EP1523576A2 - Verfahren zur identifizierung von genen die im zusammenhang mit störung des central nerven systems stehen - Google Patents

Verfahren zur identifizierung von genen die im zusammenhang mit störung des central nerven systems stehen

Info

Publication number
EP1523576A2
EP1523576A2 EP03740117A EP03740117A EP1523576A2 EP 1523576 A2 EP1523576 A2 EP 1523576A2 EP 03740117 A EP03740117 A EP 03740117A EP 03740117 A EP03740117 A EP 03740117A EP 1523576 A2 EP1523576 A2 EP 1523576A2
Authority
EP
European Patent Office
Prior art keywords
hypothalamic
cdna
differentially expressed
gene
genes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03740117A
Other languages
English (en)
French (fr)
Inventor
Leif Kongskov Larsen
Niels Vrang
Philip Just Larsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rheoscience AS
Original Assignee
Rheoscience AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rheoscience AS filed Critical Rheoscience AS
Publication of EP1523576A2 publication Critical patent/EP1523576A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention concerns methods for identification of genes related to pathogenic conditions.
  • the present invention relates to genes with a differential pattern of expression in specific areas of the brain.
  • genes and/or their gene products potentially constitute novel drug targets for treatment of various human diseases as well as diagnostic targets.
  • a number of human diseases are associated with alterations of gene expres- sion in confined areas of the brain.
  • hypothalamic dysfunctions In particular, a large number of somatic diseases are caused by hypothalamic dysfunctions or accompanied by altered hypothalamic function, which upon pharmacological correction will ameliorate symptoms or normalise the dysfunction. Comparative studies of the hypothalamus show that this region of the brain is anatomically, functionally, and physiologically very well conserved in vertebrates. Thus, several examples of dysfunctions originally observed in animal models have subsequently been shown to be analogous to similar human dysfunctions.
  • hypothalamic hypogonadism and diabetes insipidus.
  • metabolic disorders such as obesity and accompanying diabetes mellitus and dyslipidaemia are frequently associated with abnormal function of hypothalamic neurons.
  • monogenetic diseases such as the metabolic syndromes associated with absent leptin synthesis (ob/ob mice), mutated leptin receptors (db/db mice, fa/fa rats), and the early onset obesity associated with melanocortin 4- receptor mutations are corrected by restoration of hypothalamic expression of the wild type gene.
  • data obtained using the hypothalamus from model animals excellently reflects human disorders involving dysfunctional hypothalamus and provides therapeutic targets for restoration of normal function.
  • the hypothalamus As a central player of the limbic system, the hypothalamus is centrally placed as the overall conductor of such diverse functions as: reproduction and sexual behaviour, water and electrolyte homeostasis, energy homeostasis, blood glucose, emotions, mood, maternal behaviour, sleep and wakefulness, cir- cadian rhythms, memory, thermoregulation, blood pressure regulation, kid- ney function, endocrine system (thyroid, gonadal, adrenocortical, growth, mammary function, lactation), gastrointestinal function, and immune competence.
  • reproduction and sexual behaviour water and electrolyte homeostasis, energy homeostasis, blood glucose, emotions, mood, maternal behaviour, sleep and wakefulness, cir- cadian rhythms, memory, thermoregulation, blood pressure regulation, kid- ney function, endocrine system (thyroid, gonadal, adrenocortical, growth, mammary function, lactation), gastrointestinal function, and immune competence.
  • Drugs, compounds, gene therapies, and other therapeutic devices for amelio- rating, curing or modulating diseases with a hypothalamic component are suitable therapeutic tools for a number of diseases including:
  • hypothermia hyperthermia, obesity, dyslipidaemia, sarcopenia, anorexia nervosa, cancer cachexia, AIDS related wasting, bulimia nervosa, diabetes mellitus, hypoglycaemia, dehydration, polyuria, electrolyte disturbances (hy- ponatraemia, hypematraemia, hypokalaemia, hyperkalemia, hypocalcaemia, hypercalcaemia), diabetes insipidus, inappropriate syndrome of antidiuretic hormone (SIADH), autonomic dysfunction, arterial hypertension, arterial hypotension, (overhydration, water intoxication, sexual dysfunction, infertitility, precocious puberty, dysmenorrhea, oligomenorrhea, premature menopause, perimenopause and postmenopausal complications (including osteoporosis), hypogonadism, hyperprolactinaemia, galactorrhea, endogenous depression, stress, adrenocortical hyper
  • hypothalamus In mammals, energy homeostasis is regulated by neurons located in the hypothalamus
  • the hypothalamus is organized as a collection of distinct autonomously active nuclei with discrete functions
  • the hypothalamus governs several physiological variables regulated around an adjustable set point, including body composition and body temperature
  • the hypothalamus is a heterogeneously paired brain structure located below the thalamus on each side of the third ventricle
  • the heterogeniety of the hypothalamus is well recognized, and is evident when microscopically examin- ing this structure in Nissl stained (Cresyl violet/Thionin) sections of the mammalian brain
  • Nissl stained Crlosyl violet/Thionin
  • groups or clusters of more or less densely packed neurons can be recognized More densely packed groups of neurons are classically termed "nuclei”
  • areas with more loosely packed neurons are termed "areas” or "zones” [K ⁇ eg, 1932, Swanson, 1992]
  • An example of a "nucleus" and an "area/zone” is given in Figure 1A
  • Figure 1A shows a Nissl stained (thionin) section through the rat hypothalamus corresponding to Plate 26 in the atlas by Swanson [Swanson, 1992] All nomenclature and abbreviations for hypothalamic and extrahypothalamic nuclei and areas used herein corresponds to the nomenclature used in the brain atlas by Swanson [Swanson, 1992]. Different nomenclatures are sometimes used in the literature in addition to the nomenclature suggested in Swanson.
  • the lateral hypothalamic area (LHA; Plate 22-33 [Swanson, 1992]) has been further subdivided according to Geeraedts and co-workers [Geeraedts et al., 1990a; Geeraedts et al., 1990b].
  • the hypothalamic paraventricular nucleus (PVH) is depicted in Figure 1A and from the figure (as well as from the Atlas) it can be seen that the PVH can be further sub- divided into so-called sub-nuclei; e.g. the dorsal parvicellular subnucleus (dpPVH), the posterior magnocellular subnucleus (pmlPVH) and the dorsal medial parvicellular subnucleus (mpdPVH).
  • sub-nuclei e.g. the dorsal parvicellular subnucleus (dpPVH), the posterior magnocellular subnucleus (pmlPVH)
  • hypothalamic arcuate nucleus ARH; plate 26-30
  • VMH ventromedial hypothalamic nucleus
  • DH hypothalamic dorsomedial nucleus
  • LHA lateral hypothalamic area
  • Me median eminence
  • PV periventricular nucleus
  • SBPV subparaventricular zone
  • Obesity is recognised as a disease, which requires medical attention and treatment.
  • obesity is defined as a condition characterised by excess body fat mass relative to lean tissue mass, and this condition is generally reflected in a body mass index above 30 kg/m 2 .
  • the condition is often characterised by accompanying metabolic disorders including insulin resistance and hypehnsulinaemia, which predispose to glucose intolerance.
  • the medical condition characterized by visceral adiposity, insulin resistance, blood dyslipidaemia, and arterial hypertension is recognized as the metabolic syndrome and constitutes a severely elevated risk for development of type 2 diabetes and cardiovascular disease.
  • Other secondary medical complications such as atherosclerosis, arterial hypertension, os- teoarthritis, certain cancers, as well as liver and gall bladder diseases sometimes accompany obesity.
  • laser capture microdissection has been introduced as a tool for the isolation of microscopically sized tissue samples.
  • a laser beam that is controlled by sophisticated software is used for circumcising the area of interest followed by isolation of the area.
  • the isolation can be performed with non-contact methods where the isolated sample is catapulted or dropped from the slide into a centrifuge tube or cap, or with contact methods where the sample is fused with a membrane and isolated.
  • the size of the area can be varied from single cells (for most systems) and up to several square millimiters containing thousands of cells.
  • Techniques for analysing gene expression include low throughput methods such as Northern blotting, multiplex PCR, real time PCR, and in situ hybridisation. More recently, various microarray based techniques have become available for high throughput analysis of gene expression. A common feature of these methods is that they only allow characterisation of genes that were previously described in the art.
  • Meth- ods generally employed to amplify cDNA comprise various polymerase chain reaction based (PCR) techniques.
  • PCR polymerase chain reaction based
  • T7-dhven linear amplification Another technique widely used for amplify- ing cDNA, has several drawbacks, the most important being that the gene fragments amplified are preferably derived only from the 3'-end of the mRNAs.
  • T7 -driven amplification is based on the following principle: Isolated mRNA is reverse transcribed using a poly-dT primer with a T7 RNA polymerase promoter tag.
  • Double-stranded cDNA is prepared and the tagged cDNA used as a template for transcription with T7 RNA polymerase.
  • T7 RNA polymerase Another disadvantage of T7-driven amplification is that amplification of low amounts of RNA has to be performed in several rounds (e.g. [Ohyama et al., 2000; Scheidl et al., 2002]), making this procedure tedious and defective.
  • hypothalamus-specific genes A number of recent documents are addressing aspects of hypothalamus- specific genes:
  • Ziotopoulou et al. discloses differential expression of neuropeptides known to be implicated in weight regulation. These neu- ropeptides were examined in mice fed on different diets. RT-PCR analysis on RNA extracted from entire mice hypothalami were carried out in order to detect and quantify expression of NPY, AGRP, POMC, orexin, and SOCS-3.
  • Gautvik et al. discloses identification of hypothalamus- specific transcripts in a rat hypothalamic cDNA library from which cerebellar and hippocampal sequences had been depleted, enriching for sequences expressed selectively in the hypothalamus. 94 clones from this library were selected for further analysis.
  • Marathos-Flier et al. discloses differential display analysis (DD-RTPCR) of hypothalamus tissue from normal and obese mice. In this study 10 entire hypothalami from each mouse type are excised and pooled in order to provide sufficient amounts of RNA for the analysis. In the introduction it is stressed that elucidation of the molecular mechanisms that contribute to hypothalamic dysfunction in obesity are difficult to carry out because hypothalamic tissue is scarce. It thus follows that is it very difficult to isolate differentially expressed genes from entire hypothalami.
  • the present invention improves such approaches by making possible the identification of genes that are differentially expressed in well-defined groups of hypothalamic neurons under certain conditions. Such genes may or may not have been previously described. Such genes have most likely not previously been associated with hypothalamic malfunctions.
  • genes differentially expressed in specific brain areas as a consequence of disease can be identified and/or cloned by combining brain sectioning and staining, laser capture microdissection, cDNA amplification by PCR, and subtraction cloning, and optionally microarray analysis.
  • Such differentially expressed genes and/or their gene products represent potentially useful drug targets for use in treatment or prophylaxis of the particular hypothalamic malfunction.
  • the present invention demonstrates that genes expressed pref- erentially in distinct areas of the brain of model organisms can be identified and cloned. These genes exhibiting a spatially restricted expression represent good targets for specific modification of the function of the brain nucleus in which they are expressed and will thus constitute novel drug targets for drugs addressing the function(s) of distinct areas in the brain. These genes furthermore represent targets for diagnosis of conditions and diseases of plausible hypothalamic origin or with verified hypothalamic pathophysiology.
  • the present invention discloses methods for identification of genes involved in various hypothalamic diseases and/or malfunctions. These methods com- prise a combination of microdissection of tissue samples from brain cross sections, global reverse transcription and amplification by PCR, identification of differentially expressed cDNA by subtraction cloning, and optionally array analysis in order to identify genes that are differentially expressed in a hypothalamic subregion. Such genes and their gene products constitute potential drug targets and diagnostic targets. These drugs will ultimately lead to novel tools for treating obesity and accompanying metabolic disorders including type 2 diabetes, impaired glucose tolerance, impaired fasting glucose, dyslipidaemia, and metabolic syndrome. Identification of differentially expressed genes likewise allows for the development of diagnostic tools that can be used for diagnosis as well as evaluation of propensity to develop cer- tain hypothalamus related diseases.
  • the desired hypothalamic subregion (aggregate of functional equivalent neurons), which is also herein referred to as the first tissue sample, is isolated preferably using the laser capture technique (or other mi- croscope guided microdissection techniques).
  • a second tissue sample is concurrently isolated using the same approach.
  • RNA is then extracted in parallel from the two isolated tissue samples and subsequently amplified using a global RT-PCR approach.
  • Amplification by PCR is usually more efficient than T7-driven amplification.
  • PCR amplification is not linear and may introduce misrepresentation of some cDNA species, this concern is of minor importance if samples to be compared are processed in parallel and thus, the representation of every single gene in the samples to be compared is skewed to the same degree.
  • subtraction cloning techniques are employed for identifying novel genes differentially expressed in the desired brain nuclei.
  • Differentially expressed genes may encode almost any gene product.
  • Differentially expressed genes according to the present invention comprise: previ- ously unknown genes and splice variants as well as known genes not previously associated with a specific hypothalamic function.
  • Differentially expressed genes that have been identified using the methods of the present invention also comprise genes that are specifically expressed in a subregion of the hypothalamus compared to other brain tissue types. Examples of such gene products include genes that constitute part of novel signalling pathways, novel parts of known pathways, enzymes, transcription factors, membrane proteins, organelle associated proteins, extracellular proteins, peptide hormones, etc.
  • the products of these "novel" genes will be ob- vious targets for modification of the function of the specific brain nuclei in which they are expressed and are thus potential drug targets.
  • Antisense nucleic acid molecules that are complementary to differentially expressed genes, or parts thereof, identified by the methods of the present invention can also be used for preparing medicaments for treatment of diseases char- acterised by hypothalamic pathophysiology.
  • Other potential drug targets comprise regulatory sequences regulating expression of differentially expressed genes.
  • FIG. 1 Cross-sections of hypothalamus subregions from rats. Scale- bars ⁇ 00 ⁇ m.
  • B Fluroscence microphotograph showing retrogradely labeled neurons in the PVH. Brightest neurons (whitest; thin arrows) are labelled with True Blue injected into the dorsal vagal complex; more faintly labelled neurons (fat arrows) contain the retrograde tracer Fluorogold (rats injected in- traperitoneally with Fluorogold). The two tracers are localized in different hypothalamic subregions.
  • C A hypothalamic subregion defined on the basis of neurotransmitter content. An antibody to oxytocin was used to label cells in the PVH containing this neuropeptide (dark neurons).
  • D A hypothalamic subregion defined on the basis of projection pattern.
  • Cholera Toxin subunit B was injected into the PVH and retrogradely labeled neurons in the DMH (neurons projecting to the PVN) are visualized using a peroxidase coupled ChB antibody and stained using diaminobenzidine as a chromogen.
  • A Bilateral cutting of two PVH subregions - the posterior magnocellular subnucleus (pmlPVH) and the medial parvicellular subnucleus (mpPVH). The PVH boundaries are illustrated on the left side of the third ventricle (3V) by a dashed line.
  • B The right PVH from Figure 2A at a higher magnification.
  • C Two hypothalamic subregions cut from the dorsomedial hypothalamic nucleus (DMH) - the dorsal subnucleus (DMHd) and the compact subnucleus (DMHc).
  • Figure 3 Global amplification of RNA, cycle test for SMART cDNA synthesis.
  • cDNA is amplified with a modified SMART kit and samples taken after 4, 6, 8, 10, 12, 14, 16, 18, and 20 cycles. These samples are run on a 1.2 % agarose gel.
  • the optimal cycle number in this specific experiment is deduced to be 10 cycles of PCR where the visible products are sized approximately 0.3 to 10 kb.
  • Top number of cycles in second PCR.
  • Left marker sizes in kb.
  • Figure 4 Integrity check of cDNA.
  • RNA purified from DMH was reverse-transcribed with Superscript (Invitrogen) and 35 cycles of PCR performed with various primers corresponding to the p619 (primer sets A to E), ⁇ -actin (primer set F), and GAPDH (primer set G) encoding cDNAs, respectively.
  • Figure 5 Reverse Northern blotting of clones derived from a DMH vs. CTX
  • Figure 6 Flowchart visualizing the methods of the invention.
  • Figure 7 In situ hybridization using probe generated from clones in the DMH versus CTX screen. Slices from three different levels of Sprague-Dawley rat brains (PVN, DMH, and ARC) are used for in situ hybridization. The probes are generated by in vitro transcription of cloned cDNA from the DMH minus CTX subtraction experiment as indicated.
  • Figure 8 Regulation of necdin upon starvation of fatty Zucker (fa/fa) rats, fa/fa Zucker rats and wildtype rats (Fa/?) were freely fed or subjected to 48 hours fast (8 rats in each group). In situ hybridisation was performed and necdin expression in the arcuate nucleus quantified by densitometry of the exposed photographic film.
  • hypothalamic pathophysiology Diseases of hypothalamic origin or diseases characterised by hypothalamic pathophysiology have very diverse manifestations.
  • the common theme of hypothalamic malfunctions is malfunction attributable to a pathophysiological condition in well defined neurones localised within a specific hypothalamic subregion. It is generally accepted that malfunctions in many, if not all, cases can be linked to an aberrant gene expression pattern. Genes that are differentially expressed and genes that are differentially expressed under certain conditions in a hypothalamic subregion and their gene products thus constitute desirable targets for treatment and prevention of various hypothalamic malfunctions.
  • presently available methods have been unable to identify dysfunction associated with differentially expressed genes in specific subregions.
  • the present invention relates to a method of identifying differentially expressed nucleotide sequences in a tissue sample that corresponds to a hypothalamic subregion from a mammalian brain, said method comprising the following steps:
  • tissue sample (i) isolating a subregion that is referred to as a first tissue sample, said sample being substantially free of cells from hypothalamic neighbouring tissues surrounding said hypothalamic subregion, (ii) isolating a second tissue sample,
  • RNA from the first and the second tissue samples areolating RNA from the first and the second tissue samples, (iv) synthesizing cDNA from the isolated RNA samples, (v) identifying cDNA sequences that are differentially expressed in the first tissue sample as compared with cDNA from the second tissue sample, and
  • the present invention further relates to the following methods:
  • tissue samples are taken from a DIO/DR rat.
  • Said tissue samples are preferably isolated by laser capture microdissection.
  • a labelling agent selected from the group consisting of: immunostaining, expression of fluorescent proteins, Nissl staining (Cresyl violet, Thionin), haematoxylin-eosin, methylene blue, neutral red, any nuclear staining method, immunocytochemistry, endogenous expression of fluorescent proteins
  • a method that comprises a step wherein cDNA is amplified prior to identification of differentially expressed genes
  • differentially expressed genes are identified by differential display RT-PCR or cDNA subtraction. These methods allow identification of differentially expressed genes that were not necessarily previously associated with the hypothalamus or hypothalamic subregions.
  • Methods for performing this verification include various PCR based methods, hybridization based methods, as well as micro array based methods.
  • a method that comprises a step wherein cDNA is amplified prior to identifica- tion of differentially expressed genes
  • amplifying cDNA's it has traditionally been difficult to obtain representation of the 5' ends.
  • this problem can usually be circumvented.
  • a method where the mammalian brain is derived from a non-human animal, e.g. sheep, goat, rabbit, mouse, rat, horse, cow, dog, cat, primate, etc.
  • a method where a human counterpart gene to the differentially expressed gene is subsequently identified.
  • Methods for identifying a human counterpart gene include various bioinformatics tools that the skilled man will be familiar with.
  • a labelling agent selected from the group consisting of: immunostaining, expression of fluorescent proteins, Nissl staining (Cresyl violet, Thionin), haematoxylin-eosin, methylene blue, neutral red, any nuclear staining method, immunocytochemistry, endogenous expression of fluorescent proteins,
  • the present invention further relates to an isolated DNA sequence that is selected from the group consisting of SEQ ID NOs 1-11 , or a part thereof or an isolated DNA sequence that hybridises under stringent conditions with said sequence or is a degenerative of said sequence.
  • DNA sequences ac- cording to the present invention may furthermore be used for designing a diagnostic kit for diagnosis of a hypothalamic condition.
  • Said diagnostic kit may comprise e.g. specific primers, antibodies, probes, etc.
  • DNA sequences according to the present invention may be inserted into an expression vector.
  • Said expression vector may be inserted into a host cell and said host cell may be cultivated in order to produce recombinant poly- peptides.
  • the recombinant polypeptide may subsequently be used for designing drugs for treatment of hypothalamic diseases, and optionally for designing diagnostic kits for diagnosis of a hypothalamic condition.
  • the present invention further relates to antisense nucleic acid molecules that are complementary to DNA sequences according to the present invention.
  • the antisense molecule may be in form as a DNA, PNA or LNA molecule.
  • Antisense nucleic acids according to the present invention may be used for the preparation of a medicament for treatment of hypothalamic malfunctions.
  • the present invention also relates to methods of diagnosing a disease or malfunction of plausible hypothalamic origin or with known hypothalamic pathophysiology in an individual comprising determining the presence and/or amount or absense of a differentially expressed gene or gene product in a tissue or fluid sample from the individual, wherein said differentially expressed gene has been identified as being differentially expressed by any of the methods of the present invention.
  • Methods of diagnosing a disease or malfunction of plausible hypothalamic origin or with known hypothalamic pathophysiology in an individual according to the present invention further comprise determining the presence and/or amount or absence of a marker in the upstream regulatory region of a differentially expressed gene, wherein said differentially expressed gene is identified by any of the methods according to the present invention.
  • Mammalian brain may be derived from any mammal excluding humans.
  • Examples of experimental animals from where the mammalian brain preferably may be derived include mice, rats, primates, rabbits, pigs, etc.
  • the brain is situated at the anterior end of the spinal cord enclosed in the bony cranium and it comprises the forebrain, midbrain, and hindbrain.
  • hypothalamic subregion is herein defined as a microscopically identified group of nerve cells, or even a single nerve cell, located within the hypothalamus of a mammalian brain.
  • the isolated hypothalamic subregion according to the invention is isolated in a manner that is so precise that only trace amounts (less than 20% by weight, preferably less than 5% by weight, more preferably less than 2% by weight and even more preferably less than 1 % by weight) of tissues from neighbouring areas are included in the isolated sample.
  • a hypothalamic subregion typically comprises less than 10% of the entire hypothalamic volume, more preferably less than 5% and most preferably less than 3%.
  • a hypothalamic subregion typically contains a number of non-neuronal cells such as glia cells and other cells.
  • hypothalamic subregion examples include hypothalamic nuclei, hypothalamic subnuclei, single hypothalamus cells with a distinct appearance, hypothalamic areas, hypothalamic zones.
  • a hypothalamic subregion according to the invention can only be identified and isolated in a sufficient precise manner using labelling methods combined with highly sophisticated microscope based equipment.
  • a hypothalamic subregion can be identified in several different ways:
  • tissue sample of interest i.e. the first tissue sample
  • tissue sample of interest must correspond exactly to the tissue or even the single cell of interest.
  • the amount of neighbouring tissue included in the sample of interest is therefore preferably less than 20%, more preferably less than 5%, even more preferably less than 2% and most preferably less than 1 % measured by weight of the tissue sample of interest.
  • First tissue sample The first tissue sample is characterised as the tissue sample wherein differentially expressed genes of interest may be found by subtraction with a second tissue sample.
  • a first tissue sample is taken from a cross section of a mammalian brain.
  • a first tissue sample is an isolated hypo- thalamic subregion.
  • a second tissue sample is to be understood as the "reference tissue sample” in comparison with the first tissue sample.
  • the second tissue sample can in principle comprise any brain tissue or single cell sample taken from within the same species or specimen from which the relevant hypothalamic subregion (first tissue sample) has been isolated, as long as the second tissue sample is not identical with the first tissue sample.
  • second tissue samples include: cortex, thalamic nuclei, basal ganglia, hypothalamic subregions, mesencephalic, pontine and medullary nuclei, as well as cerebellar subregions.
  • a second tissue sample can also be a sample taken from the same subregion as the first tissue sample but from another animal that has been treated differently (e.g.
  • Tester and driver Tester and driver samples correspond to cDNA from the first and second tissue samples respectively.
  • Isolating a hypothalamic subregion of interest comprises the use of laser capture microdissection technologies to isolate tissue samples from brain cross sections.
  • Other ways of isolating a microscopically identified tissue sample for use in the present invention include micromanipu- lated manual or automated dissection using principles different from the laser (e.g. Eppendorf MicroDissector where an extremely fine metal tip (Micro- Chisel) is oscillated at high levels of frequency and low amplitude and samples isolated by subsequent aspiration with a pipette).
  • Hybridising under stringent conditions should in this context be understood as hybridisation under conditions that only allows closely related DNA sequences to hybridise.
  • Hybridisation under stringent conditions may in the present invention be understood as hybridization under highly stringent conditions.
  • hybridisation may also be carried out under moderately stringent conditions according to the present invention.
  • Carrying out hybridization under highly stringent conditions will typically only allow specific hybridization between two sequences that have sequence homologies that are greater than 80% and preferably greater than 90%.
  • Carrying out hybridization under moderately stringent conditions will typically allow specific hybridization between two sequences that have sequence homologies that are greater than 70%. How to carry out hybridization under moderate and highly stringent conditions has been described in greater detail in e.g. Sambrook et al. (2001 ) Molecular Cloning, CSHL PRESS.
  • a fragment of a DNA sequence according to the present invention can be any fragment with a length of at least 30 bases.
  • a fragment of an amino acid sequence according to the present invention can be any fragment with a length of at least 10 amino acids.
  • cDNA molecules are preferably synthesized using methods that allow for subsequent amplification of the full-length cDNA molecules.
  • kits and methods suitable for cDNA synthesis according to the present invention include but are not limited to: Capfinder and SMART II kits from Clontech, and FirstChoiceTM RLM-RACE kit (with modifications) from Ambion.
  • DNA molecules can be amplified by methods employing polymerase chain reaction (PCR) based techniques. PCR based techniques are described in greater detail in e.g. Sambrook et al. (2001 ) Molecular Cloning, CSHL PRESS. cDNA molecules are preferably amplified prior to subtrac- tion. Preferred methods or preferred kits for amplifying cDNA include but are not limited to: Capfinder and SMART II kits from Promega, Expand High Fidelity PCR System from Roche, any other PCR based kit employing proofreading thermostable DNA polymerases or mixtures of proofreading and non- proofreading polymerases.
  • PCR polymerase chain reaction
  • Verification of differentially expressed genes according to the present invention can be carried out using a number of methods known in the art. Examples of such methods include but are not limited to: Northern blot, reverse Northern blot, real-time PCR, RT-PCR, and various microarray based methods, and Western blot/immunoblot based methods. Verification may take place by amplification using gene specific primers, hybridization (in situ/in vitro) using gene specific probes, immunoblot based methods using specific antibodies, or other methods available to the man skilled in the art (e.g. Sambrook et al. (2001 ) Molecular Cloning, CSHL PRESS).
  • An expression vector according to the present invention can be any vector that has the ability to transcribe an inserted sequence into mRNA by means of either a constitutive or an inducible promoter.
  • the transcribed mRNA may or may not be fused to an mRNA sequence enabling translation and it may or may not be fused to an mRNA sequence encoding a "tag sequence" that eases subsequent purification.
  • expression vectors include but are not limited to pT7-7, pSKF101 , pSKF301 , pUR, pATH, pMAL-c2, pMAL-p2, pGEX1 , pGEX2T, pGEX3X, pESP-1 , pESP-2, pESP3, and CDM8.
  • a host cell according to the present invention may be any cell that is transformable by an expression vector comprising an isolated DNA sequence according to the present invention and is able to express the encoded recombinant gene product.
  • suitable host cells include, mammalian cells (such as CHO, COS, HeLa, C33A, Caski, HaCat, etc. cells), insect cells, yeast cells, bacteria (e.g. E. coli cells, Bifidobacterium Sp. cells, etc.)
  • antisense nucleic acid molecule means any nucleic acid molecule in the form of a DNA, a RNA, a PNA ("peptide nucleic acid”), a LNA ("locked nucleic acid”) or a phosphorothioate or derivatives, analogs or fragments thereof, including double-stranded siRNA (small interfering RNA) molecules, capable of down-regulating the expression of a particular protein encoded by a nucleic acid complementary of the antisense nucleic acid.
  • the size of an antisense nucleic acid molecule may range from 15 bases to encompassing the entire coding sequence of the gene of interest.
  • immediate and “drug” are used interchangably throughout the present invention. These terms cover any substance that posses a biological activity and may function as a therapeutical or profylactic compound in humans or animals, said compounds may furthermore comprise pharmaceuti- cally acceptable excipients that are selected in accordance with conventional pharmaceutical practise.
  • Diagnosis, according to the present invention, of a disease or malfunction of plausible or hypothalamic origin or with known hypothalamic pathophysiology might be carried out in several ways.
  • Differential gene expression may e.g. be caused by mutations or other alterations in the DNA sequences that regulate transcription (e.g. promoters and/or enhancers) or it may be caused by mutations within the gene that cause the gene to be differentially expressed or alternatively the gene may be deleted, duplicated or in other ways altered.
  • diagnosis can be performed on basis of a DNA sample from an individual either by detecting and/or sequencing a marker or by cloning and sequencing a larger fragment of the genomic DNA.
  • the size of the marker or the length of the DNA strand that has to be identified may vary highly. In case of SNP polymorphism, as little as one specific nucleotide may be determined in order to diagnose specifically. In cases of larger genomic alterations, hundreds or maybe even thousands of bases may have to be determined.
  • the diagnostic assay may also be designed on basis of detecting presence/absence/size/melting/temperature, etc. of PCR- fragments. However, in other cases, where there is either no genetic basis for the differential expression or the genetic basis for the altered expression is unknown, the gene products can be detected by either detecting the mRNA or protein products of the gene. This can be done by e.g. a sample of the cerebrospinal fluid or ultimately a brain biopsy.
  • Diagnosis can be performed by means of e.g. SNP-detection (single nucleotide polymorphism), or other PCR based methods by detection of the presence and/or amount, absence, and/or size of a PCR product.
  • the PCR prod- uct may or may not be sequenced in order to perform the diagnosis.
  • Diagnosis may furthermore be carried out on the level of DNA or mRNA using meth- ods based on hybridization, e.g. in situ hybridization, Southern blot, Northern blot, microarray based methods, etc.
  • diagnosis may be performed by detection on the level of proteins using e.g. antibody based detection methods (Western blot, ELISA, protein microarray, etc.), assays detecting specific enzyme activities, radiolabelling based methods, etc.
  • the methods of the present invention are unique since they provide highly sophisticated ways of specifically isolating a hypothalamic subregion of interest substantially without including cells from neighbouring areas and regions in the isolated sample and thereby enabling identification of differentially expressed genes from this subregion that were not previously known to be associated with a specific hypothalamic disease or malfunction.
  • RNA is then extracted from the isolated brain nucleus.
  • the RNA is preferably amplified up to approximately 1 million-fold using e.g. global PCR amplification of full- length cDNA by PCR [Chenchik et al., 1998; Matz et al., 1999; Zhu et al., 2001 ; Zhumabayeva et al., 2001].
  • cDNA is amplified by methods that ensure that both the 3' and the 5' ends of most of the cDNA species are amplified.
  • amplification can be accomplished by the method of T7 based RNA amplification, a method that usually leads to preferential isolation of the 3'-end of genes.
  • differential cloning and/or identification of genes are employed to isolate genes specifically expressed in the brain nucleus of interest.
  • Various techniques such as RASH [Jiang et al., 2000], RDA [Hubank and Schatz, 1994], differential display PCR [Liang and Pardee, 1992] and, microarrays with oligonucleotides [Lockhart et al., 1996] or cDNAs [Schena et al., 1995] may be used to identify and/or validate genes differentially expressed.
  • cDNA subtraction methods are used according to the present invention.
  • Microarray based methods are preferably used subsequently in order to assay for the differential expression of already known genes or expressed se- quence tags (ESTs).
  • Differentially expressed genes may furthermore be used as diagnostic targets. It is possible to diagnose on basis of a DNA-containing sample in cases where the differential expression is caused by e.g. a mutated promoter and/or enhancer, or mutation(s) within the gene that cause the gene to be differentially expressed.
  • Sources of genomic DNA include: urine, blood, sweat, saliva, tears, semen, bronchoalveolar lavage fluid, sputum, stick scra- bes (e.g. buccal swabs), hair, nails, dandruff, tissue samples, or other body fluid or tissues obtained from an individual.
  • diagnosis where the RNA and/or protein corresponding to a specific gene is examined may be performed on basis of a sample of cerebrospinal fluid or ultimately a brain biopsy.
  • differentially expressed genes in the brain opens for new di- agnostic and therapeutic avenues.
  • Differentially expressed genes are identified from first and second tissue samples.
  • the two tissue samples can be different subregions from the same animal or identical subregions from phe- notypically different subjects of the same species. Both approaches to isolate and characterise differentially expressed genes are exemplified in the pre- sent text.
  • the present invention can be used to identify differentially expressed genes in specific cells of the central nervous system.
  • the affected animals comprise the phenotype mimicking human disease whilst unaffected animals represent the phenotype of non-diseased humans.
  • unaffected animals represent the phenotype of non-diseased humans.
  • identity of isolated cDNAs are characterised in genome databases and their pathophysiological relevance assessed using both bioinformatic tools, molecular approaches as well as common clinical judgement.
  • the cDNA is full length cloned and the nature and function of the gene product assessed in a cellular expression system.
  • the clinical and pharmacological relevance of identified differentially expressed genes are assessed in several ways. Firstly, using the humane genome database and available information about single nucleotide polymorphisms (SNPs) the possible linkage of certain point mutations in the identified genes and aggregation of human disease among bearers is investigated. As example, more than 50 alleles of the human melanocortin-4 receptor (MC-4R) exist, some of which are phenotypically related with early onset obesity whereas others have no overt phenotype.
  • SNPs single nucleotide polymorphisms
  • mice having a life without the MC-4R From both genetically modified mice having a life without the MC-4R, and from mice having the MC-4R function constantly antagonized by ectopically expressed Agouti protein (A y mice), it is known that intact hypothalamic MC- 4R function is required for regulation of normal body weight, confirming that loss of function mutations of the human MC4-R yields an obese phenotype.
  • pathophysiological relevance of differentially expressed gene products is studied in human sufferers of specific diseases. Because patho- physiologically relevant gene products represent practically all types of pep- tides and proteins and direct or indirect products hereof, a broad spectrum of diagnostic tools should be employed to assess altered levels of the gene products. Thus, sputum, urine, stools, blood, plasma, cerebrospinal fluid as well as specific tissue biopsies constitute possible relevant samples from dis- ease-affected humans.
  • DMHc compact part of DMH
  • the DMH is known to be involved in the regulation of body weight in mammals and is a good target for the demonstration of this technique because a number of genes are known to be expressed specifically in this hypothalamic nucleus and thus, the success of this experiment can be readily assessed.
  • Genes previously described to be differentially expressed in this subregion were identified based on "trial and error" experiments where specific genes suspected to be differentially expressed were confirmed or denied as being differentially expressed using techniques such as in situ hybridization, real-time PCR, and Northern blot- ting.
  • the first tissue sample was DMHc and the second tissue sample was a cerebral cortex subregion. Both samples were excised and isolated from Nissl stained 12 micrometer thick frontal brain sections of normal Sprague- Dawley rats.
  • cDNAs sized up to at least 14 kb can be generated from laser dissected brain nuclei.
  • the cDNA is efficiently amplified from the minute amounts of RNA present in such samples.
  • One microgram of amplified cDNA from each area was used for cDNA subtraction [Jiang et al., 2000] using the cDNA from DMHc as the tester and the cDNA from the cerebral cortex subregion (CTX) as the driver.
  • This method leads to the insertion of differentially expressed genes in a plasmid vector of choice and a number of clones encoding differentially expressed genes were thus isolated.
  • the clones isolated were subsequently subjected to Reverse Northern blotting.
  • the inserts from approximately 90 clones were amplified by PCR and spotted on a nylon membrane.
  • SMART amplified cDNA from DMHc and CTX, respectively were labelled with 32 P and hybridised to the insert DNA on the membrane in two separate experiments ( Figure 5).
  • Figure 5 Compared with the ⁇ - actin standard, most of the clones obtained are labelled more with the amplified cDNA from DMHc than with the amplified cDNA from CTX, indicating that DMHc specific clones were indeed selectively captured by the present method.
  • Other methods of confirming a differential pattern of expression include microarrays (preferred), so-called virtual Northern blotting where ampli- fied cDNA is run on a gel and tested with gene-specific probes, and real-time PCR.
  • ESTs expressed sequence tags
  • sequences encoding these genes were previously reported from rat and, perhaps more importantly, no homologous genes are present in public databases with mouse and human EST and annotated gene sequences. This clearly illustrates the potential of the present invention for the specific identification of novel genes with specific expression within a hypothalamic subregion.
  • the expression patterns of several novel genes isolated by cDNA subtraction between DMHc and CTX as described above were further examined by in situ hybridisation (figure 7). These genes were confirmed to be expressed in the DMH and, for some genes also PVN and ARC, whereas no or at least weaker expression was detected in CTX. Importantly, the level of expression of some of these genes is quite low, also in their confined areas of expres- sion, demonstrating the ability of this invention for the identification/cloning of sparsely expressed genes.
  • the present invention provides a method for the isolation/identification of genes with expression confined to one or more hypothalamic subregions.
  • the present invention provides methods for the identification of genes involved in disease by the harvesting of identical hypothalamic subre- gions from two animals, one of these being a model animal for a disease. Subsequent amplification of cDNA and comparison of gene expression in the amplified cDNA from these hypothalamic subregions by subtraction or RNA profiling methods will yield a number of expressed gene tags that are obvious drug targets.
  • SuperFrost Plus slides (Menzel, Germany) were coated with pieces of Pen- Foil (PALM, Microlaser Technologies, Germany). Twelve micron sections of rat brain were cut on a cryostat and mounted on the coated slides. The slides were frozen at -20 degrees Celsius, transferred to -20 degrees ethanol (70% W/v) and fixed for 5 minutes. The slides were then frozen at -80 degrees Celsius, and counterstained in Thionein (on ice) using the following approximate time schedule: 70 % EtOH, 1 min.; 50 % EtOH, 1 min.; 0.1 % Thionein in 200 mM sodium acetate pH 4.0, 3.5 min.; 50% EtOH, 1 min.; 70% EtOH, 1 min.; 96% EtOH, 1 min.
  • the sections were air dried briefly and rapidly frozen at -80 °C. On the day of Laser Capture Microdissection, the slides were thawed and the PenFoil membrane gently released from the slide, turned up side down and re-glued with nail polish to a thin glass cover slip (0.17 mm thick).
  • the slides were microdissected on a P.A.L.M. laser microdissection system (PALM, Microlaser Technologies, Germany) where the central compact sub- nucleus of the DMH (DMHc, first tissue sample) and a cerebral cortex subregion (CTX, second tissue sample) were identified.
  • DMHc was identified as a densely packed group of neurons in Nissl stained sections (see e.g. Figure 1 and 2).
  • the cortical sample was taken from the piriform cortex at the same rostrocaudal level as the DMHc sample.
  • Samples were dissected with the dissection microscope using a computer assisted or manual microma- nipulator and the samples were transferred to an eppendorf tube using either manual or automated systems (laser blast, gravity or adherent films). Unilat- eral or bilateral samples of the specified hypothalamic subregions were gathered in sample tubes, one for each region, and kept at -80 C until further use.
  • RNA samples were stored at room temperature for 5-10 min and centrifuged at least 12,000 g for 8 min at 4-25 °C. The supernatants were removed and the pellet washed with 0.5 ml 75% ethanol, air dried, and dissolved in 4 ⁇ l RNase free water. For each sample, one microliter of the isolated RNA was used for fluorescence-based concentration measurement. (Ribogreen kit, Molecular Probes, R-11490).
  • RNA/cDNA Inspector Kit manual Sigma, INSP-1
  • primers specific for rat genes only.
  • the primary feature of this procedure is the ability to test for the presence of intact cDNA sized up to 14 kb by the amplification of small fragments in the 15 kb long p619 cDNA using the following primers:
  • p619 Set A, pos. 12984 to 13892, SEQ ID NO 12: GGC AGT TGG AGC TGA ACA CA and SEQ ID NO 13: TGG AGG TCC AGA GGC TTC TT.
  • GAPDH Set G, pos 503 to 856, SEQ ID NO 24: TGC ATC CTG CAC CAC CAA CT and SEQ ID NO 25: CGC CTG CTT CAC CAC CTT C.
  • RNA isolated from DMHc and the CTX was reverse transcribed and subjected to PCR with the primers described above.
  • the presence of PCR- products in all the lanes indicates that undegraded RNA was iso- lated from the micodissected hypothalamic subregions.
  • Similar results were obtained using the globally amplified cDNA as a template (data not shown), indicating that the SMART cDNA synthesis and amplification was successful.
  • cDNA was synthesized and amplified by using a modified SMART kit (Clon- tech PT3041 -1 ) as outlined below:
  • RNA sample Three ⁇ l RNA sample were mixed with 1 ⁇ l cDNA synthesis (CDS) primer (10 pmol/ ⁇ l) and 1 ⁇ l SMART II oligonucleotide (10 pmol/ ⁇ l). The mixture was incubated at 70 °C for 2 min. The following was thereafter added to each tube: 2 ⁇ l 5X First-Strand Buffer (250 mM Tris-HCL pH 8.3, 375 mM KCI, 30 mM MgCI 2 ), 1 ⁇ l DTT (20 mM), 1 ⁇ l dNTP (10 mM), 0.5 ⁇ l RNAsin (Promega N2515, 20-40 u/ ⁇ l), and 0.5 ⁇ l Powerscript reverse transcriptase. The tubes were incubated at 42 °C for 1 hr in an air incubator and placed on ice. Amplification of cDNA
  • the cDNA was amplified using the Expand High fidelity PCR system (Roche 1 732 641 ): To each tube was added: 35.4 ⁇ l H 2 O, 1.6 ⁇ l 12.5 mM dNTP, and 3 ⁇ l cDNA-PCR primer. A cycle premix was made of: 34.9 ⁇ l H 2 0, 10 ⁇ l 10X Expand high fidelity PCR buffer without MgCI 2 , 3.6 ⁇ l 25 mM MgCI 2 , 1 5 ⁇ l Enzyme mix. The cycle premix was added to the cDNA and the tube subjected to cycling following the program described below: 95 degrees 1 min. (1 cycle), 94 degrees 15 seconds, 65 degrees 30 seconds, 68 degrees 10 minutes (12 cycles).
  • a second amplification was made by preparing mixtures A and B on ice.
  • A 35.4 ⁇ l H 2 0, 1.6 ⁇ l 12.5 mM dNTP, 10 ⁇ l of the cDNA from the first amplification, 3 ⁇ l cDNA-PCR primer.
  • B 33.1 ⁇ l H 2 0, 10 ⁇ l 10X Expand high fidelity PCR buffer without MgCI 2 , 5.4 ⁇ l 25 mM MgCI 2 , 1.5 ⁇ l En- zyme mix.
  • a and B were mixed and the tube subjected to cycling following the program described above with at total cycle number of 18. Five ⁇ l samples were transferred to eppendorf tubes after 4, 6, 8, 10, 12, 14, 16, 18, and 20 cycles, respectively, and run on a 1.2% agarose gel.
  • the optimal number of cycles was determined as described in the SMART manual (the optimal number of cycles is the number of cycles where the amount of PCR-products is not reaching saturation) and the remaining cDNA from the first amplification subjected to cycling in nine separate reactions as described above using this optimal cycle number.
  • PCR products were pooled and purified using a Centricon YM50 column (Millipore 4224) as described by the manufacturer. Expected yield was approximately 20 ⁇ g.
  • the filter was hybridised with 50 ng of the amplified cDNA (a mixture where half was cut with Bsp 1431 and the other half with EcoRII) from DMHc and CTX, respectively, and labelled with 32-P (Sigma, Random-primed labelling mix, R7522) using a Super HYB kit (Molecular Research Center, SK116) as described in the manual except that the last two washes were at 50 degrees Celsius to reduce cross hybridisation.
  • Template preparation and in vitro transcription were prepared by PCR using the bacterial stocks directly as templates and the primers 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO 26) and 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO 27). The products were subsequently purified by the High Pure PCR purification kit (Roche, 1732676) and analyzed on agarose gels before use.
  • cDNA probes were prepared as follows: 1x transcription buffer, 10mM DTT, RNase inhibitor (Promega, N2515, 0.5U/ ⁇ l), CTP/ATP/GTP mix (1 mM ), S35- alpha-UTP or P33-alpha-UTP (Amersham Pharmacia), template (25 ng per 100 basepairs) and polymerase (T3 or T7, 40U) were mixed and incubated in a total volume of 25 ⁇ l for 2 hours at 37°C. Subsequently, DNA was digested by the addition of 1 ⁇ l RQ1 Dnase (Promega, M6101 ), 2 ⁇ l yeast tRNA and 1 ⁇ l RNase inhibitor (20-40 U/ ⁇ l).
  • the transcripts were purified using Micro- Biospin 30 columns (Qiagen) followed by precipitation in 2.0 M ammonium acetate and ethanol.
  • the transcripts were diluted in a 1 :1 mixture of 100% deionized formamide and Tris (10 mM) EDTA (1 mM)-DTT (10 mM) buffer (pH 7.5).
  • the specific activity of the generated transcripts was determined using a beta-counter.
  • the radioactively labeled probe was incubated for 3 min at 80°C (denaturation) and mixed with hybridization buffer.
  • the hybridization buffer comprised 50% deionised formamide, 1X SALTS (300 mM NaCI , 10 mM Tris, 10 mM NaPO4 (pH 6.8), 5 mM EDTA, 0.02% Ficoll 400, 0.2% polyvinylpyrolidone (PVP-40, 40000 MW), 0.2% BSA Frac- tion V), 10% dextran sulphate, 1 ⁇ g/ ⁇ l yeast tRNA and 9 mM DTT. Probe was added so that the final activity of the hybridization mix is approximately 15.000 cpm/ ⁇ l. The hybridization mix was applied onto the sections (35 ⁇ l/section) and the sections were cover-slipped. Hybridization was performed overnight at 47°C and the slides were washed the next day in two stringency washes at 62 and 67°C.
  • the sections were washed for 1 hour at each temperature (lowest first) in a washing buffer comprising 50% formamide, 1 x SALTS and 10mM DTT.
  • the sections were rinsed twice (2 x 2 min) in NTE buffer (0,5 M NaCI, 10 mM Tris-CI (pH 7,2), 1 mM EDTA) containing 10 mM DTT, and RNAse A treated (20 ⁇ g/ml; Boehringer-Mannheim) for 30 min.
  • Fresh tissue (hypothalamus, cerebellum, cerebrum, heart, liver, pancreas, fat, skeletal muscle, kidney, spleen, intestine, colon, and lung) is isolated from Sprague-Dawley rats and immediately submerged in RNAIater (Ambion, Texas, U.S.A.). Total RNA is extracted from the tissue using RNeasy spin columns (QIAGEN Inc., California, USA), following the manufacturer's instructions. First-strand cDNA is prepared using 1 ⁇ g total RNA, the Superscript RT kit, and random hexamer primers (GIBCO BRL, Gaithersburg, Maryland, USA), according to the manufacturer's instructions.
  • the cDNA is diluted 1 :6 in distilled water, and PCR is carried out using 3 ⁇ L of the diluted cDNA and a PCR mix containing Biotaq DNA polymerase (2.5 U) and buffer (Bioline Ltd, London, UK ), 1.5 mM MgCI 2 , dNTP mix (final concentrations of 60 ⁇ M of each dNTP, except dCTP, which is present at 30 ⁇ M [Sigma, St. Louis, U.S.A.]), and 1.25 ⁇ Ci of [o-33P]-dCTP (2,000 Ci/mmol; Hartmann Analytic, Germany) in a 25 ⁇ L reaction volume, using a protocol provided by Promega.
  • Two primer sets (5 pmol of each primer) are included in each reaction, 1 set specific for the hypothalamic gene identified as described above, the second set specific for an internal standard.
  • the internal standard could be any of a number of housekeeping genes including but not limited to elongation factor- 1 (EF-1cv), TATA box binding protein (TBP), beta-actin etc.
  • the primers are chosen so the final products are in the range of approximately 150 to 300 bp.
  • the PCR conditions are an initial incubation at 95°C for 2 minutes. This is followed by a number of cycles of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 45 seconds.
  • the number of cycles is chosen in the range where the limiting factor for the amount of product is the amount of input template cDNA, normally 18 to 25 cycles, the exact number depending on the expression of the gene examined and the efficiency of the PCR.
  • the final PCR re- actions are mixed with 98% formamide denaturing loading buffer and separated on a 6% (wt/vol) polyacrylamide gel, containing 7 M urea. The gel is subsequently dried, exposed to a phosphorimager screen, and the resulting scan analyzed using ImageQuant (Amersham Biosciences, Sweden).
  • Polypeptide sequences predicted from the sequences of ESTs and/or predicted genes overlapping the clones found in subtraction experiments can be analyzed using a plethora of programs. Most of these programs use evolutionary conserved domains for functional predictions.
  • One example of such programs is the Panal program (http://mgd.ahc.umn.edu/panal/run_panal.html), which makes a simultaneous search on the input polypeptide sequence using the SMART, TIGRFAM, Prosite, BLOCKS, prints, and pfam conserved sequence signature databases for finding conserved sequence motifs that are indicative of polypeptide function.
  • the probability of a polypeptide for being secreted is of special interest when searching for new neuropeptides, and can be examined using the programs SignalP and TargetP.
  • the SignalP http://www.cbs.dtu.dk/services/SignalP- 2.0/, [Nielsen et al., 1997]
  • Method incorporates a prediction of cleavage sites and a signal peptide/non-signal peptide prediction based on a combination of several artificial neural networks and hidden Markov models
  • TargetP http://www.cbs.dtu.dk/services/TargetP/, [Emanuelsson et al., 2000] predicts the subcellular location of eukaryotic protein sequences.
  • the subcel- lular location assignment is based on the predicted presence of any of the N- terminal presequences chloroplast transit peptide (cTP), mitochondrial targeting peptide (mTP) or secretory pathway signal peptide (SP).
  • the Mm.141526 mouse peptide has the following sequence:
  • the 14-3-3 eta protein is an activator protein for tyrosin and tryptophan hy- droxylases (rate-limiting enzymes in catecholamine and serotonin biosynthe- sis) but is also a multifunctional regulatory protein in mechanisms in signal transduction and phosphorylation
  • G protein Signaling RGS7 RGS proteins facih- tate the conversion of G-protein bound GTP to GDP by accelerating the inac- tivation of GTP-bound Galpha.
  • the polypeptide sequence contains a leucine zipper motif and might therefore encode a transcription factor.
  • Se- lenoprotein M (SelM) because it contains a selenocysteine amino acid residue [Korotkov et al., 2002].
  • SelM harbors characteristics of neuropeptides such as presence of a peptidase cleavage site (RPDWN) and a signal peptide. The protein seems to be localized in the endoplasmic reticulum and the Golgi system.
  • a mouse homologue of this gene has previously been identified (Unigene Mm.12787) and a leucine zipper motif indicates that the protein might be a transcription factor.
  • Necdin cDNA Unigene Mm. 7089.
  • Necdin is one of several genes deleted in the Prader-Willi syndrome, a syndrome characterized by mental retardation, decreased muscle tone, short stature, emotional lability, and an insatiable appetite, which can lead to life- threatening obesity.
  • Necdin polypeptide has been shown to have a plethora of functions and interaction partners and has a proposed role in cell cycle, apoptosis, and signal transduction.
  • In situ hybridization signal from necdin is seen in PVN, Ret- rochiasmatic area and in the DMHc (compact part) as well as in the VMH and the arcuate nucleus.
  • panel P1 G1 expression in cor- tex is low
  • Other areas expressing Necdin includes the hippocampus (CA1 , CA2 and CA3), thalamus, amygdala and pi ⁇ form cortex
  • necdin is regulated upon fasting in fatty Zucker (fa/fa) rats (figure 8), indicating a role of necdin in metabolic regulation
  • the translated cDNA has a low degree of homology (-40%) to SH3B_Mouse SH3 domain-binding glutamic acid rich protein, which shows a significant similarity to Glutaredoxin 1 (GRX1 ) of Es- cherichia coli and is predicted to belong to the thioredoxin superfamily. In situ hybridization studies showed hypothalamic expression of this gene (data not shown).
  • the DIO (Diet Induced Obesity) /DR (Diet Resistant) rat model of obesity has been established as two outbred Sprague-Dawley rat strains exhibiting dif- ferent sensitivity to a high energy diet.
  • the DIO rats become obese when fed a high energy diet as compared to chow-fed controls, whereas the DR rats gain no more weight when fed the high energy diet than the controls and thus are resistant to the high energy diet [Levin and Dunn-Meynell, 2002; Levin et al., 1997; Levin and Keesey, 1998].
  • This rat model has a number of traits in common with human obesity such as the polygenetic inheritance and the status of a number of metabolic parameters.
  • hypothalamic nuclei A number of hypothalamic nuclei are implicated in the regulation of appetite and energy expenditure, and the DMH has been implied as a key player in the setting and maintenance of the body weight set point, (see [Behaps and Bellinger, 1998] for a review).
  • the present invention can be used to identify genes in the DMH and other hypothalamic nuclei with a differentially regulated expression in DIO vs DR rats.
  • the difference in gene expression in the hypothalamic nuclei of the DIO and DR rats may be constitutive and/or induced by a number of conditions, and therefore, the search for differentially expressed genes may be performed on animals subjected to a number of different feeding paradigms.
  • These feeding paradigms could include but are not limited to:
  • genes differentially expressed a priori in DR and DIO rats are described below.
  • the genes identified in this experiment are differentially expressed in DR and DIO rats fed on chow diet and may represent genes whose differential expression confers different sensitivity to high energy diets.
  • the feeding paradigms described above constitute examples of physiological parameters that can be explored in the DR/DIO or other animal model settings.
  • DIO and DR rats fed a standard chow are decapitated at 10 weeks of age, the brains quickly removed and frozen in 2-methyl butane cooled with dry ice. Then, laser dissection, RNA isolation, cDNA preparation and amplification is performed as described above. Subtraction is subsequently performed in two separate reactions, using the DIO and DR cDNA as tester and driver, respectively in the first reaction and using the DR and DIO cDNA as tester and driver, respectively in the second reaction. Subsequently, a number of clones are isolated. The genes are identified by sequencing and the expression dif- ferences validated by Reverse Northern blotting and in situ hybridizations as described above.
  • the RACE technology requires the setup of two independent reactions, a 5'-RACE, where the 5'-end of the cDNA is amplified by PCR and cloned, and a 3'-RACE, where the 3'-end of the cDNA is amplified and cloned.
  • GSPs Gene specific primers
  • the results of the in situ hybridization experiments are used to determine the direction of the primers for use in 5'-RACE (GSP1 ) and 3'-RACE (GSP2), respectively.
  • the methods used for the RACE cloning of cDNA are adapted from the SMARTTM RACE cDNA amplification kit (Clontech).
  • first-strand buffer 250 mM Tris-HCI (pH 8.3), 375 mM KCI, 30 mM MgCI 2
  • 1 ⁇ l 20 mM DTT 1 ⁇ l 10 mM dNTP
  • 1 ⁇ l Powerscript reverse transcriptase is added and the tube is incubated at 42°C for 90 min- utes.
  • the cDNA is diluted with 100 ⁇ l of 10 mM Tricine-KOH (pH 8.5), 1 mM EDTA and heated to 72°C for 7 minutes.
  • cDNA (2.5 ⁇ l) is mixed with 5 ⁇ l of universal primer mix (0.4 ⁇ M of 5'- CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT; SEQ ID NO 30) and 2 ⁇ M of 5'-CTAATACGACTCACTATAGGGC-3'; SEQ ID NO 31 ), 1 ⁇ l of gene specific primer (10 ⁇ M), 34.5 ⁇ l water, 5 ⁇ l 10X Advantage 2 PCR buffer, 1 ⁇ l 10 mM dNTP mix (10 mM), and 1 ⁇ l 50 X advantage 2 po- lymerase mix.
  • the tube is subjected cycling with the following program: 5 cycles of 94°C for 5 sec, 72 °C for 3 min. 5 cycles of 94°C for 5 sec, 70°C for 10 sec, and 72°C for 3 min. 25 cycles of 94°C for 5 sec, 68°C for 10 sec, and 72°C for 3 min.
  • the conditions of the PCRs are individually optimized for each different cDNA to assure that the highest possible amount of specific fragment is obtained.
  • the tube is incubated at 70 °C for 2 minutes and placed on ice for 2 min.
  • first-strand buffer 250 mM Tris-HCI (pH 8.3), 375 mM KCI, 30 mM MgCI 2
  • 1 ⁇ l 20 mM DTT 1 ⁇ l 10 mM dNTP
  • 1 ⁇ l Powerscript reverse transcriptase is added and the tubes are incubated at 42°C for 90 minutes.
  • the cDNA is diluted with 100 ⁇ l of 10 mM Tricine-KOH (pH 8.5), 1 mM EDTA and heated to 72°C for 7 minutes.
  • cDNA (2.5 ⁇ l) is mixed with 5 ⁇ l of universal primer mix (0.4 ⁇ M of 5'- CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT; SEQ ID NO 33 and 2 ⁇ M of 5'-CTAATACGACTCACTATAGGGC-3'; SEQ ID NO 34), 1 ⁇ l of gene specific primer (10 ⁇ M), 34.5 ⁇ l water, 5 ⁇ l 10X Advantage 2 PCR buffer, 1 ⁇ l 10 mM dNTP mix (10 mM), and 1 ⁇ l 50 X advantage 2 polymerase mix.
  • the tube is subjected cycling with the following program: 5 cycles of 94°C for 5 sec, 72 °C for 3 min. 5 cycles of 94°C for 5 sec, 70°C for 10 sec, and 72°C for 3 min. 25 cycles of 94°C for 5 sec, 68°C for 10 sec, and 72°C for 3 min.
  • PCRs number of cycles, annealing temperature, extension time, buffer composition, and polymerase
  • the products of the PCR reactions are ana- lyzed on agarose gels, cloned into TA-cloning type vectors and characterized by sequencing.
  • Gautvik KM de Lecea L, Gautvik VT, Danielson PE, Tranque P, Dopazo A, Bloom FE, Sutcliffe JG (1996): Overview of the most prevalent hypothala- mus-specific mRNAs, as identified by directional tag PCR subtraction. Proc Natl Acad Sci U S A 93:8733-8. Geeraedts LMG, Nieuwenhuys R, Veening JG (1990a): Medial forebrain bundle of the rat: III. Cytoarchitecture of the rostral (telencephalic) part of the medial forebrain bundle bed nucleus. J.Comp.Neurol. 294:507-536.
  • Muscatelli F Abrous DN, Massacrier A, Boccaccio I, Le Moal M, Cau P, Cremer H (2000): Disruption of the mouse Necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet 9:3101 -10. Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997): Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10:1-6.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
EP03740117A 2002-07-24 2003-07-23 Verfahren zur identifizierung von genen die im zusammenhang mit störung des central nerven systems stehen Withdrawn EP1523576A2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DKPA200201131 2002-07-24
DK200201131 2002-07-24
US39894202P 2002-07-25 2002-07-25
PCT/DK2003/000509 WO2004009842A2 (en) 2002-07-24 2003-07-23 Methods for identifying genes related to malfunctions of the central nervous system
US398942P 2010-07-02

Publications (1)

Publication Number Publication Date
EP1523576A2 true EP1523576A2 (de) 2005-04-20

Family

ID=30771914

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03740117A Withdrawn EP1523576A2 (de) 2002-07-24 2003-07-23 Verfahren zur identifizierung von genen die im zusammenhang mit störung des central nerven systems stehen

Country Status (3)

Country Link
EP (1) EP1523576A2 (de)
AU (1) AU2003281540A1 (de)
WO (1) WO2004009842A2 (de)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1824996A2 (de) * 2004-11-19 2007-08-29 Oy Jurilab Ltd Verfahren und kit zum nachweis der gefahr eines essentiellen arteriellen bluthochdrucks
CN105504873B (zh) * 2015-11-26 2017-10-10 龚林 用于神经组织尼氏体染色的染料组合物、染液及染色方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004009842A2 *

Also Published As

Publication number Publication date
WO2004009842A2 (en) 2004-01-29
AU2003281540A1 (en) 2004-02-09
WO2004009842A3 (en) 2004-03-18

Similar Documents

Publication Publication Date Title
US20210199660A1 (en) Biomarkers of breast cancer
US6673549B1 (en) Genes expressed in C3A liver cell cultures treated with steroids
US6727066B2 (en) Genes expressed in treated human C3A liver cell cultures
US20030190640A1 (en) Genes expressed in prostate cancer
US20020156263A1 (en) Genes expressed in breast cancer
KR101229402B1 (ko) 개 고관절 이형성증 조기 진단용 snp 및 이의 용도
Caqueret et al. Laminar organization of the early developing anterior hypothalamus
KR101157526B1 (ko) 주의력결핍 과잉행동장애의 진단용 snp와 그를 포함하는 마이크로어레이 및 키트
JP2011505579A (ja) 眼圧を変調し、ステロイドの応答者と非応答者とを鑑別するための分子標的
US20040018511A1 (en) Quantitative trait loci and somatostatin
EP0824597A1 (de) Testverfahren und methode zum transkriptnachweis
CN108841823A (zh) circRNA_26852及其应用
US20050130171A1 (en) Genes expressed in Alzheimer's disease
EP2216340A1 (de) Durch alternatives prozessieren hergestellte isoformen des humanen somatostatinrezeptors vom typ 5, und oligonukleotidpaare zu deren nachweis durch pcr
US8138123B2 (en) Gene expressing analysis tool
EP1523576A2 (de) Verfahren zur identifizierung von genen die im zusammenhang mit störung des central nerven systems stehen
CN1914336B (zh) 犬骨关节炎相关基因及相关的方法和组合物
US20050123966A1 (en) Diagnostic and prognostic methods and compositions for seizure- and plasticity-related disorders
Shiue Identification of candidate genes for drug discovery by differential display
WO2001072781A2 (en) Human genes and expression products
EP1522596A2 (de) Verfahren zur Analyse von Aktivierungswegen, die durch Neurotransmitter kontrolliert werden
KR101864331B1 (ko) 폐암 환자의 생존기간 예측용 키트와 생존기간 예측을 위한 정보 제공 방법
KR100908125B1 (ko) 심근 경색에 관련된 유전자 다형성 및 그의 용도
KR20050049891A (ko) 돼지의 성장단계별 근육특이유전자의 발현 프로파일의검색 및 이를 이용한 기능성 cDNA 칩
KR100790871B1 (ko) 심근 경색에 관련된 유전자 다형성 및 그의 용도

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050114

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20080201