administering to the subject an effective amount of the pharmaceutical composition of any one of claims 1-37. The method of claim 38, wherein the viral infection is caused by a virus having a single stranded RNA genome. The method of claim 38, wherein the virus is orthomyxoviruses (eg influenza virus), paramyxoviruses (eg respiratory syncytial virus & human parainfluenza virus-3), rhabdovirus (rhabdoviruses) (e.g., rabies virus), togaviruses (e.g., rubella virus and eastern equine encephalitis virus), Picornaviruses (eg, poliovirus & Coxsackieviruses), flaviviruses (eg, West Nile virus, dengue virus ( Dengue virus, and hepatitis C virus), bunyaviruses (eg, LaCrosse virus, Rift Valley Fever virus) Valley fever virus & Hantavirus, retroviruses (e.g. gammaretrovirus XMRV and lentivirus HIV-1 & -2), filoviruses (e.g. ebolavirus, hemorhagic Heberrhagic fever virus) or hepatitis B virus (a DNA virus with a genomic RNA mediator). The method of claim 38, wherein the viral infection is caused by a virus having a DNA genome. The method of claim 41, wherein the virus is human papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus or human herpesvirus-8. 42. The virus of claim 41 wherein the virus is a Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr. Virus (Epstein-Barr virus), adenovirus, varicella-zoster virus, human herpesvirus 6, human herpes virus 7, B19 parvovirus, adeno-associated virus (adeno- associated virus), BK virus, and JC virus, human papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus or human herpesvirus-8. A method of treating a subject with cancer, comprising administering an effective amount of the pharmaceutical composition of claim 1 to a subject having cancer. 45. The method of claim 44, wherein the cancer is prostate cancer, ovarian cancer, brain cancer or bone cancer. 38. A method of treating restenosis in a subject, comprising administering to the subject an effective amount of the pharmaceutical composition of any one of claims 1-37. Compounds having the formula: or pharmaceutically acceptable salts thereof

Where Ring A and Ring B are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; Y is CH, N or N ⁺ -O ^-, and; Z ¹ and Z ² are independently 0 or S; Z ³ is CR ¹ or N; R ¹ is —H, —C (O) H, —C (O) R ²⁰ , —C (O) OR ³⁰ or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, Or a C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -C (O) R ²⁰ , -C (O) OR ³⁰ , -OC (O) H and -OC (O) R ²⁰ ; R ¹ is a group having the structure

R ² is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H or A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ ; Each R ²⁰ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ³⁰ is C1-C3 alkyl, C1-C3 haloalkyl or a group having a structural formula selected from:

Provided that the compound is not a compound having a structure selected from: or a pharmaceutically acceptable salt thereof:

48. The compound of claim 47, wherein Z ¹ is O and Z ² is S. 49. The compound of claim 48, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

48. The compound of claim 47, wherein ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) at one or more substitutable ring carbon atoms. H, -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ , or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ Is substituted with a C1-C3 alkyl group substituted with -OC (O) H or -OC (O) R ²¹ , or Ring A is unsubstituted or substituted by a group having the formula:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ , -OCH ₂ R ⁴⁰ or Substituted with a C1-C3 alkyl group substituted with hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is independently H, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl, R ⁴⁰ is -COOH, -P0 ₃ H ₂ , -SO ₃ H, -PO ₂ H or -SO ₂ H. 51. The compound of claim 50, wherein ring B has one or more substitutable ring carbon atoms selected from halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H. , -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ or hydrate Substituted with a C1-C3 alkyl group substituted with a hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. The compound of claim 50 or 51, wherein each R ²⁰ is independently C 1 -C 3 alkyl, each R ²¹ is independently C 1 -C 3 alkyl, and each R ³⁰ is independently, C 1 -C 3 alkyl And R ² is -H. 49. The compound of claim 48, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

The method of claim 53, Ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H Or a C1-C3 alkyl group substituted with -OC (O) R ²¹ or a group having the structure:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , -CH ₂ OCH ₂ R ⁴⁰ or hydroxyl, -OR ²¹ Is substituted with a C1-C3 alkyl group substituted with keto, -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ⁴⁰ is —COOH, —P0 ₃ H ₂ , —SO ₃ H, —PO ₂ H or —SO ₂ H. 55. The compound of claim 54, wherein each R ²¹ is independently C1-C3 alkyl and R ² is -H. 49. The compound of claim 48, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

The method of claim 56, wherein Ring A is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms ) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H Or a C1-C3 alkyl group substituted with OC (O) R ²¹ or a group having the structure:

Ring B is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, OR ²¹ , -C (O) H, -C (O) at one or more substitutable ring carbon atoms R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ ,-(CH ₂ ) ₃ R ⁴⁰ , CH ₂ OCH ₂ R ⁴⁰ or hydroxyl, -OR ²¹ , keto Unsubstituted or substituted with a C1-C3 alkyl group substituted with -C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; R ⁴⁰ is —COOH, —P0 ₃ H ₂ , —SO ₃ H, —PO ₂ H or —SO ₂ H. 59. The compound of claim 57, wherein each R ²¹ is independently C1-C3 alkyl and R ² is -H. Compounds having the formula: or pharmaceutically acceptable salts thereof

Where Z ³ and Z ⁴ are independently 0 or S; Ring C and Ring D are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; R ³ is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H and A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ , Each R ²⁰ is, independently, C 1 -C 3 alkyl or haloalkyl, Provided that the compound is not a compound having a structure selected from: or a pharmaceutically acceptable salt thereof:

60. The compound of claim 59, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

61. The compound of claim 60, wherein ring C is unsubstituted or substituted with C1-C3 alkyl, halogen, = 0, hydroxyl or C1-C3 alkoxy at one or more substitutable ring carbon atoms. 62. The compound of claim 61, wherein ring D is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ , -C (O) H, -C (O) R ²¹ ,- C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or halogen, hydroxyl, -OR ²¹ , keto, -C (O) OR ²¹ , -OC (O) H or -OC Unsubstituted or substituted with a C1-C3 alkyl group substituted with (O) R ²¹ ; Each R ²¹ is, independently, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 63. The compound of claim 62, wherein R ³ is -H. 64. The compound of claim 63, wherein ring C is unsubstituted. Compounds having the formula: or pharmaceutically acceptable salts thereof

Where Z ⁵ and Z ⁶ are independently 0 or S; Ring E and Ring F are independently substituted or unsubstituted at one or more substitutable ring carbon atoms; R ⁶ is —H or halogen, hydroxyl, —OR ²⁰ , nitro, cyano, —C (O) H, —C (O) R ²⁰ , —C (O) OR ²⁰ , —OC (O) H and A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from -OC (O) R ²⁰ ; R ⁷ and R ⁸ are independently —H, a C1-C5 alkyl group or a C1-C5 haloalkyl group; Each R ²⁰ is, independently, C 1 -C 3 alkyl or haloalkyl, Provided that the compound or pharmaceutically acceptable salt thereof has a structure other than:

67. The compound of claim 65, wherein Z ⁵ is S and Z ⁶ is O. 67. The compound of claim 66, wherein ring E and ring F are independently halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²¹ at one or more substitutable carbon atoms. -C (O) H, -C (O) R ²¹ , -C (O) OR ²¹ , -OC (O) H, -OC (O) R ²¹ or halogen, hydroxyl, -OR ²¹ , keto,- Unsubstituted or substituted with a C1-C3 alkyl group substituted with C (O) OR ²¹ , -OC (O) H or -OC (O) R ²¹ ; Each R ²¹ is, independently, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 68. The compound of claim 67, wherein R ⁶ is -H. The compound of claim 68, wherein R ⁷ and R ⁸ are independently —H or methyl. A compound of the formula: or a pharmaceutically acceptable salt thereof:

Where X ¹ and X ² are independently CH ₂ , NH or 0; X ³ is -OC (O)-, -OC (S)-, -SC (O)-, -SC (S)-, -C (O)-, C (S)-, -CH ₂ -,- CH (CH ₃ ) —, —NHC (O) —, —C (O) NH—, —NHC (S) — or —C (S) NH—; Z ⁸ and Z ⁹ are independently S or 0; Ring G is substituted or unsubstituted at one or more substitutable ring carbon atoms; R ⁹ is halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ , -OC (O) H and -OC ( O) a C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from R ²⁰ ; R ¹⁰ and R ¹¹ are independently -H or halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ ,- A C1-C5 alkyl group unsubstituted or substituted with one or more groups selected from OC (O) H and -OC (O) R ²⁰ ; R ¹² is -H; C1-C5 alkyl groups unsubstituted or substituted with one or more R ²¹ ; Monocyclic aromatic groups unsubstituted or substituted with R ²² at one or more substitutable ring carbon atoms; Or R ²³ at one or more substitutable ring carbon atoms Substituted or unsubstituted monocyclic C1-C3 aralkyl group; Each R ²⁰ is, independently, C1-C3 alkyl or C1-C3 haloalkyl; Each R ²¹ is independently halogen, hydroxyl, -OR ²⁰ , nitro, cyano, -C (O) H, -C (O) R ²⁰ , -C (O) OR ²⁰ , -OC (O) H or -OC (O) R ²⁰ ; Each of R ²² and R ²³ is independently C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, —OR ²⁴ , —C (O) H, —C (O) R ²⁴ , — C (O) OR ²⁴ , -OC (O) H, -OC (O) R ²⁴ or hydroxyl, -OR ²⁴ , keto, -C (O) OR ²⁴ , -OC (O) H or -OC (O C1-C3 alkyl substituted with R ²⁴ ; R ²⁴ is C1-C3 alkyl or C1-C3 haloalkyl, Provided that the compound is not a compound having a structure selected from: or a pharmaceutically acceptable salt thereof:

71. The compound of claim 70, wherein R ¹² is -H; C 1 -C 5 alkyl group unsubstituted or substituted with R ²¹ ; Phenyl group unsubstituted or substituted with R ²² ; Or a C1-C3 phenalkyl group unsubstituted or substituted with R ²³ at one or more substitutable ring carbon atoms _. The compound of claim 71, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

73. The compound of claim 72, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

Where X ³ is -OC (O)-or -C (O)-. The compound of claim 73, wherein the compound is a compound having the formula: or a pharmaceutically acceptable salt thereof:

75. The compound of claim 74, wherein ring G is halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR ²⁵ , -C (O) H, at one or more ring carbon atoms, -C (O) R ²⁵ , -C (O) OR ²⁵ , -OC (O) H, -OC (O) R ²⁵ or hydroxyl, -OR ²⁵ , keto, -C (O) OR ²⁵ , -OC Unsubstituted or substituted by C1-C3 alkyl substituted with (O) H or -OC (O) R ²⁵ ; Each R ²⁵ is, independently, C 1 -C 3 alkyl or C 1 -C 3 haloalkyl. 76. The compound of claim 75, wherein R ⁹ is a C1-C5 alkyl group unsubstituted or substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy. 77. The compound of claim 76, wherein R ¹² is -H; Alkyl groups unsubstituted or substituted with R ²¹ ; Or a benzyl group unsubstituted or substituted with R ²³ at one or more substitutable ring carbon atoms; R ²¹ is halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy; Each R ²³ is independently C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, nitro, cyano, hydroxy, -OR ²⁴ , -C (O) H, -C (O) R ²⁴ , -C (O ) OR ²⁴ , -OC (O) H, -OC (O) R ²⁴ or hydroxyl, -OR ²⁴ , keto, -C (O) OR ²⁴ , -OC (O) H or -OC (O) R ²⁴ C1-C3 alkyl substituted with C. 78. The compound of claim 77, wherein R ¹⁰ is methyl, halomethyl or hydroxymethyl. 79. The compound of claim 78, wherein R ⁹ is C1-C5 alkyl; R ¹⁰ is -C (Cl) ₃ ; R ¹² is C 1 -C 5 alkyl or benzyl.

Images