EP1713913A2 - Screening assays - Google Patents
Screening assaysInfo
- Publication number
- EP1713913A2 EP1713913A2 EP05701358A EP05701358A EP1713913A2 EP 1713913 A2 EP1713913 A2 EP 1713913A2 EP 05701358 A EP05701358 A EP 05701358A EP 05701358 A EP05701358 A EP 05701358A EP 1713913 A2 EP1713913 A2 EP 1713913A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- rna
- seq
- oligonucleotide
- secondary structure
- mrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
Definitions
- the present invention provides a method for modulating regulatory RNA-ligand interactions, e.g. for the identification, selection and validation of opener and closer nucleic acids for the controlled manipulation of RNA secondary structures.
- the openers or closers of the present invention are used to modulate RNA secondary structure dependent RNA-ligand interactions and the associated downstream processes such as gene expression.
- the present invention for example relates to the field of RNA biology, in particular to RNA secondary structure analysis and prediction and to RNA secondary structure dependent RNA-ligand interactions.
- the present invention is particularly related to RNA interactions with proteins involved in gene regulation, more specifically in the post transcriptional regulation of gene expression, particularly the control of mRNA stability, e.g. the mRNA stabilization by binding of the protein HuR (ELAVL1 ) to AU-rich element containing mRNAs.
- the present invention relates for example further to the field of drug discovery, more specifically to the identification and validation of pharmaceutical targets, to the development of assays for high throughput screening and to the profiling of compounds.
- the present invention is for example further related to the manipulation of disease relevant RNA-ligand interactions, particularly to RNA-ligand interactions which are dependent on RNA secondary structure features, e.g. the manipulation of RNA-ligand interactions controlling the messenger RNA stability of disease relevant genes, e.g. the interactions between the protein HuR and AU-rich element mRNAs like early response gene mRNAs, e.g. the mRNAs of TNF ⁇ or IL-2.
- the present invention includes the development of nucleic acid tools for the manipulation of gene expression, which is related to other but complementary approaches such as antisense techniques or RNAi.
- RNA associated regulatory processes in the cell critically depend on the formation of a specific RNA secondary structure.
- the secondary structure ⁇ of an RNA molecule of sequence s is a list of base pairs (i.e. pairs of nucleotides of the sequence) satisfying the following conditions: (/) Each nucleotide s,- participates in at most one base pair; (ii) each base pair (s suSy) of ⁇ is one of the canonical base pairs GC, CG, AU, UA, GU and UG; (iii) base pairs satisfy the non-pseudoknot condition, i.e.
- RNA molecules of equal sequence s may form many different structures, denoted by the set ⁇ (s).
- ⁇ free energy F( ⁇ ) (relative to a random coil structure) by adding up energy contributions for stacked base pairs, hairpin loops, interior loops, bulges and multi-branched loops.
- a secondary structure motif or secondary structure element, required for a particular biological process may not be formed by all structures in the thermodynamic equilibrium ensemble of a sequence but only by a subset ' ⁇ — ' * *' .
- Structures forming a secondary structure motif or element required for a particular biological purpose are herein designated as active or accessible structures throughout the present invention. If a particular secondary structure motif can be formed only once within a secondary structure, the probability of accessible structures p* in the thermodynamic ensemble can be computed by summing over the probabilities of individual structures in A(s):
- p ⁇ can be calculated using the exclusion-inclusion principle (see e.g. Meisner N.C. et al., Chembiochem 2004, 5(10): 1432-47;hackerm ⁇ ller J. et al., Gene, 2005, in press).
- the thermodynamics of an RNA molecule M may change dramatically when it hybridizes with a short oligonucleotide O. Consequently, hybridization of an oligonucleotide may change the tendency of RNA molecules to form a particular secondary structure motif.
- the probability of structures in the thermodynamic ensemble that form at least one structure motif of interest may be different in a structure ensemble of RNA-oligonucleotide hybrids as compared to the structure ensemble of the RNA molecule alone.
- the overall probability P* of secondary structures forming at least one motif of interest depends on the M probability of accessible structures of the RNA molecule p * , the probability of accessible MO structures of the RNA-oligo hybrid p * and on the equilibrium between hybridized and unhybridized RNA, i.e. on the equilibrium concentrations of oligonucleotide [O] and RNA [M] and the hybridization energy between RNA and oligonucleotide expressed by the equilibrium constant of the hybridization, K M0 .
- RNA secondary structure motifs augment or enable the recognition of (degenerate) sequence motifs or that "pure" RNA secondary structure motifs without sequence constraints are recognized by regulatory proteins. It has been shown recently that the apparent affinity of an RNA protein interaction which requires a particular RNA secondary structure motif depends directly on the probability of accessible (i.e. motif forming) secondary structures in the thermodynamic equilibrium ensemble of the RNA sequence
- [R], [R*], [P], [RP] denote the respective equilibrium concentrations of RNA, accessible RNA, protein and the RNA protein complex.
- AU-rich elements are cis acting elements predominately present in the 3' untranslated regions (UTR) of early response gene mRNAs. These loosely defined elements are essentially characterized by a combination of AUUUA and UUAUUUA(U/A)(U/A) motifs and U-rich regions. Their presence targets a messenger RNA for rapid degradation in cis, and their function is dependent on the specific interaction with trans-acting factors.
- ARE-binding proteins Among the at least 21 ARE-binding proteins identified so far, a positive regulatory effect has been attributed only to the ubiquitously expressed HuR (ELAVL1 , RefSeq accession: NP_001410) and its neuronal homologues HuB, HuC, HuD.
- HuR ubiquitously expressed HuR
- HuC HuC
- HuD HuD
- the list of currently known HuR controlled genes is given in Meisner N.C.
- BMP6 bone morphogenetic protein 6
- CCL11 chemokine (C-C motif) ligand 11
- eotaxin CSF2 (colony stimulating factor 2)
- GMCSF granulocyte monocyte colony stimulating factor
- FSHB follicle stimulating hormone beta
- IL1 b interleukin 1 beta
- IL2 interleukin 2
- IL3 interleukin 3
- IL4 interleukin 4
- IL6 interleukin 6
- IL8 interleukin 8
- MYOD1 myogenic factor 3
- MYOG myogenin
- NF1 neurofibromin 1
- PITX2 paired-like homeodomain transcription factor 2
- TNF ⁇ tumor necrosis factor alpha
- VEGF vascular endothelial growth factor
- CCNA2 cyclin A
- CCNB1 cyclin B1
- CCND1 CCND1
- CDKN1 B cyclin-dependent kinase inhibitor 1 B, i.e. p27 or kipl
- DEK deK
- FOS v-fos FBJ murine osteosarcoma viral oncogene homolog, c-fos
- HLF hepatic leukemia factor
- JUN v-jun sarcoma virus 17 oncogene homolog (avian), c-jun
- MYC v-myc myelocytomatosis viral oncogene homolog, c-myc
- MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived, n-myc
- TP53 tumor protein p53
- HDAC2 histone deacetylase 2
- MMP9 matrix metalloproteinase 9
- NDUFB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex
- NOS2A cyclin-
- the present invention combines the foresaid aspects, i.e. the ability to influence RNA thermodynamics by hybridization of short oligonucleotides and the dependence of RNA protein interactions on the formation of a particular secondary structure element.
- This invention provides methods to rationally design short oligonucleotides which manipulate the probability of secondary structures that form a particular secondary structure element required for a particular biological process, e.g. a secondary structure element required for an RNA-ligand interaction.
- RNA secondary structure is of central importance in the regulation of many cellular processes such as translation, mRNA processing, metabolic pathways or other control mechanisms depending on RNA-ligand interactions.
- the present invention provides a method for controlled manipulation of RNA secondary structure and the associated regulatory processes.
- Computationally designed oligonucleotides hybridize to their target RNA molecule and thereby maximize or minimize the probability of a particular secondary structure element which is crucial for the molecular interaction of interest.
- These modulator (opener or closer) nucleic acids not only allow to e.g. unfold a regulatory hairpin but to disrupt or favor any functional RNA structure element.
- Such an artificially induced conformational reorganization may occur at regions proximal or distant to the hybridization site within the target RNA sequence.
- the method therefore provides a means for (i) the development of specific target related assays and HTscreens to identify compounds which inhibit or strengthen the modulator induced structure change on a disease relevant target mRNA, (ii) for boosting or silencing gene expression as a tool in cell biological or in vivo assays, (iii) in drug target validation or (iv) in compound profiling, and (v) for mechanistic studies of the biological role of one particular protein binding site by specifically "opening” or "closing” an individual among multiple binding sites.
- the present invention provides a method for modulating regulatory RNA-ligand interactions comprising
- RNA of the present invention includes any RNA molecule with a biological function, including covalently modified RNA, e.g. from the group consisting of messenger RNA (mRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), transfer RNA (tRNA), micro RNA (miRNA), small nucleolar RNA and spliceosomal RNA.
- mRNA messenger RNA
- rRNA ribosomal RNA
- snRNA small nuclear RNA
- tRNA transfer RNA
- miRNA micro RNA
- small nucleolar RNA small nucleolar RNA
- RNA is an mRNA, such as an AU-rich element mRNA, e.g.
- BMP6 bone morphogenetic protein 6
- CCL11 chemokine (C-C motif) ligand 11
- eotaxin CSF2 (colony stimulating factor 2)
- GMCSF granulocyte monocyte colony stimulating factor
- FSHB follicle stimulating hormone beta
- IL-1b interleukin 1 beta
- IL-2 interleukin 2
- IL-3 interleukin 3
- IL-4 interleukin 4
- IL-6 interleukin 6
- IL-8 interleukin 8
- MYOD1 myogenic factor 3
- MYOG myogenin
- NF1 neurofibromin 1
- PITX2 paired-like homeodomain transcription factor 2
- TNF ⁇ tumor necrosis factor alpha
- VEGF vascular endothelial growth factor
- CCNA2 cyclin A
- CCNB1 cyclin B1
- CCND1 cyclin D1
- CCND2 cyclin D2
- CD83 CD83
- CDKN1 B cyclin-dependent kinase inhibitor 1 B, i.e. p27 or kipl
- DEK cyclin-dependent kinase inhibitor 1 B, i.e. p27 or kipl
- FOS v-fos FBJ murine osteosarcoma viral oncogene homolog, c-fos
- HLF hepatic leukemia factor
- JUN v-jun sarcoma virus 17 oncogene homolog (avian), c-jun)
- MYC v-myc myelocytomatosis viral oncogene homolog, c-myc
- MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived, n-myc
- TP53 tumor protein p53
- HDAC2 histone deacetylase 2
- MMP9 matrix metalloproteinase 9
- NDUFB6 nuclear factor-
- a ligand of the present invention includes a molecule which binds to an RNA molecule, e.g. including an RNA, DNA, peptide, protein or a small molecule, e.g. a protein, such as an ARE binding protein, e.g. of the ELAV family, such as ELAVL1 (HuR), HuB, HuC, HuD, e.g. ELAVL1.
- RNA molecule e.g. including an RNA, DNA, peptide, protein or a small molecule, e.g. a protein, such as an ARE binding protein, e.g. of the ELAV family, such as ELAVL1 (HuR), HuB, HuC, HuD, e.g. ELAVL1.
- a secondary structure element or, synonymously used, a secondary structure motif of the present invention includes an RNA secondary structure pattern consisting of paired and unpaired positions, e.g. a hairpin, such as a hairpin of eight stacked bases closing a loop of 5 bases.
- a secondary structure element or secondary structure motif includes a combined sequence/RNA secondary structure motif, such as a sequence pattern with a secondary structure constraint, preferably, a sequence pattern with defined secondary structure, e.g. the sequence pattern NNUUNNUUU in fully single stranded conformation, where N is the IUPAC code for any RNA nucleotide.
- the secondary structure element or secondary structure motif is required for a particular biological function, e.g. the binding of a particular protein to the RNA or the autocatalytic cleavage of the molecule, preferably, the secondary structure motif is required for the binding of HuR to an mRNA.
- thermodynamic equilibrium ensemble The probability of RNA secondary structures in the thermodynamic equilibrium ensemble of a particular sequence that form a particular secondary structure element required for a biological process, such as the probability of RNA secondary structures that contain the sequence motif NNUUNNUUU in fully single stranded conformation, is herein also designated as accessibility.
- the thermodynamic equilibrium ensemble may be of any RNA molecule, such as an mRNA, or of an RNA molecule hybridized with oligonucleotides, such as an mRNA hybridized with openers or closers as defined below.
- An oligonucleotide of the present invention includes all nucleoside oligomers of defined sequence, preferably RNA, DNA, PNA (peptoid nucleic acids) or LNA (locked nucleic acids) with any 2'- or backbone modification such as 2'oxy-methyl or phosphorothioate- substitutions.
- An oligonucleotide of the present invention may also be present in a labeld form, e.g. labeled at the 3' or 5' terminus or at internal positions with labeling substances as conventional, such as e.g.
- the length of the oligonucleotide depends on the secondary structure of the RNA and the desired sequence specificity, preferably the oligonucleotide has a length of 10 to 200 nucleotides, such as 10 to 100, preferably 10 to 50, such as about 20 nucleotides.
- the oligonucleotide of the present invention may act as an opener or as a closer.
- An opener of the present invention includes an oligonucleotide which raises the accessibility of the hybrid of a particular RNA with said opener of a particular secondary structure element beyond a defined threshold compared to the accessibility of said RNA of said secondary structure element, e.g. a threshold defined as a value which is at least 2 times higher.
- An opener is partly reverse complementary to the RNA, preferably it is exactly reverse complementary.
- a closer of the present invention includes an oligonucleotide which lowers the accessibility of the hybrid of a particular RNA with said closer of a particular secondary structure element beyond a defined threshold compared to the accessibility of said RNA of said secondary structure element, e.g. a threshold defined as a value which is at least 0.5 times lower.
- a closer is partly reverse complementary to the RNA, preferably it is exactly reverse complementary.
- the present invention further provides a method for the identification and selection of oligonucleotides which act as openers or closers for a particular RNA and a particular secondary structure element.
- a prerequisite is the prior knowledge of the secondary structure element required for a particular biological process of interest, e.g. for binding of a ligand, e.g. a protein.
- the secondary structure element may e.g. be common knowledge or identified from the literature.
- a required secondary structure element can be identified, e.g. from affinity data, using a method as conventional, e.g. such as a method which is described in detail inhackermueller J. et al., 2005, Gene (in press) or which is exemplified for the interaction between HuR and mRNAs as described in Meisner N.C. et al. Chembiochem, 2004, 5(10:1432-47. M
- the accessibility " • is calculated for said RNA secondary structure element and said RNA, e.g. by using a computational method as given in Computational Protocols.
- the temperature for which the accessibility is calculated is set.
- the temperature is set to the ambient temperature at which the oligonucleotide is experimentally validated or applied, e.g. to 37° for in vivo use.
- RNA -oligonucleotide hybrid The accessibility "* of the RNA -oligonucleotide hybrid is calculated for candidate openers or closers.
- Candidate openers or closers may be arbitrarily chosen oligonucleotides which are at least partly reverse complementary to the RNA, or may be chosen as partly reverse complementary oligonucleotides which hybridize to the RNA in proximity of positions where MO said secondary structure element can be formed.
- P is evaluated for all oligonucleotides of a defined length, e.g. 20 nucleotides (nt) which are exactly reverse complementary to said RNA.
- An oligonucleotide is selected as an opener if the difference between * and p * is MO M beyond a certain threshold, e.g. "* is twice as high as p * .
- An oligonucleotide is selected M MO MO as a closer if the difference between "* and p * is beyond a certain threshold, e.g. p * is M half as high as p * .
- such identified openers or closers may be further validated experimentally by hybridizing them with said RNA and determining the effect of the hybridization on the accessibility of the secondary structure element, e.g. by known methods such as ELISA
- the present invention provides a method of the present invention wherein the RNA is an IL-2 mRNA, the ligand is ELAVL1 and the oligonucleotide has a sequence selected from the group consisting of SEQ ID NO 1 AAGGCCTGATATGTTTTAAG , SEQ ID NO 2 AATATAAAATTTAAATATTT, SEQ ID NO 3 TAGAGCCCCTAGGGCTTACA, SEQ ID NO 4 TGAAACCATTTTAGAGCCCC, SEQ ID NO 5 AAGGCCUGAUAUGUUUUAAG, SEQ ID NO 6 AAUAUAAAAUUUAAAUAUUU, SEQ ID NO 7 UAGAGCCCCUAGGGCUUACA, SEQ ID NO 8 UGAAACCAUUUUAGAGCCCC.
- the present invention provides a method of the present invention wherein the RNA is a TNF- ⁇ mRNA, the ligand is ELAVL1 and the oligonucleotide has a sequence selected from the group consisting of SEQ ID NO 9: TCGGCCAGCTCCACGTCCCG,
- SEQ ID NO 10 TCTGGTAGGAGACGGCGATG
- SEQ ID NO 11 ACGGCGATGCGGCTGATGGT
- SEQ ID NO 12 TTCTGGAGGCCCCAGTTTGA
- SEQ ID NO 13 ATTCCAGATGTCAGGGATCA
- SEQ ID NO 14 ATCACAAGTGCAAACATAAA
- the present invention provides the use of a method of the present invention for manipulating the expression of a gene by altering the secondary structure of the corresponding RNA.
- the present invention provides an oligonucleotide that changes the thermodynamic probability of a secondary structure element beyond a defined probability threshold identified by a method of the present invention.
- the present invention provides an oligonucleotide having a sequence selected from the group consisting of
- the oligonucleotide identified by a method of the present invention is an RNA or DNA molecule or an oligonucleotide of SEQ ID NO 1 to SEQ ID NO 14, with any chemical modification; e.g. a modification selected from the group consisting of 2 % -0-methyl- Phosphorothioate-, Cholesterol-, Biotin- and fluorescence dye.
- the oligonucleotide identified by a method of the present invention or an oligonucleotide of SEQ ID NO 1 to 14 is a PNA or LNA molecule.
- an oligonucleotide identified by a method of the present invention or an oligonucleotide of SEQ ID NO 1 to SEQ ID NO 14 are hereinafter designated as "an oligonucleotide of the present invention”.
- the present invention provides the use of an oligonucleotide identified by a method of the present invention or an oligonucleotide selected from the group consisting of SEQ ID No 1 - 14 for manipulating regulatory RNA-ligand interactions, e.g. as a tool in the manipulation of RNA secondary structure, e.g. to modulate RNA-ligand interactions such as RNA protein interactions, preferably mRNA protein interactions, and the regulatory effects associated with this interaction.
- oligonucleotides identified by a method of the present invention may be used for the manipulation of gene expression, e.g. the expression of AU-rich element controlled genes, preferably by manipulation of HuR controlled mRNA stability as illustrated in Figure 1.
- the function of the opener or closer oligonucleotides provided by the present invention merely depends on the ability to specifically hybridize with its target RNA. Hence, they provide a great flexibility with respect to chemical modifications. This allows to adjust the physico- and biochemical properties of the opener or closer oligonucleotide.
- single stranded RNA, DNA, PNA (peptoid nucleic acids) or LNA (locked nucleic acids) with any 2'- or backbone modification such as 2'oxy-methyl- or phosphorothioate- substitutions may be used.
- the opener or closer oligonucleotides may be labeled at the 3' or 5' terminus or at internal positions with biotin, cholesterol, digoxigenin, colloids, transition element complexes, carbohydrates, amino acids, or with fluorescent, radioactive, alkyl-, peptide or other tags or with synthetic polymers, e.g. polylysine or (poly)ethyleneglycol.
- opener or closer oligonucleotides may be used in in vitro, cellular or in vivo applications.
- opener or closer oligonucleotides of the present invention may be delivered to cells by transfection methods such as adjuvant mediated transfer, e.g. transfer by liposome, DEAE dextran, calcium phosphate or other adjuvants, by viral vectors, e.g. retroviral vectors, or by physical methods, e.g. electroporation, microinjection or optoinjection.
- the openers or closers may be delivered e.g. orally, by injection, e.g.
- manipulation of gene expression by opener or closer oligonucleotides of the present invention may be applied for the validation of drug targets, e.g. by comparing a phenotypic readout for an opener increased expression of a disease relevant gene versus normal expression or a decreased expression of the same gene, mediated by a closer of the present invention or by conventional methods, e.g. RNAi, antisense or other knockdown methods.
- manipulation of gene expression by opener or closer oligonucleotides of the present invention may be used for mechanistic studies in in vivo, cell biological or biochemical assays, e.g. by comparing a phenotypic readout for an opener increased expression of a gene of interest versus normal expression or a decreased expression of the same gene, mediated by a closer of the present invention or by conventional methods, e.g. RNAi, antisense or other knockdown methods.
- Said phenotypic readout is e.g.
- RNA secondary structure selected from the group consisting of a change in RNA secondary structure, RNA tertiary structure, RNA-ligand complex levels, RNA-ligand affinities, RNA oligo- or multimerization, ligand oligo- or multimerization, autocatalytic RNA cleavage, ligand conformation, RNA splicing, covalent RNA modifications, RNA localization, RNA stability, RNA expression levels, protein expression levels, RNA or protein localization, cell proliferation, cell differentiation, cell migration, inflammation, tissue vascularization, tumour progression, angiogenesis or any other downstream effect of the RNA secondary structure which is manipulated by an oligonucleotide of the present invention.
- manipulation of gene expression by opener or closer oligonucleotides of the present invention may be applied for the profiling of agents, e.g. a chemical substance, by e.g. comparing the effect of said agent at an opener increased expression of a gene of interest versus normal expression or a decreased expression of the same gene, mediated by a closer of the present invention or by conventional methods, e.g. RNAi, antisense or other knockdown methods.
- agents e.g. a chemical substance
- the present invention provides the use of an oligonucleotide identified by a method of the present invention or an oligonucleotide selected from the group consisting of SEQ ID No 1 - SEQ ID NO 14 for influencing the stability of an RNA molecule.
- the present invention provides:
- an assay for identifying an agent that modulates the effect of the hybridization of an RNA molecule to an oligonucleotide comprising (a) hybridizing an RNA comprising a secondary structure element which is required for recognition by a ligand to an oligonucleotide that changes the thermodynamic probability of said secondary structure element beyond a defined probability threshold in the presence and in the absence of a candidate compound, (b) determining the effect of hybridization of said RNA to said oligonucleotide in the presence and in the absence of said candidate compound, and (c) identifying an agent which modulates the effect of hybridization.
- (ll)an assay for identifying an agent that mimics the effect of hybridization of an RNA molecule to an oligonucleotide comprising (a)hybridizing an RNA comprising a secondary structure element which is required for recognition by a ligand to an oligonucleotide that changes the thermodynamic probability of said secondary structure element beyond a defined probability threshold, (b)hybridizing an RNA comprising a secondary structure element which is required for recognition by a ligand to a candidate compound which is expected to have a similar effect as the oligonucleotide, (c) determining the effect of hybridization for steps (a) and (b), and (d)identifying an agent which mimics the effect of hybridization of step (a).
- a candidate compound includes compound (libraries) from which hybridization according to the present invention may be expected, e.g. including RNA fragments, DNA fragments, oligopeptides, polypeptides, proteins, antibodies, mimetics, small molecules, e.g. low molecular weight compounds (LMW ' s), preferably LMW.
- LMW low molecular weight compounds
- An agent is one of the chosen candidate compounds, for which a hybridizing effect as described above has been proven.
- Agents like small molecules or other chemical substances may be tested for either inhibiting, enhancing or simulating this effect, e.g. by binding to a specific conformation in the mRNA structure during rearrangement.
- the effect of hybridization in the assays of the present invention is determined by measuring a signal which is related to the effect of hybridization, which effect is selected from the group consisting of changes in secondary RNA structure, tertiary RNA structure, RNA-ligand affinity, RNA oligo- or multimerization, ligand oligo- or multimerization, conformational change of the ligand, efficiency of a downstream effect of RNA-ligand recognition, RNA splicing, covalent RNA modifications, RNA localization, RNA stability.RNA translation and protein expression profiles.
- Such assays may be realized by hybridizing an oligonucleotide of the present invention to an RNA of interest in presence or absence of a candidate compound and measuring a phenotypic readout associated with the effect of said hybridization to identify an agent which modulates or mimics said effect.
- the effect of said hybridization is e.g. determined by measuring a signal which is related to a phenotypic readout as described above.
- said assays can be used for making ARE controlled genes drugable at the level of mRNA regulation.
- the openers or closers of the present invention may be used to design target specific mRNA stability assays.
- Exemplary assay principles using openers of the present invention are illustrated in Figures 11 and 12:
- the opener leads to a structural rearrangement, detected e.g. by standard fluorescence spectroscopic methods like fluorescence intensity, lifetime or fluorescence resonance energy transfer (FRET) measurements.
- FRET fluorescence resonance energy transfer
- RNA in said assays is an mRNA.
- RNA, the ligand and the oligonucleotide are as defined above.
- the present invention provides the use of the assays of the present invention for high throughput screening.
- the present invention provides oligonucleotides or agents identified by a method of the present invention or an oligonucleotide selected from the group consisting of SEQ ID No 1 - SEQ ID NO 14 for use as a pharmaceutical.
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising an agent identified by an assay of the present invention or an oligonucleotide of the present invention beside at least one pharmaceutical excipient, e.g. appropriate carrier and/or diluent, e.g. including fillers, binders, disintegrators, flow conditioners, lubricants, sugars and sweeteners, fragrances, preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers.
- a pharmaceutical excipient e.g. appropriate carrier and/or diluent, e.g. including fillers, binders, disintegrators, flow conditioners, lubricants, sugars and sweeteners, fragrances, preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers.
- the present invention provides a pharmaceutical composition of the present invention, further comprising another pharmaceutically active agent.
- compositions may be manufactured according, e.g. analogously to a method as conventional, e.g. by mixing, granulating, coating, dissolving or lyophilizing processes.
- Unit dosage forms may contain, for example, from about 0.5 mg to about 1000 mg, such as 1 mg to about 500 mg.
- an agent or an oligonucleotide of the present invention includes one or more agents or oligonucleotides, e.g. a combination of agents or oligonucleotides.
- compositions of the present invention may be used for the treatment of a disorder having an etiology associated with a downstream effect of the RNA secondary structure which is manipulated by said oligonucleotide or agent.
- said downstream effect may be the production of a substance, e.g.
- a protein e.g encoded by an AU-rich element controlled gene, preferably selected from the group consisting of cytokines, chemokines, growth factors, proto-oncogenes, viral proteins, receptors, hormones or enzymes, preferably such substance is selected from the group consisting of BMP6 (bone morphogenetic protein 6), CCL11 (chemokine (C-C motif) ligand 1), eotaxin, CSF2 (colony stimulating factor 2), GMCSF (granulocyte monocyte colony stimulating factor), FSHB (follicle stimulating hormone beta), IL-1 b (interleukin 1 beta), IL2 (interleukin 2), IL-3 (interleukin 3), IL-4 (interleukin 4), IL-6 (interleukin 6), IL-8 (interleukin 8), MYOD1 (myogenic factor 3), MYOG (myogenin), NF1 (neurofibromin 1), PITX2 (paired-like homeodomain transcription factor 2), TNF
- CDKN1 B cyclin-dependent kinase inhibitor 1 B, i.e. p27 or kipl
- DEK cyclin-dependent kinase inhibitor 1 B, i.e. p27 or kipl
- FOS v-fos FBJ murine osteosarcoma viral oncogene homolog, c-fos
- HLF hepatic leukemia factor
- JUN v-jun sarcoma virus 17 oncogene homolog (avian), c-jun)
- MYC v-myc myelocytomatosis viral oncogene homolog, c-myc
- MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived, n-myc
- TP53 tumor protein p53
- HDAC2 histone deacetylase 2
- MMP9 matrix metalloproteinase 9
- NDUFB6 nuclear factor-
- Treatment includes treatment and prophylaxis.
- an indicated daily dosage is in the range from about 0.01 g to about 1.0 g, of an agent or an oligonucleotide of the present invention; conveniently administered, for example, in divided doses up to four times a day.
- An agent or an oligonucleotide of the present invention may be administered by any conventional route, for example enterally, e.g.
- an agent or an oligonucleotide of the present invention may be administered in the form of a pharmaceutically acceptable salt, e.g.
- An agent or an oligonucleotide of the present invention in the form of a salt exhibit the same order of activity as the compounds of the present invention in free form; optionally in the form of a solvate.
- An agent or an oligonucleotide of the present invention may be used for pharmaceutical treatment according to the present invention alone or in combination with one or more other pharmaceutically active agents.
- Combinations include fixed combinations, in which two or more agents or oligonucleotides of the present invention are in the same formulation; kits, in which two or more agents or oligonucleotides of the present invention in separate formulations are sold in the same package, e.g. with instruction for co-administration; and free combinations in which the agents or oligonucleotides of the present invention are packaged separately, but instruction for simultaneous or sequential administration are given.
- Figure 1 Schematic illustration of the opener action
- HuR binding is impaired by inaccessibility of the binding site (marked by 1 ).
- the opener marked by 2
- target mRNA mRNA ⁇
- specific modulation of the local secondary structure within the ⁇ mRNA leads to a presentation of the HuR binding site in accessible conformation resulting in mRNA ⁇ stabilization without affecting any other HuR target mRNA (e.g. mRNA ⁇ ).
- Figure 2 Design of IL-2 opener oligonucleotides
- the HuR binding site accessibility p * M0 (i.e. fraction of accessible RNA) at 37° is shown in dependence of IL-2 3'UTR hybridization to a reverse complementary 20mer oligonucleotide at a given hybridization site (start position, x-axis) within the 3'UTR.
- the IL-2 ARE is indicated as a white box
- NNUUNNUUU HuR binding sites are shown as blocks in the continuous black line at opener start positions about 50 and about 150. A significant increase in the accessibility is restricted to discrete "hotspots" in proximity of the HuR binding sites.
- Figure 3 Illustration of opener hybridization to the IL-2 3'UTR
- MFE Minimum free energy secondary structure of the IL-2 3'UTR (left panel) and of the IL- 2 3'UTR hybridized to opener Op ⁇ (right panel, Opi represented as a dark full line). NNUUNNUUU elements are marked as small spots in the right panel. As illustrated in the MFE conformation of the complex, the opener shifts the equilibrium towards conformations with accessible (i.e. single stranded) NNUUNNUUU elements - following the model sketched in Figure 1. Importantly, the opener effect does not necessarily need to be reflected in MFE structures, as the ensemble of structures is relevant for opener prediction. MFE secondary structures for 3'UTR - opener complexes are computed using Cofold (available with the Vienna RNA package). Figure 4: IL-2 openers increase in vitro HuR affinity to IL-2 3'UTR
- IL-2 mRNA openers increase endogenous HuR-IL2 mRNA association
- HuR mRNA complexes are co-immunoprecipitated from lysates of human PBMC without or after treatment with opener or negative control oligonucleotides Op Op 2 , N 2 and Op ⁇ .
- HuR- bound IL-2 mRNA is quantified by real time RT-PCR.
- IL-2 mRNA amounts are normalized to the levels in untreated cells (open bars). Openers are added to 2.5 ⁇ M (hedged bars) or 10 ⁇ M (solid bars), negative controls N 2 and Op ⁇ to 10 ⁇ M concentration. Both openers boost HuR mRNA complexation to up to 6.5 fold (Op or 3.1 (Op 2 ) fold higher levels.
- FIG. 6 IL-2 mRNA openers inhibit IL-2 mRNA degradation
- Degradation of endogenous IL-2 mRNA is monitored in human PBMC lysates.
- Mg 2+ 0 minutes
- the data are fitted to a single exponential decay (solid line: no opener; dashed line: N 2 ).
- Addition of openers Op ⁇ (filled circles) or Op 2 (filled triangles) promotes a transient IL-2 mRNA stabilization in a concentration dependent manner (openers at 10 ⁇ M in (A), 25 ⁇ M in (B) and 40 ⁇ M in (C)).
- Op ⁇ blocks the degradation over the entire incubation time of 70 minutes.
- Op 2 shows a similar stabilizing effect, although it targets another HuR binding site (filled triangles, (B) and (C)).
- EF-1 ⁇ a non-ARE mRNA, remains stable over the entire observation time of 70 minutes (B)).
- Figure 7 IL-2 opener oligonucleotides specifically promote IL-2 mRNA stabilization
- t 1/2 36.0 ⁇ 2.2 minutes
- t 1 2 37.6 ⁇ 5.6 minutes
- Op 1 filled circles
- Op 2 filled triangles, both at 25 ⁇ M
- the HuR binding site accessibility p * M0 (i.e. fraction of accessible RNA) at 37° is shown in dependence of TNF- ⁇ mRNA hybridization to a reverse complementary 20mer oligonucleotide at a given hybridization site (start position, x-axis) within the mRNA (RefSeq NM_000594).
- the TNF- ⁇ 3'UTR is depicted by a black line, the ARE is indicated as a white box, NNUUNNUUU HuR binding sites are shown as black small boxes.
- Hybridization sites with a significant change in the accessibility are clustered in "hotspots", mainly in proximity but also distant to the HuR binding sites.
- TNF- ⁇ openers increase in vitro HuR affinity to TNF- ⁇ 3'UTR
- the apparent affinity of recombinant HuR to TNF- ⁇ 3'UTR is determined in the presence and in the absence of the opener, closer or negative control oligonucleotides in a 1 D-FIDA assay.
- the TNF- ⁇ closer Cl ⁇ significantly reduces the HuR association with the TNF- ⁇ 3'UTR, reflected by an increase in the apparent dissociation constant K d app .
- the effect correlates with the concentration of the closer.
- the opener Op ⁇ increases the affinity of HuR to the TNF- ⁇ 3'UTR by a factor of up to ⁇ 2 (B), which is in good consistence with the computationally predicted effect (Figure 8). However, at opener concentrations above 0.5 nM, the effect revertes again towards increased dissociation constants. Hybridization with a negative control oligonucleotide N ⁇ does not affect the HuR - TNF- ⁇ 3'UTR affinity over the entire concentration range of the experiment (C). The TNF- ⁇ 3'UTR concentration is 1 nM in all experiments.
- TNF- ⁇ openers specifically promote TNF- ⁇ mRNA stabilization
- An opener designed for TNF- ⁇ specifically stabilizes the TNF-- ⁇ mRNA (A) without affecting IL-1 ⁇ mRNA levels (B). (circles: without opener; stars: with opener Op ⁇ at 25 ⁇ M).
- An exemplary assay principle for the identification of compounds acting on the ARE mRNA conformation is schematized.
- the opener induced conformational rearrangement is e.g. detected by appropriately positioned fluorophores, constituting a FRET pair. Strategically placed within the mRNA, their distance and, hence, the FRET efficiency becomes diagnostic for open or closed HuR binding site (marked by ⁇ 8>).
- an opening of the HuR binding site induced by a computationally designed opener is detected by a decrease in the FRET efficiency.
- B Low molecular weight compounds might interfere with this rearrangement by different modes of action. By binding to the mRNA, they may either compete directly with opener hybridization or locally freeze the mRNA in the closed conformation.
- Such compounds characterized by a persistent energy transfer in presence of the opener, will prevent HuR from binding to the mRNA and thereby down-regulate the corresponding target gene.
- the opener effect may be enhanced by a compound which stabilizes the opened conformation.
- These compounds as well as such which mimic the opener induced conformational switch are identified by a reduced energy transfer in presence or absence of the opener, respectively.
- the main issue for an adaptation to the HTS format will be the preparation of site specifically double labeled mRNA in sufficient amounts. An alternative strategy is therefore outlined in Figure 12.
- Figure 12 Opener based in vitro assay design II: HuR binding
- the assay strategy may be shifted to the detection of the HuR binding event by measuring energy transfer between two fluorophores on the mRNA and on HuR.
- the mRNA label may be either (A) covalently attached to the 3' terminus (e.g. as described in Qin P.Z. et al., Methods, 1999, 18(1):60-70) or (B) introduced via the opener oligonucleotide.
- the conformational rearrangement induced by the opener is measured indirectly by a determination of HuR mRNA association, which is the subsequent step. Therefore, HuR inhibitors will produce the same signal as compounds which act on the mRNA conformation and need to be sorted out in an appropriate counterscreen.
- Figure 13 Strategies for mRNA opener based cellular assays
- Exemplary strategies for cellular assay design on ARE mRNA conformational switches are outlined (A).
- the target mRNA is specifically visualized by an appropriately designed fluorescent probe (e.g. Cy5).
- the probe is computationally designed to ensure minimal influence on the thermodynamic mRNA ensemble and to be compatible with the opener induced structural rearrangement.
- Endogenous HuR is labeled by fusion to a fluorescent protein (e.g. CFP).
- a fluorescent protein e.g. CFP
- the two fluorophores HuR, mRNA
- the two fluorescent molecules will co-localize on the mRNA, which can e.g. be detected by high resolution confocal imaging (B).
- the mRNA specific label is placed directly on the opener oligonucleotide.
- the probe hybridizes in sufficient proximity to the HuR binding site (marked by ®), energy transfer (i.e. donor quenching/acceptor sensitization) is the preferable detection mode to discriminate closed from. open (i.e. HuR bound) conformations.
- energy transfer i.e. donor quenching/acceptor sensitization
- HuR bound open conformations
- Sequences of putative opener or negative control oligoribonucleotides identified for IL-2 or TNF ⁇ are specified. Openers/closers which are selected for experimental validation, as well as negative control oligos are depicted in bold. The sequences are reverse complementary to the specified region in the target mRNA and given in 5' to 3' direction. Table 2. Primers used for RT PCR
- sequences of the primers used for RT-PCR quantification of the target mRNAs of IL-2, TNF- ⁇ and IL-1 ⁇ as well as for EF-1- ⁇ as internal control mRNA are specified in 5' to 3' direction.
- IPTG isopropyl- ⁇ -D-thiogalaktopyranoside LC/EI-MS Liquid chromatography/Electrospray lonization-Mass spectroscopy
- EXAMPLE A Experimental protocols: a) Preparation of fluorescently labeled RNA. 5' amino-C6 modified RNA is synthesized on an 394A synthesizer (Applied Biosystems) using 5-0-dimethoxytrityl-2O- triisopropyloxymethyl- protected '-cyanoethyl-( ⁇ /, ⁇ /-diisopropyl-)nucleotide phosphoramidites (Glen Research) adopting published procedures (see e.g. Chaix C. et al., Nucleic Acids Symp. Ser. 1989, (21 ):45-6; Scaringe S.A. et al., Nucleic Acids Res.
- RNA concentrations are calculated from UV-absorption at 260 nm according to the Bouguer-Lambert-Beer Law, using the exact molar extinction coefficient at 260 nm as determined according to reference (Gray D.M. et al., Methods in Enzymology 1995, 246:19-34).
- 3'UTRs are prepared by run-off transcription from dsDNA templates with T7 RNA polymerase (T7 MEGASCRIPT in vitro transcription kit, Ambion).
- T7 RNA polymerase T7 MEGASCRIPT in vitro transcription kit, Ambion.
- the T7 promoter is incorporated into the transcription templates during PCR amplification, using primers encompassing the 3'UTRs of IL-2 and TNF- ⁇ (IL-2: nt 707-1035, TNF- ⁇ : nt 872-1568,
- the transcript is 3' terminally oxidized with Na(m-)I0 4 and coupled to hydrazide activated Cy3 (AP Biotech), essentially as described in reference (Qin P.Z. et al., Methods 1999, 18(1):60-70).
- the product is subsequently purified by RP-HPLC as described for synthetic ORNs, desalted and transferred into aqueous solution by gel filtration.
- a 1 :1 labeling stoichiometry is controlled by determination of the Cy3 and RNA concentration by UV ⁇ /IS absorption spectroscopy with correction for the dye absorbance at 260 nm. Preparation of recombinant human HuR.
- the coding sequence for full-length HuR (amino acids 1-326, RefSeq accession: NP_001410) is amplified from cDNA prepared from activated human T-lymphocytes. The product is cloned directionally into the Ndel and Sapl sites of the vector pTXB1 (IMPACTTM-CN system, New England Biolabs), allowing C- terminal fusion with an intein-chitin binding domain tag without additional amino acid insertion. The fusion protein is expressed in E.coli ER2566 (New England Biolabs) upon induction with IPTG (1mM, for 6 hours at 28°).
- the bacterial cells are lysed by successive freezing/thawing cycles in a buffer of Tris/CI (tris(hydroxymethyl)aminomethane, 20 mM pH 8.0), NaCI (800 mM), EDTA (1 mM) and Pluronic F-127 (0.2 % w/v, Molecular Probes). After DNA digestion, the lysates are cleared by ultracentrifugation and the fusion protein is captured onto chitin agarose beads (New England Biolabs).
- Tris/CI tris(hydroxymethyl)aminomethane, 20 mM pH 8.0
- NaCI 800 mM
- EDTA EDTA
- Pluronic F-127 0.2 % w/v, Molecular Probes
- the recombinant protein is recovered by thiol-induced on-column self-splicing of the intein tag with 2-mercaptoethanesulfonic acid (sodium salt, 50 mM) for 12 hours at 4° (see e.g. Cantor E.J. et al., Protein Expr. Purif. 2001 , 22(1): 135-40). Any co-eluted intein tag and uncleaved fusion protein are removed from the eluate in a second, subtractive affinity step.
- 2-mercaptoethanesulfonic acid sodium salt, 50 mM
- the protein is transferred into the storage buffer (Na 2 HP0 4 /NaH 2 P0 (25 mM) pH 7.2, NaCI (800 mM), Pluronic F-127 (0.2 % w/v)) by gel filtration (DG-10 columns, Bio-Rad), shock-frozen in small aliquots in liquid nitrogen and stored at -80°. Under these conditions, full length HuR is soluble without presence of higher aggregation states (analytical size exclusion chromatography), and shows the characteristic CD-spectra for RRM domains (Manival X. et al., Nucleic Acids Res. 2001 , 29(11 ):2223-30).
- the protein is > 99 % pure according to LC/EI-MS, RP-HPLC and SDS-PAGE analysis. N-terminal sequencing reveals a correct N-terminus quantitatively missing Met
- purified HuR is lyophilized, dissolved in guanidinium hydrochloride (6 M) and the concentration is determined by UV-spectroscopy according to reference (see Gill S.C. et al., Anal. Biochem. 1989, 182(2):319-26). This solution is used as external standard for determination of HuR concentrations by RP-HPLC quantification.
- 2D-FIDA-anisotropy HuR-RNA binding assay The fluorescently labeled RNA is thermally denatured for 2 minutes at 80° in assay buffer (PBS, Pluronic-F-127 (0.1 % w/v), MgCI 2 (5 mM)), refolded by cooling to rt (-0.13 °C s "1 ) and diluted to 0.5 nM, which ensures an average of ⁇ 1 fluorescent particles in the confocal volume in the described setup (Ecotec BA, 2001 , 2D-FIDA Quick Guide, Hamburg).
- assay buffer PBS, Pluronic-F-127 (0.1 % w/v), MgCI 2 (5 mM)
- the accurate concentration in each sample is determined based on the particle number derived from a parallel FCS evaluation and the size of the confocal volume, as given by the adjustment parameters for the point spread function (EVOTEC BioSystems, 2001). Fluorescently labeled RNA is titrated against increasing concentrations of recombinant HuR (at least 11 titration points). HuR-RNA samples are incubated for at least 15 minutes at rt prior to each measurement. HuR-RNA complex formation is monitored under true equilibrium conditions by determination of the fluorescence anisotropy with 2D-FIDA. Measurements are performed in 96 well glass bottom microtiter plates (Whatman) on an EvotecOAI PickoScreen instrument at ambient temperature (constant at 23.5°).
- the Olympus inverted microscope IX70 based instrument is equipped with two fluorescence detectors, a polarization beamsplitter in the fluorescence emission path and an additional linear polarization filter in the excitation path.
- a 0.5 nM solution of TMR in assay buffer is used for the adjustment of the confocal pinhole (70 ⁇ m) and for the determination of the G-factor of the instrument (Lakowitcz J.R.
- the anisotropy data are fitted based on the exact algebraic solution of the binding equation describing the average steady-state anisotropy signal r in dependence of the degree of 1 :1 complex formation derived from the law of mass action (Daly T.J. et al., J.Mol.Biol. 1995,
- the labeled mR ⁇ A or 3'UTR is thermally denatured for 2 minutes at 80° in assay buffer (PBS, Pluronic-F-127 (0.1 % w/v), MgCI 2 (5 mM)) and refolded by cooling to rt (-0.13 °C s "1 ).
- Opener, closer or negative control OR ⁇ s (MWG Biotech, sequences see Table 1 ) are added to final concentrations between 0.5 and 100 nM.
- the final concentration of Cy3-labeled mR ⁇ A is 0.5 nM, accurate particle numbers are determined as described for the 2D-FIDA anisotropy measurements.
- the labeled mR ⁇ A is titrated against increasing concentrations of HuR in presence and absence of openers or negative control OR ⁇ s.
- HuR-mR ⁇ A complex formation is monitored with 1 D-FIDA by a determination of the molecular brightness change of Cy3 induced by HuR binding to the R ⁇ A.
- the molecular brightness q is extracted from the 1 D-FIDA raw data using the FIDA algorithm and averaged from 20 consecutive measurements (10 seconds each).
- the molecular brightness data are fitted based on an equation analogous to equation [VI], adapted for fluorescence intensity measurements:
- hPBMC are isolated from heparinized blood by Ficoll-Hypaque centrifugation, washed with PBS containing BSA (15 % w/v), resuspended at 2 x 10 6 ml "1 in RPMI 1640 (Gibco/BRL) supplemented with heat-inactivated FCS (1 0% v/v), L-glutamine (2mM), streptomycin (100 ⁇ g ml "1 ) and penicillin (100u ml "1 ) and incubated in a 37° C0 2 incubator.
- hPBMC are stimulated for 4 hours with PMA (25 ng ml "1 , Sigma-Aldrich) and anti-CD3 mAb (1 ⁇ g ml "1 , Pharmingen).
- Nonidet-P-40 0.5 % v/v
- RNAsin 0.4 u ml "1 , Promega
- Superasln 0.2 u ml " 1 , Ambion
- the lysates are centrifuged for 4 minutes at 15,000 x g and 4° to pellet nuclei.
- the cleared lysates are incubated for 5 minutes with anti- HuR mAb (5 ⁇ g ml "1 , 19F12, Molecular Probes) at 4° in presence and absence of opener or negative control ORNs (at 2.5 or 10 ⁇ M).
- biotinylated anti(mouse) IgG mAb 10 ⁇ g mM , Amersham Pharmacia
- the immunecomplexes are captured on streptavidin sepharose beads (Amersham Pharmacia).
- the beads are washed thoroughly with lysis buffer.
- HuR and the complexed mRNA are eluted under acidic conditions (Glycin/HCI (50 mM, pH 2.5), NaCI (50 mM), prewarmed to 95 °C).
- the eluates are passed by centrifugation through BioSpin gel filtration columns (BioRad), pre-equilibrated with H 2 0.
- Co-precipitated RNA is quantified by real-time RT-PCR. mRNA decay.
- 5 x 10 6 stimulated hPBMC are lysed in lysis buffer (250 ⁇ l) as described above, in presence or absence of opener, closer or negative control ORNs at 10, 25 or 40 ⁇ M.
- mRNA degradation is initiated in the cleared lysates by addition of MgCI 2 (net concentration of 5 mM free Mg 2+ ). The degradation reaction is proceeded at rt and stopped after various timepoints between 2 and 70 minutes incubation (50 ⁇ l aliquots for each timepoint) by addition of EDTA and guanidinium isothiocyanat containing buffer (Qiagen).
- RNA is isolated using the RNeasy Miniprep RNA isolation kit (Qiagen) according to the manufacturers protocol, with DNAse I treatment for elimination of residual DNA.
- Quantitative real-time RT PCR RNA is reverse transcribed to cDNA using the TaqMan RT PCR reagents (Applied Biosystems) and random hexamers for priming following standard protocols. Control reactions for genomic DNA contamination are performed without addition of reverse transcriptase.
- Quantitative RT-PCR is performed with SYBR Green detection on an ABI7700 instrument (Applied Biosystems). EF-1 ⁇ is used as endogenous control.
- the primers used for RT-PCR are specified in Table 2.
- the ⁇ Ct method is used for relative quantification of mRNA levels (as described eg. in (Applied Biosystems 2000) using in vitro transcribed IL-2 mRNA for calibration. All presented data are averages from at least 5 identical independent samples and representative of at least two independent experiments using cells from independent donors.
- RNA secondary structure prediction software Zuker M. Curr.Opin.Struct.Biol. 2000, 10(3):303-10.
- RNA library distributed with the Vienna RNA Package (Hofacker I.L. et al. Monatshefte Chemie 1994, 125:167-88), which is based on free energy parameters described in Mathews D.H. et al., J.Mol.Biol.1999, 288(5):911-40.
- P * can be approximated by counting the occurrence n* of accessible structures in a set of (suboptimal) RNA secondary structures of size n, with thermodynamic equilibrium distribution.
- sets of RNA secondary structures can be generated using stochastic backtracking (Tacker M. et al., Eur.Biophys.J. 1996, 25:115-30; Ding Y. et al.
- RNA secondary structure prediction which considers all possible structures of hybrids and is suitable to study the impact of hybridization on the accessibility directly.
- all secondary structures of the RNA-oligonucleotide duplex can be approximated by those secondary structures of the RNA where the target site of the oligonucleotide cannot form internal base pairs, i.e. the RNA nucleotides which participate in MO the hybridization are constrained to be single stranded.
- Example 1 Manipulating the association of HuR to the IL-2 mRNA and thereby the IL-2 mRNA stability
- Openers, closers and negative control ORNs are constructed for the IL-2 and TNF- ⁇ mRNAs and experimentally validated in vitro and in human primary cell lysates.
- the opener effect is initially validated in vitro. As measured in a 1 D-FIDA assay, HuR binds to the IL-2 3'UTR (281 nt) with significantly higher affinity in presence of any of the openers (Figure 4A). The affinity increase induced by the opener correlates with the opener concentration ( Figures 4B and C). Additionally, for Op1 the effect reverted at concentrations beyond a certain threshold (1.6 nM with 2.5 nM IL-2 3'UTR) and the HuR IL-2 3'UTR affinity is again reduced (Figure 4C).
- a certain threshold 1.6 nM with 2.5 nM IL-2 3'UTR
- this particular sequence hybridizes also to secondary sites within the IL-2 3'UTR and thereby induces an adverse conformational rearrangement.
- Negative controls are performed with two IL-2 3'UTR specific 20mers which do not affect the accessibility p(ssNNUUNNUUU). As demonstrated in Figure 4, both ORNs do not influence the HuR - IL-2 3'UTR association.
- ORNs also function in a more complex cellular environment. Cytoplasmic lysates of hPBMC are treated with the opener ORNs. This experimental approach allows to exclude transcriptional effects of the openers. Defined opener concentrations are achieved and cellular stress responses induced by opener transfection are excluded from the experiment.
- IL-2 mRNA-HuR complexes are co-immunoprecipitated in presence or absence of the opener and HuR-bound IL-2 mRNA is quantified by real-time RT-PCR. Unspecific immunoprecipitation is excluded using a control antibody (goat IgG, data not shown). Both openers increase the level of HuR-IL-2 mRNA association up to 6.5 fold in a concentration dependent manner ( Figure 5). No increase in HuR bound IL-2 mRNA is observed with the negative control ORN N 2 or with the TNF- ⁇ specific opener Op ⁇ at the same conditions. To validate the potential of the openers to modulate mRNA levels we test whether the induced increase in HuR complex formation would also antagonize the rapid ARE dependent mRNA degradation.
- Op 2 which targets another HuR binding site, shows a similar stabilizing effect (Figure 6, Opi and Op 2 at concentrations of 25 ⁇ M (B) and 40 ⁇ M concentration (C)).
- Example 2 Manipulating the association of HuR to the TNF- ⁇ mRNA and thereby the TNF- ⁇ mRNA stability.
- the decay is significantly slowed down.
- the mRNA decay of IL-1 ⁇ mRNA as another ARE containing HuR target is not influenced by Op ⁇ , which demonstrates that the opener induced TNF- ⁇ mRNA stabilization is indeed a specific effect.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Endocrinology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Pain & Pain Management (AREA)
- Cardiology (AREA)
- Rheumatology (AREA)
- Pulmonology (AREA)
- Heart & Thoracic Surgery (AREA)
- Virology (AREA)
- Crystallography & Structural Chemistry (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US54231504P | 2004-02-05 | 2004-02-05 | |
| US56046404P | 2004-04-08 | 2004-04-08 | |
| PCT/EP2005/001168 WO2005075637A2 (en) | 2004-02-05 | 2005-02-04 | Screening assays |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1713913A2 true EP1713913A2 (en) | 2006-10-25 |
Family
ID=34841137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP05701358A Withdrawn EP1713913A2 (en) | 2004-02-05 | 2005-02-04 | Screening assays |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP1713913A2 (https=) |
| JP (1) | JP2007521813A (https=) |
| KR (1) | KR20060135798A (https=) |
| CN (1) | CN1918294A (https=) |
| AU (2) | AU2005210006B2 (https=) |
| BR (1) | BRPI0507480A (https=) |
| CA (1) | CA2554218A1 (https=) |
| IL (1) | IL176991A0 (https=) |
| RU (1) | RU2006131550A (https=) |
| WO (1) | WO2005075637A2 (https=) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011062166A1 (ja) * | 2009-11-17 | 2011-05-26 | 武田薬品工業株式会社 | Rnaの二次構造の動態を予測する方法 |
| US20120296403A1 (en) | 2010-02-10 | 2012-11-22 | Novartis Ag | Methods and compounds for muscle growth |
| CN121725892A (zh) * | 2026-02-13 | 2026-03-24 | 北京悦康科创医药科技股份有限公司 | 信使rna稳定性的预测方法、模型、装置、设备及介质 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004099411A1 (en) * | 2003-05-07 | 2004-11-18 | Novartis Ag | A method for dissecting the rna secondary structure dependence of rna-ligand interactions |
-
2005
- 2005-02-04 EP EP05701358A patent/EP1713913A2/en not_active Withdrawn
- 2005-02-04 CA CA002554218A patent/CA2554218A1/en not_active Abandoned
- 2005-02-04 AU AU2005210006A patent/AU2005210006B2/en not_active Ceased
- 2005-02-04 BR BRPI0507480-0A patent/BRPI0507480A/pt not_active IP Right Cessation
- 2005-02-04 JP JP2006551815A patent/JP2007521813A/ja active Pending
- 2005-02-04 RU RU2006131550/13A patent/RU2006131550A/ru not_active Application Discontinuation
- 2005-02-04 WO PCT/EP2005/001168 patent/WO2005075637A2/en not_active Ceased
- 2005-02-04 KR KR1020067017940A patent/KR20060135798A/ko not_active Withdrawn
- 2005-02-04 CN CNA2005800042234A patent/CN1918294A/zh active Pending
-
2006
- 2006-07-20 IL IL176991A patent/IL176991A0/en unknown
-
2008
- 2008-12-23 AU AU2008261191A patent/AU2008261191A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2005075637A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20060135798A (ko) | 2006-12-29 |
| IL176991A0 (en) | 2006-12-10 |
| AU2005210006A1 (en) | 2005-08-18 |
| BRPI0507480A (pt) | 2007-07-17 |
| RU2006131550A (ru) | 2008-03-10 |
| WO2005075637A2 (en) | 2005-08-18 |
| WO2005075637A3 (en) | 2005-11-10 |
| AU2005210006B2 (en) | 2008-09-25 |
| CA2554218A1 (en) | 2005-08-18 |
| AU2008261191A1 (en) | 2009-01-22 |
| JP2007521813A (ja) | 2007-08-09 |
| CN1918294A (zh) | 2007-02-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Meisner et al. | mRNA openers and closers: modulating AU‐rich element‐controlled mRNA stability by a molecular switch in mRNA secondary structure | |
| Lyu et al. | RNA G-quadruplexes (rG4s): genomics and biological functions | |
| Gareiss et al. | Dynamic combinatorial selection of molecules capable of inhibiting the (CUG) repeat RNA− MBNL1 interaction in vitro: discovery of lead compounds targeting myotonic dystrophy (DM1) | |
| Kuwano et al. | NF90 selectively represses the translation of target mRNAs bearing an AU-rich signature motif | |
| Jones et al. | Challenges and perspectives for structural biology of lncRNAs—the example of the Xist lncRNA A-repeats | |
| US8710199B2 (en) | Signal activated molecular delivery | |
| Bevilacqua et al. | Thermodynamic analysis of an RNA combinatorial library contained in a short hairpin | |
| JP6281953B2 (ja) | 核酸分子の酸化還元活性を評価する方法および酸化還元活性を有する核酸分子 | |
| Ma et al. | ADAR1 promotes robust hypoxia signaling via distinct regulation of multiple HIF‐1α‐inhibiting factors | |
| Gude et al. | Mapping targetable sites on human telomerase RNA pseudoknot/template domain using 2′-OMe RNA-interacting polynucleotide (RIPtide) microarrays | |
| Dimitrova-Paternoga et al. | Validation and classification of RNA binding proteins identified by mRNA interactome capture | |
| Kierzek et al. | Facilitating RNA structure prediction with microarrays | |
| Luo et al. | Iso-FRET: an isothermal competition assay to analyze quadruplex formation in vitro | |
| Rukov et al. | Dissecting the target specificity of RNase H recruiting oligonucleotides using massively parallel reporter analysis of short RNA motifs | |
| Guo et al. | Mapping circular RNA structures in living cells by SHAPE-MaP | |
| Kunkler et al. | A single natural RNA modification can destabilize a U• AT-rich RNA• DNA-DNA triple helix | |
| AU2008261191A1 (en) | Screening assays | |
| Shang et al. | siRNAs target sites selection of ezrin and the influence of RNA interference on ezrin expression and biological characters of osteosarcoma cells | |
| Kierzek | Binding of short oligonucleotides to RNA: studies of the binding of common RNA structural motifs to isoenergetic microarrays | |
| Duan et al. | Interpreting Oligonucleotide Microarray Data To Determine RNA Secondary Structure: Application to the 3 ‘End of Bombyx mori R2 RNA | |
| Gunaratne et al. | Key RNA-binding domains in the La protein establish tRNA modification levels in Trypanosoma brucei | |
| Romero Agosto et al. | DMS‐MapSeq Analysis of Antisense Oligonucleotide Binding to lncRNA PANDA | |
| Ferreira et al. | Complete mesoscopic parameterization of single LNA modifications in DNA applied to oncogene probe design | |
| Litovchick et al. | Stereospecificity of short Rev-derived peptide interactions with RRE IIB RNA | |
| Dedeoğlu et al. | Experimental microRNA targeting validation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20060905 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1097569 Country of ref document: HK |
|
| 17Q | First examination report despatched |
Effective date: 20080718 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20100901 |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1097569 Country of ref document: HK |