EP1753882A2 - Expression genique et polymorphismes associes au cancer du poumon - Google Patents
Expression genique et polymorphismes associes au cancer du poumonInfo
- Publication number
- EP1753882A2 EP1753882A2 EP20040796566 EP04796566A EP1753882A2 EP 1753882 A2 EP1753882 A2 EP 1753882A2 EP 20040796566 EP20040796566 EP 20040796566 EP 04796566 A EP04796566 A EP 04796566A EP 1753882 A2 EP1753882 A2 EP 1753882A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- lasl
- protein
- gene
- expression
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- Lung cancer is the leading cause of mortality from cancer in both men and women in developed countries. There is evidence that although incidence is almost always associated with environmental factors such as smoking or occupational exposure to carcinogens, susceptibility has a genetic component, with early onset lung cancer following Mendelian inheritance. Moreover, susceptibility is largely intrinsic to the lung itself, as shown by classical experiments involving lung explants from sensitive and resistant mice. [004] Accordingly, it is desirable to have methods to provide additional information about the genetic profile of an individual. This information is useful in the context of cancer, including lung cancer, to identify individuals who are at risk for developing the disease so as to provide preventive care or prophylaxis. It is also useful for determining methods of treatment that are optimized for an individual's particular cancer profile.
- This invention relates to diagnosis and treatment of cancer.
- it relates to cancers that involve the expression of the Lung Adenoma Susceptibility- 1 Gene (Lasl) gene and/or its product, the Lasl protein.
- Lasl is believed to be an inhibitor of cellular proliferation by influencing cell cycle.
- the Lasl is reported herein by Applicants as a gene that is associated with the pulmonary adenoma susceptibility 1 (Pasl) chromosomal locus that has been described in species such as mice and humans.
- Human groups exist that have an above average probability of being diagnosed with and/or of developing particular cancers (i.e., high-risk groups) and are appropriate candidates for evaluation of Lasl expression, and/or therapeutic or prophylactic use of Lasl.
- Such human groups may be at high risk because of exposure to particular environmental materials or circumstances (e.g., smoking or exposure to tobacco smoke, occupational exposure to carcinogens such as urethane and other agents), because of familial susceptibility to certain cancers (e.g., genetic inheritance of genes causing increased susceptibility), as a result of the presence of mutant forms of Lasl or decreased levels of expression of Kirsten rat sarcoma oncogene 2 ("Kras2”), for other reasons, or for combinations of causes and reasons.
- Kras2 Kirsten rat sarcoma oncogene 2
- the invention provides methods for characterizing the etiology of a cancer in an individual by testing at least one cancer cell from the individual for at least one of a reduction in the level of expression of Lasl as compared to normal cells, and one or more mutations in the at least one cancer cell's genomic Lasl gene.
- the levels of Lasl expression in normal cells may be determined from non-cancer cells in the individual, or based on standard levels of Lasl expression in normal cells of other individuals.
- the at least one cancer cell is tested for the presence of a mutation at codon 60 of the Lasl gene which encodes a mutant Lasl protein.
- the at least one cancer cell is tested for the level of Lasl gene expression.
- the level of Las 1 expression may be tested by measuring mRNA transcribed from the Lasl gene.
- the level of Las 1 expression may be tested by measuring the amount of Lasl protein in the cell.
- the level of Lasl expression may be tested using an antibody to Lasl protein. [010] According to one embodiment, the presence of a mutation at codon 60 of the Lasl gene is tested by analyzing the coding sequence of the Lasl gene.
- the presence of a mutation at codon 60 of the Lasl gene is tested by using an antibody that detects the mutant Lasl protein.
- the methods also comprise testing the at least one cancer cell from the individual for at least one of a reduction in the level of expression, or one or more mutations of one or more of the genes in the Pas-1 locus, which include Kras2, Lrmp, Bcatl, AK016641 and AK015530.
- the methods comprise testing the at least one cancer cell from the individual for at least one of a reduction in the level of expression of Kras2 as compared to non-cancer cells from the individual, and one or more mutations in the at least one cancer cell's genomic Kras2 gene.
- the level of Pasl gene expression may be tested by measuring mRNA transcribed from one or more of the Pasl genes.
- the level of Pasl expression may be tested by measuring the amount of one or more of the Pasl gene products in the cell.
- the level of expression of one or more of the Pasl gene products may be tested using an antibody to one or more of such gene products.
- the levels of expression one or more of the Pasl genes in normal cells may be determined from non-cancer cells in the individual, or based on standard levels of expression of one or more of the Pasl genes in normal cells of other individuals.
- the invention provides methods for identifying an individual who is at risk of developing cancer by testing at least one cell from the individual for at least one of a reduction in the level of expression of Lasl as compared to normal cells, and one or more mutations in the at least one cell's genomic Lasl gene.
- the at least one cell is tested for the presence of a mutation at codon 60 of the Lasl gene which encodes a mutant Lasl protein.
- the at least one cell is tested for the level of Lasl gene expression.
- the level of Las 1 expression may be tested by measuring mRNA transcribed from the Lasl gene.
- the level of Las 1 expression may be tested by measuring the amount of Lasl protein in the cell.
- the level of Lasl expression may be tested using an antibody to Lasl protein.
- the presence of a mutation at codon 60 of the Lasl gene is tested by analyzing the coding sequence of the Lasl gene.
- the presence of a mutation at codon 60 of the Lasl gene is tested by using an antibody that detects the mutant Lasl protein.
- the methods also comprise testing the at least one cell from the individual for at least one of a reduction in the level of expression, or one or more mutations of one or more of the genes in the Pas-1 locus, which include Kras2, Lrmp, Bcatl, AK016641 and AK015530.
- the methods comprise testing the at least one cell from the individual for at least one of a reduction in the level of expression of Kras2 as compared to normal cells, and one or more mutations in the at least one cell's genomic Kras2 gene.
- the level of Pasl gene expression may be tested by measuring mRNA transcribed from one or more of the Pasl genes.
- the level of Pasl expression may be tested by measuring the amount of one or more of the Pasl gene products in the cell.
- the level of expression of one or more of the Pasl gene products may be tested using an antibody to one or more of such gene products.
- the levels of expression one or more of the Pasl genes in normal cells may be determined from other cells in the individual, or based on standard levels of expression of one or more of the Pasl genes in normal cells of other individuals. [019]
- the invention also provides methods for treating an individual identified as having a mutant Lasl gene or reduced expression of Lasl protein by administering to the individual an agent that restores Lasl protein function.
- the individual may have an adenocarcinoma, such as an adenocarcinoma of the lung.
- the agent is a Lasl protein.
- the Lasl protein may be administered in a fashion such that it is specifically targeted to cancer tissue in the individual.
- the agent is a polynucleotide encoding a Lasl protein, wherein the polynucleotide is in operable connection with a promoter that directs its expression.
- the treatment is prophylactic.
- the genes at the Pas-1 locus include the Lasl, Lrmp, Bcatl, AK016641 and AK015530, and Kras2 genes or ORFs (Figs. 10-19). Sequences for mRNAs encoding Lrmp, Ak015530, and Ak016641 can be found with the National Center for Biotechnology Information GenBank (GI: 6678713, 12853911 and 12855487, respectively). The sequence for Bcatl can be found in Benvenisty, N. et. al. (1992) Genes Dev., 6, 2513-2523. The sequence for the Kras2 ORF is found in application for US patent, 20030133910. The sequences for Lasl reported in this paper have been deposited in the GenBank database (accession nos. AY423542 for mouse and AY423543 for human. The sequences for these molecules are herby incorporated by reference, in their entirety.
- this invention relates to methods for the treatment of lung cancer, therapeutically to prevent or decrease the proliferation of cancer cells, or prophylactically to prevent formation of lung cancer.
- Such methods comprise increasing levels of non-mutant Lasl protein, or a functional fragment thereof, in such cells.
- the invention provides a method for therapeutic or prophylactic treatment of a cancer in an individual by administering to the individual one or more agents comprising Lasl protein, or a functional fragment thereof, that inhibits proliferation of cancer cells.
- a Lasl protein, or a functional fragment thereof may be administered in a fashion such that it is specifically targeted to cancer tissue.
- introduction or transfer of a Lasl protein, or a functional fragment thereof is achieved by any of a variety of methods known in the art to introduce proteins to or into cells.
- the invention provides a method for therapeutic or prophylactic treatment of a cancer in an individual by administering to the individual one or more agents comprising a polynucleotide encoding a Lasl protein, or a functional fragment thereof, wherein the polynucleotide is in operable connection with a promoter that directs its expression.
- the polynucleotide is administered in a fashion such that it is specifically targeted to cancer tissue, and is in an amount sufficient to achieve expression of Lasl protein, or a functional fragment thereof, that inhibits proliferation of cancer cells.
- introduction or transfer of a polynucleotide, such as a DNA molecule or molecules, specifically a DNA molecule encoding one or more Lasl protein, or a functional fragment thereof, into a cell is achieved by any of a variety of methods known in the art to introduce polynucleotides into cells.
- the invention provides a method for treating an individual identified as having a disease associated with reduced expression or mutation of Lasl gene by administering to the individual at least one compound that restores the individual's Lasl proteins ability to influence cell cycle and inhibit cancer cell proliferation.
- the compositions that are used according to the methods of this invention may be administered prior to, concurrent with, or after administration of other cancer therapeutic or prophylactic treatments.
- the agent or agents are administered to an individual identified as having a cancer associated with mutant Lasl genes or reduced expression of Lasl.
- the agent or agents are administered to an individual having an adenocarcinoma, in particular, an adenocarcinoma of the lung.
- Fig. 1 shows the amino acid sequence for Lasl protein from human.
- Fig. 2 shows the nucleotide sequence which encodes the human Lasl protein.
- Fig. 3. shows the amino acid sequence for the mouse Lasl protein.
- Fig. 4 shows the nucleotide sequence which encodes the mouse Lasl protein.
- Fig. 5. Characterizations of the Pasl locus.
- A Substitution mapping of Pasl QTL for mouse lung tumor susceptibility with the use of a set of congenic strains. The open boxes represent a chromosome fragment from the donor strain (A/J), and the solid boxes represent a chromosome fragment from the recipient strains (C57BL/6J). Eight microsatellite markers were used to alleleotype the 26.1 cM region containing the Pasl locus.
- AB is a congenic strain in which the entire chromosomal region between markers D6MIT54 and D6MIT373 has been substituted into the recipient C57BL6J strain from the donor A/J strain.
- Congenic substrains 1 through 8 carry various donor (A/J) fragments as indicated.
- BB is the control congenic strain in which no substitution was found in the entire region.
- B Expression of Pasl candidate genes in mouse lungs. Total RNAs were isolated from A/J and C57BL/6J normal lung tissues. Expression levels of five candidate genes were tested using RT-PCR and Northern blot analysis. For each autoradiograph, Upper panel, individual candidate genes; lower panel, b-actin control.
- Lrmp contains 5 functional polymorphisms including codon 31 (Asp to Gly), codon 56 (Gly to Asp), codon 58 (Phe to Leu), codon 438 (Arg to Gly), and codon 537 (Pro to Leu).
- Fig. 6 Cluster alignment of mouse rat human and Ciona intestinalis Lasl protein sequences. The sequences of mouse, rat, human, and Ciona intestinalis Lasl are presented. Identical residues are shaded in black. Residues identical in at least two species are shaded in black.
- the codon 60 encodes an Asparagine (AAT) in A/J mice and a Serine (AGT) in C57BL/6J mice.
- AAT Asparagine
- AGT Serine
- the human protein sequence (67% identities and 81% positives) is based on predicted human Lasl cDNA sequence. Searching NCBI protein database using mouse protein sequence revealed a rat homologous protein, encoded by NCBI predicted gene LOC297720 (84% identities and 92% positives).
- the mouse Lasl protein is also homologous to a Ciona intestinalis protein axonemal p83.9 (GI: 20086393, 33% identities and 52% positives).
- Fig. 7 Characterization of the Lasl gene as a candidate Pasl gene. ⁇ A ⁇ Colony formation assay. Inhibition of colony formation by transfected Lasl in LMl cell line (a) and MC14 cell line (b). LMl and MC14 cells of the same passage were transfected under identical conditions with 4_g of purified plasmid DNA of Lasl-A/J- ⁇ cDNA3.1, Lasl- C57BL/6J-pcDNA3.1, or pcDNA3.1 vector alone. 1.5 x 106 cells were seeded into each of the four (10-cm) dishes, and incubated in proper medium plus G418 (50 _g ml) for 14 days.
- Myc-tagged Lasl plasmids were transfected into NIH/3T3 and COS7 cells and visualized by immunofluorescent staining using rhodamine (red). Nuclei were stained with DAPI (blue).
- A/J Lasl-A/J-pcDNA3.1 transfected cells
- C57BL/6J Lasl-C57BL/6J-pcDNA3.1 transfected cells
- vector pcDNA3.1 vector transfected cell, control, untransfected negative control cells.
- Fig. 8. Kras2 allelic effects on chemically induced lung tumorigenesis. (A) Allelic effects on tumor multiplicity.
- A/J (open bars) or C57BL/6J (solid bars) hybrid mouse groups the remaining A/J or C57BL/6J Kras2 allele in Kras2+/- mice has no significant differential effect on lung tumor multiplicity 3.82- (A/J Kras2+/- mice/A/J Kras2+/+ mice) vs 4.88- (C57BL/6J Kras2+/- mice/C57BL/6J Kras2+/+ mice) fold (urethane treated group); 4.76- vs 5.10-fold (MNU treated group) between the two Kras2 alleles. (B) Allelic effects on tumor volume.
- A/J or C57BL/6J hybrid groups the remaining A/J or C57BL/6J Kras2 allele in Kras2+/- mice have a significant differential effect on lung tumor progression 31.73- (A/J Kras2+/- mice/A/J Kras2+/+ mice) vs 8.04- (C57BL/6J Kras2+/- mice/C57BL/6J Kras2+/+ mice) fold (urethane treated group); 56.85- vs 14.47- fold (* pO.OOl) between the two Kras2 alleles.
- K-Ras2 activity in large and small tumors from Kras2+/+ and Kras2+/- mice was presented that corresponds to A/J and C57BL/6J alleles.
- b, and s correspond to large (> 4 mm in diameter) and small tumors (1 ⁇ 4 mm in diameter), respectively. Note: half the amount of lysate was used in the pull-downs from A/J tumors (lanes 1-4) compared to C57BL/6J tumors (lanes 5-8).
- Fig. 9 shows all genes found in the narrowed Pasl QTL region encompassed by markers D60SU6 and D60SU12.
- Fig. 10 shows the nucleotide sequence for human LRMP.
- Fig. 11 shows the nucleotide sequence for mouse LRMP.
- Fig. 12 shows the human BCAT1 cDNA sequence.
- Fig. 13 shows the mouse BCAT1 cDNA sequence.
- Fig. 14 shows the human Kras2 isoform a cDNA sequence.
- Fig. 15 shows the human Kras2 isoform b cDNA sequence.
- Fig. 16 shows the mouse Kras2 isoform a cDNA sequence.
- Fig. 17 shows the mouse Kras2 isoform b cDNA sequence.
- Fig. 18 shows the mouse Ak016641 cDNA sequence.
- Fig. 19 shows the mouse Ak015530 cDNA sequence. DETAILED DESCRIPTION OF THE INVENTION [049]
- the present invention will now be described with occasional reference to the specific embodiments of the invention. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
- cDNA means a DNA prepared using messenger RNA (mRNA) as template. In contrast to genomic DNA and DNA polymerized from a genomic, non- or partially-processed RNA template, cDNA contains coding sequences of the corresponding protein in the absence of introns and other non-translated nucleic acids.
- Gene refers broadly to any region or segment of DNA associated with a biological molecule or function. Thus, genes include coding sequence, and may further include regulatory regions or segments required for their expression. Genes may also include non- expressed DNA segments that, for example, from recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest, or synthesizing from known or predicted sequence information, and may include sequences encoding desired parameters. [024] "Isolated,” when used herein in the context of a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state.
- метод ⁇ ани ⁇ иров is preferably in a homogeneous state although it can be in either dry form or an aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant molecular species present in a preparation is substantially purified. An isolated gene is separated from open reading frames that flank the gene and encode a protein other than the gene of interest. [056] "Malignant” or "cancerous” or “cancer” refers to the properties of cells or tissue that distinguish them from benign or normal cells. Malignant, cancerous, and cancer cells invade, grow and destroy adjacent tissue, metastasize, and usually grow more rapidly than benign cells.
- Naturally-occurring and wild-type are used herein to describe something that can be found in nature as distinct from being artificially produced by man.
- a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and that has not been intentionally modified by man in the laboratory is naturally-occurring.
- wild-type is used herein to refer to the naturally-occurring or native forms of proteins and their encoding nucleic acid sequences that lack mutations or polymorphisms that alter their function. Therefore, in the context of this application, 'wild-type' includes naturally occurring variant forms of Lasl and Kras2 genes, either representing splice variants or genetic variants between individuals, which may require different probes for selective detection.
- Normal cell means a non-cancerous or non-malignant cell.
- Nucleic acid and “polynucleotide” refer to deoxyribonucleotides or ribonucleotides, nucleotides, oligonucleotides, polynucleotide polymers and fragments thereof in either single- or double-stranded form.
- a nucleic acid may be of natural or synthetic origin, double-stranded or single-stranded, and separate from or combined with carbohydrate, lipids, protein, other nucleic acids, or other materials, and may perform a particular activity such as transformation or form a useful composition such as a peptide nucleic acid (PNA).
- PNA peptide nucleic acid
- nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and may be metabolized in a manner similar to naturally-occurring nucleotides.
- a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al. (1991) Nucleic Acid Res.
- nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
- Proliferation means growth and reproduction, i.e., division of cells.
- An important aspect of this invention is that the Lasl and Kras2 genes that are expressed in cells are believed to inhibit or suppress cell proliferation associated with cancer or malignancy.
- “Inhibition” and “suppression,” as used with reference to cell proliferation are terms well known to those skilled in the art, and refer to slowing or stopping of cell division such that cells do not increase in number. The magnitude of such slowing of cell growth can be variable.
- any alteration of the growth of cells that comprise cancerous or precancerous cells or tissue falls within the scope of this application.
- Sample refers to an isolated sample of material, such as material obtained from an organism, containing nucleic acid molecules.
- a sample may comprise a bodily fluid; a cell; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; genomic DNA, RNA, or cDNA in solution or bound to a substrate; or a biological tissue or biopsy thereof.
- a sample may be obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
- Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and northern hybridizations are sequence dependent, and are different under different environmental parameters. Nucleic acids having longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Acid Probes part I chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, N.Y. Generally, highly stringent hybridization and wash conditions are selected to be 5 °C. lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- T m thermal melting point
- a probe will hybridize to its target subsequence, but to no other sequences.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
- Very stringent conditions are selected to be equal to the T m for a particular probe.
- An example of stringent hybridization conditions for hybridization of complementary nucleic acids that have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42 °C, with the hybridization being carried out overnight.
- An example of highly stringent wash conditions is 0.15 M NaCl at 72 °C for 15 minutes.
- An example of stringent wash conditions is a 0.2x SSC wash at 65 °C for 15 minutes (see, Sambrook, infra., for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal.
- An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 45 °C for 15 minutes.
- An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 40 °C for 15 minutes.
- stringent conditions typically involve salt concentrations of less than 1.0 M Na ion, typically 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least 30 °C.
- Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.
- a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially similar if the polypeptides that they encode are substantially similar.
- Target polynucleotide refers to a nucleic acid to which a polynucleotide probe can hybridize by base pairing and that comprises all or a fragment of a gene that encodes Lasl, Kras2 or another other Pasl gene product.
- sequences of target and probes may be 100% complementary (no mismatches) when aligned. In other instances, there may be up to a 10% mismatch.
- Target polynucleotides represent a subset of all of the polynucleotides in a sample that encode the expression products of all transcribed and expressed genes in the cell or tissue from which the polynucleotide sample is prepared.
- the gene products of target polynucleotides are Lasl or Kras2, or other Pasl gene products, or fragments thereof.
- Target Region means a stretch of consecutive nucleotides comprising all or a portion of a target sequence such as a gene or an oligonucleotide encoding Lasl, Kras2 or another Pasl gene product.
- Target regions may be 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 5,6, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200 or more polynucleotides in length.
- target regions are 70 nucleotides in length, and lack secondary structure.
- Target regions may be identified using computer software programs such as OLIGO 4.06 software (National Biosciences, Plymouth MN), LASERGENE software (DNASTAR, Madison Wis.), MACDNASIS (Hitachi Software Engineering Co., San Francisco, Calif.) and the like. [031] Methods For Characterizing The Etiology Of A Cancer and For Identifying An Individual Who Is At Risk Of Developing Cancer
- Polynucleotides encoding the human and mouse Lasl protein are shown in Fig. 2 and Fig. 4; Figs. 10-19 show various of the mouse and human sequences for other genes or cDNAs at the Pasl locus.
- Polynucleotides comprising all or a portion of these sequences, or having sequences which are the complement thereof, are useful tools for designing hybridization probes for screening tissue samples for Lasl and other Pasl gene mutations, particularly tissues from patients at risk for, known to have, or suspected of having lung cancer, and for preparing primers useful for isolating and identifying cDNA clones and genomic clones encoding the Lasl and other Pasl genes and allelic forms thereof.
- Such hybridization techniques are known to those of skill in the art.
- tissue samples are obtained from cancerous tissue or tissue that is believed to be or may become cancerous.
- normal tissue is also obtained. According to such embodiments, a comparison may be made between the genetic profiles of the actual or suspected cancer cells and normal cells.
- Primers can be used to obtain Lasl and other Pasl polynucleotides from cDNA libraries, for screening tissue samples, or for diagnostic purposes.
- the primers may be used according to polymerase chain reaction (PCR) technologies to amplify transcripts of the genes which encode the Lasl and other Pasl gene products, or portions of such transcripts.
- PCR polymerase chain reaction
- Primers may comprise 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 5,6, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 or more nucleotides, and have a G+C content of 40% or greater.
- Such oligonucleotides can be at least 98%, 99% or more complementary with a portion of the DNA strand, i.e., the sense strand, which encodes the respective Lasl or other Pasl gene or a portion of its corresponding antisense strand.
- Primers that have 100% complementarity with the antisense strand of a double-stranded DNA molecule which encodes a Lasl or other Pasl gene product have a sequence which is identical to a sequence contained within the sense strand.
- Isolated allele specific primers can be used for diagnosis of an individual having or at risk of developing cancer, particularly lung cancer, more particularly adenocarcinoma of the lung.
- Allele specific primers for Lasl or other Pasl genes are produced based upon identification of regions within the Lasl or other Pasl gene encoding one or more polymorphisms, or SNPS, such as the polymorphism identified at Lasl codon 60.
- the primers of the invention are designed to hybridize to the upstream and downstream (e.g., flanking) sequences of target regions of the Lasl or other Pasl gene so as to bracket the locus of such one or more SNPs.
- the primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids flanking the polymorphic locus. Conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization, such as DNA polymerase, and a suitable temperature and pH. In some embodiments, primers are single stranded for maximum efficiency in amplification. Primer length is determined based on many factors, including temperature, buffer, and nucleotide composition. [066] Primers are typically sufficiently complementary to hybridize with their respective strands under conditions which allow the agent for polymerization to perform.
- the primers should have sufficient complementarity with the 5 1 and 3* sequences flanking the target sequence, for example, the Lasl coding sequence, to hybridize therewith and permit amplification of one or more polymorphic locus, such as the SNP at codon 60.
- the oligonucleotide primers of the invention may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments thereof. In one such automated embodiment, diethylphosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al. (Tetrahedron Letters, 22:1859-1862, 1981). One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.
- Lasl -designed primers may be used in RT-PCR to quantify the amount of Lasl mRNA in the test tissues and cells.
- examples of such primers include, but are not limited to: [069] 5'- GACCAAAGCCGAGCGACTGCGGC; [070] 3'-TCGAAGAAGTAGTTCTGTGGC
- Lasl -designed primers may be used to analyze tissue sections from individuals by an RT in situ-PCR hybridization protocol as described Nuovo et al (1994) in Am J. Pathol., 144, 659-666, which is specifically incorporated herein by reference.
- Polynucleotide Probes may be used to analyze tissue sections from individuals by an RT in situ-PCR hybridization protocol as described Nuovo et al (1994) in Am J. Pathol., 144, 659-666, which is specifically incorporated herein by reference.
- Polynucleotide probes are useful for detecting transcripts of the genes which encode the Lasl and Kras2 proteins and other Pasl gene products.
- Such polynucleotide probes may comprise 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 5,6, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, Or 200 or more nucleotides.
- Polynucleotide probes have a sequence which is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more complementary with a contiguous sequence contained within the sense strand or antisense strand of a double stranded DNA molecule which encodes the Lasl or Kras2 protein (i.e., the target region of the Lasl or Kras2 gene).
- Polynucleotide probes bind to the sense strand or antisense under stringent conditions, and in some instances under highly stringent conditions.
- the polynucleotide probes may be used in Northern assays to detect transcripts of Lasl homologous genes and in Southern assays to detect Lasl homologous genes. At least some of said polynucleotide probes comprise a polynucleotide sequence that is complementary to a target region of a Lasl or Kras2 gene or one or more other Pasl genes.
- the polynucleotide probes may be genomic DNA or cDNA or mRNA, or any RNA- like or DNA-like material, such as peptide nucleic acids, branched DNAs and the like.
- the polynucleotide probes may be sense or antisense polynucleotide probes. Where target polynucleotides are double stranded, the probes may be either sense or antisense strands.
- the nucleotide probes may be complementary single strands.
- the polynucleotide probes may be prepared by a variety of synthetic or enzymatic schemes that are well known in the art.
- the polynucleotide probes can be synthesized, in whole or in part, using chemical methods well known in the art Caruthers et al. (1980)
- the probes can be generated, in whole or in part, enzymatically.
- Nucleotide analogues can be incorporated into the polynucleotide probes by methods well known in the art.
- the incorporated nucleotide analogues should serve to base pair with target polynucleotides.
- certain guanine nucleotides can be substituted with hypoxanthine, which base pairs with cytosine residues. However, these base pairs are less stable than those between guanine and cytosine.
- adenine nucleotides can be substituted with 2,6-diaminopurine that can form stronger base pairs than those between adenine and thymidine.
- the polynucleotide probes can include nucleotides that have been derivatized chemically or enzymatically. Typical chemical modifications include derivatization with acyl, alkyl, aryl or amino groups.
- the polynucleotide probes may be labeled with one or more labeling moieties to allow for detection of hybridized probe/target polynucleotide complexes.
- the labeling moieties can include compositions that can be detected by specfroscopic, photochemical, biochemical, bioelectromc, immunochemical, electrical, optical or chemical means.
- the labeling moieties include radioisotopes, such as P , P or S , chemiluminescent compounds, labeled binding proteins, heavy metal atoms, specfroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, and the like.
- the polynucleotide probes can be immobilized on a substrate.
- Preferred substrates are any suitable rigid or semi-rigid support, including membranes, filters, chips, slides, wafers, fibers, magnetic or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries.
- the substrate can have a variety of surface forms, such as wells, trenches, pins, channels and pores, to which the polynucleotide probes are bound.
- the substrates are optically transparent.
- samples that will be assessed for the presence of target polynucleotides, that is, Lasl or Kras2 genes, or Lasl genes containing one or more SNPS, are obtained.
- the samples can be any sample containing target polynucleotides and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
- samples comprise cancer cells, other cells, or cell extracts from an individual or is at risk of developing, has or may have cancer, such as adenocarcinomas of the lung.
- nucleic acid specimen in purified or nonpurified form, can be utilized as the starting nucleic acid or acids, provided it contains, or is suspected of containing, the specific nucleic acid sequence containing the polymorphic locus.
- the process may employ, for example, DNA or RNA, including messenger RNA, wherein DNA or RNA may be single stranded or double stranded.
- DNA or RNA may be single stranded or double stranded.
- enzymes, and/or conditions optimal for reverse transcribing the template to DNA would be utilized.
- a DNA-RNA hybrid which contains one strand of each may be utilized.
- a mixture of nucleic acids may also be employed, or the nucleic acids produced in a previous amplification reaction herein, using the same or different primers may be so utilized.
- the specific nucleic acid sequence to be amplified i.e., the polymorphic locus, may be a fraction of a larger molecule or can be present initially as a discrete molecule, so that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form; it may be a minor fraction of a complex mixture, such as contained in whole human DNA.
- DNA utilized herein may be extracted using one of a variety of techniques such as that described by Maniatis, et al.
- the extracted sample may be treated before amplification with an amount of a reagent effective to open the cells, or animal cell membranes of the sample, and to expose and/or separate the strand(s) of the nucleic acid(s). This lysing and nucleic acid denaturing step to expose and separate the strands will allow amplification to occur much more readily. Additional methods of purification of nucleic acids are described in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Elsevier, New York N.Y.
- RNA is isolated using the TRIZOL reagent (Life Technologies, Gaithersburg Md.), and mRNA is isolated using oligo d(T) column chromatography or glass beads.
- the polynucleotides can be a cDNA reverse transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA amplified from that cDNA, an RNA transcribed from the amplified DNA, and the like.
- the polynucleotide is derived from DNA
- the polynucleotide can be DNA amplified from DNA or RNA reverse transcribed from DNA.
- Suitable methods for measuring the relative amounts of the target polynucleotide transcripts in samples of polynucleotides are Northern blots, RT-PCR, or real-time PCR, or RNase protection assays. Fore ease in measuring the transcripts for target polynucleotides, it is preferred that arrays as described above be used.
- the target polynucleotides may be labeled with one or more labeling moieties to allow for detection of hybridized probe/target polynucleotide complexes.
- the labeling moieties can include compositions that can be detected by specfroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means.
- the labeling moieties include radioisotopes, such as P , P or S , chemiluminescent compounds, labeled binding proteins, heavy metal atoms, specfroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, and the like.
- PCR polymerase chain reaction
- One such set of regions surrounding the Lasl gene that can be used are polymorphic microsatellite markers, whose sequences and locations throughout the human, and some animal genomes, are known in the art.
- the primers are used in a PCR reaction to amplify the region of the genome that contains the Lasl gene.
- a single PCR reaction may be used to amplify the entire genomic region containing the Lasl gene.
- multiple PCR reactions each amplifying a different region of the Lasl gene may be used.
- PCR reactions are used such that the entire coding region of the Lasl gene is amplified.
- genomic regions within nitrons and surrounding the Lasl gene may also be amplified.
- the amplified product may be detected by analyzing via a Southern blotting technique or similarly, using dot blot analysis.
- Suitable solid supports useful in Southern blotting techniques are membranes, beads, microtiter plates, etc.
- the use of non-radioactive probes or labels is facilitated by the high level of the amplified signal.
- probes used to detect the amplified products can be directly or indirectly detectably labeled.
- a detectable label is one that can be detected by physiochemical means, such as with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, by color absorbance, a metal chelator or an enzyme.
- Those of ordinary skill in the art will know of other suitable labels for binding to the probe, or will be able to ascertain such, using routine experimentation.
- a deletion of DNA in the genome between two PCR primers results in a PCR product that is smaller in size compared to a control PCR product obtained using DNA from a genome not containing a deletion.
- Such analyses detect relatively large changes (e.g., minimum of 10% change) in size of a PCR product as compared to the product from a Lasl genome.
- size determination of PCR products is performed by comparing the relative sizes of two or more PCR products. For example, the size of a PCR product from a genome where a Lasl mutation is suspected is compared to the size of the same PCR product from a genome where Lasl mutations are known not to be present.
- Relative sizes are easily compared using migration of PCR products in an electric field, as occurs in gel electrophoresis. Agarose gel electrophoresis is often used for this purpose.
- Another method for analyzing PCR products is through determination of the nucleotide sequence of all or part of the PCR product. This method of analysis detects changes in relative size of PCR products that are less than 10%. This method also detects changes in the DNA sequence that do not result in relative size changes. For example, determination of the sequence and comparison of the sequence of the same PCR product obtained from amplification of DNA from two different cells can detect single or multiple nucleotide base changes, substitutions of regions of DNA, and the like.
- RNA preferably mRNA isolated from the tumor or cancer cells is used as a template to make DNA in a reverse transcription reaction.
- the reverse transcribed DNA is then used as a template in PCR reactions using PCR primers with sequences known to be within the mRNA of the Lasl gene.
- PCR primers can be chosen, as described above in order to amplify the entire length of the mRNA sequence of the Lasl gene. This can be done using a single PCR reaction, or multiple PCR reactions as described above.
- Analysis of the PCR products is then performed much as already described.
- the presence of absence of a PCR product, or a change in its size as compared to controls is indicative of large changes, such as large insertions or deletions within the Lasl genome regions.
- such analysis is commonly performed using gel electrophoresis of the PCR products.
- the DNA sequence of the PCR products is determined, using methods well known in the art.
- a Lasl mutating polymorphism may be detected using the reverse dot blot hybridization technique (RDB) (see for example, Bray, et al., Blood, 84(12):4361, 1994, incorporated herein by reference).
- RDB reverse dot blot hybridization technique
- allele-specific oligonucleotides are fixed to a solid support (e.g., a filter).
- an amino group is added to the terminus of the allele-specific oligonucleotides for covalent attachment to the support.
- Labeled (e.g., biotinylated) oligonucleotides flanking the polymorphic sequence in genomic are used to amplify genomic DNA by PCR, for example, and these PCR products are denatured into single stranded DNA and hybridized to the filters containing the allele- specific oligonucleotides s.
- the invention provides for the diagnosis of an individual having or at risk of developing cancer, such as adenocarcinoma of the lung, using an antibody or other agent which detects a mutating polymorphism, such as a mutation in the Lasl protein.
- mutations in other Pasl genes may be detected using antibodies.
- Antibodies may be used either to detect levels of gene products of Lasl or one or more of the other Pasl genes, or to detect mutant forms of the gene products.
- Monoclonal antibodies useful for immunophenotyping are suited for use, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier.
- the monoclonal antibodies in these immunoassays can be detectably labeled in various ways.
- types of immunoassays which can utilize monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format.
- examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay.
- RIA radioimmunoassay
- sandwich immunometric assay
- immunometric assay or "sandwich immunoassay” includes simultaneous sandwich, forward sandwich and reverse sandwich immunoassays. These terms are well understood by those skilled in the art. Those of skill will also appreciate that antibodies as described herein will be useful in other variations and forms of assays which are presently known or which may be developed in the future. These are intended to be included within the scope of the present invention. [097] Monoclonal antibodies can be bound to many different carriers and used to detect the presence and phenotype of Lasl or other Pasl gene products.
- Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite.
- the nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or will be able to ascertain such using routine experimentation.
- the incubation medium usually added with the labeled soluble antibody.
- the "blockers” are added to assure that non-specific proteins, proteases, or anti-heterophilic immunoglobulins to anti-Pl immunoglobulins present in the experimental sample do not cross-link or destroy the antibodies on the solid phase support, or the radiolabeled indicator antibody, to yield false positive or false negative results.
- the selection of "blockers” therefore may add substantially to the specificity of the assays described in the present invention.
- nonrelevant antibodies of the same class or subclass (isotype) as those used in the assays e.g., IgGl, IgG2a, IgM, etc.
- concentration of the "blockers” may be important, in order to maintain the proper sensitivity yet inhibit any unwanted interference by mutually occurring cross reactive proteins in the specimen.
- Methods for Treating Individuals who have or at Risk of Developing Cancer Various embodiments of the invention provides methods for preventing the formation of cancer or treating cancer in individuals in need of such treatment.
- individuals may be identified as having cancer, such as adenocarcinoma of the lung, wherein at least one causative factor in their disease is the presence of a mutation in the Lasl gene, or in the Lasl gene and one or more of the other Pasl genes.
- Other individuals may be identified as being at risk for developing a cancer, such as adenocarcinoma of the lung, wherein at least one indicator of such risk is the presence of a mutation in the Lasl gene, or in the Lasl gene and one or more of the other Pasl genes.
- Such individuals are in need of treatment to prevent or stop proliferation of cancer cells.
- the methods of treatment described herein involve, in some embodiments, elevating the levels of Lasl protein in the individual.
- the level Lasl protein is elevated by administering to an individual in need of freatment a Lasl protein, or a pharmaceutical composition containing a Lasl protein. In other embodiments the level Lasl protein is elevated by administering to an individual in need of treatment a polynucleotide encoding a Lasl protein, or a pharmaceutical composition containing a polynucleotide encoding a Lasl protein.
- Lasl Protein [0104] The present invention identifies a novel tumor suppressor protein, Lung Adenoma Susceptibility- 1, referred to herein as Lasl or Lasl protein, the human sequence for which is shown in Fig. 1, and the mouse sequence for which is shown in Fig. 3. Polynucleotide sequences for the mouse and human Lasl open reading frames are shown in Figs. 2 and 4. Alignment of amino acid sequences for Lasl in human, mouse, rat, and sea squirt are shown in Fig. 6.
- the Lasl protein, and functional fragments thereof may be produced by conventional peptide synthesizers.
- the Lasl proteins may also be produced using cell-free translation systems and RNA molecules derived from DNA constructs that encode the Lasl proteins.
- Lasl proteins may also be made by fransfecting host cells with expression vectors that comprise a DNA sequence that encodes the respective Lasl protein or and then inducing expression of the protein in the host cells.
- recombinant constructs comprising a sequence which encodes the Lasl protein are introduced into host cells by conventional methods such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape lading, ballistic introduction or infection.
- the Lasl protein may be expressed in suitable host cells, such as for example, mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters using conventional techniques. Following fransformation of the suitable host strain and growth of the host strain to an appropriate cell density, the cells are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification of the Lasl protein.
- suitable host cells such as for example, mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters using conventional techniques. Following fransformation of the suitable host strain and growth of the host strain to an appropriate cell density, the cells are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification of the Lasl protein.
- the present invention provides methods for inhibiting or suppressing growth of cells by introduce Lasl proteins into cells of an individual who has developed or is at risk of developing cancer. Such individuals include those who have or may develop adenocarcinomas of the lung.
- proteins are coupled or fused to short peptides that direct entry of the Lasl protein into cells.
- One such group of peptides are called protein transduction domains.
- Another method for introduction proteins into cells uses lipid carriers. For example, proteins that are associated with liposomes are able to enter cells when the liposomes enter or fuse with the cell membranes.
- Such methods include, but are not limited to, "protein transduction” or "protein therapy” as described in publications by Nagahara et al. (Nagahara, et al., 1998, Nat Med, 4:1449-52.) and in publications from the laboratory of Dowdy (Nagahara, et al., 1998, Nat Med, 4:1449-52.; Schwarze, et al, 1999, Science, 285:1569-72.; Vocero-Akbani, et al., 2000, Methods Enzymol, 322:508-21; Ho, et al., 2001, Cancer Res, 61:474-7.; Vocero-Akbani, et al., 2001, Methods Enzymol, 332:36-49; Snyder and Dowdy, 2001, Curr Opin Mol Ther, 3:147-52.; Becker-Hapak, et al., 2001, Methods, 24:247-56.), publications which are incorporated herein by reference.
- an eleven amino acid sequence is fused to the Lasl protein.
- the purified protein is then put in contact with the surface of cells and the cells take up the Lasl protein which functions to inhibit or suppress growth of that cell.
- the protein is administered to the human by a variety of methods.
- the Lasl protein may be administered by injection (e.g., intravenously) or by inhalation in an aerosol.
- Lasl proteins that contain the fused PTD are preferably made by fusing the DNA sequence encoding the Lasl gene with the DNA sequence encoding the PTD.
- the resulting Lasl -PTD fusion gene may be incorporated into a vector, for example a plasmid or viral vector, that facilitates introduction of the fusion gene into a organism and expression of the gene at high levels in the organism such that large amounts of the fusion protein are made therein.
- a vector for example a plasmid or viral vector
- One such organism in which the vector containing the fusion gene can be expressed is a bacterium, preferably Escherichia coli. Other organisms are also commonly used by those skilled in the art.
- the fusion protein is purified from the organism using protein purification techniques well known to those skilled in the art.
- the present invention provides isolated polynucleotides which encode a Lasl protein.
- the Lasl-encoding polynucleotides may be single-stranded or double stranded. Such polynucleotides may be DNA or RNA molecules.
- the isolated polynucleotide comprises all or a portion of the Lasl sequence shown in Fig. 2 or Fig. 4.
- the Lasl polynucleotides are useful in one embodiment for preparing Lasl proteins.
- the present invention also encompasses isolated polynucleotides whose sequence is the complement of the Lasl gene sequence, shown in Figs.
- Polynucleotides comprising sequences encoding a Lasl protein may be synthesized in whole or in part using chemical methods. Polynucleotides which encode a Lasl protein, particularly alleles of the genes which encode a Lasl protein, may be obtained by screening a genomic library or cDNA library with a probe comprising sequences identical or complementary to the sequences shown in Figs. 2 or 3, or with antibodies immunospecific for a Lasl protein, to identify clones containing such polynucleotide. Alternatively, polynucleotides encoding Lasl proteins may be made using polymerase chain reaction (PCR) technology and primers that bind specifically to sequences which are known to encode a Lasl protein.
- PCR polymerase chain reaction
- the present method comprises introduction of Lasl encoding polynucleotides, preferably contained within a vector, into cancer cells so that the cells achieve increased levels of Lasl expression.
- introduction or transfer of a DNA molecule or molecules, specifically a DNA molecule encoding one or more Lasl encoding polynucleotide, into a cell refers to any of a variety of methods known in the art to achieve transfer of DNA molecules into cells. Whatever methodology is used to administer the Lasl genes to humans or animal, such methodologies comprise variations that result in the Lasl genes being introduced exclusively into normal and not being introduced into tumor cells.
- Targeting can be accomplished through manipulation of cellular receptors for the recombinant viruses and/or manipulation of viral ligands that recognize and bind to cellular receptors for the viruses.
- Such methodologies as used to introduce Lasl genes into cancer cells in animals or humans, are within the purview of the present application.
- Targets on cancer cells include, but are not limited to, proteins such as carcino embryonic antigen, and other markers that are differentially expressed on cancer cells but not in corresponding normal cells.
- Specific ligands for such targets include, but are not limited to, known ligands, antibodies.
- polynucleotides encoding the Lasl protein or a functional equivalent thereof are introduced into such cells to permit expression or overexpression of the Lasl protein.
- Viral or plasmid vectors may be used to deliver the polynucleotide to the cells.
- Levels of Lasl may be increased in cancer cells by introducing a DNA fragment comprising an Lasl polynucleotide and a promoter into the cell and expressing the Lasl protein.
- the promoter, which is operably linked to the Lasl polynucleotide is a tissue specific promoter.
- the DNA fragment may be incorporated into a viral vector or into a liposome which, preferably, further comprises a molecule which targets the liposome to the cancer cell.
- polynucleotides encoding the Lasl protein or a functional equivalent or fragment thereof is introduced into cancer cells to permit expression or overexpression of the Lasl protein.
- Lasl delivery is specifically selective for cancer cells and is achieved using a targeting carrier that is selective for cancer cells and does not direct delivery to normal cells.
- the protein coding region of the polynucleotide sequences is normally attached to sequences that facilitate its transcription into mRNA as well as translation of the mRNA into Lasl.
- Expression vectors normally contain sequences that facilitate gene expression.
- An expression vehicle can comprise a transcriptional unit comprising an assembly of a protein encoding sequence and elements that regulate transcription and translation.
- Transcriptional regulatory elements generally include those elements that initiate transcription. Types of such elements include promoters and enhancers. Promoters may be constitutive, inducible or tissue specific. Transcriptional regulatory elements also include those that terminate transcription or provide the signal for processing of the 3' end of an RNA (signals for polyadenylation).
- Translational regulatory sequences are normally part of the protein encoding sequences and include translational start codons and translational termination codons. There may be additional sequences that are part of the protein encoding region, such as those sequences that direct a protein to the cellular membrane, a signal sequence for example.
- the Lasl-encoding polynucleotides that are introduced into cells are, in some embodiments, expressed at a high level (i.e., the introduced polynucleotide sequence produces a high quantity of Lasl protein within the cells) after introduction into the cells.
- Techniques for causing a high-level of expression of polynucleotide sequences introduced into cells are well known in the art. Such techniques frequently involve, but are not limited to, increasing the transcription of the polynucleotide sequence, once it has been introduced into cells. Such techniques frequently involve the use of transcriptional promoters that cause transcription of the introduced polynucleotide sequences to be initiated at a high rate. A variety of such promoters exist and are well known in the art.
- promoters are derived from viruses. Such promoters can result in efficient transcription of polynucleotide sequences in a variety of cell types. Such promoters can be constitutive (e.g., CMV enhancer/promoter from human cytomegalovirus) or inducible (e.g., MMTV enhancer/promoter from mouse mammary tumor virus). A variety of constitutive and inducible promoters and enhancers are known in the art. Other promoters that result in transcription of polynucleotide sequences in specific cell types, so-called "tissue-specific promoters," can also be used. A variety of promoters that are expressed in specific tissues exist and are known in the art. For example, promoters whose expression is specific to neural, liver, epithelial and other cells exist and are well known in the art. Methods for making such DNA molecules (i.e., recombinant DNA methods) are well known to those skilled in the art.
- vectors refer to nucleic acid molecules capable of mediating introduction of another nucleic acid or polynucleotide sequence to which it has been linked into a cell.
- One type of preferred vector is an episome, i.e., a nucleic acid capable of extrachromosomal replication.
- Other types of vectors become part of the genome of the cell into which they are introduced.
- Vectors capable of directing the expression of inserted DNA sequences are referred to as "expression vectors" and may include plasmids, viruses, or other types of molecules known in the art.
- vectors typically contain one or more restriction endonuclease recognition sites which permit insertion of the Lasl polynucleotide sequence.
- the vector may further comprise a marker gene, such as for example, a dominant antibiotic resistance gene, which encode compounds that serve to identify and separate transformed cells from non- transformed cells.
- viral vectors are recombinant viruses which are generally based on various viral families comprising poxviruses, herpesviruses, adenoviruses, parvoviruses and retroviruses.
- Such recombinant viruses generally comprise an exogenous polynucleotide sequence (herein, a Lasl gene) under control of a promoter which is able to cause expression of the exogenous polynucleotide sequence in vector-infected host cells.
- One type of viral vector is a defective adenovirus which has the exogenous polynucleotide sequence inserted into its genome.
- the term "defective adenovirus” refers to an adenovirus incapable of autonomously replicating in the target cell.
- the genome of the defective adenovirus lacks the sequences necessary for the replication of the virus in the infected cell. Such sequences are partially or, preferably, completely removed from the genome.
- the defective virus contains sufficient sequences from the original genome to permit encapsulation of the viral particles during in vitro preparation of the construct.
- Other sequences that the virus contains are any such sequences that are said to be genetically required "in cis.”
- the adenovirus is of a serotype which is not pathogenic for man.
- serotypes include type 2 and 5 adenoviruses (Ad 2 or Ad 5).
- Ad 2 or Ad 5 the sequences necessary for the replication are the E1A and E1B regions.
- the virus vector is an immunologically inert adenovirus.
- immunologically inert means the viral vector does not encode viral proteins that activate cellular and humoral host immune responses.
- Methods for preparing immunologically inert adenoviruses are described in Parks et al., Proc Natl Acad Sci USA 1996; 93(24) 13565-70; Leiber, A. et al., J. Virol. 1996; 70(12) 8944-60; Hardy s., et al, J. Virol. 1997, 71(3): 1842-9; and Morsy et al, Proc. Natl. Acad. Sci. USA 1998.
- Cre-loxP recombination In vitro, Cre-loxP recombination is particularly adaptable to preparation of recombinant adenovirus and offers a method for removing unwanted viral nucleotide sequences.
- Replication deficient recombinant adenovirus lacks the El coding sequences necessary for viral replication. This function is provided by 293 cells, a human embryonic kidney cell line transformed by adenovirus type. First generation adenoviruses are generated by co-transfecting 293 cells with a helper virus and a shuttle plasmid containing the foreign gene of interest.
- viral vector is a defective retrovirus which has the exogenous polynucleotide sequence inserted into its genome.
- retroviruses are well known in the art.
- Recombinant retroviruses for use in the present invention are preferably free of contaminating helper virus.
- Helper viruses are viruses that are not replication defective and sometimes arise during the packaging of the recombinant retrovirus.
- Non-defective or replication competent viral vectors can also be used. Such vectors retain sequences necessary for replication of the virus.
- Other types of vectors are plasmid vectors.
- Lasl-encoding polynucleotides are introduced into cells, techniques may be used to determine the cells into which the polynucleotide sequences have been introduced and/or the specific cells that are expressing the introduced polynucleotide sequences.
- a variety of techniques to examine the presence of polynucleotide sequences and/or expression of polynucleotide sequences exist and are well known in the art. Some such techniques include Southern blotting, Northern blotting, polymerase chain reaction (PCR), Western blotting, RNase protection, radioiodide uptake assays, and others.
- antisense polynucleotides having sequences which are complementary to the DNA and RNA sequences which encode the Lasl protein.
- the term complementary as used herein refers to the natural binding of the polynucleotides under permissive salt and temperature conditions by base pairing.
- Administration of proteins and polynucleotides may be selected, depending on their dosage form, patient's age, sex and severity of disease, and other conditions, as appropriate, but the amount of the active ingredient may be generally about 0.0001 to 100 mg/kg a day.
- a unit dosage form may contain about 0.001 to 1000 mg of the active ingredient.
- compositions may be administered using any mode that is medically acceptable, meaning any mode that produces effective levels of the active protein without causing clinically unacceptable adverse effects.
- modes of administration include parenteral routes (e.g., intravenous, infra-arterial, subcutaneous, intramuscular, mucosal or infusion), but may also include oral, rectal, topical, nasal or infradermal routes.
- Another route of introduction, of special use for treatment of patients with pulmonary fibrosis is the respiratory route by inhalation into the lungs.
- Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated adminisfrations, increasing convenience to the patient and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art.
- the pharmaceutical compositions of the present invention may also be administered by the respiratory route.
- the formulations administered by the respiratory route are generally oral aerosol formulations. Such formulations can be administered via the respiratory route in a variety of ways.
- Therapeutic proteins and polynucleotides may be administered to an individual in need of the same in a pharmaceutical composition.
- Suitable formulations for delivery are found in Remington's Pharmaceutical Sciences, 17th ed. (Mack Publishing Co., Philadelphia, Pa., 1985). These pharmaceutical compositions are suitable for use in a variety of drug delivery systems (Langer, Science 249:1527-1533, 1990).
- Lasl and Kras2 proteins and polynucleotides in pharmaceutical compositions are suitable for single administration or in a series of inoculations.
- the pharmaceutical compositions are intended for parenteral, topical or oral administration.
- Parenteral administration may be by intravenous, subcutaneous, infradermal, infraperitoneal or intramuscular administration.
- Parenteral administration may be preferentially directed to the patient's liver such as by catheterization to hepatic arteries or into a bile duct.
- the compositions can include Lasl proteins and a suitable sterile carrier such as water, aqueous buffer, 0.4% saline solution, 0.3% glycine, hyaluronic acid or emulsions of nontoxic nonionic surfactants as is well known in the art.
- the compositions may further include substances to approximate physiological conditions such a buffering agents and wetting agents such as NaCl, KC1, CaCl 2 sodium acetate and sodium lactate.
- Solid compositions in conventional nontoxic solid carriers such as, for example, glucose, sucrose mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or cellulose derivatives, sodium carbonate and magnesium carbonate.
- the HCV-like particles preferably comprise 10% to 95%, and more preferably 25% to 75% of the composition.
- compositions may be administered as a single dose, but more likely as a series of dosages over a period of days, weeks or even months.
- an effective therapeutic dose is a dose that inhibits growth of a tumor, or causes tumor regression.
- EXAMPLES [0143] Mouse model for Lung Cancer: Inbred mice models offer an effective means of identifying candidate lung cancer susceptibility loci. Inbred strains of mice have different susceptibilities to spontaneous and carcinogen-induced lung tumor formation. The A/J sfrain is the most susceptible to lung tumorigenesis whereas the C3H and C57BL/6 are among the most resistant sfrains.
- mice After selection, an average of 5-12 N9 congenic mice were generated from each subcongenic sfrain.
- Genotyping Using Polymorphic Markers For selecting mice on the basis of their geneotypes throughout the Pasl region on chromosome 6, the following markers were used: D6MIT54, D6MIT52, D6MIT59, D6MIT57, D6MCO10, D6MCO11, D6MIT15, and D6MIT373. All of the mouse microsatellite primers were purchased from Research Genetics, Inc. (Huntsville, AL). The forward primer was end-labeled with 32P-ATP, and 30 cycles of PCR were performed at 94°C for denaturation, 55°C for annealing and 72°C for extension. Eight percent denaturing polyacrylamide gels were used for resolution of the radiolabeled PCR products followed by autoradiography.
- RNAs were prepared from mouse lung tissues using TRIzol reagent (Life Technologies). Poly(A)+ RNAs were purified from the total RNAs with MicroPoly(A)Pure (Ambion). A 2-microgram aliquot of each Poly(A)+ RNA was separated on a 1% agarose gel containing 2% formaldehyde and transferred to nylon membrane.
- blots were hybridized with a random-primed 32P- labelled cDNA probe in ExpressHybTM Hybridization Solution (Clontech) at 68 °C, washed with 0.1XSSC-0.1%SDS at 50-65 °C, and exposed for autoradiography at -80 °C.
- first strand cDNAs were synthesized using Superscript 2 (Life Technologies) with random primer and 1 mg of Poly(A)+ RNAs or 3_g of total RNAs described above.
- Primer sequences were 5'- GACCAAAGCCGAGCGACTGCGGC, 3'- TCGAAGAAGTAGTTCTGTGGC for Las- 1, 5'-TGACATCCGTAAAGACCTCTATGCC, 3, -AAG CAC TTG CGG TGCACG ATG GAG for b-actin. All reactions involved initial denaturation at 94 °C for 3 min followed by 30-35 cycles at 94 °C for 30 sec, 55 °C for 30sec, 72 °C for 30 sec (for Lasl), and 21 cycles at 94 °C for 30 sec, 68 °C for 30sec, 72 °C for 30 sec (for _-actin) on PTC- 100 Programmable Thermal Controller (MJ Research).
- NTH3T3 mouse fibroblast cell line
- LMl cells were seeded at 1.5 x 106 per 10 cm dish and transiently transfected with 4 ⁇ g of the constructed and empty vectors with Lipofectamine (Invifrogen).
- the transfected cells were cultured in the presence of lmg/ml G418 for 2 weeks.
- the cells, which survived, were fixed with 10% formalin and stained with 0.125% crystal violet.
- the colonies (! lmm) were counted. Applicants repeated at least 3 independent experiments.
- Female athymic BALB/c nude mice aged 4-6 weeks were purchased from Charles Rivers Laboratories.
- Applicants injected 10 million cells subcutaneously into each flank of nude mice. Four animals were used per sample. Applicants monitored the health of animals 3 times a week and measured the size of tumors weekly for 6 weeks. Tumor volume was calculated as length _ height _ width _ 0.5. Applicants also confirmed the expression of Lasl for several tumors resected from nude mice by RT-PCR.
- pcDNA3.1(+)/N-myc-tagged Lasl expression vectors were constructed from A/J allele and C57BL/6J allele individually to identify the localization of Lasl in cells.
- Transiently transfected NIH/3T3 cells with pcDNA3.1(+)/N-myc-Las- 1 were re-plated on multiwell chamber slides (Beckton Dickinson). Then the cells were fixed with 4% paraformaldehyde in PBS and made permeable with 0.1%Triton X-100 in PBS for 3 minutes. Cells were covered with 3% BSA-containing blocking solution for 1 hr at room temperature.
- mice anti-myc antibody Oncogene, diluted 1:50 in blocking solution
- Anti-myc antibody was stained with goat anti-mouse secondary antibody conjugated to rhodamine (1:250) for 1 hr and viewed with ECLIPSE E600 microscope (Nikon).
- AKO 16641 contained an elevated frequency of an alternative-splicing transcript in A/J (Fig. 5B). No differential expression was found for Bcatl, Lrmp, and Lasl between lung tissues of A/J and C57BL/6J strains (Fig. 5B & Fig. 7C).
- sequence analyses were performed to detect functional polymorphisms between susceptible and resistant sfrains. For Lrmp, Bcatl, Kras2, AK016641, and AK015530, the entire open reading frames (ORFs) were sequenced.
- ORFs open reading frames
- RACE Rapid amplification cDNA ends
- AK016641 had 2 functional polymorphisms at codon 218 (Arg to His), codon 258 (Gly to Glu) and an alternative splicing transcript without exon 5 only found in A/J sfrain.
- AK015530 had a polymorphism at codon 28 resulting in a change of Asp to Gly.
- Lrmp had 5 functional polymorphisms including codon 31 (Asp to Gly), codon 56 (Gly to Asp), codon 58 (Phe to Leu), codon 438 (Arg to Gly), and codon 537 (Pro to Leu). Lasl showed one functional polymorphism at codon 60 (Asn to Ser). Therefore, five genes including AKO 16641, AKO 15530, Lrmp, Lasl, and Kras2 contained either functional polymorphisms or differential expression between A/J and C57BL/6J and were further characterized as candidates for Pasl gene(s).
- Lasl has a 2193 bp ORF and consists of 730 amino acids; estimated molecular weight is 84.8 Kd homologous to axomonal p83.9 (Ciona intestinalis) (Fig. 6).
- Northern blot showed that Lasl mRNA had a size of approximately 4 Kb and the same expression level between A/J and C57BL/6J (Fig. 7C-a).
- RT-PCR data also revealed that no differential expression was detected in a total of 12 different strains examined including 6 resistant (C57BL/6J, DBA/2J, SJL/J, C3H HeJ, AKR/J, M.
- Fig. 7D shows the cytoplasmic distribution of the Lasl gene product in NLH/3T3 cells. Similar results were obtained when Applicants transfected those plasmids into COS7 and LMl cells (data not shown). Looking into homology between mouse Lasl and other species, Lasl products revealed a high degree of conservation from Ciona intestinalis to human (Fig. 6).
- Lasl protein is 67% identical and 81% positive to the derived human Lasl protein (similar to human hypothetical protein FLJ10921, 30.41Mb). Searching NCBI protein database using mouse protein sequence revealed a rat homologous protein, encoded by NCBI predicted gene LOC297720 (84% identities and 92% positives). The mouse Lasl protein is also homologous to a Ciona intestinalis protein axonemal p83.9 (GI: 20086393, 33% identities and 52% positives) (Fig. 6). Amoxonemes are highly organized microtubule based structure present in diverse types of cells that perform motile, sensory, and developmental functions in organisms from protists to humans. These functions are consistent with observed cellular distribution.
- Applicants also tested the ability of the C57BL/6J derived Lasl to inhibit tumor development of LMl cells in nude mice.
- Fig. 7B after 5 weeks of inoculation, large tumors developed in all four mice injected with Lasl-A/J- pcDNA3.1 transfected cells, but only small tumors developed in the four mice injected with transformed LMl cells carrying Lasl-C57BL/6/J-pcDNA3.1 (PO.05) (Fig. 7B-b, c, d). Expression of Lasl was also confirmed in the resected tumors by RTPCR (Fig. 7B-a). These results indicate that the C57BL/6J derived Lasl can inhibit the tumorigenic potential of the LMl cells in vivo.
- Mouse lung tumors from Kras2+/- of A/J or C57BL/6J mice were obtained from the lung tumor bio assays. These tumors were homogenized in lysis buffer- PBS (5 mM MgC12, 1 mM DTT, 0.2 mM PMSF, 2 ⁇ g/mL leupeptin, 5 ⁇ g/mL aprotinin, 1 mM benzamidine) and cleared by centrifugation. NP-40 was then added to 1% after centrifugation. Protein concentrations were determined by Bradford assay (BioRad) and equalized prior to incubation with 40 mg GST-RafRBD (Ras binding domain), precoupled to glutathione agarose.
- lysis buffer- PBS 5 mM MgC12, 1 mM DTT, 0.2 mM PMSF, 2 ⁇ g/mL leupeptin, 5 ⁇ g/mL aprotinin, 1 mM benzamidine
- the animals were paired to develop breeding colonies for production of (A/J ⁇ K- ras+/-) FI, and (C57BL/6J ⁇ K-ras+/-) FI mice.
- Either wild type or heterozygous Kras2 knockout and wild type mice were subjected to lung tumorigenesis assays using two lung carcinogens: urethane and methylnitrosourea (MNU).
- MNU methylnitrosourea
- the Kras2 allele derived from A/J mouse strains confers a significantly higher susceptibility to lung tumor progression than does the C57BL/6J Kras2 allele.
- the Activation State of Kras2 in Lung Tumors from Kras2 Deficient Mice The mechanism for the Kras2 alleles in lung tumor progression appears to be related to the observed differential mRNA expression of the activated Kras2 alleles in lung tumors from the A/J sfrain of mice.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
L'invention concerne des méthodes portant sur l'identification et le traitement de cancers impliquant une expression altérée du gène de sensibilité à l'adénome du poumon (Las1) et/ou de son produit, la protéine Las1.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US51467303P | 2003-10-27 | 2003-10-27 | |
PCT/US2004/035690 WO2005045062A2 (fr) | 2003-10-27 | 2004-10-27 | Expression genique et polymorphismes associes au cancer du poumon |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1753882A2 true EP1753882A2 (fr) | 2007-02-21 |
Family
ID=34572767
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP20040796566 Ceased EP1753882A2 (fr) | 2003-10-27 | 2004-10-27 | Expression genique et polymorphismes associes au cancer du poumon |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1753882A2 (fr) |
AU (1) | AU2004288177A1 (fr) |
CA (1) | CA2543965A1 (fr) |
WO (1) | WO2005045062A2 (fr) |
-
2004
- 2004-10-27 WO PCT/US2004/035690 patent/WO2005045062A2/fr not_active Application Discontinuation
- 2004-10-27 EP EP20040796566 patent/EP1753882A2/fr not_active Ceased
- 2004-10-27 CA CA002543965A patent/CA2543965A1/fr not_active Abandoned
- 2004-10-27 AU AU2004288177A patent/AU2004288177A1/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO2005045062A3 * |
Also Published As
Publication number | Publication date |
---|---|
CA2543965A1 (fr) | 2005-05-19 |
WO2005045062A3 (fr) | 2005-07-28 |
WO2005045062A2 (fr) | 2005-05-19 |
AU2004288177A1 (en) | 2005-05-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5989815A (en) | Methods for detecting predisposition to cancer at the MTS gene | |
US6090578A (en) | MTS1 gene | |
KR20140047138A (ko) | Kif5b 유전자와 ret 유전자와의 융합 유전자, 및 당해 융합 유전자를 표적으로 한 암 치료의 유효성을 판정하는 방법 | |
WO2001009311A9 (fr) | Procedes permettant d'inhiber les cellules cancereuses a l'aide d'oligonucleotides antisens adnf iii | |
NZ283539A (en) | Multiple tumour suppressor (mts) gene, probes, use in diagnosis and treatment of cancer | |
US20120207755A1 (en) | Cancer | |
WO1999063110A1 (fr) | Diagnostic et traitement du cancer | |
EP1753882A2 (fr) | Expression genique et polymorphismes associes au cancer du poumon | |
EP1394268A1 (fr) | HNF1alpha en tant que suppresseur de tumeur et utilisation thérapeutiques et diagnostiques de celle-ci | |
JP4297209B2 (ja) | Kiaa0172遺伝子の疾病治療及び診断並びに創薬への利用 | |
US6210949B1 (en) | Mouse MTS2 gene | |
US6929910B2 (en) | Diagnostic and therapeutic methods using the H37 tumor suppressor gene | |
US20030133910A1 (en) | Wild-type ras as a cancer therapeutic agent | |
WO2000077252A1 (fr) | Diagnostic, pronostic et traitement de cancers en rapport avec le gene barx2 | |
EP1723424A2 (fr) | Expression genique et polymorphismes influen ant la sensibilite au cancer du poumon | |
US6060301A (en) | Vector containing MTS1E1β gene | |
ES2395121T3 (es) | Métodos para el diagnóstico del cáncer en base a genes OBCAM y NTM | |
JP2003529321A (ja) | P−hydeファミリーの単離された核酸、p−hydeタンパク質、及び癌における細胞死の誘導に対する感受性を誘導する方法 | |
CN117957332A (zh) | 内质网钙结合蛋白-3(RCN3)变体和用白细胞介素-4受体α(IL4R)拮抗剂治疗哮喘 | |
WO2000037677A1 (fr) | Cancer en rapport avec un gene suppresseur de tumeur du chromosome humain 16q |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20060509 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED |
|
18R | Application refused |
Effective date: 20070320 |