EP1752040A1 - Identification de distorteurs du complex-t et leurs applications - Google Patents

Identification de distorteurs du complex-t et leurs applications Download PDF

Info

Publication number
EP1752040A1
EP1752040A1 EP05017651A EP05017651A EP1752040A1 EP 1752040 A1 EP1752040 A1 EP 1752040A1 EP 05017651 A EP05017651 A EP 05017651A EP 05017651 A EP05017651 A EP 05017651A EP 1752040 A1 EP1752040 A1 EP 1752040A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
acid molecule
seq
expression product
distorter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05017651A
Other languages
German (de)
English (en)
Inventor
Bernhard Herrmann
Hermann Bauer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Max Planck Gesellschaft zur Foerderung der Wissenschaften eV filed Critical Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority to EP05017651A priority Critical patent/EP1752040A1/fr
Priority to ARP060103504A priority patent/AR054910A1/es
Priority to CA2618198A priority patent/CA2618198C/fr
Priority to PCT/EP2006/007977 priority patent/WO2007020026A1/fr
Priority to EP06776794A priority patent/EP1912494B1/fr
Priority to NZ565122A priority patent/NZ565122A/en
Priority to AU2006281607A priority patent/AU2006281607B2/en
Priority to US11/997,992 priority patent/US20090307790A1/en
Publication of EP1752040A1 publication Critical patent/EP1752040A1/fr
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • C07K14/4706—Guanosine triphosphatase activating protein, GAP
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00—Chemistry: analytical and immunological testing
    • Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
    • Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
    • Y10T436/143333—Saccharide [e.g., DNA, etc.]

Definitions

  • the present invention relates to a method for producing a transgenic non human male animal, preferably a mammal, fish, bird or insect, wherein the transgene(s) confer(s) a change in the transmission ratio of (a) genetic trait(s) to the offspring of said non human male animal, preferably mammal, fish, bird or insect to a non-Mendelian ratio, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic male to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product with a Distorter function into (a) chromosome(s) of a non-
  • the invention relates to a method for producing a transgenic non human male animal, preferably a mammal, fish, bird or insect, wherein the transgene(s) confer(s) a change in the transmission ratio of (a) genetic trait(s) to the offspring of said non human male animal, preferably mammal, fish, bird or insect to a non-Mendelian ratio, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic male to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product directed against the Distorter function into (a) chromosome(s) of a non-
  • the mouse t-complex a region of approximately 12 cM genetic distance on the proximal part of chromosome 17, contains several loci acting in concert to produce a phenomenon called transmission ratio distortion (TRD).
  • TRD transmission ratio distortion
  • the latter designation indicates the fact that the so-called t-haplotype form of this chromosomal region has a selective advantage over the wild type form in that it is transmitted to the offspring at non-Mendelian ratios of up to 99%.
  • This transmission at non-Mendelian ratio is achieved by the concerted action of at least five loci, the t complex Distorters Tcd1a and Tcd1b (D1a, D1b), Tcd2 (D2) and Tcd3 (D3), and the t complex responder, Tcr (R t )(Lyon 1984, Lyon et al 2000). More Distorters have been postulated (Silver and Remis 1987).
  • the chromosome containing R t is transmitted at less than 50% to the offspring (as low as 12%, "low” phenotype).
  • the Distorters are only transmitted at ratios over 50% if they are tightly linked to R t .
  • the trans-acting and cis-acting properties of the Distorters and the Responder, respectively, have been demonstrated by the transmission ratio properties of so-called partial t-haplotypes, which carry only a subset of the above named loci.
  • T complex Distorters could only be mapped very roughly to large chromosomal subregions of several megabase each in size due to suppression of meiotic recombination between the t-haplotype and the wild type chromosome. Rare recombinants have occurred between these chromosomes allowing separation of the different loci, but molecular access to the Distorter loci is extremely difficult.
  • Several attempts to isolate t-Distorters have been reported, though none of the candidates has been verified by genetic means (for review see (Schimenti 2000) (Lyon 2003), Systematic approaches using deletion mapping in the Tcd1 region and candidate gene isolation also has failed to identify a Distorter at the molecular level (Planchart, You et al.
  • the present invention relates to a method for producing a transgenic non human male animal, preferably a mammal, fish, bird or insect, wherein the transgene(s) confer(s) a change in the transmission ratio of (a) genetic trait(s) to the offspring of said non human male animal, preferably mammal, fish, bird or insect to a non-Mendelian ratio, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic male to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product with a Distorter function into (a) chromosome(s) of a non-
  • the invention relates to a method for producing a transgenic non human male animal, preferably a mammal, fish, bird or insect, wherein the transgene(s) confer(s) a change in the transmission ratio of (a) genetic trait(s) to the offspring of said non human male animal, preferably mammal, fish, bird or insect to a non-Mendelian ratio, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic male to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product directed against the Distorter function into (a) chromosome(s) of a non-
  • genetic trait relates to a heritable feature or characteristic of an organism encoded by (a) nucleic acid molecule(s) contained in its genome, comprising naturally occurring characteristics as well as (a) feature(s) encoded by (a) nucleic acid molecule(s) engineered in vitro, which has/have been introduced into its genome.
  • the term "confer a change in the transmission ratio of a genetic trait(s) to the offspring of said non human male animal, preferably mammal, fish, bird or insect to a non-Mendelian ratio” as used in accordance with the present invention refers to changing the transmission ratio of (a) genetic trait(s) from the parents to their offspring to ratios markedly deviating from the expected Mendelian ratio of 50% (equal transmission).
  • “Markedly deviating” in connection with the present invention means that the ratios might be less than 50 percent, preferably less than 40%, more preferably less than 30%, even more preferably less than 20% and most preferably less than 10% (reduced transmission) or might be at least 60%, more preferably at least 70 %, even more preferably at least 80% and most preferably at least 90 % (enhanced transmission).
  • said chromosome containing said genetic trait(s) as used in connection with the present invention means that the genetic trait is part of the chromosome and will then be transmitted together with said chromosome through the germline.
  • said chromosome conferring said genetic trait(s) means that the entire chromosome is to be considered as the genetic trait therefore the transmission ratio of said genetic trait is also changed when the entire chromosome will be transmitted through the germline.
  • Responder function refers to the unique property of a Responder to distort the transmission ratio of itself and (a) closely linked genetic trait(s) to non-Mendelian ratios, i.e. a marked deviation from 50%.
  • Distal function refers to the potency of (a) Distorter(s) to enhance or reduce the transmission ratio of a Responder and (a) closely linked genetic trait(s), wherein the transmission ratio of the Responder and (a) closely linked genetic trait(s) markedly deviates from the Mendelian ratio.
  • nucleic acid molecule encoding an expression product with Distorter function/with Responder function relates to nucleic acid molecules wherein the deduction of the amino acid sequence of the nucleic acid molecules used in connection with the method of the present invention allows the conclusion that the (poly)peptide is the expression product that contributes to the Distorter/Responder function. However, it is not excluded that the mRNA contributes to or triggers said Distorter/Responder function. Also, it is envisaged in accordance with the present invention that the expression level, stage of expression during spermatogenesis or the copy number of said nucleic acid molecule results in or contributes to the Distorter/Responder function. Therefore, in a preferred embodiment of the nucleic acid molecule used in connection with the method of the invention said expression product is an RNA or a (poly)peptide.
  • (poly)peptide as used in the present invention describes a group of molecules which comprise the group of peptides, as well as the group of polypeptides.
  • the group of peptides is consisting of molecules with up to 30 amino acids
  • the group of polypeptides is consisting of molecules with more than 30 amino acids.
  • protein as used in connection with the present invention is to be considered identical with the term "(poly)peptide”.
  • the terms “Distorter” or “Responder” therefore as used in connection with the present invention are to be considered in their broadest sense.
  • the terms refer to the (poly)peptide with Distorter or Responder function encoded by the corresponding nucleic acid molecules.
  • said term might refer to the corresponding mRNAs or the nucleic acid molecule encoding the (poly)peptide with Distorter or Responder function.
  • the nucleic acid molecule encoding a Distorter function is selected from the group consisting of SEQ ID NOs 1 and 2 (mouse wildtype Tagap1); SEQ ID NOs 3 to 6 (mouse Tagap t1 ; Tagap t2 ; Tagap t3 ; Tagap t4 (Tcd1a)); SEQ ID NOs 7 and 8 (homop sapiens and Rattus Tagap); SEQ ID NOs 9 to 12 (mouse wildtype Fgd2); SEQ ID NO 12 (mouse Fgd2 t6/w5; (Tcd2)) and SEQ ID NOs 13 and 14 (mouse and human Tiam2 (Tcd 1 b)).
  • nucleic acid molecule encoding a Responder function is as shown in SEQ ID NO 15 or 16 (Smok Tcr , Tcr, R t ).
  • factors involved in G protein signaling refers to any factor and preferably any protein that is a part of a G protein signaling cascade and in particular to members of the GTPase superfamily.
  • said members comprise trimeric G proteins and monomeric GTPases, and (poly)peptides triggering, controlling, modifying (a) signal pathway(s) involving small GTPases or regulated by (a) signal pathway(s) involving small GTPases.
  • homologous recombination refers to gene targeting of a nuclear gene locus of interest by integration of a nucleic acid molecule construct containing (a) genomic fragment(s) of said gene thereby altering the DNA sequence of said nuclear gene locus. It is preferred that by introducing said nucleic acid molecule construct into the nuclear gene locus the gene activity of the Distorter is down-regulated or abolished.
  • the term "directed against the Distorter function" means that the nucleic acid molecule or the expression product of said nucleic acid molecule or the antibody directed against the Distorter reduces or interferes with the activity of the expression product(s).
  • the term "thereby partially or completely inactivating the Distorter function" as used in connection with the present invention refers to interfering with the gene activity of the Distorter by destruction of the mRNA, inhibition of translation of the mRNA, inhibition of the protein or enzymatic activity, or by other mechanisms allowing down-regulation or abolishment of the gene or protein activity of the Distorter.
  • partial inactivation means inactivation of at least 50%, preferably of at least 60%, more preferably of at least 70%, even more preferably of at least 80%, even more preferably of at least 90%, even more preferably of at least 95% and most preferably 100% (complete inactivation)
  • inactivation of at least 50% preferably of at least 60%, more preferably of at least 70%, even more preferably of at least 80%, even more preferably of at least 90%, even more preferably of at least 95% and most preferably 100% (complete inactivation)
  • the skilled person can devise an assay wherein for example the amount of Distorter transcripts in cells containing said Distorter and expressing a nucleic acid molecule directed against said Distorter is compared to cells containing said Distorter but not said nucleic acid molecule directed against said Distorter.
  • the protein expression level of cells expressing said Distorter can be compared to cells expressing in addition a nucleic acid molecule allowing down-regulation or abolishment of the gene or protein activity of the Distorter for instance by western blot analysis using an antibody binding to the protein product of said Distorter.
  • the protein activity of the expression product of a Distorter allele which has been altered in vitro in order to interfere with the protein activity of said wild type Distorter product can be compared to the activity of said wild type Distorter protein using in vitro activity assays such as for example those known in the art devised for assaying the activity of GAP or GEF proteins on target GTPases, such as for example, the one shown herein below, the method comprising expression of the Distorter protein in vitro or in bacterial cells.
  • Expression products derived from dominant negative alleles can be assayed in mixing experiments in the presence of the wild type protein for its ability to interfere with the activity of the wild type protein.
  • the activity of constitutively active proteins can be compared to the activity of the wild type protein comprising relating the activity of either protein to the protein amounts used in the assay.
  • genomic fragments used for integrating the nucleic acid molecule construct by homologous recombination are completely identical with the target nucleic acid molecule encoding an expression product with Distorter function.
  • the overall construct is partially identical because the target nucleic acid molecule encoding an expression product with Distorter function is not identical with the sequence in the construct used for the inactivation.
  • genomic fragments may not be completely identical with the target nucleic acid molecule encoding an expression product with Distorter function but are sufficiently identical to allow recombination.
  • the invention solves the recited technical problem by providing a reproducible method for changing the transmission ratio of genetic traits in non-human mammals, birds, fish or insects.
  • prior art methods failed to identify a Distorter which, however, is needed for carrying out the method of the present invention.
  • all t-Distorter candidate genes which have been reported had been identified by the criteria that they were a) located within the t-complex region and b) play a role in sperm specific functions or are primarily expressed in sperm cells, such as Tctex1, Tctex2, Tcte2 and Tcp11 (Fraser and Dudley, 1999).
  • the method of the present invention is based on the fact that in mouse the t-haplotype chromosome is transmitted at non-Mendelian ratio (significantly higher or lower than 50%) to the offspring.
  • This phenomenon involves Tcr (Responder) and several Tcd (Distorter) loci, wherein the Tcd loci in the t-haplotype, that is the mutant forms, enhance the transmission ratio of Tcr.
  • the Tcd+ loci reduce the transmission ratio of Tcr (the "low" phenotype).
  • Tcd loci could not be localized precisely by chromosomal mapping due to recombination suppression between the t-haplotype and the wild type chromosome.
  • the present invention not only makes use of Distorters which are factors involved in G protein signaling, but on top of this solved the problem which was in the prior art that the isolation of a Distorter could not be achieved.
  • the inventors isolated a specific fusion gene, which showed similarity to FGF receptor oncogene partner (Fop) and is highly expressed in testis of wild type mice, but not of mice carrying the t-haplotype, suggesting that it is related to transmission ratio distortion.
  • Tagap1 The transcript of the missing locus, Tagap1, per se was only very weakly expressed in testis and did not hint to a Distorter function either. Only by completing the entire gene the inventors could recognize the missing (second) gene as a gene involved in G protein signalling. Gene targeting and genetic testing demonstrated that Tagap1 is able to alter the transmission ratio of a t-haplotype carrying Tcr. However, the targeted allele reduced the transmission ratio, in contrast to the teachings of the prior art, since Lyon had shown that a deletion of Tcd1 on the wild type chromosome enhanced the transmission ratio (Lyon 1992).
  • Tagap1 constitute a Distorter which enhances the transmission ratio of a t-haplotype and which must be different from the t-Distorter identified by Lyon by genetic means using the deletion chromosome T 22H .
  • the present invention for the first time links G protein signalling to the phenomenon of transmission ratio distortion.
  • the method of the present invention comprises deriving an adult animal from said non human germ cell, fertilized egg cell, embryonic cell or cell derived therefrom containing the nucleic acid molecules as defined in the present invention.
  • the offspring of the foster mother are then determined for the integration of the nucleic acid molecules as described in the present invention and the sex is determined by methods known to the person skilled in the art. Such methods comprise for example genotyping by PCR and further methods as also described below.
  • the male offspring can further be characterized by visual inspection of outer genitalia and also by detecting male specific markers. Said techniques are also known to the person skilled in the art.
  • the transgenic non-human male, fish, bird or insect produced by the method of the present invention can be prepared in at least two alternative ways.
  • the nucleic acid molecules as defined in the present invention can be introduced into the same non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom and the adult organism let develop as described above.
  • the nucleic acid molecules as defined in the present invention can be introduced into different cells thereby producing two different adult organisms with the same methods as described above. The male and female of said two organisms are then crossed and the offspring is analyzed for the nucleic acid molecule as described in the present invention and the male is characterized as described above.
  • the invention relates to a method for producing a transgenic non human animal, preferably mammal, fish, bird or insect, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic animal to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product with a Distorter function into (a) chromosome(s) of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic female to be prepared, wherein said expression product with a Distorter function is a factor involved in G protein signal
  • the invention envisages a method for producing a transgenic non human animal, preferably mammal, fish, bird or insect, said method comprising introducing (a) a first nucleic acid molecule encoding an expression product with a Responder function into a chromosome of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic animal to be prepared, said chromosome containing or conferring said genetic trait(s), thereby linking on said chromosome said Responder function to the genetic trait(s); and (b) at least one second nucleic acid molecule encoding an expression product directed against the Distorter function into (a) chromosome(s) of a non-human germ cell, (fertilized) egg cell, embryonic cell or a cell derived therefrom, of the same species as the transgenic female to be prepared, wherein said Distorter function is an expression product which is encoded by a nucleic acid molecule en
  • the above animal may be male or female.
  • the invention envisages methods for the production of transgenic animals wherein only step (b) is carried out.
  • said animals are preferably mammals, birds, fish or insects.
  • the male animal of the main embodiments (if the outcome is not a male anyhow) can be generated by the above embodiments.
  • transgenic mammal, fish, bird or insects are well known in the art and are described (for example in (DePamphilis 1993), (Chapman, Lawson et al. 2005).
  • Other methods comprise the use of retroviral, in particular lentiviral particles carrying constructs engineered in vitro for the infection of cells, preferably egg cells, zygotes or early embryos, the integration of recombinant DNA constructs into embryonic stem cells and production of stem cell/embryo chimera, or the generation of egg cells or sperm cells from embryonic stem cells having integrated the recombinant DNA construct, by differentiation of said cells in vitro (Lever et al., 2004; Hubner et al., 2003; Geijsen et al., 2004).
  • a further method comprises recombinase mediated cassette exchange (RMCE) whereby a construct which is flanked by non-identical target sites, such as IoxP and lox2272 sites, recognized by a site specific recombinase, such as Cre is exchanged by homologous recombination mediated by the recombinase for a fragment which is contained in a chromosome and which is flanked by said sites (such as loxP and lox2272 in this example), thereby integrating the construct into said chromosome (Pirottin, Grobet et al. 2005).
  • RMCE recombinase mediated cassette exchange
  • the method of the invention also comprises embodiments related to the cloning of transgenic animals. These embodiments include the steps of introducing the nucleic acid molecule as defined in the present invention, recombinant DNA molecule or vector comprising said nucleic acid molecule into the nucleus of a cell, preferably an embryonic cell, replacing the nucleus of an oocyte, a zygote or an early embryo with said nucleus comprising said nucleic acid molecule, recombinant DNA molecule or vector, transferring either said oocyte, zygote or early embryo into a foster mother or first in vitro or in vivo culturing said oocyte, zygote or early embryo and subsequently transferring the resulting embryo into a foster mother and allowing the embryo to develop to term; see, for example, (Wilmut, Schnieke et al.
  • a method for the production of a transgenic non-human animal comprises introduction of a nucleic acid molecule or targeting vector into a germ cell, an embryonic cell, stem cell or an egg or a cell derived therefrom. Production of transgenic embryos and screening of those can be performed, e.g., as described (Joyner 1993). The DNA of the embryonal membranes of embryos can be analyzed using, e.g., Southern blots with an appropriate probe.
  • a general method for making transgenic non-human animals is described in the art, see for example WO 94/24274 .
  • transgenic non-human organisms which include homologously targeted non-human animals
  • ES cells embryonal stem cells
  • Murine ES cells such as AB-1 line grown on mitotically inactive SNL76/7 cell feeder layers ( McMahon and Bradley, Cell 62: 1073-1085 (1990) ) essentially as described ( Robertson, E. J. (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. E. J. Robertson, ed. (Oxford: IRL Press), p. 71-112 ) may be used for homologous gene targeting.
  • Other suitable ES lines include, but are not limited to, the E14 line ( Hooper et al., Nature 326: 292-295 (1987) ), the D3 line ( Doetschman et al., J. Embryol. Exp. Morph.
  • a mouse line from ES cells bearing a specific targeted mutation depends on the pluripotence of the ES cells (i. e., their ability, once injected into a host developing embryo, such as a blastocyst or morula, to participate in embryogenesis and contribute to the germ cells of the resulting animal).
  • the blastocysts containing the injected ES cells are allowed to develop in the uteri of pseudopregnant nonhuman females and are born as chimeric mice.
  • the resultant transgenic mice are chimeric for cells having either the recombinase or reporter loci and are backcrossed and screened for the presence of the correctly targeted transgene (s) by PCR or Southern blot analysis on tail biopsy DNA of offspring so as to identify transgenic mice heterozygous for either the recombinase or reporter locus/loci.
  • transgenic flies such as Drosophila melanogaster are also described in the art, see for example US-A-4,670,388 , Brand & Perrimon, Development (1993) 118: 401-415 ; and Phelps & Brand, Methods (April 1998) 14: 367-379 .
  • said mammal is selected from the group consisting of Mus, Rattus, Bos, Sus and Ovis.
  • Mus is Mus musculus
  • Rattus is Rattus norvegicus
  • Bos is Bos taurus
  • Sus is Sus scrofa f. domestica.
  • said genetic trait is sex.
  • said chromosome is an X or Y chromosome or a corresponding sex chromosome in birds (W, Z), fish or insect.
  • Changing the transmission ratio in insects will have an important impact on the fight against insect pests.
  • transgenic male Anopheles prepared in accordance with this invention with a naturally occurring Anopheles population, responsible for the spreading of malaria, the production of e.g. predominantly male offspring of the transgenic Anopheles is expected (see also explanation herein below).
  • These male Anopheles will change the overall frequency of males in the population and thus lead to an overall mating problem in the Anopheles population which eventually will lead to an overall reduced amount of Anopheles.
  • a corresponding strategy may be employed with, for example, locusts.
  • said chromosome is an autosome.
  • the factor involved in G protein signalling is a factor involved in Rho signalling.
  • the term "a factor involved in Rho signaling" as used in connection with the present invention refers to small G proteins of the Rho subfamily, as well as to molecules acting upstream or downstream of G proteins in terms of signal transduction.
  • Such molecules comprise in particular members of the families of GEFs (guanine nucleotide exchange factors), which enhance the activity of small G proteins, GAPs (GTPase activating proteins) which act as negative regulators and GDls (guanine nucleotide dissociation inhibitors) which also attenuate small G protein signaling (Schmidt and Hall, 2002; Donovan et al., 2002; DerMardirossian and Bokoch, 2005). Finally, the term refers to target molecules, influenced by small G proteins (Bishop and Hall, 2000).
  • said first nucleic acid molecule encoding an expression product with Responder function is selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in SEQ ID No:15 or 16 or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code.
  • said (at least one) second nucleic acid molecule encoding an expression product with a Distorter function is/are selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in any one of SEQ ID NOs: 1 to 14 or a fragment thereof, (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecules of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code.
  • an allelic variant or homologue refers to different wild type forms and t-alleles of the nucleic acid molecues.
  • the nucleic acid molecules can be further manipulated in vitro in order to achieve an optimized transmission ratio distortion effect and/or to adapt it to the specific requirements of the breeding scheme employed, thus further improving the selectability of genetic traits as further described below.
  • a number of standard manipulations known in the field are taken into consideration, such as those resulting in the exchange of amino acids in the catalytic domain(s) which is the GAP domain in case of the GTPase activating proteins and the DH (Dbl-homology) domain in case of the guanine nucleotide exchange factors, overexpression or knock out mutagenesis of said nucleic acid molecules, construction of hypomorphic or hypermorphic (poly)peptides by mutagenesis, deletion or alteration of candidate modification sites on said (poly)peptide, deletion or alteration of binding sites for other (poly)peptides involved in the G protein signaling cascade (see for example Dvorsky and Ahmadian, 2004), synthesis of antisense RNA, siRNA, shRNA, N-terminal or C-terminal truncations, introduction of frame shifts, which alter part of the amino acid sequence of the protein, etc., resulting either in null, hypomorphic, constitutively active, antimorphic or dominant negative alleles.
  • a distortion of the transmission ratio can be achieved with several, if not all, manipulated forms of the nucleic acid molecules described above.
  • a manipulated allele affecting the transmission ratio most effectively will have to be identified empirically for each gene by employing activity assays in vitro and in cell culture systems such as NIH-3T3 cells and transgenic animal systems.
  • orthologue refers to genes present in different organisms and which have the same function.
  • fragment as used in connection with the method of the present invention relates to the fact that said fragment retains the Responder/Distorter function.
  • fragments, allelic variants, homologues or orthologues of a specifically identified sequence conferring responder or Distorter function are referred to throughout this specification, it is understood that these fragments etc. retain or essentially retain the Responder or Distorter function. "Essentially retain” means in accordance with these embodiments that at least 70% of the function are retained, preferably at least 80% such as at least 90%.
  • hybridizing as used in connection with the present invention and as used in the description of the present invention, preferably refers to “hybridizing under stringent conditions", and is well known to the skilled artisan and corresponds to conditions of high stringency.
  • Appropriate stringent hybridization conditions for each nucleic acid sequence may be established by a person skilled in the art on well-known parameters such as temperature, composition of the nucleic acid molecules, salt conditions etc.; see, for example, (Sambrook J. 1989) (Hames 1985), see in particular the chapter “Hybridization Strategy” by Britten & Davidson, 3 to 15.
  • Stringent hybridization conditions are, for example, conditions comprising overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 micrograms/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°.
  • Other stringent hybridization conditions are for example 0.2 x SSC (0.03 M NaCl, 0.003Msodium citrate, pH 7) at 65°C.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
  • salt concentrations e.g. 5X SSC.
  • Typical blocking reagents include, but are not limited to, Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • nucleic acid molecules encoding an interaction partner of a biomolecule, wherein the interaction partner is capable of modulating the activity said biomolecule and wherein the nucleic acid molecules hybridize to the nucleic acid molecule encoding the biomolecule at even lower stringency hybridization conditions.
  • Changes in the stringency of hybridization and signal detection are, for example, accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC). Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments.
  • Typical blocking reagents include, but are not limited to, Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • the method of the present invention be carried out by using the nucleic acid molecules encoding a Distorter function described in SEQ ID NOs: 1 to 14.
  • These sequences relate to wildtype Tagap1 (SEQID NO: 1 and 2), the t-alleles of Tagap1, Tagap1 t1 to t4 (SEQ ID NOs: 3 to 6), the homo sapiens Tagap (SEQ ID NO: 7), the Rattus Tagap (SEQ ID NO: 8), the mouse wildtype Fgd2 (SEQ ID NO: 9), two isoforms thereof (SEQ ID NOs: 10 and 11), a t-allele of Fgd2 (SEQ ID NO: 12), the mouse and homo sapiens Tiam 2 (SEQ ID NOs 13 and 14).
  • said at least one second nucleic acid molecule encoding an expression product with a Distorter function is/are selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in any one of SEQ ID Nos 1 to 12 or a fragment thereof (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code, thereby enhancing said transmission ratio of said genetic trait(s).
  • said at least one second nucleic acid molecule encoding an expression product with a Distorter function is/are selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in of SEQ ID NO: 13 or 14 or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code, thereby reducing said transmission ratio of said genetic trait(s).
  • said nucleic acid molecule encoding an expression product with a Distorter function is selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in any one of SEQ ID NOs: 1 to 12 or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code, thereby reducing said transmission ratio of said genetic trait(s).
  • said nucleic acid molecule encoding an expression product with a Distorter function is selected from the group consisting of (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule as shown in SEQ ID Nos 13 or 14 or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code, thereby enhancing said transmission ratio of said genetic trait(s).
  • the method of the present invention further comprises crossing the transgenic non human male mammal, fish, bird or insect obtained by the method of the present invention with a non human female mammal, fish, bird or insect and analyzing the offspring of said cross for transmission of said genetic trait(s).
  • the above preferred embodiments of the method of the present invention are of particular interest for the applicability of the present invention.
  • the genetic trait(s) of interest can be transmitted to the offspring either at an enhanced or at a reduced ratio with respect to the Mendelian ratio.
  • the most interesting trait in this respect is sex.
  • the method of the present invention making use of the Distorter now allows an enhancement of the effect of the Responder, for example it will be possible to obtain strong selection for or against sperm carrying the Y chromosome.
  • a transgene construct expressing the nucleic acid molecule encoding the Responder function and expressing at least one other nucleic acid molecule encoding (a) Distorter function(s) and/or products directed against the Distorter function be integrated on the Y-chromosome of the farm animal species.
  • action of the Distorter(s) would impair the sperm cells carrying the Responder, which would result in a preferential or exclusive transmission of the X-chromosome and thus generation of female offspring.
  • the action of the Distorter(s) and/or the product(s) directed against the Distorter function would impair all sperm cells, while the sperm cells carrying and expressing the Responder would be rescued.
  • the Y chromosome would be preferentially or exclusively transmitted to the offspring resulting in the production of male offspring.
  • the construct expressing the Responder function and the construct(s) expressing at least one Distorter function and/or product(s) directed against the Distorter function could be integrated on the X chromosome and allow the generation of males preferentially or exclusively transmitting the Y chromosome or, in the latter example, wherein a high transmission ratio of the Responder construct is achieved, the X chromosome. It will depend on the design of the construct(s) (as taught above) expressing the Distorter function and/or product(s) directed against the Distorter function whether enhanced transmission or reduced transmission of the chromosome carrying the Responder construct will be achieved.
  • the teachings of the t-Distorters and of the mutations in the wild type gene provided by the present invention provide the knowledge how Distorter alleles need to be engineered to achieve enhancement or reduction of the transmission ratio of the chromosome carrying the Responder construct and the genetic trait(s) linked to it.
  • Distorters act additively or synergistically, thus the combinatorial use of several nucleic acids encoding Distorter function(s) and/or products directed against the Distorter function(s) is preferred in order to achieve an optimal effect.
  • nucleic acid molecules encoding products directed against the function of Tagap1 and of Fgd2 and of a construct overexpressing Tiam2 achieves a strong effect with respect to selection against sperm carrying and expressing the Responder construct, since all three expression products singly should reduce the transmission ratio of the Responder.
  • constructs expressing the Distorter(s) and/or the constructs expressing an expression product directed against the Distorter function and/or the constructs for inactivation of the Distorter function can be integrated independently of the Responder construct on the same or on different chromosomes.
  • Such a tool for preselection of sex in farm animals is most desirable for Bos taurus, a species for which specialized strains for milk or meat production have been derived.
  • Female offspring is needed for milk production whereas for meat production male offspring is preferred in this species. In most other farm animal species female offspring is most desired.
  • preselection of sex is of general importance in farm animal breeding.
  • said Responder function and/or said Distorter function is the mouse-t-complex Responder/Distorter function.
  • the mouse t-complex Distorter may find applications, for example in breeding, also when introduced into other animals. Specific applications of the Distorter function are addressed herein below.
  • said expression product directed against the Distorter function is an aptamer, a siRNA or shRNA or miRNA, a ribozyme, or an antisense nucleic acid molecule specifically hybridizing to said nucleic acid molecules encoding a factor involved in G protein signaling, or is an antibody, an antibody fragment or derivative thereof specific for the Distorter (poly)peptides as used in connection with the present invention.
  • shRNA small hairpin RNA
  • RNA interference RNA interference
  • vectors comprising nucleic acid molecules encoding a miRNA can be utilized for inhibition of translation of the RNA encoding said Distorter(s) (Kim 2005).
  • Constructs expressing aptamers can be utilized to inhibit protein-protein interaction such as between a Distorter protein and another (poly)peptide of the Distorter/Responder signaling cascade in order to interfere with the propagation of the signal thereby inhibiting said signal pathway.
  • the person skilled in the art is able to design shRNA or miRNA constructs on the basis of the sequence of the mRNA of the gene the function of which shall be down-regulated. The efficacy of the constructs can easily be tested in cellular systems.
  • Aptamers able to inhibit protein-protein interaction can be selected in vitro or in cellular system such as the yeast the method comprising assaying inhibition of protein-protein interaction as measured in the yeast two-hybrid assay (Schmidt, Diriong et al. 2002) (Kurtz, Esposito et al. 2003) (Cassiday and Maher 2003).
  • antibody fragment or derivative thereof relates to single chain antibodies, or fragments thereof, synthetic antibodies, antibody fragments, such as Fab, a F(ab 2 )', Fv fragments, single domain antibodies etc., or a chemically modified derivative of any of these. Derivatives include scFvs.
  • Antibodies to be employed in accordance with the invention or their corresponding immunoglobulin chain(s) can be further modified using conventional techniques known in the art, for example, by using amino acid deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s) and/or any other modification(s) (e.g.
  • antibody fragment or derivative thereof particularly relates to (poly)peptide constructs comprising at least one CDR such as two, three and preferably all six CDRs of an antibody, e.g. in the scFv format. Framework regions of the antibody may also be replaced by unspecific non-antibody-related sequences. Fragments or derivatives of the recited antibody molecules may also define (poly)peptides which are parts of the above antibody molecules and/or which are modified by chemical/biochemical or molecular biological methods.
  • said at least one second nucleic acid molecule encoding the expression product with a Distorter function is modified, thereby further reducing or further enhancing the Distorter function activity.
  • the term "further reducing or further enhancing the Distorter function activity" as used in connection with the method of the present invention refers to the fact that the method of the present invention can be further optimized by genetically manipulating the nucleic acid molecules encoding the Distorters.
  • dominant active or dominant negative alleles of (a) Distorter(s) may be designed and assayed in vitro for their ability to enhance or interfere with the activity of the wild type allele of said Distorter, followed by genetic testing in vivo in transgenic animals of the allele(s) which improve the activity of said Distorter or enhance down-regulation of said Distorter in vitro.
  • alterations of the nucleic acid sequence resulting in changes of the polypeptide encoded by said Distorter gene may be introduced in vitro by exchanging nucleic acid molecules or by synthesizing genes or gene parts in vitro or by random mutagenesis, and (high-throughput) in vitro assays can be designed to measure the activity of the altered proteins or their ability to enhance or inhibit or interfere with (a) component(s) of the Distorter/Responder signal cascade.
  • said first nucleic acid molecule encoding an expression product with a Responder function and said at least one second nucleic acid molecule encoding an expression product with Distorter function and/or said at least one second nucleic acid molecule encoding an expression product directed against the Distorter function and/or said second nucleic acid molecule for inactivation of the Distorter function by homologous recombination and a promoter controlling expression in spermatogenesis and/or spermiogenesis and/or a stop cassette are integrated in said X or Y chromosome or corresponding sex chromosome or in one of said autosomes in a reversible inactive state of expressibility.
  • said promoter is a heterologous promoter.
  • reversibe inactive state of expressibility refers to the possibilty to keep the above nucleic acid molecules in an inactive state of expressibility which can by genetic means be activated, as further described below.
  • the construct(s) expressing the Distorter(s) and/or products directed against the Distorter function(s) reduce the transmission of the nucleic acid molecule encoding a Responder function to such a low ratio that the transmission of the Responder construct is almost or completely excluded.
  • it is envisaged to introduce a construct containing the nucleic acid molecule encoding the Responder in an inactive state for instance by inserting a transcription stop cassette between the promoter controlling expression of the Responder gene and the nucleic acid encoding the Responder, comprising flanking the stop cassette by loxP sites in same orientation.
  • This construct would be inactive with respect to expression of the Responder and thus could be transmitted at Mendelian ratio to the offspring.
  • Males producing sperm allowing preselection of (a) trait(s) are envisaged to be produced by breeding the male or female carrying the inactive Responder construct to a female or male carrying a construct expressing Cre recombinase prior to spermiogenesis. Activation of the Responder construct would then occur by excision of the transcription Stop cassette due to the action of the Cre recombinase during embryonic development or in germ cells.
  • construct(s) will only be activated in sperm cells, in particular if promoter(s) are used which activate transcription specifically during spermatogenesis and/or spermiogenesis.
  • selection against transmission of said construct(s) will be restricted to transmission through sperm cells, while transmission through the female germ cells occurs normally.
  • constructs designed for selection against a genetic trait such as male sex are rendered in some rare cases difficult by the fact that the transgene construct may not or hardly be transmitted to the offspring of the carrier male animal.
  • sperm cells at random or after preselection of cells carrying the transgene construct in order to significantly enhance the likelihood for the production of offspring carrying said transgene construct.
  • Selection can be effected, e.g., by cell sorting. It is also envisaged to make use of in vitro fertilization since it has been shown that transmission ratio distortion in mouse does not occur during in vitro fertilization procedures; other methods are ICSI (intracellular sperm cell injection), (Horiuch, Emuta et al. 2002)
  • the present invention relates to a non human male or female animal, preferably mammal, fish, bird or insect, wherein said non human male or female animal, preferably mammal, fish, bird or insect is transgenic for the nucleic acid molecule encoding an expression product with a Distorter function and/or the nucleic acid molecule encoding an expression product directed against the Distorter function and/or the nucleic acid molecule for inactivation of the Distorter function by homologous recombination as defined in the present invention and optionally for the nucleic acid molecule encoding an expression product with a Responder function.
  • the present invention also relates to a pair of non human male and female animals, preferably mammals, fish, birds or insects, wherein at least one of the male and/or female is a transgenic non human mammal, fish, bird or insect as defined in the present invention.
  • the nucleic acid molecule or part thereof encoding an expression product with a Responder function and/or the nucleic acid molecule or part thereof encoding an expression product with a Distorter function and/or the nucleic acid molecule or part thereof encoding an expression product directed against the Distorter function and/or the nucleic acid molecule or part thereof for inactivation of the Distorter function by homologous recombination as defined in the present invention is/are flanked by recombinase recognition sites.
  • one of the pair has (only) the Responder stably integrated into the germline whereas the partner of the pair has (only) integrated the Distorter into the germline. Upon crossing the offspring will carry both the Responder and the Distorter in the germline. In this manner, male offspring may be selected that is described in accordance with the main embodiments of the invention.
  • the above pair of non-human male and female animal preferably mammal, fish, bird or insect has further stably integrated into its genomic DNA a nucleic acid molecule encoding a site specific DNA recombinase.
  • constructs which are in an inactive state and therefore not selected against under standard breeding conditions, but can be activated after expression of a site specific recombinase.
  • the (inactive) transgene construct can be transmitted at Mendelian rates.
  • a site specific recombinase such as Cre
  • offspring can be generated which carries said transgene construct in an active state allowing selection against the sperm cells carrying said transgene construct.
  • the latter offspring could then be utilized for the production of animals, which do not carry the undesired genetic trait.
  • Several methods can be utilized to keep a transgene construct in an inactive state, the most common being the use of a transcription stop cassette and/or a reporter gene inserted between the promoter driving expression of the transgene construct and the open reading frame (ORF) of the gene kept inactive by this method. It is envisaged that the stop cassette and/or reporter is flanked by recognition sequences for the site specific recombinase in direct repeat orientation allowing deletion of the stop cassette and/or reporter upon recombination, and subsequent expression of the ORF made active by this recombination event.
  • said DNA recombinase is Cre, wherein said recognition sites are IoxP sites, or flp, wherein said recognition sites are FRT sites, or ⁇ c31, wherein said recognition sites are att sites.
  • DNA recombinase is controlled by regulatory elements that are active prior to spermiogenesis.
  • the present invention also relates to sperm obtainable from a male of the transgenic non-human animal, preferably mammal, fish, bird or insect of the present invention.
  • the present invention further relates to the use of the sperm of the present invention for the production of offspring.
  • the present invention also relates to the use of the nucleic acid molecule encoding an expression product with a Distorter function as defined in the present invention, for the identification of chemicals or biological compounds able to trigger the (premature) activation or inhibition of the Responder/Distorter signalling cascade.
  • Responder/Distorter signalling cascade refers to any G protein signalling cascade, wherein at least one of the G proteins or other proteins in the cascade confers Responder/Distorter function.
  • Such compounds could be applicable as potent contraceptiva since it is envisaged that the activation or inhibition (repression) of said signaling cascade may affect the motility of sperm, due to rapid exhaustion of their energy reserve, and/or by inhibiting sperm movement and/or by affecting the ability of sperm to fertilize ovulated eggs. It is envisaged that the identification of said chemical or biological compounds could be achieved by standard screening technology using the activity of the wild type Distorter protein expressed in vitro or in cell culture cells as an assay. It is e.g.
  • GTPase-activating proteins such as Tagap1 enhance the GTPase activity of target GTPases rendering them inactive, or that GEFs such as Fgd2 or Tiam2 exchange GDP for GTP in said GTPases rendering them active.
  • Assay systems for the activity of GAPs and GEFs and GTPases and other proteins involved in G protein signaling are well known in the art (Balch 1995) (Der 2000) allowing an artisan to screen for compounds triggering or inhibiting said proteins in vitro or in cell culture systems. It is envisaged that the compounds are then tested for their effects on sperm motility in vitro and on their effect in preventing fertilization of egg cells by sperm in vivo.
  • the present invention further relates to the use of the nucleic acid molecule encoding an expression product with a Distorter function as defined in the present invention for the isolation of receptor molecules and/or other members of the Responder/Distorter signaling cascade to which said expression product may bind.
  • nucleic acid molecule as defined in the method of the present invention or the expression product as defined in the method of the present invention can be used for the isolation of receptor molecules and/or other members of the Responder/Distorter signaling cascade to which said expression product which would be expected to be a (poly)peptide may bind.
  • Said signal transducing molecules are envisaged to be preferably identified by immunoprecipitation of protein complexes involving the Distorter (poly)peptide and cloning of the corresponding genes encoding them, or by Two Hybrid Screening techniques in yeast employing standard technology.
  • the Distorter gene or (poly)peptide may be used to isolate the membrane receptor of the signaling molecule which is envisaged to activate said Responder/Distorter signaling cascade.
  • Said membrane receptor is envisaged to be most preferable as a target for the development of novel contraceptives.
  • the present invention also relates to a method for the detection of a nucleic acid molecule encoding an expression product with a Distorter function and/or a nucleic acid molecule encoding an expression product directed against the Distorter function and/or a nucleic acid molecule for inactivation of the Distorter function by homologous recombination as defined in the present invention in a non human male or female animal, preferably mammal, fish, bird or insect as defined in the present invention comprising identifying said nucleic acid molecule encoding an expression product with a Distorter function and/or said nucleic acid molecule encoding an expression product directed against the Distorter function and/or said nucleic acid molecule for inactivation of the Distorter function by homologous recombination in said non human male or female animal, preferably mammal, fish, bird or insect by polymerase chain reaction (PCR), gene (micro)array hybridization, single nucleotide polymorphism (SNP) analysis, and/
  • the present invention also relates to a nucleic acid molecule encoding an expression product with a Distorter function, wherein said expression product with a Distorter function is a factor involved in G protein signaling, selected from the group consisting of: (a) a nucleic acid molecule comprising or consisting of the nucleic acid molecule of any one of SEQ ID NOs: 3 to 6 and 12 or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue or orthologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule which hybridizes under stringent conditions to the nucleic acid molecule of (a), wherein said nucleic acid molecule encodes a polypeptide which has (i) at the position corresponding to position 49 of SEQ ID NO: 17 an I (ii) at the position corresponding to position 144 of SEQ ID NO: 17 an L (iii) at the position corresponding to position 323 of SEQ ID NO: 17
  • the nucleic acid molecule of the invention in any case retains the Distorter function. It has preferably a minimal length of at least 200 or 300 nucleotides. Such a molecule may also be used for example as a specific probe for hybridization reactions and would comprise at least one of the mutations of any one of SEQ ID NOs: 3 to 6. It is however also preferred that the nucleic acid molecules of the invention be significantly larger such as at least 500 or 1000 nucleotides.
  • the nucleic acid molecules or fragments thereof of the invention may be fused to flanking sequences.
  • the nucleic acid molecules of the invention may have a length of up to 500 nucleotides, 1000 nucleotides, 2000 nucleotides, 5000 nucleotides, 10000 nucleotides and in particular cases even up to 100000 nucleotides.
  • the nucleotides of the invention may have chromosomal length.
  • the invention encompasses oligonucleotides/primers of a length of at least 8 and up to preferably 50 nucleotides, that are part of the above identified sequences or hybridize to the complementary strand thereof wherein said oligonucleotides/primers contain the sequence of at least one codon coding for any of the above-identified specific amino acid positions (or a complementary sequence thereof).
  • nucleic acid molecule of the present invention is a DNA molecule.
  • said expression product is an RNA or a (poly)peptide.
  • the polypeptide is the expression product that contributes to the Responder/Distorter phenotype.
  • the mRNA contributes to said Responder/Distorter phenotype.
  • the expression level, stage of expression during spermatogenesis or the copy number of said gene results in or contributes to the Distorter phenotype. Therefore, in a preferred embodiment of the nucleic acid molecule of the invention said expression product is an RNA or a (poly)peptide.
  • the present invention also relates to a recombinant DNA molecule comprising the nucleic acid molecule as defined above and a regulatory region being capable of controlling expression of said nucleic acid molecule.
  • said regulatory region is a naturally occurring region or a genetically engineered derivative thereof.
  • said regulatory region comprises or is a promoter.
  • the present invention also relates to a vector comprising the recombinant DNA molecule of the present invention.
  • the vector of the invention may simply be used for propagation of the genetic elements comprised therein.
  • it is an expression vector and/or a targeting vector.
  • Expression vectors such as Pichia pastoris derived vectors or vectors derived from viruses such as CMV, SV-40, baculovirus or retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the recombinant DNA molecule or vector of the invention into targeted cell population.
  • Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, loc. cit. and Ausubel, loc. cit.
  • the recombinant DNA molecules and vectors of the invention can be reconstituted into liposomes for delivery to target cells.
  • the vector of the present invention comprises a heterologous promoter.
  • said vector comprises a heterologous promoter.
  • Said heterologous promoter not naturally operatively linked with the nucleic acid contributing to the Distorter function may be used to determine a certain time point of the onset of Distorter expression. This time point may be the same or a different one that is set when the natural Distorter transcription unit is employed.
  • said heterologous promoter may also be active in the early or late haploid phase of spermatogenesis.
  • said heterologous promoter is controlling gene expression in spermatogenesis and/or in spermiogenesis.
  • said heterologous promoter is the testis promoter of c-kit, ACE, Tcr or Smok.
  • the present invention also relates to a host cell or organism transformed or transfected with the nucleic acid molecule of the present invention, the recombinant DNA molecule of the present invention or the vector of the present invention.
  • the host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell.
  • Prokaryotic host cells will usually only be employed for the propagation of the nucleic acid molecule of the invention and sometimes for the production of the expression product.
  • Suitable mammalian, fish or bird cell lines are well known or can easily be determined by the person skilled in the art and comprise COS cells, Hela cells, primary embryonic cell lines etc.
  • transfected or transformed is used herein in its broadest possible sense and also refers to techniques such as electroporation, infection or particle bombardment.
  • the present invention furthermore relates to a method of recombinantly producing an expression product as defined for the nucleic acid of the present invention comprising the steps of culturing the host cell of the present invention under conditions to cause expression of the protein and recovering said protein from the culture.
  • the method of the invention is most advantageously carried out along conventional protocols which have been described, for example, in Sambrook, loc. cit.
  • the present invention also relates to an expression product encoded by the nucleic acid molecule of the present invention or obtainable by the above method of recombinantly producing an expression product.
  • said expression product may either be an mRNA or a polypeptide.
  • Said expression product is, in accordance with the present invention, involved in the Responder/Distorter phenotype and contributes to the phenomenon of transmission ratio distortion.
  • the expression products relating to a (poly)peptide are preferred.
  • This embodiment therefore comprises the (poly)peptides as shown in any of the sequences listed as SEQ ID NOs: 19 to 22, referring to mouse Tagap1 t1-t4 , respectively, and SEQ ID NO: 28, relating to mouse Fgd2.
  • the present invention further relates to a method for the identification of a nucleic acid molecule encoding an expression product with a Distorter function, comprising the steps of (a) isolating a nucleic acid molecule encoding a candidate expression product with a Distorter function from the mouse t-complex by means of genomic localization, wherein said nucleic acid molecule is involved in G protein signalling; and (b) testing the nucleic acid molecule isolated in step (a) for a change of the transmission ratio of the Responder or of a genetic trait linked to a Responder in an experimental non human animal, wherein when said transmission ratio is enhanced or reduced, said nucleic acid molecule isolated in (a) is a nucleic acid molecule encoding an expression product with Distorter function.
  • Example 4 for Fgd2.
  • the methods described in detail in Example 4 provide an ideal example how a Distorter can be identified and verified in vivo by genetic testing of a null allele.
  • the present invention relates in addition to a method for the identification of an expression product of a nucleic acid molecule encoding a Distorter, comprising the steps of (a) isolating an expression product of a nucleic acid molecule encoding a candidate Distorter by means of protein-protein interaction with a known Distorter derived from the mouse t-complex; and (b) testing the nucleic acid molecule encoding said expression product isolated in (a) for change of the transmission ratio of the Responder or of a genetic trait linked to a Responder in an experimental non human animal, wherein when said transmission ratio is enhanced or reduced, said expression product isolated in (a) is an expression product with Distorter function.
  • step (b) of the above identification methods hypomorphic or hypermorphic alleles of said nucleic acid molecule are used for testing for change of the transmission ratio.
  • (a) (poly)peptide(s) binding to a known Distorter (poly)peptide is/are identified by co-immunoprecipitation of protein complexes involving the Distorter (poly)peptide, or by affinity chromatography purification of a protein binding to said Distorter polypeptide or a part thereof, or by other methods allowing purification and analysis of protein complexes such as mass spectrometry, and subsequent cloning of the corresponding genes encoding the proteins binding to said Distorter (poly)peptide, or by Two Hybrid Screening techniques in yeast employing standard technology (Chien, Bartel et al. 1991).
  • Genetic testing in transgenic animals for the ability of the Distorter candidate identified by the methods described above to enhance or reduce the transmission ratio of the Responder can be performed using, for example, hypomorphic or amorphic or hypermorphic alleles of said Distaorter candidate, which are constructed for example by introduction of (a) nucleic acid molecule(s) expressing a shRNA directed against said Distorter candidate, or by targeting the nuclear gene locus of said Distorter candidate thereby inactivating the gene function, or by introducing a construct expressing the wild type Distorter candidate thereby increasing the dosage of the expression products of said Distorter candidate.
  • t -haplotypes For mapping of Tagap1 on genomic DNA the following t -haplotypes were used: t w12 / t w12 t h2 / t h2 , t h49 / t h49 , t h51 / t h51 , T OR / t w5 , T OR / t 6 , t 6 /+.
  • the t -haplotypes t w12 , t h49 , t h51 and t w5 carry Tcd1, while t 6 and t h2 , which is derived from t 6 , lack Tcd1 activity.
  • the 5'ends of me7Fop and Tagap1 were obtained by 5'-RACE using the GeneRacer kit (Invitrogen). Standard reverse transcription was performed with 1 microgram of total RNA using AMV-RT (Promega). RNAse protection assays were done using standard procedures (Gilman 1997).
  • the Tagap1 probe was synthesized in vitro in the presence of [ 32 P] UTP from a fragment derived from the Tagap1 cDNA by PCR (sense 5'-GACTCCTAGGGTCAGAGTGTCATG-3', antisense 5'-TGGGCTCCACATCTGGGTCATT-3') cloned in pCRII TOPO (Invitrogen).
  • the GAPDH control RNA was transcribed from the pTRI-GAPDH template (Ambion). Northern analysis was performed by standard techniques (Sambrook J. 1989) using 8 ⁇ g of single purified poly(A+)RNA using the Fast Track system (Invitrogen). Quantitative PCR analysis was carried out on an ABI PRISM 7900 HT SDS (Applied Biosystems) using the TaqMan probe 5'-ATCCTCTGCCTTAAAGGTCCTTCAACGGAA-3' (5' FAM and 3' TAMRA labeled) and primers sense 5'-CCAGACCCATCCAGGACATC-3' and antisense 5'-CTGGCAGCTTTCCTGAATATC-3'. As a reference, GAPDH expression was determined using the mouse GAPDH assay (Applied Biosystems).
  • the Tagap1 targeting vector was constructed by ligation of the left and right arm, both derived by PCR amplification of genomic DNA, to the PGK-neo cassette. Culture, electroporation, selection, isolation of ES-cell clones, DNA preparation in 96 well plates and Southern blot analysis were done according to standard procedures (Ramirez-Solis, Davis et al. 1993).
  • the transgenic construct Tg(Tagap1)H1Bgh consists of the Angiotensin Converting Enzyme ( ACE ) testis promoter and transcription start (extending from -91 to +17 bp), driving expression in elongating spermatids (Morita, Murata et al.
  • the wild-type band is 541 bp in length, the transgenic construct produces bands of 165 bp and 266 bp.
  • a fragment containing the PGK-promoter driven neomycin resistance gene flanked by IoxP sites was isolated from the vector pPGKneo Floxl (gift of Moises Mallo) by EcoRV / EcoR I digest and ligated into the EcoRV / EcoR I digested pDT Bluescript vector (provided by Achim Gossler), which contains the diphteria toxin-A chain coding sequence under the control of RNA polymerase II promoter.
  • pDT/pGKneoflox 3xpA was digested with Not I, filled in, cut Xbal and ligated to the left homology region, which was obtained by PCR amplification of genomic DNA using primers s: 5'- ACTAGTCTGCTTCTGGGGTAACT -3' containing a Spe l site and as: 5'-ATAGGCCTGCTCCGTCT -3' followed by digestion with Spel.
  • the obtained construct was digested EcoRV / Sal l and the right homology region, obtained by PCR on genomic DNA with primers s ( EcoRV ): 5'- GATATCAAGAATCCCGCGGTACGAACTG -3' and as ( Sal l : 5'- GTCGACGACAACGCCCGACATCATAGAG -3' and cut with EcoR V and Sal l was ligated into this vector.
  • the resulting targeting vector was linearized by restriction digest with Sal I. Establishment of a BTBR/TF-ES cell line, culture, electroporation, selection, isolation of ES-cell clones, DNA preparation in 96 well plates and Southern blot analysis was done according to standard procedures.
  • the left probe (LP) and right probe (RP) for Southern blot analysis were generated by PCR with primers LPs 5'- ACAGGTCTCACGTAGCCGAATC -3', LPas 5'-CGGGTGAAGCAGGTCTACCACA -3' and RPs 5'-TGGATGCCGCTCAGTTGCTAAT -3',RPas 5'- TGAAACTCAGTGTGTAGACCAG - 3'respectively.
  • the catalytic domain of wild type Tagap1, small G proteins and the C-terminal polypeptide of Tagap1, the latter serving as negative control, were produced as GST-fusion proteins in E. coli BL21 using the pGEX vectors as described (Frangioni and Neel 1993) (Self and Hall 1995). For quantification of relative amount of proteins used, all preparations were adjusted relative to a BSA standard. GAP assays were performed in triplicate (G proteins at 6 nM; Tagap1: 15 nM) essentially as published (Self and Hall 1995).
  • Example 1 Isolation of a candidate gene for Tcd1
  • Tcd a positional cloning approach to identify a candidate for Tcd1, based on the following criteria: 1) The gene must be located in the genomic interval comprising Tcd1, 2) it must be expressed in testis, 3) show alterations in the t- haplotype form vs. the wild type, and 4) should encode a protein involved in signalling.
  • the latter criterion was based on our proposal that Tcd s encode components of signalling cascades acting upstream of Smok (Herrmann, Koschorz et al. 1999).
  • This polymorphism confirms the mapping of Tagap1 to the Tcd1 region. Quantification of the wild-type and the t -specific signals revealed that the Tcd1 -bearing t -haplotypes harbour four Tagap1 loci, while the wild-type genome contains a single complete Tagap1 gene. This result was confirmed by quantitative PCR on genomic DNA using Tagap1 specific primers. Hybridisation with the 3'-probe, which detects me7Fop and Tagap1 , and quantification of the bands revealed two-fold higher signal intensity in genomic DNA from t h49 / t h49 mice compared to t h2 / t h2 mice or wild type strains.
  • RNA expression analysis by RT-PCR and RNAse protection assays showed that Tagap1 is transcribed in the testis already at the earliest stage analysed, day 7 post partum (Fig. 2 a,b).
  • Tagap1 is expressed already in diploid spermatocytes, which may be conducive to distribution of the gene products to all sperm cells, since spermatids develop in a syncytium.
  • Northern blot analysis using poly(A+) RNA suggested low level transcription in this organ (Fig. 2c).
  • In situ hybridisation analysis on testis sections using a Tagap1 specific probe did not produce distinct signals.
  • the transcript detected in the t-haplotype shows a slightly faster migration compared to the wild type mRNA (Fig. 2c). The reason for this is unclear, as no major size differences (except for the 21-base deletion) were observed in any of the t -specific cDNA clones analysed.
  • RhoA enhance the intrinsic GTPase activity of small G proteins, promoting their inactive state.
  • Our data show that the GTPase activity of RhoA was strongly enhanced by the GAP domain of Tagap1, whereas the other family members were only mildly (Cdc42) or hardly (Rac1) stimulated, identifying RhoA as a possible in vivo target of Tagap1 (Fig. 2e).
  • Example 2 Tagap1 distorts the transmission ratio of t-haplotypes
  • the translation product is predicted to be truncated upstream of the RhoGAP domain.
  • This allele termed Tagap tm3Bgh (in accordance with standard nomenclature) was bred in trans to the partial t -haplotype t 6 . Litter mates carrying either the wild type allele or Tagap tm3Bgh in trans to t 6 were tested for transmission ratio distortion (Fig. 3e, Table1). Complementary to the transgenic experiments, the transmission ratio of t 6 from Tagap tm3Bgh / +; t 6 / + males was strongly reduced compared to the ratio obtained from Tagap1 +/+; t 6 /+ litter mates (69% vs.
  • the inactivation (in terms of GAP activity) of one of the originally two Tagap1 genes by a chromosomal rearrangement in the wild type may have had a selective advantage over the progenitor chromosome since it decreased the overall Tagap1 activity in t/+ heterozygotes, possibly "defending" the wild type chromosome better against the disadvantageous hyperactivity caused by the t- specific Tagap1 loci.
  • the distortion of the t 6 transmission ratio caused by the gain- and loss-of-function alleles of Tagap1 is considerably lower than that expected for Tcd1 encoded by the partial t -haplotype t h51 (8-15% for Tagap1 vs. >27% for t h51 ; ref. (Lyon 1984)). Though some of this difference may be accounted for by variation in the genetic background or by a stronger effect of the Tagap1 loci in the t-haplotype, our data support the identification of two Tcd1 loci.
  • Tcd1a the t-Tagap1 loci, in accordance with their map position on the chromosome, encode Tcd1a, and should be named Tagap1 Tcd1a (according to nomenclature rules). The contribution of each of the four loci and the exact mechanism by which they produce a hypermorph remains to be explored in detail. In accordance with the finding of two Tcd1 loci and the data shown here, we predict that the second locus, Tcd1b , represents a hypomorphic or amorphic allele of a gene acting upstream of or epistatically to the G protein controlled by Tagap1.
  • Tagap1 down-regulates a member of the Rho subfamily of small G proteins, which acts as negative regulator of Smok kinases.
  • Tagap1 Tcd1a enhances down-regulation of this Rho GTPase, which leads to indirect up-regulation of Smok.
  • the wild type allele of Tcd1b encodes either an activator of the Rho protein controlled by Tagap1, or an indirect inhibitor of Smok acting through another factor. If the t- haplotype allele Tcd1b represents a hypomorphic or amorphic allele, as suggested, this mutation would cause a reduction of the Tcd1b protein level indirectly resulting in up-regulation of Smok.
  • Tcd1b would thus act additively or synergistically with and epistatically to Tagap1 Tcd1a .
  • Tcd2 would further enhance this effect.
  • Only Tcr expressing spermatozoa would be rescued from the motility defect caused by Tcd s , resulting in preferential fertilisation of the eggs by t -sperm.
  • Tagap1 for the first time links Rho signalling to transmission ratio distortion. Previous reports have provided evidence for a role of Rho-GTPases in sperm motility, and the Rho binding protein Rhophilin and its interaction partner Ropporin are found in the flagellum(Hinsch, Habermann et al.
  • Rhophilin is localised on the outer surface of the outer dense fibers of the sperm tail, directly opposing Ropporin, which is localised at the inner surface of the fibrous sheath (Fujita, Nakamura et al. 2000).
  • Rho-GTPases are well known for their essential role in cell motility and chemotaxis, which has been extensively studied in human neutrophils, fibroblasts and in the slime mould Dictyostelium discoideum (Van Haastert and Devreotes 2004).
  • Rho-GTPases control repeated extension of pseudopodia at the leading edge in response to a shallow gradient of signalling molecules, enabling the cell to move towards the stimulus.
  • Rho-GTPases control repeated extension of pseudopodia at the leading edge in response to a shallow gradient of signalling molecules, enabling the cell to move towards the stimulus.
  • Rho-GTPases Whether these analogous functions of Rho-GTPases in cell motility in neutrophils and in sperm motility are part of a common mechanism, despite the fact that the former involves actin and myosin fibers while the latter involves microtubuli remains to be explored.
  • the identification of a t-complex-Distorter provides access to understanding the molecular principles of transmission ratio distortion and promotes the investigation of the role of Rho signalling in sperm motility.
  • Example 4 Fgd2 is a candidate for Tcd2
  • Tagap11 as Distorter of the transmission ratio of t-haplotypes for the first time demonstrated an important role of small GTPases (preferentially of the Rho type) in transmission ratio distortion. This finding led us to suggest that other proteins involved in G protein signalling might also play a role in TRD. Therefore, the genomic region comprising the t-haplotype was searched with bioinformatics tools for genes encoding proteins of this group. Several were identified, among them Fgd2, encoding for a protein containing a Dbl homology domain and belonging to the GEF (guanine nucleotide exchange factor) family of proteins. Fgd2 is located in the distal portion of the t-haplotype, the In4 region.
  • Fgd2 cDNA fragments were isolated by RT-PCR from testis of a male carrying the t-haplotypes t 6 / t w5 . Sequence analysis demonstrated a number of mutations in the t -specific transcript with respect to the wild type transcript suggesting Fgd2 as candidate for Tcd2. On the basis of these data, involvement in G protein signalling, location in the t- haplotype region, expression in testis and modification of the coding region in the t- allele, Fgd2 was genetically analysed with respect to enhancement or reduction of the transmission ratio of the Tcr carrying t-haplotype t h49 , which lacks Tcd2.
  • Example 5 Tiam2 is a candidate for Tcd1b
  • Tiam2 Another candidate for a t -Distorter was identified with bioinformatics tools in the Tcd1 subregion of the t -haplotype. This region contains another member of the family of Dbl homology domain proteins, Tiam2. Thus, this gene also belongs to the GEF family of proteins involved in G protein signalling. Primary characterization of the Tiam2 transcripts in t -haplotypes failed to identifiy a t -specific transcript in testis using the sensitive RT-PCR technology, suggesting that the t -allele of Tiam2 is not transcribed in testis.
  • transgenic lines TgH1-33 and tgH1-4
  • TgH1-33 and tgH1-4 The transmission ratio of t 6 was compared between transgenic and non-transgenic animals. Both lines significantly increase the transmission ratio of t 6 .
  • An inactivated Tagap1 allele (loss-of-function) produced by gene targeting results in the complementary effect on the transmission ratio of the t-haplotype (lower part).
  • the transmission ratio of the t-haplotype by t 6 /+ animals is strongly reduced by heterozygozity for Tagap1 tm3Bgn .
  • Table 2 Transmission ratio of t h49 from males lacking Fgd2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Environmental Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Microbiology (AREA)
  • Animal Husbandry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP05017651A 2005-08-12 2005-08-12 Identification de distorteurs du complex-t et leurs applications Withdrawn EP1752040A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP05017651A EP1752040A1 (fr) 2005-08-12 2005-08-12 Identification de distorteurs du complex-t et leurs applications
ARP060103504A AR054910A1 (es) 2005-08-12 2006-08-10 Metodo para producir un animal macho transgenico no humano
CA2618198A CA2618198C (fr) 2005-08-12 2006-08-11 Isolement des generateurs de distorsion complexes t, et applications correspondantes
PCT/EP2006/007977 WO2007020026A1 (fr) 2005-08-12 2006-08-11 Isolement des generateurs de distorsion complexes t, et applications correspondantes
EP06776794A EP1912494B1 (fr) 2005-08-12 2006-08-11 Isolement des générateurs de distorsion du complexe T et applications correspondantes
NZ565122A NZ565122A (en) 2005-08-12 2006-08-11 Isolation of the T-complex distorters and applications thereof for producing transgenic non human animals which a non-Mendelian transmission ratio of a genetic trait
AU2006281607A AU2006281607B2 (en) 2005-08-12 2006-08-11 Isolation of the t-complex distorters and applications thereof
US11/997,992 US20090307790A1 (en) 2005-08-12 2006-08-12 Isolation of the t-complex distorters and applications thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP05017651A EP1752040A1 (fr) 2005-08-12 2005-08-12 Identification de distorteurs du complex-t et leurs applications

Publications (1)

Publication Number Publication Date
EP1752040A1 true EP1752040A1 (fr) 2007-02-14

Family

ID=35976636

Family Applications (2)

Application Number Title Priority Date Filing Date
EP05017651A Withdrawn EP1752040A1 (fr) 2005-08-12 2005-08-12 Identification de distorteurs du complex-t et leurs applications
EP06776794A Not-in-force EP1912494B1 (fr) 2005-08-12 2006-08-11 Isolement des générateurs de distorsion du complexe T et applications correspondantes

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP06776794A Not-in-force EP1912494B1 (fr) 2005-08-12 2006-08-11 Isolement des générateurs de distorsion du complexe T et applications correspondantes

Country Status (7)

Country Link
US (1) US20090307790A1 (fr)
EP (2) EP1752040A1 (fr)
AR (1) AR054910A1 (fr)
AU (1) AU2006281607B2 (fr)
CA (1) CA2618198C (fr)
NZ (1) NZ565122A (fr)
WO (1) WO2007020026A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019165465A1 (fr) * 2018-02-26 2019-08-29 Aggenetics, Inc. Matériaux et procédés de prévention de la transmission d'un chromosome en particulier

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999025815A2 (fr) * 1997-11-18 1999-05-27 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Acides nucleiques participant au phenotype du repondeur et leurs applications
WO2000040607A2 (fr) * 1999-01-06 2000-07-13 Chiron Corporation Adn codant les proteines tiam-2 et procede d'utilisation dudit adn

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999025815A2 (fr) * 1997-11-18 1999-05-27 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Acides nucleiques participant au phenotype du repondeur et leurs applications
WO2000040607A2 (fr) * 1999-01-06 2000-07-13 Chiron Corporation Adn codant les proteines tiam-2 et procede d'utilisation dudit adn

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BAUER HERMANN ET AL: "The t complex-encoded GTPase-activating protein Tagap1 acts as a transmission ratio distorter in mice", NATURE GENETICS, vol. 37, no. 9, September 2005 (2005-09-01), pages 969 - 973, XP002372066, ISSN: 1061-4036 *
DATABASE GENBANK NCBI; 20 September 2004 (2004-09-20), PIAO ET AL.: "Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method", XP002373587, Database accession no. NM_145968.1 *
HERRMANN B G ET AL: "A protein kinase encoded by the t complex responder gene causes non-mendelian inheritance.", NATURE. 11 NOV 1999, vol. 402, no. 6758, 11 November 1999 (1999-11-11), pages 141 - 146, XP002373480, ISSN: 0028-0836 *
LYON MARY F: "Transmission ratio distortion in mice.", ANNUAL REVIEW OF GENETICS. 2003, vol. 37, 2003, pages 393 - 408, XP002373584, ISSN: 0066-4197 *
MARTIN-DELEON PATRICIA A ET AL: "Spam1-associated transmission ratio distortion in mice: Elucidating the mechanism", REPRODUCTIVE BIOLOGY AND ENDOCRINOLOGY, vol. 3, 10 August 2005 (2005-08-10), pages 32 - 43, XP002373481, ISSN: 1477-7827 *
PASTERIS N G ET AL: "Isolation, characterization, and mapping of the mouse and human Fgd2 genes, faciogenital dysplasia (FGD1; Aarskog syndrome) gene homologues.", GENOMICS. 15 AUG 1999, vol. 60, no. 1, 15 August 1999 (1999-08-15), pages 57 - 66, XP004444836, ISSN: 0888-7543 *
PIAO Y ET AL: "Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method.", GENOME RESEARCH. SEP 2001, vol. 11, no. 9, September 2001 (2001-09-01), pages 1553 - 1558, XP002373477, ISSN: 1088-9051 *
SCHIMENTI JOHN C ET AL: "Mutations in Serac1 or Synj2 cause proximal t haplotype-mediated male mouse sterility but not transmission ratio distortion.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 1 MAR 2005, vol. 102, no. 9, 1 March 2005 (2005-03-01), pages 3342 - 3347, XP002373479, ISSN: 0027-8424 *

Also Published As

Publication number Publication date
US20090307790A1 (en) 2009-12-10
CA2618198C (fr) 2018-04-17
WO2007020026A1 (fr) 2007-02-22
NZ565122A (en) 2011-10-28
CA2618198A1 (fr) 2007-02-22
EP1912494B1 (fr) 2012-10-17
EP1912494A1 (fr) 2008-04-23
AU2006281607A1 (en) 2007-02-22
AR054910A1 (es) 2007-07-25
AU2006281607B2 (en) 2012-04-26

Similar Documents

Publication Publication Date Title
Zekri et al. Control of fetal growth and neonatal survival by the RasGAP-associated endoribonuclease G3BP
US5814300A (en) Gene-targeted non-human mammals deficient in the SOD-1 gene
WO2005060739A1 (fr) Mammifere transgenique non humain comprenant un polynucleotide codant pour un recepteur c5ar humain ou humanise
US6734336B1 (en) Gene-targeted non-human mammal with human fad presenilin mutation and generational offspring
EP1912494B1 (fr) Isolement des générateurs de distorsion du complexe T et applications correspondantes
US6984771B2 (en) Mice heterozygous for WFS1 gene as mouse models for depression
Cheah et al. Requirement of LIM domains for LIM1 function in mouse head development
García et al. Generation of a conditional allele of the B‐myb gene
WO2006016692A1 (fr) Animal non-humain assommé
US20050066380A1 (en) Perv screening method and use thereof
Orquera et al. NKX2. 1 is critical for melanocortin neuron identity, hypothalamic Pomc expression and body weight
US20090007283A1 (en) Transgenic Rodents Selectively Expressing Human B1 Bradykinin Receptor Protein
US6794147B1 (en) Methods for identifying contraceptive compounds
CA2416381A1 (fr) Mammifere non humain a gene cible avec mutation de preseniline de fad et sa descendance
JP4217782B2 (ja) ロスモンド・トムソン症候群の特徴を示すマウス及びその作製方法
JPWO2008062904A1 (ja) トランスジーンの安定的発現を可能にする方法
AU2001276995A1 (en) Gene-targeted non-human mammal with human fad presenilin mutation and generational offspring
US7541511B2 (en) Mouse exhibiting characteristics of Rothmund-Thomson syndrome and preparation method thereof
JP2006141329A (ja) Ｐｏｌθノックアウト動物、並びに免疫機能調節用組成物及びそのスクリーニング方法
Nielsen et al. Control of Fetal Growth and Neonatal
AU2003271882A1 (en) Screening method
JPH06245670A (ja) トランスジェニック動物
WO2002059140A2 (fr) Elements regulateurs de l'ikaros et leurs utilisations
JP2001299141A (ja) ノックイン非ヒト哺乳動物
WO2006055416A2 (fr) Souris transgenique pouvant surexprimer le ve-ptp

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

AKX Designation fees paid
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070815

REG Reference to a national code

Ref country code: DE

Ref legal event code: 8566