EP1525472A2 - Method and device for screening molecules in cells - Google Patents

Method and device for screening molecules in cells

Info

Publication number
EP1525472A2
EP1525472A2 EP03750828A EP03750828A EP1525472A2 EP 1525472 A2 EP1525472 A2 EP 1525472A2 EP 03750828 A EP03750828 A EP 03750828A EP 03750828 A EP03750828 A EP 03750828A EP 1525472 A2 EP1525472 A2 EP 1525472A2
Authority
EP
European Patent Office
Prior art keywords
support
characterized
cell
drops
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03750828A
Other languages
German (de)
French (fr)
Inventor
François Chatelain
Yves Fouillet
Brigitte Fouque
Alexandra Fuchs
Béatrice SCHAACK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commissariat a lEnergie Atomique et aux Energies Alternatives
Original Assignee
Commissariat a lEnergie Atomique et aux Energies Alternatives
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to FR0209326 priority Critical
Priority to FR0209326A priority patent/FR2842747B1/en
Application filed by Commissariat a lEnergie Atomique et aux Energies Alternatives filed Critical Commissariat a lEnergie Atomique et aux Energies Alternatives
Priority to PCT/FR2003/002298 priority patent/WO2004011938A2/en
Publication of EP1525472A2 publication Critical patent/EP1525472A2/en
Application status is Withdrawn legal-status Critical

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J19/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J19/0046Sequential or parallel reactions, e.g. for the synthesis of polypeptides or polynucleotides; Apparatus and devices for combinatorial chemistry or for making molecular arrays
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5032Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on intercellular interactions
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00351Means for dispensing and evacuation of reagents
    • B01J2219/00364Pipettes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00351Means for dispensing and evacuation of reagents
    • B01J2219/00364Pipettes
    • B01J2219/00367Pipettes capillary
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00351Means for dispensing and evacuation of reagents
    • B01J2219/00378Piezo-electric or ink jet dispensers
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00646Making arrays on substantially continuous surfaces the compounds being bound to beads immobilised on the solid supports
    • B01J2219/0065Making arrays on substantially continuous surfaces the compounds being bound to beads immobilised on the solid supports by the use of liquid beads
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES, IN SILICO LIBRARIES
    • C40B60/00Apparatus specially adapted for use in combinatorial chemistry or with libraries
    • C40B60/14Apparatus specially adapted for use in combinatorial chemistry or with libraries for creating libraries
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/10Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices
    • G01N2035/1027General features of the devices
    • G01N2035/1034Transferring microquantities of liquid
    • G01N2035/1046Levitated, suspended drops

Abstract

The invention concerns a method for reacting a reagent R with a cell C, which consists in: setting the cell C on a support S comprising a substantially planar surface, in the form of an aqueous drop on said surface; covering the planar surface of the support S whereon the aqueous drop has been set containing the cell C with a separation film F, allowing through gases and preventing the aqueous drops set on the support S from evaporating, F being non-miscible with the reagent R; triggering the reaction between the reagent R and the cell C by introducing the reagent R in the aqueous drop containing the cell C. The invention also concerns a device for implementing said procedure and its applications.

Description

METHOD AND APPARATUS FOR SCREENING MOLECULES IN CELLS

The present invention relates to a method and a device for implementing reactions on one or more cells or tissue cells or cells or between cell arrays.

The entry of molecules into the cell is a key step in biotechnology. The. .Often more to study this step, must be screened in parallel, in the same conditions, the biological effects of a family of molecules. The increasing amount of DNA and other molecules available to be tested on cells makes necessary the use of automated processes with systematic and with high yields.

It is known from WO01 / 07159 a device for performing biochemical protocols in series in microreactors. However, this device does not work on cells. The document W095 / 34374 discloses an apparatus and a method for performing serial microreactions. However, this device and this process does not plan to implement reactions called transfection, in which a reagent enters a cell. In fact, the cell is a living organism, heterogeneous, whose survival and reacting require special conditions, particularly regarding gas exchange. These parameters are not taken into account or even contemplated herein.

At present, most molecules of screening methods do not allow the use of living cells, they are made of molecules isolated pairs. In the case of screening putting challenge of living cells, the screened molecules rarely penetrate into cells, they only recognize surface sensors, such as for example receptors.

For example, transfection of cells by DNA family is currently made in boxes having well distributed in the form of matrices. This process has the disadvantage of consuming large quantities of reagent, requiring heavy devices for the detection of molecular interactions. In addition, wells fluorescence analysis systems have the disadvantage of being a large, clean fluorescence well plates must be taken into account, the analysis must be done well by well, without vision overall the whole device

by J. Ziauddin known et al, Nature, 411, 107-110, 2001, an automated method of transfection. DNA is deposited as a dispersion in gelatin of a matrix on a glass slide . After drying, the slots comprising the DNA are treated with a lipid transfection agent and the plate is placed in a medium in which cells are distributed. On the glass slide, gelatinized DNA is present in solid form and transfection is carried out in semi-solid phase by binding the DNA molecules to lipids that promote penetration of the DNA into the cells adjacent to deposits DNA. This gives a matrix of transfected cells at the locations corresponding to the DNA deposits. However this method has the disadvantage of being imprecise and not reproducible. The attachment of gelatin does not enable to control the dropping of the transfected DNA. It does not help either to improve the efficiency of transfection. By this method the expression or blocking the expression of sufficient protein can hardly be obtained. In addition, one kind of cell may be used for each glass slide.

There is thus a need for a method of transfection, and more generally reacting compounds with biological cells, said method being automated, using minimal quantities of reagents and give reproducible results. In addition, it is desired to serialize several reactions in the same cell, able to work on complex cell systems (2 different cell types), on tissue or cellular networks, and to parallel several cellular systems. It is also desired that the genome of the cells used can be modified beforehand to prepare for the detection of molecular interactions, for example by the introduction of fluorescent protein genes.

The invention therefore relates to a process reacting a reagent R with at least one cell C, said method being characterized in that:

- the cell C is deposited on a support S comprising a substantially planar surface in the form of an aqueous drop on said surface; - the substantially flat surface of the support S on which has been deposited the aqueous drop containing the cell C is covered with a separating film F, allowing the passage of gas and preventing the evaporation of the aqueous drops deposited on the support S, F being immiscible with the reagent A. - the reaction between the reagent R and the cell C is triggered by the introduction of the reagent R in the aqueous drop containing the cell C. Several variants exist for the introduction of the reagent R in the cell C :

. In a first variant, an aqueous drop containing the cell C is deposited on the support S, a second aqueous drop containing the reagent R is injected, using any suitable injection means, directly into the drop containing the cell C . such variant is illustrated in Figure 1.

. In a second variant, a first aqueous drop is deposited on the support S and a second aqueous drop is deposited on the same support in proximity to the first, one of the drops containing the cell C, the other reagent R, reacting the reagent R with the cell C, and optionally its transfection into the cell C, is triggered by the merging of two drops. Displacement and fusion of the droplets can be obtained by vibration within the support by electrophoretic movement of the electrically charged drops or by mechanical or optical tweezers. They can also be obtained by modifying the surface properties of the support under the effect of an electric field, magnetic, optical or by a heat treatment. Such variant is illustrated in Figure 2.

. According to a third variant, the reagent R is attached to the support S or the film F, the cell C is deposited in the form of an aqueous drop on the support S and the reagent R is then dropped out of the film F or S medium to allow its reaction with the cell and possibly its transfection into the cell. This variant is illustrated in Figures 3 and 7.

In the present invention, the term transfection is used to refer to the penetration of a molecule of a reagent of any kind, in a cell.

The invention also relates to a device for reacting a reagent with R a cell C, the device being characterized in that it comprises: - a support S comprising a substantially flat surface covered with a film F separation allowing the passage of gas and preventing the evaporation of the aqueous drops deposited on the support S, F being immiscible with the reagent R,

- means for depositing on said surface and under the film F of aqueous drops containing the cell C,

- a controlled-atmosphere chamber in which is placed the support S so as to permit the survival of the cell C.

Preferably, the support S is constituted by a plate which can be silicon, glass or polymer, such as polyurethane, nylon, polyester, polyéthyiène, polypropylene, polyfluorocarbon, in polyméthylméfhacrylate (PMMA), in polycarbonate, polyvinyl chloride (PVC), polydimethylsiloxane (PDMS) or polysulfone.

According to the invention, the attachment of the drops on the support is done by capillarity, through the surface tension forces. Preferably, the support S has a substantially planar surface having at least one means for receiving aqueous drops.

Preferably, the means for receiving the aqueous drops consists of areas of the substantially planar surface S of a medium size of from 5 .mu.m 2 to 5 mm 2. In a first variant, it is expected that the present support S on its flat surface hydrophobic and comprises one or more hydrophilic regions constituting said receiving means. According to another variant, it is also possible that the support S comprises on its planar surface cavities of a depth ranging from 1 micron to 1 millimeter, and as said receiving means. It is also possible that the support S is a plate equipped with protuberances of small thickness, from 1 micron to 1 mm, arranged on its surface and intended to promote the attachment of the drops. Finally, one can provide that the support S is a plate provided with at least one thread, on which are hanging drops. The deposition of two drops to the same receiving means will promote fusion of the two drops and therefore the reaction of the reagent R with the cell C. Preferably, the support S has on its flat surface hydrophobic and comprises one or more hydrophilic areas constituting the receiving means. To confer to the planar surface of the carrier a hydrophobic character, it is preferably covered with a hydrophobic material such as a polyfluorocarbon, such as polytetrafluoroethylene or Teflon ®, a silane such as perfluorosilane. The hydrophobic region of the support may consist of a serrated surface structuring at the nanoscale as "Black silicon" as used in optics. Examples of commercial blades of this type is immunofluorescence slides 40 wells D2 mm super Teflon, marketed by Merck Eurolab division Polylabo. Even more preferably, the support further comprises a second receiving means drops superimposed on the first, such as a hydrophobic flat surface and low hydrophilic thickness growths, or a hydrophobic planar surface and hydrophilic wells, or a hydrophobic planar surface and a hydrophilic thread.

According to a variant of the invention, the support has a surface whose hydrophilicity / hydrophobicity properties can vary under the influence of a parameter such as temperature, electric field, magnetic field, radiation. The support can thus be active in changing drops on its surface using the principles of microfluidic in gout. This amounts to dynamically modify the surface of the support properties (e.g. variations in energy / surface tension) to move the droplets in a controlled manner. Thus, the cell culture drops may pass through various stages of reactions carried within the support: one can combine two drops which approach (one with the reagent and another with the cells for example).

To achieve this kind of support and Shenderov al. ( "Electrowetting- based actuation of liquid droplets for microfluidic applications", Applied Physics Letters, Vol. 77, No. ll, pp. 1725-1726, September 2000) describes the use of the change of surface energy of a layer hydrophobic, upon application of an electric field: the surface tension decreases with increasing field strength, the surface becomes less hydrophobic, hydrophilic see and control the movement of the electric field used to move the liquid drops on. . this surface this method has been patented by the company Nanolytics (Shenderov et al "Actuators for microfiuidics without moving parts," No. US 6,565,727;. 2003), but without the use of cell cultures another way to change these properties. surface consists of the physico-chemical modification of the surface layer of the support, always by means of an electric potential. for example, the conformational change of a layer of SAM ( "self-assemb LED monolayer "self-assembled monolayer, e.g., modified thiols, comprising at least one hydrophilic end and a hydrophobic chain), shown by n Laha et al. ( "A reversibly switching surface", Science, Vol. 299, pp. 371-374, January 2003), to switch from a straight conformation of molecules within the surface layer, which then has a hydrophilic character, a curved conformation wherein it has a hydrophobic character.

Similarly, the temperature may be used as a means to change the surface properties of a carrier. Liang et al. ( "Preparation of Composite-Crosslinked Poly (N-Isopropylacrylemide) Gel Rent and Characteristics of Reverse Hydrophilic-Hydrophobic Surface" Journal of Applied Polymer Science 72: 1, 1999) discloses a polymer which is hydrophilic at low temperatures (<30 ° C) and hydrophobic above. By incorporating a localized control system of the temperature under the substrate, one can control the surface properties.

One can also set up a support having the properties of the surface layer changes with the application or not of light (electromagnetic fields). Ichimura et al. ( "Light-driven motion of liquids was photoresponsive surface", Science, vol 288, p 1624-1626, June 2000..) Discloses such a surface: a polymer layer (calix [4] resorinarene) whose terminal group ( azobenzene) can change isomeric conformation after irradiation an asymmetrical picture. When exposed these cyclic groups in trans conformation (hydrophilic layer) UV (365nm), they pass in cis conformation (hydrophobic). The reaction is reversible using blue light (436 nm). Illuminating selectively and gradually the polymer layer, can be moved drops of liquid in a controlled manner.

According to a variant of the invention, the reagent R is attached to the support S before depositing the aqueous drop containing the cell C. Such devices are known to those skilled in the art for other uses: it is the chip DNA as described by:

- Eisen MB, Spellman PT, Brown PO, Botstein D.

Cluster analysis and display of génome- wide speech patterns, Proc Natl AcadSci USA. 1998 Dec. 8; 95 (25): 14863-8;

- Haab BB Dunha MJ, Brown PO,

Protein microarrays for highly parallel Detecting and quantitation of proteins and antibodies specifies in complex solutions, Genome Biol. 2001 Jan 22; 2 (2): RESEARCH 0004.1-0004.13; - Livache T., H. Bazin, Caillat P., A. Roget, Electroconducting Polymers for the Construction of DNA or peptide arrays on silicon chips, Biosens Bioelectron. 1998 September 15; 13 (6): 629-34. the same principle can be applied to molecules other than polynucleotides. molecules chips are described in: Kuruvilla et al Glucose signaling with small molecule microarrays, Nature (2002), 416 p. 653. In all cases, the reactant molecule is first attached on the chip (e.g., by covalent attachment to a glass slide). According to the present invention, the molecule may optionally be unhooked after depositing of the aqueous drops containing cells on the chip molecules. Dropping of the reagent molecule can be done in known manner by one of the following means:

- photocleavage by UV using a binding site of the reagent to the support which is photocleavable as shown in Figure 5.

And in the case where the reagent is a polynucleotide only: - DNA double-stranded cleavage by restriction enzymes, or by other nucleases,

- modification of the hybridization stringency: a change in salt concentration, temperature or ORP environmental conditions used to separate the two DNA strands. In some cases it is expected that the reagent R is left attached to the substrate. According to the invention, the substantially planar surface of the support S is covered with a release film which fulfills three functions:

- it prevents fusion of the aqueous drops unwanted,

- it prevents evaporation of the aqueous drops deposited on the support,

- it allows the passage of gas, in particular O and C0, the latter two functions being intended to allow the survival of cells in their drops.

The film F can be of various types: - it can be a liquid immiscible with water such as an oil. Until now, we knew to use oil to keep certain cells, however, it had never been used to perform reactions on cells. Among the oils useful in the method and device according to the invention that may be mentioned include mineral oils and silicone oils. May also be used as a liquid The water-immiscible organic solvent with the compounds to be treated (cells and reagents), such as, for example octane. Preferably a light mineral oil is used.

- it can also be a gas such as air saturated with moisture, - it can then be a flexible film, solid, such as a film

PDMS or polydimethylsiloxane or a film of nitrocellulose,

- it can finally be a rigid foamed cover of porous material, the cell size being adapted to be able to contain the drop of cell (s) and optionally reagent. According to a variant of the invention, the rigid foamed cover may be functionalized, in each cell, by a reagent molecule and thus constitute a smart molecule or a nucleotide chip called come into contact with the support on which the drops of cells were deposited symmetrically with respect to the alveoli. This variant of the invention is illustrated by Figure 7.

When the separating film is a gas or a liquid, advantageously, the deposition of the aqueous drops containing one or more cells or a reagent on the support S and under the film separation takes place by means of fine capillaries, as shown in FIG 1. preferably, the capillaries are connected to a pump or syringe pump to control the volume of the drops.

Reagents or cells can also be provided by a conventional system such as those used for the manufacture of DNA chips. These include for example the piezoelectric systems for compressing a cavity and eject a droplet from a nozzle. We can see this at N. Takada et al,

Proceeding of the SID, Vol. 27/1 1986, 31-35.

Preferably, the ejected drops pass through the film of liquid or gas through their ejection velocity and / or by gravity, the liquid or gas being lighter than the solution to be deposited. When the separating film is a solid film or a rigid cap, the latter is deposited on the support after depositing of the aqueous drops of cells and optionally reagents by the same means as described above.

Displacement and fusion of the droplets can be obtained by vibration within the support by electrophoretic or electromagnetic movement of electrically charged drops or by mechanical or optical tweezers. It can also be obtained by modifying the surface properties of the carrier caused by applying an electric field, magnetic or thermal or optical treatment. Preferably, the support S of the device is movable, so as to allow its movement from a first depositing means to a second deposition means, and optionally other deposition means. The support S may in some cases be constituted by a solid film attached to the rollers at both ends, the rollers being provided with means for winding so as to allow the movement of the film and therefore the displacement of the droplets that have been deposited thereon .

Generally, the process according to the invention provides for the moving of the support S after deposition on the support S of the first series of drops, whether drops cells or reagent drops.

According to the invention the support S is placed in an environmental chamber where the temperature, humidity and CO content are adjusted so as to allow cell survival. Such devices include controlled atmosphere ovens. The temperature in such a device can vary from 35 to 42 ° C, a preferred temperature is between 36.5 and 37.5 ° C. The variation in temperature can particularly be used to induce cell differentiation. C0 rate is preferably maintained between 3 and 5%. O the oxygen level is preferably that of the ambient air.

For example, one can provide for maintaining the cells in aqueous drops on the support S in an oven at 37 ° C with 95% air, 5% CO and 97% humidity. Can be provided that the entire reaction apparatus: support, film separation, storage means, sensing means, etc. are placed in the enclosure with controlled atmosphere.

It is also possible that only supports on which were deposited the drops of cells and the release film are placed in a controlled atmosphere chamber.

Advantageously, it is expected that the aqueous drops containing one or more cells, a tissue or a cellular network, comprises a culture medium.

Indeed, the establishment of cell cultures depends on the ability of cells to maintain their proliferation and therefore indispensable conditions for their growth.

Advantageously, it is expected that the aqueous drops of cells include MEM or "minimal essential medium" sold by the company GIBCO BRL under the Cat reference. No. 12000-022. The culture medium may also contain other constituents such as calf serum, one or more antibiotics to control the sterility of the medium, such as penicillin.

There may also be used in the culture medium of chemical agents that induce cell differentiation, such as bromodeoxyuridine. It is also possible that the aqueous drops wherein the cells C are cultured are gelled using any known gelling agent such as agar or gelatin.

Advantageously, the aqueous drops containing the cell or cells or tissue or the cell array, and / or the aqueous drops containing the reagent include one or more components intended to promote transfection such as liposome. Such transfection agents are described in particular in WO 01/20015 and WO 98/33932.

Other means intended to promote transfection can also be used in the device of the invention, such as electroporation or microprecipitation. These transfection methods, well known to those skilled in the art, are described including http://opbs.okstate.edu/~melcher/MG/MGW4/MG43.html.

According to the invention, it may furthermore provide that the device comprises:

- means for supplying energy to one or more drops deposited on the support;

- optical processing means of one or more drops deposited on the support; - means for applying a magnetic field or an electric field to one or more drops deposited on the support, in particular for electroporation;

- detection means focused on one or more drops deposited on the support. The means used in the devices according to the invention will preferably be connected to a control device allowing the automation of the device and method according to the invention.

Among the energy supply means include in particular thermal treatment means, which may consist for example in a heating device which can be placed in proximity of the support S or fixed to the support and intended to carry the droplets at a suitable temperature. For example, the heating means may consist of electrically conductive son also serving as droplet receiving means.

The detection means include devices for measuring the fluorescence or radioactivity of one or more drops or cells contained in one or more drops.

optical processing means include processing means ultraviolet ray, the latter being known to induce cross-linking between complementary strands of DNA and between DNA and proteins.

Use of the device and / or method according to the invention has many advantages: one can use very small quantities of material: a single cell per drop allows a transfection experiment. One can work with very small volumes of droplets, less than 1 microliter, preferably from 0.1 to 1000 nanoliters containing 1 to 500 cells, more preferably from 0.1 to 10 nanoliters containing 1 to 10 cells. Advantageously, working on drops of 1 to 100 cells. There may also be working on larger volumes, including higher microliter (10 to lOOμl containing 500 to 100,000 cells). This method also allows the use of small amounts of reagent. The separating film F used to control the gas exchange of the culture medium of the cell and its sterility. It also separates drops which we do not want them to react together. Finally, this method improves the efficiency of transfection: each cell involved in the process can be transfected. The cell cultures as drops under the separating film can be kept at least 24 hours and up to several days without being observed significant changes in their cellular activity (without significant influence on the proliferation and growth of cells).

The method and device according to the invention also possible to produce batteries of reactions:

Several aqueous drops each comprising at least one cell may be deposited on the support S, said droplets being isolated from each other. Preferably, each of these drops is placed in a separate receiving means. All cells can be identical, but it is also possible to place different cells (at least two different kinds of cells) in the different drops. Drops containing the reactants are deposited, close to each droplet containing a cell, so as to allow the fusion of a drop containing the appropriate reagent with the drop containing the target cell. For carrying out reactions of batteries, it is advantageously provided a carrier comprising a receiving means be regularly arranged in matrix form, so as to allow automation of the process.

Advantageously, the support and capillaries for depositing the aqueous drops of cells and reagents are connected to control means so as to allow automation of the process. The method and device according to the invention therefore make it possible to perform simultaneously and in an automated manner a large number of reactions of a reagent on a cell by varying the nature of the reagent and the cell, while working on the extremely small volumes .

Among the cells that can be interesting to study by this method, there may be mentioned:

- primary cells,

- hybridomas,

- cell lines: Cells can continue forever and thus form lines - stem cells: they are obtained from a sample from the animal or from biopsies,

- a piece of tissue (cells are not individualized)

- mixtures of different types of cells stated above. The cells are grown in culture medium (aqueous) in a known manner. It can also grow heterogeneous cell for several days and use this mixture.

According to a variant of the invention, when all cells to be reacted on the same support are identical one can proceed as follows: the support is a hydrophobic sheet having hydrophilic regions, immersed in an aqueous solution containing cells then it is removed from this solution by allowing excess liquid to drain. The drops of the medium containing the cells are retained in hydrophilic areas. This step is followed by the deposition of a film layer F separation and deposition of drops containing a reagent or other cells. Depending on the nature of the film F (fluid or solid), it is deposited before or after deposition of the reagent drops or other cells. Among the reagents R may be used in the method and device according to the invention include:

Chemical molecules of all types, including natural organic molecules, molecules from organic synthesis and combinatorial synthesis, molecules extracted from biological samples and molecules extracted from biological samples modified by synthesis. These include in particular the polynucleotides: RNA molecules, single-stranded and double-stranded, including siRNA molecules (for small RNA interference); DNA molecules, single-stranded and double-stranded; PNA molecules (from the English "peptidic nucleic acid" or peptide nucleic acid) which are peptide-nucleic acid chimeras; ribozymes; Double stranded RNA interference or proteins and peptides. Among the proteins can be made most particularly transcription factors.

reactive molecules can be formulated in solution ready to be filed. They may also be prepared directly after deposition on the support, for example by synthesis, including by organic synthesis, in situ, or by in vitro transcription in the drop. Prion-like molecules can also be obtained by drop by polymerase chain reaction or PCR (standing for "polymerization chain reaction") peptide prior to transfection into cells. When using the nucleic acid molecules, their preparation can be done by PCR nucleic. As has already been explained above, the reagent may also be fixed to the support.

When employing as the DNA reagent, preferably it is in precipitated form. As is known, one can for example use the calcium phosphate. Precipitation of the DNA also can be made in the aqueous droplet deposited on the support by melting with a drop of the appropriate reagent.

According to a variant of the device and method according to the invention can be provided to several successive depositions to be merged: can be provided to successively deposit several reagents for transfecting the same cell and observe their cumulative effects;

There may also be to deposit several drops of cells and make them merge, so as to reconstitute a cellular network of identical cells or different in order to approach closer to conditions found in vivo. For example, we can reconstruct neural networks at the scale of a few cells by the meeting of glial cells and neurons to the cornmuniquer within a same drop, or interactions between different cell types that make up the skin in order to mimic the behavior of the latter at the cellular level. Can also reconstruct a cell tissue to mimic the behavior of the epidemic in cultivating together in a single drop of keratinocytes on a collagen pad. We can also cultivate all the stem cells of the skin in the presence of the follicle pilleux cells to study their interactions. For example, transfection reagents can be used in a first type of cells to trigger a cellular response, such as production of recombinant protein and then reacting said first cell population with a cell population of a different type by fusion with another drop. According to a variant of the invention illustrated by Figure 8, it is also possible that the support is provided with separation means for separating two different types of cells but permitting the passage of small molecules between the cells. Such separation means is intended to mimic a biological barrier, such as for example the existing barrier between the blood and brain cells. Such separating means are advantageously arranged at the receiving means, on the support. For their implementation, an aqueous drop comprising at least one cell of a first type on one side of the separating means and an aqueous drop comprising at least one cell of a second type on the other side it is provided to deposit the separating means. Merging the drops on either side of the separating means allows communication between the cells through molecules capable of diffusing through the separation means. This communication may then be studied by any means, including the addition of reagents in the form of aqueous drop before or after fusion of the cell drops. For automated transfection of these drops, it is possible to analyze the biological role of the factors transfected into an organic multilayer. The separation means used according to this variant of the invention are artificial membranes such as for example a filter nitrocellulose, silicon nano-drilled holes, a blotting paper, a filter cloth; it is also possible to use a solid gel such as an agarose gel, collagen or gelatin.

The apparatus and method of the invention can automate the expression of recombinant proteins produced by DNA encoding entry into the cells, to perform screening of nucleic molecules designed to change (block or on the contrary increase) the gene expression in the cells and look for genomic promoter sequences. This invention also allows the study of interactions between cells of different types, this interaction being triggered by the mixture of the drops. The device and method according to the invention provide a global view of the biological effects of the reaction of molecules of all kinds with cells, including automated entry of molecules in all kinds of cells.

Advantageously, the overall detection of cellular phenotypes caused by the entry of molecules into cells will be carried out using labeled molecules, that is to say molecules which can be detected without affecting the integrity of medium that contains them. We think including fluorescent, radioactive markers or any other known means of marking the art. One advantage of the method and device according to the invention lies in the fact that all the steps of transfection and manipulation of cellular interactions is in the liquid phase which promotes cell culture nutrient medium and enzyme reactions.

In general, the method and device according to the invention have the following advantages: - improvement in transfection efficiency, compared to transfection done conventionally in culture wells;

- several cell types can be tested on the same support in a same sequence of reactions; - several types of molecules can be tested on the same support in a same sequence of reactions;

- reagents may be obtained directly in the droplet before melting;

- all reagents are prepared independently and in parallel with the preparation of cell cultures.

Among the applications of the device and method according to the invention, we may notably mention the search sequences antisense activity. Known from Dean ed al, Current Opinion in Biotechnology, 12, 622 (2001), the use of small sequences of DNA or RNA to block the synthesis of a protein in cells and in animals. This gene therapy has been used to test new anti-viral agents in humans. However, this biotechnological approach has failed repeatedly, using one or more oligonucleotides not to block the expression of protein. During these tests, in the absence of appropriate screening means, the sequences of the oligonucleotides used were chosen somewhat randomly, from genomic sequences accessible. Oligonucleotides employees did not have sufficient affinity for the target RNA and did not allow to block its translation in cells. The synthetic DNA molecules being toxic to the eukaryotic cell, it seeks to use minimal amounts. To block expression of a target gene in a cell, it is necessary to intervene at four levels:

- find the optimum binding position on RNA, a position which generally corresponds to a portion less folded in the quaternary structure of the RNA;

- find oligonucleotide sequences having a high affinity for RNA;

- find oligonucleotide sequences capable of entering a eukaryotic cell; - retain undegraded oligonucleotides in the cell for several days.

The first two steps can be performed using conventional oligonucleotide chip on which is tested hybridization of a family oligonucléαtides to RNA target made fluorescent (one can for example refer to the work of Olejnik et al., NAR, 26, 3572 (1998)). The method of the invention will test the penetration of oligonucleotides into the cell and their stability.

To highlight the optimum sequence to reduce the expression of a target protein in a cell, use modified oligonucleotides, such as e.g., phosphorothioate derivatives, such modification confers to the oligonucleotide affected resistance of several nucleases days.

The antisense molecules may also be constituted by RNA duplexes, called RNA interference (RNAi), which hybridize to mRNA by forming triple helices RNA (for this approach, one may refer to Elbashir et al., Nature, 411, 494-498 (2001)). The method and device according to the invention also enable screening of long RNAi sequences (plasmid) and short (synthetic).

Another application of the method and the device according to the invention concerns the automated production of recombinant proteins in drops. Automatic transfection is expected to test the expression of various DNA fragments coding as well as of different mutants of the same DNA. Automated expression of recombinant proteins on the devices of the invention can be an alternative to the protein chip. It is no longer necessary to produce proteins, purify and hang them on a solid support, proteins are produced de novo on the device.

Another application of the method and device of the invention is the preparation and screening of siRNA. The RNAsi ( 'small interference RNA "or for small RNA interference) are double-stranded RNA molecules capable of specifically and efficiently blocking the expression of genes in cultured cells and in animals. The RNAsi were elected 'molecules of 2002 "by Science magazine: these molecules could allow particularly innovative therapies in oncology and virology. They also have to characterize the previously unknown gene function (T.Tuschl, Nature Biotechnology, vol.20, May, 2002, p.446-448)

To manufacture these RNAsi four tracks were recorded. The first uses the chemistry, both strands of the siRNA are each made in a nucleic acid synthesizer and are associated after synthesis (synthetic molecule made from RNA phosphoramidite described in: SMElbaschir et al, Nature, 411, 24 May 2001, 494-498). The second in vitro using an RNA polymerase, each strand of the siRNA is constructed in a complementary manner with respect to a DNA strand and then the two strands are associated after synthesis (eg pSilencer commercial kit marketed by the company Ambion and commercial kit HiScrib sold by NEB Biolabs). The third uses the in vivo synthesis in eukaryotic cells or in bacteria, the two strands are manufactured using the RNA polymerase present in vivo. The fourth uses long RNA, single or double stranded, (produced in vitro or in vivo) to be converted to small molecules (RNAsi) by nucleases transfected cells (R. Agami, Current Opinion in Chemical Biology 2002, 6, 829-834).

In the present invention it is the second path that can be applied, which seeks to make RNAsi from DNA molecules contained in a tube. this path is used especially because it is cheaper than that of making the RNAsi chemically. It has also been reported that in vitro synthesized RNAsi structure is different from that of chemically RNAsi obtained, it allows to obtain a greater affinity in the case of hybridization of RNAsi obtained in vitro with the target RNA of cells transfected . Thus the blocking gene expression is better with RNAsi obtained in vitro with chemical RNAsi: better efficiency and require less high concentrations of siRNA.

This variant of the invention relies on one of RNAsi manufacturing process on a solid substrate. The present invention proposes to manufacture

RNAsi drop by using two DNA templates containing a promoter sequence for an RNA polymerase (such as SP6 or T7, for example) and using this formatting drop for transfection by drops of fusion molecules RNAsi double-stranded in cells cultured in drop on a solid substrate. The DNA templates can be attached covalently or non-covalently on the solid substrate.

To optimize the blocking of the expression of a gene, it is necessary to test several siRNA sequence along the gene (at least ten), and considerable interest has turned to the systematic screening of several genes ( eg more than 5600 genes blocked by the earthworms. SSLee et al

Nature Genetics, 33, January, 2003, 40-48).

Some grades of RNAsi sequences have been proposed on the percentage of GC nucleotides for example, or T of the corresponding oligonucleotide, or the size of the molecule (21 mer). But nothing can replace the experience, the screening is necessary not only to find the optimal sequence to block expression of a gene but also to determine its concentration and its action time in the cell culture.

To achieve these different phenotypic screening, it is possible to use plastic wells (96-holes or 384), but we have shown that transfection efficiency is better in cell cultures in drop (a concentration 5 times low RNAsi was used to obtain the same transfection efficiency and blocking of the expression of a gene into cell cultures in drop rather than in cell culture wells). Further phenotypic analysis of the expression of blocking a gene is highly relevant when cells were grown in the drop on a glass plate: cells after transfection are attached to the glass slide in small separate piles, gene expression levels are visualized by fluorescent immunocytochemistry and analyzed directly by scanner (direct detection of the number of photons emitted by the labeled cells by the antibody).

Potential applications

• characterization of gene function (especially in the case of genes 'inaccessible' for transgenic mice knockout, the knockout mice die before birth) • characterization of the function of several genes in different cell types: high throughput screening necessary. This is the case of the in vivo analysis of gene deletion.

• Cancer: Analysis of the role of genes in angiogenesis as well as in the spread of some cancers. In addition, block genes essential for cell repair, will help make certain chemo-sensitive cells. The chemo-sensitivity can be analyzed on chip.

• Virology. The spread of the HIV virus was blocked in vivo through the use of RNAsi (NSLee et al., Nature biotechnology, vol.19, May 2002, 500-505)

EXAMPLES

Materials and methods used in the examples: Detection

Detection of transfection by a fluorescent molecule is done in two stages:

- by an overview of fluorescent spots,

- analysis of individual dots to create a complex image.

The global view of fluorescence is done by parametric bi detection:

- the fluorescence of propidium iodide is control of the presence of a cell,

- fluorescence of the 'green fluorescent protein GFP = green fluorescent marker control the expression of the GFP protein. The resulting image is then analyzed by signal quantification and systems that combine the measurement points of series of fluorescence.

- analysis of the fluorescence drops: the cells can be analyzed in living drops under the oil layer. For these experiments, we used a microscope Olympus ® BX 5 IM and a confocal microscope Leica ®. - analysis of the fluorescence fixed cells: after fixation of the cells with paraformaldehyde or PFA (see Application No. l) the glass slide containing the recombinant cell is used as a histology slide. It is possible to make radioactive labeling and fluorescent labeling experiments (see Application No. 5.2). The total blade fluorescence can be analyzed using a conventional microscope. We also used a scanner conventionally used in microarray experiments (Scanner: GenePix 4000B, sold by Axon Instrument). Precision in this kind of device is 5 microns, so it is possible to visualize a cell with ten pixels.

4 illustrates an example of application of the device according to the invention: the expression of a recombinant protein in a suspension of glial cells and activation of a suspension of neurons.

On a glass plate (support S) into a vessel containing a light mineral oil (film F) sold by the Sigma Company, was injected:

- a drop of cell suspension in an aqueous medium containing (a few nanoliters) one hundred glial cells;

- an aqueous drop containing DNA as calcium phosphate salt (a few picomoles); - a drop of neuronal cells in suspension in water.

is first fused the first two drops by mechanical displacement of 2 drops using the tip of a pipette to obtain the Gi drop of transfected cells. The glial cell expresses a recombinant protein. We do this so Gi drop merge with gout G? containing neurons in suspension. These are activated.

I. Transfection oligonudéotides, screening sequence capable of blocking the expression of specific genes

In this example, we tried to select sequences of oligonudéotides able to block the expression of a gene of interest, called a target in this example. To measure antisense activity of these oligonucleotides was used of stable cell lines expressing the target protein as a fusion with the variant E-GFP (Green Fluorescent Protein Type E, available from Clontech Company). These lines are valuable tools for assessing the performance of different oligonucleotides: antisense activity is measured by decrease in fluorescence of reportrices proteins. To find an oligonucleotide that has exceptional antisense activity, it is essential to carry out the screening of 50 oligonucleotides of different sequences for the same gene. During the screening the cells ,. we sought in particular oligonucleotide has the greatest affinity for the target RNA and the largest penetrance power in the cell. Experiments carried out with the device according to the invention:

Transfection with calcium phosphate was chosen because it is very effective: using oligonucleotides labeled with cy5 (Cyanine 5), these oligonucleotides being marketed by Eurogentec company, 70% of HEK 293 cells (Human Embryonic Kidney) and 80% of COS cells (Chinese Ovary Sarcoma) become fluorescent after a day of culture (fluorescence measured by flow cytometry). Other transfection methods involving the formation of lipid droplets around the DNA can also be used. Experience the: melting drops by transfection For a target gene, we choose 50 oligonucleotides of different sequences. We were interested in blocking the expression of the beta sub unit 2 casein kinase. The oligonucleotides are synthesized as residues 18 and 21 nucleotides in length, and contain phosphorothioate capable of limiting their degradation by nucleases bonds. Each of these oligonucleotides is precipitated as calcium phosphate (typical reaction: lμl of oligonucleotide resuspended in water at 1 mM was mixed with 100 .mu.l of 0.25 M calcium chloride and 100 .mu.l of HBS buffer (Chen and Okayama , Biotechniques, 1988, 6, 632-638). to perform the transfection in a plastic dish containing 1 ml of mineral oil, a drop of 1 .mu.l of each of the precipitates 50 is fused with a drop of 10 .mu.l of cells in their culture medium (DMEM marketed by Gibco Company) (about 5000 fibroblast 3T3 cells). the drops are placed at the bottom of the box on the plastic media in the oil.

The antisense activity was measured after 2 days of culture decrease in fluorescence of the GFP expressed in tandem with the target protein which it is desired to block expression. The fluorescence of 50 drops is observed simultaneously under a microscope. This experiment is carried out several times in parallel to ensure the relevance of the results. It is important to make these 50 parallel tests to compare the activity of each antisense oligonucleotides. To observe the decrease in fluorescence of the target protein, it is possible either to observe live transfected cells under the microscope, or to fix the cells with paraformaldehyde (typically 4% PFA). For cell attachment, paraformaldehyde is added in equal volume to the cell drop for 10 minutes then the whole drops + oil is rinsed with PBS twice.

Experiment lb: photocleavage oligonucleotides cell chip and transfection

This experiment is shown in Figure 3.

We used a conventional DNA chip, transfection is achieved after dropping oligonucleotides from the solid support. The cells are grown nearby deposits oligonudéotides on the glass slide. The oligonucleotides (marketed by Eurogentec) are hung by their 5 'end amine on a silanized slide (eg Surmodics blade marketed by Motorola). The DNA of the deposits is complexed to calcium phosphate salts (according to the same principle of precipitating the DNA as described in the application) and kept moist on the blade. 3T3-adherent cells are then deposited drop at the surface of spots of oligonudéotides, the whole is kept under 1 ml of mineral oil for one day in cell incubator: the drops may be formed on the surface of DNA deposits or formed using a composite surface (hydrophilic and hydrophobic, Prolabo blade described in the application # 5). Dropping oligonucleotides complexed phosphate calcium and located below the cell cultures in drop is obtained as shown in Figure 5 by illumination of the plate with UV at 365 nm, which can cut the photocleavable linker inserted 5 'oligonucleotides (3 'amine site). example of hooked oligonucleotide, then clinched by photocleavage and finally transfected into HEK 293 cells adjacent:

Name Sequence Modification Composition huGAPDH203FJPC_cy5 SEQ ID NORL 20mers + PC + PC website site 5 '- AACGACCACTTTGTCAAGCT Cy5 amine + 5' Cy5 3 '(dT)

II- Transfection encoding DNA and expression of recombinant proteins

In this example, we looked at the expression of a family of proteins in eukaryotic cells. Yet, molecular biology, recombinant protein expression is obtained well by well, by transfection of a DNA encoding a cell layer. By parallelized transfection, we will obtain simultaneously the expression of several DNA coding for several proteins. This device allows to test several constructs into vectors for expression of one or more genes.

Experiments carried out with the device according to the invention:

2a Application: Expression of recombinant proteins in a cell type.

Expression of a DNA family encoding human kinesin using the device according to the invention:

Kinesins are a family of proteins with similar biochemical properties, are driving microtubule-associated proteins. These proteins are found in all eukaryotic cells. They can transform the hydrolysis of ATP into mechanical energy and play a fundamental role in the transport of organelles, mRNA and protein complexes along microtubules. They can move on the positive side of microtubules (N-kinesins) or negative side (C-kinesins). They also participate in chromosome movement during mitosis and meiosis and play an important role in cell division. It may in particular refer to the following publications:

Refl Compton, DA (1999). New tool for the mitotic toolbox. Science 286, 913-914. Miki K, Setoy, M., Kaneshira, K. Hirokawa, N. (2001). Proc. Natl. Acad. Sci. 98, 7004-7011.

Réf.2: Wade, RH, Kozielski, F. (2000). Structural links to kinesin directionality and movement. Nature Structural Biology 7, 456-460.

Ref.3: Kozielski, F., Svergun, DI, Zaccai, G. Wade, RH Koch, M. (2001). The overall conformation of conventional kinesins Studied by Small- angle x-ray and neutron-cattering. J. Biol. Chem. 276, 1267-1275.

With the device according to the invention, we obtained the expression of a twenty DNA encoding these kinesins using expression plasmids for expressing tandem protein of interest and GFP (pcDNA3.1 / CT-GFP-TOPO, marketed by Invitrogen). Transfection was carried out as when the application is the fusion of the drops is obtained in 1 ml of oil, 10 ng of plasmid precipitated calcium phosphate is contacted with a drop of 10 .mu.l containing approximately 5000 cells HEK 293 (human embryonic kidney). After 1 day of transfection, the drops of HEK 293 cells were fluorescent by expression of GFP protein in the cells. It was possible to observe these cell drops in oil and the confocal microscope to precisely locate cellular compartmentalization for each of the fluorescent kinesins expressed in this device. Application 2b: Expression of recombinant proteins in a device according to the invention using several cell types. Recombinant factor Pax6 expression by glial cells:

10 ng of plasmid containing the tandem genes encoding the Pax6 factor and GFP (pcDNA3.1 / CT-GFP-TOPO, marketed by Invitrogen) precipitated calcium phosphate (see DNA phosphate precipitation calcium in the) application is brought into contact with a drop of 10 .mu.l containing about 5000 glial cells (cortex radial glial cells, post-natal, 2 divisions). After 1 day of culture, the Gl drop of glial cells is fused to another drop of 10 .mu.l containing G2 5000 cortical cells (isolated cortical primary culture of post-natal brain cortex). The recombinant glial cell Gl expressing Pax6 factor are, for example capable of inducing neurogenesis astrocytocales of cells in G2.

This application is important for the screening of new drugs neurotrophic potential, for example in the search for compounds capable of regenerating dopaminergic neurons in brain damaged by Parkinson's disease.

One can for example see the following publication: ref. 4: Heins et al, Glial cells generate blackberries: the role of the transcription factor Paxό, Nature Neuroscience (2002) 5, 308-315

III Transfection with viruses or prions Contained

The system according to the invention can be easily confined: drop formation can be carried out mechanically without user intervention, and these can be stored in the absence of contaminants by maintaining under a layer of oil for several days. The virus transfection can be achieved in two ways:

- fusion of a drop of eukaryotic cells and a drop of virus infection of cells per cell samples 'at risk'

In the drops it is possible to produce the virus or pathogen (amplification and encapsulation) or to detect the (biological concentration and antigen-antibody reaction).

IV Demonstration of a promoter genomic sequence The promoter sequences, a portion of the genome little known:

The reporter gene technology and more specifically structures "region promoter-reporter activity" has been widely used for the characterization of upstream regulatory regions of genes. Microtechnologies today can dramatically increase the number of developers surveyed. Transcriptional regulation of these regions can be observed in real time through the use of a reporter gene encoding GFP (Green Fluorescent Protein). The fluorescence of this protein can be observed without having to lyse the cells. The fluorescence changes will allow us to study the kinetics of the transcriptional regulation of a large number of promoters in parallel and in real time.

Experiments carried out with the device according to the invention:

The reporter activity of known genes and induced by ionizing radiation (for example, p53, c-myc) was used to validate the chip and the experimental model. Upstream sequences of interest P53 and c-myc gene were amplified and then cloned upstream of the GFP gene in the phrGFP vector (Genentech). Transfection was carried out as when the application is the fusion of the drops is obtained in oil, 10 ng plasmid (phrGFP containing promoter DNA sequences) precipitated with calcium phosphate is contacted with a drop of 10 .mu.l containing approximately 5000 cells of human keratinocytes. By its location in the skin, the keratinocyte is the most exposed cell types in vivo radiation. After 1 day of transfection, the drops of keratinocytes are fluorescent by expression of GFP protein in the cells. Measuring the reporter GFP activity is made by global reading fluorescence microscopy coupled to a CCD camera (Charge Coupled Device).

V Screening of new drugs in drops: General Note: in the pharmaceutical industry, the screening was carried out during the last ten years on recombinant protein targets. In several examples (such as glutamate receptors) it was found that the recombinant receptor present in the isolated plasma membrane was not quite in its biological conformation, receptors in particular need to be coexpressed with chaperone proteins that are present in the synapses. One can for example see the following publication:

Ref 5: Ohnuma et al. G does Expression of PSD95 in prefrontal cortex and hippocampus in schizophrenia.Neuroreport. (2000) II (14): 3133-7.

To obtain a result more accurate and closer to the in vivo behavior, screening a set of chemical compounds is now planned on living cells. In this case the screening is done using a dynamic test in which the cells are kept alive. Reference Example: ref.6: Fluorescent indicators for imaging protein phosphorylation in single living cells, Sato et al, Nature Biotech (2002) 20, 287-294).

Study Design: achievement drops of cells This experiment is shown in Figure 6. The living cells are deposited into homogeneous drops on a solid support. The realization of this cellular device can be facilitated by the use of a composite surface (hydrophilic and hydrophobic), glass slide marketed by Prolabo, covered with a film of Teflon ® and containing hydrophilic circular wells of 3 mm of diameter. Many homogeneous droplets can be achieved by simply dipping the carrier in a cell suspension. The drops are then covered with a layer of mineral oil to prevent dehydration and promote cell survival until screening assay. Cell drops may be stored on this media for several days in an incubator for cell culture. For screening different molecules n, n-drop test compounds are deposited individually on cell drops preformed. It is also possible that chemical compounds are grafted on the support surface (as the oligonucleotides in the implementation 1b) and unhooked together (e.g. by UV light). The insertion of a photocleavable site in the molecules can be obtained by combinatorial chemistry.

A simple screening test dynamic (eg FRET = fluorescence resonnance by electron transfer or resonance fluorescence by electron transfer) can be used to highlight certain properties of these compounds.

5.1.Exemple screening: measuring the activity of the adrenergic receptor: We can refer to the following publication: ref. 7: Ghanouni et al Agonist induces conformational exchange in the G protein coupling domain of the beta2 adrenergic receptor, PNAS (2001) 98, 11, 5997-6002.

It is possible to attach fluorescein at one of the cysteines (cys265) of the beta2 adrenergic receptor to make the fluorescent protein when inserted into the cell membrane. To test adrenergic properties of a new drug candidate, we contacted under an oil drop 100 or containing the molecule in solution and a drop of 1 .mu.l containing 500 recombinant cells in their culture medium expressing the recombinant adrenergic receptor and mutated . The receptor conformation change induction agonist is observed under a microscope by a decrease in fluorescence intensity of fluorescein contained in the adrenergic receptor.

5.2. Example screening: immunocytochemistry of recombinant cells:

After transfection, the recombinant cells can be attached to the support using PFA (see Application No. l). For recombinant expression of the beta sub unit 2 casein kinase with the device of the invention, we used an antibody to reveal the expression of the recombinant protein in 3T3 cells. (Antibody marketed by Upstate Biotechnology: Rabbit polyclonal anti-beta antibody CK2). We can refer to the publication ref.8: Alexander E. Escargueilet al Mitotic Phosphorylation of DNA Topoisomerase II by Protein Kinase CK2 Creates the MPM-2 Phosphoepitope we Ser 1469, J. Biol. Chem. (2000) 275, Issue 44, 34710-347183.

VI variant of the smart molecules:

Figure 7 illustrates this embodiment: drops of cells in a culture medium are deposited in the form of matrix on a Teflon support. A cover PDMS onto which are grafted organic molecules of a library screening and having cells of a volume substantially equal to that of the drops is placed on the support. The spacing of the drops was provided for an exact match between the support and the cover. The molecules are detached cover by any appropriate treatment to transfect cells.

Moving VII drops in an electric field:

displacing drops it on a support having the surface tension varies with the application of an electric field has been tested: on the test carrier, is hydrophobic in nature with the exception of hydrophilic pads, the surface tension decreases with field strength, the surface becomes less hydrophobic, hydrophilic see. Control and movement of the electric field used to move the liquid drops on the surface. The procedure was the movement of drops of cells in an electric field of 1000 V (a drop of 5 .mu.l containing a cell Hela cell suspension to 10 6 cells / ml, a drop of 5 .mu.l: trypan blue in PBS (1/5))

Trypan blue is a cell viability marker. This mixture of blue and trypan reaction cells has verified that the electric field does not kill the cells because the% of stained cells did not exceed 2%.

VIII- automated Transfection

Achieving transfections on chip cells gout, manually performed on commercial blades, can be transferred to a micro controller batteries manufacturing and thus allow a particular mode of automated DNA transfection. For this, three sets of successive deposits of three drops are formed on the same chip, so on the same plot commercial strips, drops will merge to allow mixing of reagents and cells.

Experimentation :

1. Sample Preparation: Prepare a 96-well plate containing different samples to drop: the ADNS solutions, the transfection medium, the cell media.

2. Deposit DNAs (single-stranded oligonucleotides, PCR product or plasmid) to be transfected into cells: The robot takes in the 96-well plate 2 .mu.l of a solution containing one of the DNAs and then deposits a drop of 10 nL on one of the studs of the blade. And so on for the different DNAs. We thus filed lOnL of oligonucleotide concentration in the lOnM (oligo: 5'SEQ ID NO: 2 CGGAGGCGATGGTGTTGGA 3 '- labeled 20mer 5' Cy3) and lOnL a plasmid solution encoding GFP (pEGFP -Cl, Clonetech) at a concentration of lmg / ml. 9 is a photograph showing the plate on which were filed the first three drops.

3. Deposition of the transfection solution onto the pads DNA transfection:

For this, a drop of 0.2μl 'SIPORT (Ambion), diluted 1/20 in PBS (supplier's protocol) is deposited on each of the pads and mixed with the previously deposited DNA solutions.

4. Deposit cells:

We deposited a drop of lμl containing 10 HeLa cells (initial concentration delo 6 cells / ml) on each of the pads already containing the DNAs and SIPORT.

After deposition of the cells, the slides are placed in a Petri dish containing PBS (to prevent evaporation of the cell medium). They are then transferred in a cell incubator (37 ° C, 5% C02) for 48 hours to allow expression of the EGFP protein. After this stage of culture, cells were fixed in a paraformaldehyde solution (4% in PBS) for 20 minutes and rinsed twice with PBS. The slides were then mounted in PBS and the fluorescence is observed under a microscope.

The observation of cells under a microscope Olympus BX52 shows diffuse fluorescence in the cytoplasm for transfection with the Cy3 oligo. Fluorescence is first more intense in the nucleus and then diffuses into the cytoplasm to the cells transfected with GFP. The negative controls (without cells or without DNA) show no fluorescence.

Claims

1) A method of a reagent R reaction with at least one cell C, said method being characterized in that:
- the cell C is deposited on a support S comprising a substantially planar surface in the form of an aqueous drop on said surface,
- the substantially flat surface of the support S on which has been deposited the aqueous drop containing the cell C is covered with a separating film F, allowing the passage of gas and preventing the evaporation of the aqueous drops deposited on the support S, F being immiscible with the reagent A. - the reaction between the reagent R and the cell C is triggered by the introduction of the reagent R in the aqueous drop containing the cell C.
2) Method according to claim 1, characterized in that the attachment of the drops on the medium S is carried by capillarity.
3) The method of claim 1 or claim 2, characterized in that the support S is constituted by a plate of a material selected from silicon, glass or a polymer.
4.) Process according to any one of claims 1 to 3, characterized in that the support S has on its planar surface at least one means for receiving aqueous drops. 5) A method according to any one of claims 1 to 4, characterized in that an aqueous drop containing the cell C is deposited on the support S, a second aqueous drop containing the reagent R is injected, using or any suitable injection means, directly into the drop containing the cell C.
6.) Process according to any one of claims 1 to 4, characterized in that a first aqueous drop is deposited on the support S and a second aqueous drop is deposited on the same support in proximity to the first one these drops containing the cell C, the other R reagent, reacting the reagent R with the cell C is triggered by the merging of two drops.
7 °) 'A method according to any one of claims 1 to 4, characterized in that the reagent R is attached to the support S or the film F, the cell C is deposited in the form of an aqueous drop on the support S and the reagent R is then lifted off the support S or the film F to allow its reaction with the cell. 8.) Process according to any one of claims 1 to 7, characterized in that the separating film F is a liquid chosen from oils and organic solvents.
Item 9) The method of claim 8, characterized in that the separating film F is selected from mineral oils and silicone oils.
10 °) A method according to any one of claims 1 to 7, characterized in that the separating film F is moisture-saturated air.
11 °) A method according to one of claims 1 to 7, characterized in that the separating film F is a flexible film, solid. 12 °) A method as claimed in claim 11, characterized in that the separating film F is polydimethylsiloxane or nitrocellulose.
Item 13) A method according to any one of claims 1 to 7, characterized in that the separating film F is a honeycomb rigid cover of porous material. 14 °) A method as claimed in any one of claims 1 to 13 characterized in that the depositing of the aqueous drops containing one or more cells or a reagent on the support S is effected by means of fine capillaries.
15 °) A method as claimed in any one of claims 1 to 13 characterized in that the depositing of the aqueous drops containing one or more cells or a reagent S is the carrier by means of a nozzle.
16 °) A method as claimed in any one of claims 1 to 15, characterized in that it comprises a support S of the moving step after deposition on the support S of the first set of drops.
17 °) A method as claimed in any one of claims 1 to 16, characterized in that the cell cultures in the form of aqueous droplets are kept for at least 24 hours.
18 °) A method as claimed in any one of claims 1 to 17, characterized in that a plurality of aqueous droplets comprising each at least one cell are deposited on the support S under the separating film F, said drops being insulated from each other .
19 °) A method according to any one of claims 1 to 18, characterized in that a drop contains from 1 to 100 cells 20 °) A method according to any one of claims 18 and 19, characterized in that one Place different cells in different drops.
21 °) A method according to any one of claims 18 and 19, characterized in that the placing of identical cells in the different drops. 22 °) A method as claimed in claim 21, characterized in that the support is a hydrophobic sheet having hydrophilic areas and the step of injecting the aqueous drops containing the cells is replaced by immersing the plate in an aqueous solution containing cells.
23 °) A method as claimed in any one of claims 1 to 22, characterized in that the reagent molecules are prepared directly after deposition on the support, by a method selected from in situ synthesis, in vitro transcription in the droplet, the peptide chain polymerization reaction and nucleic.
24 °) A method according to any one of claims 1 to 23, characterized in that the reagent is a DNA molecule. 25 °) A method as claimed in claim 24, characterized in that the DNA is precipitated form, particularly in the form of calcium phosphate.
26 °) A method according to any one of claims 1 to 23, characterized in that the reagent is transcription factor.
27 °) A method as claimed in any one of claims 1 to 26, characterized in that are successively deposited several reagents for reacting with the same cell.
28 °) A method as claimed in any one of claims 1 to 27, characterized in that the depositing several aqueous drops containing cells and fused these drops. 29 °) A method as claimed in claim 28, characterized in that the depositing of glial cells and neurons to communicate within the same droplet.
30 °) A method according to any one of claims 1 to 29, characterized in that reacting the reactants in a first type so as to trigger a cellular response cells, such as the production of a recombinant protein and reacting the first cell with a cell of another type by fusion with another drop. 31 °) A method according to any one of claims 1 to 30 wherein the support comprises means of separation, characterized in that one deposits an aqueous drop comprising at least one cell of a first type on one side of separating means and an aqueous drop comprising at least one cell of a second type on the other side of the separating means and then it is carried out the fusion of the cell drops.
32 °) A method as claimed in any one of claims 1 to 31, characterized in that the reagent is selected from labeled molecules, including fluorescent and radioactive labels. 33 °) A method as claimed in any one of claims 1 to 32, characterized in that the cell is selected from: primary cells, hybridoma cell lines, stem cells, a piece of tissue, and mixtures thereof .
34 °) A device for reacting a reagent with R a cell C, the device being characterized in that it comprises:
- a support S comprising a substantially flat surface covered with a separating film F to the gas passage and preventing evaporation of the aqueous drops deposited on the support, F being immiscible with the reagent R,
- means for depositing on said surface and under the film F of aqueous drops containing the cell C,
- a controlled-atmosphere chamber in which is placed the support S so as to permit the survival of the cell C.
35 °) Device according to claim 34, characterized in that the support S is constituted by a plate of a material selected from silicon, glass or a polymer.
36 °) Device according to any one of claims 34 and 35, characterized in that the support S has on its planar surface at least one means for receiving aqueous drops.
37) Device according to claim 36, characterized in that the means for receiving the aqueous drops consists of areas of the planar surface of the support S with a size of from 5 .mu.m to 5 mm. 38 °) Device according to claim 36 or claim 37, characterized in that the support S has at least one of the features a) to d) below: a) the support S has on its flat surface hydrophobicity and includes one or more hydrophilic areas constituting the receiving means; b) the support S comprises on its planar surface cavities of a depth ranging from 1 micron to 1 millimeter constituting the receiving means; c) the support S is a plate having thickness of protrusions ranging from 1 micron to 1 millimeter, disposed on its surface and intended to promote the attachment of the drops; d) the support S is a plate provided with at least one wire, on which are hanging drops.
39 °) Device according to claim 38 wherein the support S has on its flat surface hydrophobic and comprises one or more hydrophilic regions, characterized in that it further comprises a second receiving means drops superimposed on the first.
40 °) Device according to any one of claims 34 to 39, characterized in that the means for depositing the aqueous drops on the support S consist of fine capillaries. 41 °) Device according to any one of claims 34 to 40, characterized in that the means for depositing the aqueous drops on the support S consisting of a piezoelectric system mimi a nozzle.
42 °) Device according to any one of claims 34 to 41, characterized in that the support S of the device is mobile. 43 °) Device according to any one of claims 34 to 42, characterized in that the support S is constituted by a solid film attached to the rollers at both ends, the rollers being provided so as to allow winding means the movement of the film and thus moving the drops that were deposited above. 44 °) Device according to any one of claims 34 to 43, characterized in that it further comprises at least one means selected from: - means for supplying energy to one or more drops deposited on the support;
- optical processing means of one or more drops deposited on the support; - means for applying a magnetic field or an electric field to one or more drops deposited on the support;
- detection means focused on one or more drops deposited on the support;
- means to promote transfection. 45 °) Device according to any one of claims 34 to 44, characterized in that the means used in the device are connected to a control device permitting its automation.
46 °) Device according to any one of claims 34 to 45, characterized in that the support comprises receiving means arranged in a regular manner in the form of matrices.
47 °) Device according to any one of claims 33 to 45, characterized in that the support is provided with separation means for separating two different types of cells but permitting the passage of small molecules between the cells. 48 °) Device according to claim 47, characterized in that the separating means are arranged at the receiving means, on the support. 49 °) Device according to any one of claims 34 to 48, characterized in that the aqueous drops containing one or more cells comprise a culture medium. 50 °) Device according to any one of claims 34 to 49, characterized in that the support has a surface whose hydrophilicity / hydrophobicity may vary under the influence of a parameter such as temperature, an electric field, a magnetic field, irradiation.
51 °) Using a device according to any one of claims 34 to 50 perform simultaneously and in an automated manner a large number of reactions of a reagent on a cell by varying the nature of the reagent and the cell. 52 °) The use according to Claim 51, for carrying out the screening of a set of chemical compounds on living cells.
53 °) Using a device according to any one of claims 34-50 for studying cellular systems selected from: neural networks, the epidemic.
54 °) Using a device according to any one of claims 34-50 for studying the effect on a cell of a reactant selected from the nucleic acid molecules, proteins, peptides, molecules peptide nucleic acid. 55 °) Using a device according to any one of Claims 34-50 for expression of recombinant proteins.
56 °) Using a device according to any one of claims 34 to 50 carry out the screening of nucleic molecules designed to modify the expression of genes in cells. 57 °) Using a device according to any one of claims 34 to 50 search genomic promoter sequences.
58 °) Using a device according to any one of claims 34 to 50 for studying the interactions between cells of different types. 59 °) Using a device according to any one of claims 34 to 50 Preparation and screening of siRNA.
EP03750828A 2002-07-23 2003-07-21 Method and device for screening molecules in cells Withdrawn EP1525472A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
FR0209326 2002-07-23
FR0209326A FR2842747B1 (en) 2002-07-23 2002-07-23 Method and device for screening molecules in cells
PCT/FR2003/002298 WO2004011938A2 (en) 2002-07-23 2003-07-21 Method and device for screening molecules in cells

Publications (1)

Publication Number Publication Date
EP1525472A2 true EP1525472A2 (en) 2005-04-27

Family

ID=30011408

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03750828A Withdrawn EP1525472A2 (en) 2002-07-23 2003-07-21 Method and device for screening molecules in cells

Country Status (6)

Country Link
EP (1) EP1525472A2 (en)
JP (1) JP2005533509A (en)
AU (1) AU2003269041A1 (en)
CA (1) CA2492933A1 (en)
FR (1) FR2842747B1 (en)
WO (1) WO2004011938A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2543618A (en) * 2015-10-16 2017-04-26 Univ Oxford Innovation Ltd Microfluidic arrangements

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2857451B1 (en) * 2003-07-11 2005-09-30 Commissariat Energie Atomique Method and device for analysis of live reaction environments
US20090215192A1 (en) * 2004-05-27 2009-08-27 Stratos Biosystems, Llc Solid-phase affinity-based method for preparing and manipulating an analyte-containing solution
CA2594483C (en) 2005-01-28 2014-08-26 Duke University Apparatuses and methods for manipulating droplets on a printed circuit board
US7951584B2 (en) 2005-03-30 2011-05-31 National University Corporation Nagoya University Method for production of biological organic material and culture vessel
JPWO2007063898A1 (en) * 2005-11-29 2009-05-07 国立大学法人 東京大学 Protein crystallization method and apparatus, and protein crystallization treatment apparatus
US8809068B2 (en) 2006-04-18 2014-08-19 Advanced Liquid Logic, Inc. Manipulation of beads in droplets and methods for manipulating droplets
US9476856B2 (en) 2006-04-13 2016-10-25 Advanced Liquid Logic, Inc. Droplet-based affinity assays
US10078078B2 (en) 2006-04-18 2018-09-18 Advanced Liquid Logic, Inc. Bead incubation and washing on a droplet actuator
US20140193807A1 (en) 2006-04-18 2014-07-10 Advanced Liquid Logic, Inc. Bead manipulation techniques
JP5156762B2 (en) 2007-02-09 2013-03-06 アドヴァンスト リキッド ロジック インコーポレイテッド Droplet actuator device and method of using magnetic beads
US8702938B2 (en) 2007-09-04 2014-04-22 Advanced Liquid Logic, Inc. Droplet actuator with improved top substrate
AU2008345138B2 (en) 2007-12-23 2014-05-29 Advanced Liquid Logic, Inc. Droplet actuator configurations and methods of conducting droplet operations
WO2009111769A2 (en) 2008-03-07 2009-09-11 Advanced Liquid Logic, Inc. Reagent and sample preparation and loading on a fluidic device
WO2009137415A2 (en) 2008-05-03 2009-11-12 Advanced Liquid Logic, Inc. Reagent and sample preparation, loading, and storage
US8926065B2 (en) 2009-08-14 2015-01-06 Advanced Liquid Logic, Inc. Droplet actuator devices and methods
US9091649B2 (en) 2009-11-06 2015-07-28 Advanced Liquid Logic, Inc. Integrated droplet actuator for gel; electrophoresis and molecular analysis
WO2011084703A2 (en) 2009-12-21 2011-07-14 Advanced Liquid Logic, Inc. Enzyme assays on a droplet actuator
WO2011142117A1 (en) 2010-05-11 2011-11-17 パナソニック株式会社 Cell culture substrate and cell culture method using same
EP2707131B1 (en) 2011-05-09 2019-04-24 Advanced Liquid Logic, Inc. Microfluidic feedback using impedance detection
WO2013006312A2 (en) 2011-07-06 2013-01-10 Advanced Liquid Logic Inc Reagent storage on a droplet actuator
WO2013009927A2 (en) 2011-07-11 2013-01-17 Advanced Liquid Logic, Inc. Droplet actuators and techniques for droplet-based assays
US9446404B2 (en) 2011-07-25 2016-09-20 Advanced Liquid Logic, Inc. Droplet actuator apparatus and system
BR112014032727A2 (en) 2012-06-27 2017-06-27 Advanced Liquid Logic Inc bubble drop reduction actuator techniques and designs
US10072241B2 (en) 2013-03-13 2018-09-11 Innovative Surface Technologies, Inc. Conical devices for three-dimensional aggregate(s) of eukaryotic cells

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPN923596A0 (en) * 1996-04-12 1996-05-09 Australian Biomedical Corporation Limited Method and apparatus for treatment of human or animal cell samples
WO1998041869A1 (en) * 1997-03-18 1998-09-24 Chromaxome Corporation Methods for screening compounds using encapsulated cells
GB9808836D0 (en) * 1998-04-27 1998-06-24 Amersham Pharm Biotech Uk Ltd Microfabricated apparatus for cell based assays

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004011938A3 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2543618A (en) * 2015-10-16 2017-04-26 Univ Oxford Innovation Ltd Microfluidic arrangements
GB2543616A (en) * 2015-10-16 2017-04-26 Univ Oxford Innovation Ltd Microfluidic arrangements
GB2543617A (en) * 2015-10-16 2017-04-26 Univ Oxford Innovation Ltd Microfluidic arrangements

Also Published As

Publication number Publication date
AU2003269041A8 (en) 2004-02-16
WO2004011938A2 (en) 2004-02-05
AU2003269041A1 (en) 2004-02-16
WO2004011938A3 (en) 2004-08-05
FR2842747A1 (en) 2004-01-30
CA2492933A1 (en) 2004-02-05
FR2842747B1 (en) 2004-10-15
JP2005533509A (en) 2005-11-10
WO2004011938B1 (en) 2004-09-16

Similar Documents

Publication Publication Date Title
Weibel et al. Applications of microfluidics in chemical biology
Ziauddin et al. Microarrays of cells expressing defined cDNAs
US9981230B2 (en) Microfluidic devices
AU2013302756B2 (en) Microcapsule compositions and methods
Cass et al. Immobilized biomolecules in analysis: a practical approach
US7442339B2 (en) Microfluidic apparatus, Raman spectroscopy systems, and methods for performing molecular reactions
EP1179087B1 (en) Focusing of microparticles in microfluidic systems
Chan et al. Model membrane systems and their applications
US7901939B2 (en) Method for performing crystallization and reactions in pressure-driven fluid plugs
US6277628B1 (en) Linear microarrays
Stamou et al. Self‐assembled microarrays of attoliter molecular vessels
US20050048651A1 (en) Method and apparatus for spatially confined electroporation
CN105492607B (en) Composition and method for sample treatment
EP1405666A2 (en) Substrate for methods to determine analytes and methods to manufacture such substrates
US20020187485A1 (en) Open substrate platforms suitable for analysis of biomolecules
Kang et al. Microfluidics for drug discovery and development: from target selection to product lifecycle management
US20030032203A1 (en) Small molecule microarrays
Christensen et al. Surface-based lipid vesicle reactor systems: fabrication and applications
ES2203098T3 (en) Microfabricated apparatus for dosed cell-based.
EP1299564B1 (en) Integrated microarray devices
JP4755368B2 (en) High-density cell array substrate, manufacturing method, and use thereof
US20030134267A1 (en) Sensor for detecting biomolecule using carbon nanotubes
Hong et al. Micro-and nanofluidic systems for high-throughput biological screening
JP5903067B2 (en) In vitro evolution within microfluidic systems
Ozkan et al. Electro-optical platform for the manipulation of live cells

Legal Events

Date Code Title Description
17P Request for examination filed

Effective date: 20050216

AK Designated contracting states:

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent to

Countries concerned: ALLTLVMK

DAX Request for extension of the european patent (to any country) deleted
R17C Date of despatch of first examination report

Effective date: 20060926

18D Deemed to be withdrawn

Effective date: 20070201