EP1523333A2 - Utilisation du virus de la vaccine avec deletion du gene e3l en tant que vecteur de vaccin - Google Patents

Utilisation du virus de la vaccine avec deletion du gene e3l en tant que vecteur de vaccin

Info

Publication number
EP1523333A2
EP1523333A2 EP03765541A EP03765541A EP1523333A2 EP 1523333 A2 EP1523333 A2 EP 1523333A2 EP 03765541 A EP03765541 A EP 03765541A EP 03765541 A EP03765541 A EP 03765541A EP 1523333 A2 EP1523333 A2 EP 1523333A2
Authority
EP
European Patent Office
Prior art keywords
cells
gene
virus
vaccinia virus
vvδe3l
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03765541A
Other languages
German (de)
English (en)
Other versions
EP1523333A4 (fr
Inventor
Bertram Jacobs
Sangeetha Vijaysri
James Jancovich
Latha Talasela
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Arizona
Original Assignee
University of Arizona
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Arizona filed Critical University of Arizona
Publication of EP1523333A2 publication Critical patent/EP1523333A2/fr
Publication of EP1523333A4 publication Critical patent/EP1523333A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/275Poxviridae, e.g. avipoxvirus
    • A61K39/285Vaccinia virus or variola virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to vaccines having an increased level of safety comprising recombinant vaccinia viruses containing an inactivated E3L region.
  • the invention further relates to methods for stimulating a protective immune response in an immunized host using the vaccines of the invention.
  • the invention is based on the discovery that vaccinia virus mutants having deletions in the E3L region exhibit dramatically reduced pathogenesis while remaining highly immunogenic.
  • the invention relates to modified recombinant vaccinia viruses engineered to express heterologous polypeptides and the use of such viruses in vaccines designed to stimulate a protective immune response against such polypeptides in a host.
  • BACKGROUND Vaccinia virus is a member of the poxvirus family of DNA viruses.
  • Vaccinia virus has been used successMly to immunize against smallpox, resulting in worldwide eradication of smallpox.
  • the use of vaccinia virus recombinants as expression vectors and particularly as vaccines and anticancer agents raises safety concerns associated with introducing live recombinant viruses into the environment.
  • Poxviruses including vaccinia virus are used extensively as expression vectors since the recombinant viruses are relatively easy to isolate, have a wide host range, and can accommodate large amounts of DNA.
  • the vaccinia virus genome contains nonessential regions into which exogenous DNA can be incorporated.
  • Exogenous DNA has been inserted into the vaccinia virus genome using well-known methods of homologous recombination.
  • the basic technique of inserting foreign genes into live infectious poxvirus involves recombination between pox DNA and homologous plasmid DNA bearing the gene of interest ⁇ see, for example, U.S. Patent No. 6,372,455).
  • DNA molecules e.g., plasmids, naked DNA, viral vectors, and poxviruses
  • plasmids plasmids, naked DNA, viral vectors, and poxviruses
  • the resulting recombinant vaccinia viruses are useM as vaccines and anticancer agents.
  • a critical objective in vector development is to create a so called "attenuated vector" for enhanced safety, so that the vector may be employed in an immunological or vaccine composition.
  • the recombinant virus must present the immunogen(s) in a manner that elicits a protective immune response in the vaccinated host but lacks any significant pathogenic properties.
  • Virulence of vaccinia virus recombinants in a variety of host systems has been attenuated by the deletion or inactivation of certain vaccinia virus genes that are nonessential for virus growth. Replication-competent strains of vaccinia virus currently used against smallpox are interferon-resistant (Thacore and Younger, 1973, Virology 56:505-11).
  • Type I interferons are induced upon viral infection and constitute an integral part of the host cell's antiviral response (Samuel, 2001, Clin Microbiol Rev 14(4):778-809, table of contents).
  • Double-stranded RNA (dsRNA), which is produced during most viral infections, but otherwise absent from cells, is believed to directly activate human interferon regulatory factor 3 (IRF-3; from an inactive state), thereby triggering transcriptional activation of IFN (Wathelet et al, 1998, Mol Cell 1(4):507-18; Lin et al, 1998, Mol Cell Biol 19:2986-96; Sato et al, 1998, FEBSLett 452:112-16; Weaver et al, 1998, Mol Cell Biol 18:1359-68; Yoneyama et al, 1998, EMBOJ 17: 1087-95; (Nguyen et al, 1997, Cytokine Growth Factor Rev 8(4):293- 312).
  • IRF-3 human
  • the rate-limiting step in this process is C-terminal phosphorylation of IRF-3 by an uncharacterized virus activated kinase (VAK) activity (Servant et al, 2001, JBiol Chem 276(l):355-63).
  • VAK virus activated kinase
  • PKR dsRNA dependent enzymes
  • OFAS 2'-5' oligo adenylate synthetase
  • PKR is a protein kinase consisting of an amino-terminal dsRNA-binding domain and a carboxy-terminal catalytic domain and is activated by autophosphorylation in a process mediated by dsRNA (Bryan, 1999, Oncogene 18:6112-6120; Clemens and Ella, 1997, JInterferon CytokineRes 17(9) :503 -24).
  • PKR phosphorylates various substrates including the ⁇ subunit of protein synthesis initiation factor 2, eIF-2 ⁇ (Samuel, 1979, Proc Natl Acad Sci USA 76(2):600-4). Phosphorylation of eTF-2 ⁇ inhibits translation in general by impairing the eLF-2B-catalyzed guanine nucleotide exchange reaction (Clemens and Elia, 1997, JInterferon Cytokine Res 17(9): 503 -24). Thus, this inhibition blocks viral replication at the level of protein synthesis (Gale, 1998, Mol Cell Biol 18(2):859-71).
  • OAS Activated OAS polymerizes ATP to produce 2'-5' linked oligoadenylates (Rebouillat and Hovanessian, 1999, JInterferon Cytokine Res 19(4):295-308). These oligoadenylates subsequently activate a potent antiviral enzyme, RNase L, which cleaves single-stranded RNAs (Baglioni et al, 1979, Biochemistry 18(9), 1765-70; Silverman and Cirino, 1997, Gene Regulation (Morris, D.R., Hartford, J.B., eds), 295-309, John Wiley & Sons).
  • RNase L a potent antiviral enzyme
  • PKR and OAS activation result in an inhibition of viral, and at times, host protein synthesis (Jacobs and Langland, 1996, Virology 219(2):339-49).
  • Both PKR and OAS are targets of viral systems that attempt to defeat host cell resistance.
  • the vaccinia virus (VV) E3L and K3L gene products inhibit PKR (Clemens and Elia, 1997, JInterferon Cytokine Res 17(9):503- 24).
  • the viral E3L protein is a dsRNA-binding protein that blocks auto activation of PKR by sequestering dsRNA activators of PKR (Shors et al, 1997, Virology
  • E3L is a potent inhibitor not only of the PKR kinase, but also of OAS (Rivas et al, 1998, Virology 243(2):406-14).
  • the E3L gene encodes two related proteins, p20 and p25 (Chang et al, 1992, Proc Natl Acad Sci USA 89(11):4825-9; Yuwen et al, 1993, Virology 195(2):732-44).
  • VV E3L gene products consist of amino-terminal and carboxy- terminal domains, separated by a trypsin-sensitive spacer region (Ho and Shuman, 1996, Virology 217(l):272-84).
  • the C terminal domain contains one copy of a conserved dsRNA-binding motif and is required for dimerization of the protein. Mutational analysis demonstrates that the C-terminal domain is required for dsRNA binding and PKR inhibitory activity seen in VV infected cells (Chang and Jacobs, 1993, Virology 194(2): 537-47; Ho and Shuman, 1996, / Virol 70(4): 2611-4).
  • the N-terminal domain of E3L shares significant sequence homology with the eukaryotic RNA-editing enzyme ADARl, which catalyzes the deamination of adenosine residues that are present in dsRNA, or in secondary structures of predominantly ssRNA (Patterson et al, 1995, Virology 210(2):508 ⁇ 11).
  • ADARl eukaryotic RNA-editing enzyme
  • the amino- terminal 45% of EM, upstream of the dsRNA-binding domain is not essential for replication of vaccinia virus in several different cell lines in culture (Kibler et al, 1997, J Virol 71(3): 1992-2003; Shors et /., 1997, Virology 239(2):269-76).
  • E3L proteins The amino terminus of E3L proteins has also been reported to directly interact with the catalytic domain of PKR, suggesting that this interaction may be required for the function of E3L protein (Romano et al, 1998, Mol Cell Biol 18(12):7304-16).
  • the E3L gene products are the only VV gene products known to localize to both the nucleus and cytoplasm of infected cells (Yuwen et al, 1993, Virology 195(2):732-44; Chang et al, 1995, J Virol 69(10):6605-8). Sequences at the amino-terminus of E3L are necessary for accumulation of E3L products in the nucleus. These results suggest that cytoplasmic, but not nuclear, accumulation of the E3L gene products is required for efficient viral replication in cells in culture.
  • the E3L gene also confers a broad host range to VV enabling it to replicate in several cell types including HeLa, Vero and L cells (Chang et al, 1995, J tro/ 69(10):6605-8; Shors et ⁇ /., 1997, Virology 239(2):269-76). Deletion of the E3L gene from vaccinia virus produces a recombinant virus that is interferon- sensitive and highly debilitated for replication in cells in culture (Jacobs and
  • VV deleted of the E3L gene (VV ⁇ E3L) has a severely reduced host-range phenotype in that it does not replicate in human HeLa, and monkey kidney COS, CV-1, or BSC-40 cells, even in the absence of JEN treatment (Beattie et al, 1996, Virus Genes 12(1), 89-94).
  • Interferon sensitivity is exemplified by VV ⁇ E3L's sensitivity to pretreatment of rabbit kidney RK-13 cells with IFN- ⁇ and its inability to rescue Vesicular Stomatitis Virus from the effects of IFN (Shors et al, 1998, Virology 239(2):269-76).
  • VV ⁇ E3L infection induces apoptosis in HeLa cells in an JEN- independent manner (Lee and Esteban, 1994, Virology 199(2):491-6; Kibler et al, 1997, J Virol 71(3): 1992-2003). VV ⁇ E3L infection also induces apoptosis in JEN- treated RK-13 cells (Kibler et al, 1997, J Virol 71(3): 1992-2003).
  • recombinant vaccinia viruses in which the E3L gene is replaced by a gene encoding an E3L homolog from the orf virus, a poxvirus of the genus parapoxvirus that infects sheep, goats and humans, are immunogenic but have decreased pathogenicity in mice relative to wild-type vaccinia virus (U.S. Patent No. 6,372,455).
  • these recombinant viruses replicated to high titers in nasal tissues, but did not spread to the lung or brain and had reduced neurovirolence.
  • the iridoviruses are large DNA viruses that share many features of replication with the poxviruses, including cytoplasmic transcription and DNA synthesis (Jacobs, 2000, Translational control CH 35, 1-21 (CSHL Press)). They encode an eTF2 ⁇ homolog (Yu et al, 1999, Virus Res 63(l-2):53-63). Essbauer et al, 2001 have analyzed the eIF2 ⁇ of several iridoviruses offish and frogs ⁇ Virus Genes 23(3):347-59).
  • eIF2 homologous sequences of European catfish virus (ECV I-HI), European sheatfish virus (ESV), and frog virus-3 (FV-3) had a length of 780 nucleotides.
  • ECV I-HI European catfish virus
  • ESV European sheatfish virus
  • FV-3 frog virus-3
  • the iridoviral eJF2 ⁇ showed a significant homology to the N-termini of cellular initiation factor 2- ⁇ of various species and Ml-length poxviral K3L protein.
  • the eIF2 iridoviral protein had 37% identity with and 48% similarity to the N-terminus of human eIF2 ⁇ and 32% identity with and 48% similarity to the K3L protein of W.
  • the homology of poxviral and iridoviral proteins does not include 19 residues that flank serine phosphorylation site 51 and that are perfectly conserved from yeast to humans.
  • the pentapeptide KGYJD motif, which is important for the interaction of K3L of VV with the PKR is modified to KGYVD in all iridoviral eIF2 ⁇ amino acid sequences.
  • ranaviral eIF2 ⁇ Since the C-terminus of ranaviral eIF2 ⁇ reveals no homology to any known protein, it remains unclear whether a truncated form (N-terminal 100 amino acids) of the iridovirus protein could be functional and also why these polypeptides are longer than their poxviral homologs (Essbauer et al, 2001, Virus Genes 23(3):347-59). Thus, it is unclear whether the iridovirus homolog is acting as an eIF2 ⁇ kinase inhibitor, or given its large size, as an alternative eIF2 ⁇ -like translation initiation factor.
  • Ambystoma tigrinum virus is a member of the genus ranavirus in the family Iridoviridae, which was isolated from diseased tiger salamanders ⁇ Ambystoma tigrinum stebbinsi).
  • ATV genome sequencing has yielded the sequence of a gene with homology to the eukaryotic translation initiation factor, eIF2 ⁇ . The role of this gene, if any, in ATV's ability to suppress antiviral host cell responses had not previously been determined.
  • the present invention provides vaccines comprising a recombinant vaccinia virus from which the region encoding the E3L gene product has been inactivated and a suitable carrier.
  • the recombinant vaccinia virus of the invention may comprise exogenous DNA.
  • This exogenous DNA may encode a gene product.
  • a nonlimiting example of gene products that may be encoded is a polypeptide, e.g., an epitope to which a protective immune response is desired.
  • Another nonlimiting example of a gene product that may be encoded is a ribonucleic acid or polypeptide bearing some desirable property.
  • vectors having reduced pathogenicity while maintaining immunogenicity have been prepared.
  • Recombinant vaccinia viral vectors were prepared wherein the E3L gene was replaced by the eIF2 ⁇ gene from ATV.
  • the recombinant virus is interferon sensitive, but possesses a broad host range; is able to inhibit the PKR pathway but not the OAS pathway and JJRF-3 phosphorylation. Without being limited to any particular mechanism of action, these results indicate that the ATV eTF2 ⁇ homolog acts as a novel PKR inhibitor by causing proteolytic degradation of PKR and it provides the salamander virus, ATV, with a novel gene to counteract host defenses.
  • the compositions of the invention are useM for eliciting an immune response to smallpox virus and other molecules.
  • Figure 1 is a graph depicting survival of mice following intranasal injection with vaccinia virus.
  • Figure 2 is a graph depicting tissue distribution of vaccinia virus after intranasal injection.
  • Figure 3 is a graph depicting survival of mice following intracranial injection with various recombinant vaccinia viruses.
  • Figure 4 is a graph depicting survival of SCJX) mice following intranasal injection with vaccinia virus.
  • Figure 5 is a graph depicting weight change in vaccinated and unvaccinated mice after challenge with wild-type virus.
  • the vaccine comprised recombinant vaccinia virus wherein the E3L gene was replaced with a gene encoding ⁇ -galactosidase.
  • Figure 6 is a graph depicting virus replication in the nose of infected mice.
  • Figure 7 is a graph depicting weight change in vaccinated and unvaccinated mice after challenge with wild-type virus.
  • the vaccine comprised ultraviolet light-inactivated vaccinia virus.
  • Figure 8 is a graph depicting the survival of mice following intranasal injection with vaccinia virus.
  • Figure 9 Comparison of amino acid sequence of ATV eIF2 ⁇ (SEQ ID NO: 1
  • FIG. 10 interferon sensitivity assay.
  • Six well plates of RK-13 cells were treated with 0, 1, 10, 100 and 1000 units/ml of rabbit interferon 16 hours prior to infection.
  • Each well was infected with 200 pfu of wtVV, VVdelE3L or VVdelE3L/ATV eIF2 ⁇ and stained with 0.1% crystal violet in 20% ethanol 24 hours post infection.
  • the number of plaques formed in the presence of the various amounts of interferon were counted and compared to the number of plaques formed in the absence of interferon to determine the percentage of plaque reduction in the presence of interferon.
  • FIG. 11 [ 35 S] methionine labeling at 6 hpi in RK-13 cells.
  • RK-13 cells were infected at a moi of 5 in the presence or absence of 100 units/ml of rabbit interferon. Cells were starved for methionine by incubating them in media lacking methionine for 30 minutes. Cells were then labeled using media containing 50 ⁇ Ci/ml of [ 35 S] methionine for one hour. Cells were harvested as described in materials and methods and the proteins were separated on 12%) SDS-PAGE gel, stained and exposed to X-ray film. The arrows indicate viral proteins.
  • FIG 13 eLF2 ⁇ phosphorylation.
  • HeLa cells were mock infected or infected with wtVV, VV ⁇ E3L, or VV ⁇ E3L/ATV eTF2 ⁇ at a moi of 5 and harvested at 6 hpi.
  • Whole cell extracts were prepared as described in materials and methods. Extracts were run on SDS-PAGE gel, transferred to nitrocellulose, and assayed by chemiluminiscent western blot.
  • Antibodies to phosphorylated eIF2 ⁇ were used to detect the presence of phosphorylated eIF2 ⁇ .
  • Figure 14 Western blot analysis to determine the PKR activation.
  • HeLa cells were mock infected or infected with wtVV, VV ⁇ E3L, VV ⁇ 3L/ATV eTF2 ⁇ at a moi of 5 and harvested at 2, 4, and 6 hpi.
  • Whole cell extracts were prepared as described in materials and methods and were run on 10%> SDS-PAGE gel.
  • the proteins were transferred to nitrocellulose, probed with anti PKR antibody which recognizes both phosphorylated and unphosphorylated forms of PKR.
  • the blots were assayed by chemiluminiscense. Phosphorylated form of PKR runs little higher on the blot than the unphosphorylated form.
  • the arrows indicate PKR protein.
  • RNA degradation assay HeLa and S3 HeLa cells were mock infected or infected with wtVV, VV ⁇ E3L, VV ⁇ E3L/ATV eTF2 ⁇ at a moi of 5 and harvested at 18 hpi. RNA was extracted as described in materials and methods and fractionated on 1.8% formaldehyde-agarose gels and stained using ethidium bromide buffer. Stars indicate degraded RNA products.
  • FIG 16. Single step growth curve. HeLa cells were infected with wtVV, VV ⁇ E3L, or VV ⁇ 3L/ATV eTF2 ⁇ at a moi of 5 and harvested at 0 and 30 hpi. The cell pellet was freeze thawed to release the virus from the cells as described in materials and methods. The resultant virus was titered in RK-13 cells and plotted as above with the titer expressed as PFU/ml on the Y-axis and the virus on the X-axis. Figure 17. Multi-step growth curve.
  • HeLa cells were infected with wtVV, VV ⁇ E3L, VV ⁇ 3L/ATV eTF2 ⁇ at a moi of 0.01 and harvested at 0 and 72 hpi.
  • the cell pellet was freeze thawed to release the virus from the cells as described in materials and methods.
  • the resultant virus was titered in RK-13 cells and plotted as above with the virus titer expressed as PFU/ml on the Y-axis and the virus on the X- axis.
  • Figure 18 Rescue of VSV.
  • HeLa cells were mock treated or treated with cultured supernatant from the multi-step growth curve in the presence or absence of anti LFN- ⁇ antibody as described in material sand methods and infected with VSV 18 hours post treatment.
  • 24 hpi cells were stained with neutral red and the number of plaques of VSV were counted to test the ability of VSV to grow under the gien conditions and shown as replication of VSV in pfu's on
  • FIG. 19 IRF-3 phosphorylation.
  • HeLa cells were mock infected or infected with wtVV, VV ⁇ E3L, or VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5 and harvested at 6 hpi.
  • Nuclear extracts were prepared and run on a 10% SDS-PAGE gel, transferred onto nitrocellulose, and probed with anti-IRF-3 antibody. Blots were analyzed by chemiluminescence.
  • the present invention provides vaccines comprising a recombinant vaccinia virus from which the region encoding the E3L gene product has been inactivated.
  • inactivation may result from partial or complete deletion of the E3L region or, alternatively, substitution of nucleotides within the E3L region that result in inactivation of the E3L gene product.
  • the E3L gene product of the vaccinia virus is a 190 amino acid polypeptide.
  • the E3L gene codes for several functions including a dsRNA-binding protein, a Z-DNA-binding protein, and dimerization.
  • Amino acids 118-190 have been implicated in dsRNA binding, as disclosed by Chang and Jacobs (1993, Virology 194:537-547). Amino acid numbering as used herein is adopted from Goebel et al., 1990, Virology 179:247-66, 577-63.
  • deletion of the E3L gene and its grammatical equivalents refer to a vaccinia virus wherein a nucleic acid encoding all 190 amino acids or a subset of the 190 amino acids of E3L are not present.
  • the vaccinia virus having a deletion in the E3L gene has a residual nucleic acid encoding a subset of the 190 amino acids of E3L, said residual nucleic acid is incapable of producing a functional gene product or the gene product is incapable of binding dsRNA.
  • recombinant vaccinia virus refers to a vaccinia virus having a deletion or, alternatively, nucleotide substitutions in the E3L gene.
  • the term includes vaccinia virus wherein a heterologous nucleic acid is substituted for the E3L gene.
  • the present invention provides a viral vector that is a safe, effective vaccine for smallpox.
  • the present invention provides modified poxviruses in which genes that code for certain inhibitors have been substituted for the poxvirus E3L gene or that contain a modified version of the gene. These modified viruses have been found to replicate normally in cells, but display dramatically decreased pathogenesis. These viruses replicate to high titers in nasal tissues, but have a decreased propensity to spread to the lungs and brain and have decreased neurovirulence. These vectors can be used to protect against subsequent infection with vaccinia virus and, therefore, have utility in vaccination against various diseases including smallpox.
  • the invention further provides a safe replication-competent vector for expression of heterologous proteins.
  • the invention provides recombinant vaccinia viral vectors comprising the recombinant vaccinia virus described above and further containing exogenous, i.e., nonvaccinia virus, DNA.
  • Exogenous DNA may encode any desired product, including for example, an antigen, an anticancer agent, or a marker or reporter gene product.
  • the recombinant vaccinia virus may further have deletions or inactivations of nonessential virus-encoded gene functions. Nonessential gene functions are those which are not required for viral replication in a host cell.
  • the exogenous DNA is preferably operably linked to regulatory elements that control expression thereof.
  • the regulatory elements are preferably derived from vaccinia virus.
  • the present invention further provides a recombinant vaccinia virus, wherein the virus comprises a salamander ATV eLF2 ⁇ homolog. According to some nonlimiting embodiments of the invention, this virus lacks a portion of the E3L gene.
  • the invention provides, in some nonlimiting embodiments, a recombinant vaccinia virus in which a portion of the E3L gene is replaced with the eukaryotic initiation factor 2 ⁇ gene (eIF2 ⁇ ) of Ambystoma tigrinum virus (ATV).
  • eIF2 ⁇ eukaryotic initiation factor 2 ⁇ gene
  • ATV Ambystoma tigrinum virus
  • viruses may inhibit PKR by proteolytic degradation of PKR. Infection with this virus may lead to activation of IRF-3, which is a transcription factor responsible for the induction of IFN in virus infected cells. Thus, this virus may block the activity of PKR, but cannot block the induction of IFN. Subsequent IFN sensitivity of this virus may occur through alternative IFN-induced, antiviral activity, possibly involving OAS.
  • replacing the E3L gene of VV with the eIF2 ⁇ homolog partially restored the wild type phenotype to the recombinant virus.
  • the E3L gene of VV provides IFN resistance, a wide host range phenotype and inhibits apoptosis (Kibler et al., 1997, J Virol
  • recombinant viruses of the invention may resemble the wtVV in having a broad host range and in inhibiting PKR activity. At the same time recombinant viruses of the invention may also resemble VV ⁇ E3L in being IFN sensitive and leading to OAS activity and IRF-3 translocation to the nucleus.
  • the recombinant vaccinia virus of the present invention may be constructed by methods known in the art, and preferably by homologous recombination.
  • Standard homologous recombination techniques utilize transfection with DNA fragments or plasmids containing sequences homologous to viral DNA, and infection with wild-type or recombinant vaccinia virus, to achieve recombination in infected cells.
  • Conventional marker rescue techniques may be used to identify recombinant vaccinia virus.
  • Representative methods for production of recombinant vaccinia virus by homologous recombination are disclosed by Piccini et al., 1987, Methods in Enzymology 153:545.
  • the recombinant vaccinia virus of a preferred embodiment of the present invention may be constructed by infecting host cells with vaccinia virus from which the E3L gene has been deleted, and transfecting the host cells with a plasmid containing a nucleic acid encoding gene product of interest flanked by sequences homologous to the left and right arms that flank the vaccinia virus E3L gene.
  • the vaccinia virus used for preparing the recombinant vaccinia virus of the invention may be a naturally occurring or engineered strain. Strains useM as human and veterinary vaccines are particularly preferred and are well-known and commercially available.
  • Such strains include Wyeth, Lister, WR, and engineered deletion mutants of Copenhagen such as those disclosed in U.S. Patent 5,762,938.
  • Recombination plasmids may be made by standard methods known in the art.
  • the nucleic acid sequences of the vaccinia virus E3L gene and the left and right flanking arms are well-known in the art, and may be found for example, in Earl et al, 1993, in Genetic Maps: locus maps of complex genomes, O'Brien, ed., Cold Spring Harbor Laboratory Press, 1.157 and Goebel et al., 1990, supra.
  • the amino acid numbering used herein is adopted from Goebel et al., 1990, supra.
  • the vaccinia virus used for recombination may contain other deletions, inactivations, or exogenous DNA as described hereinabove. Following infection and transfection, recombinants can be identified by selection for the presence or absence of markers on the vaccinia virus and plasmid. Recombinant vaccinia virus may be extracted from the host cells by standard methods, for example by rounds of freezing and thawing. The resulting recombinant vaccinia virus may be further modified by homologous recombination to provide other deletions, inactivations, or to insert exogenous DNA.
  • the recombinant vaccinia viruses and compositions of the present invention may be used as expression vectors in vitro for the production of recombinant gene products, or as delivery systems for gene products, as human or veterinary vaccines, or anticancer agents.
  • Such utilities for recombinant vaccinia viruses are known in the art, and disclosed for example by Moss, 1996, "Poxviridae: The Viruses and Their Replication" in Virology, Fields et al., eds., Lippincott-Raven, Philadelphia, pp. 2637-2671.
  • the present invention further provides a method of making a recombinant gene product comprising subjecting a recombinant vaccinia viral vector having a deletion of the E3L gene and further comprising exogenous DNA that encodes the recombinant gene product operably linked to the control of regulatory elements that control expression thereof, to conditions whereby said recombinant gene product is expressed, and optionally recovering the recombinant gene product.
  • the recombinant gene product is an antigen that induces an antigenic and/or immunogenic response when the gene product or a vector that expresses it is administered to a mammal.
  • the present invention further provides vaccines for providing immunological protection against vaccinia virus, or heterologously expressed polypeptides, wherein said vaccines comprise a recombinant vaccinia viral vector and a carrier.
  • carrier as used herein includes any and all solvents, diluents, dispersion media, antibacterial and antifungal agents, microcapsules, liposomes, cationic lipid carriers, isotonic and absorption delaying agents, and the like. Suitable carriers are known to those of skill in the art.
  • the vaccine compositions of the invention can be prepared in liquid forms, lyophilized forms or aerosolized forms.
  • the vaccine may be formulated to contain other active ingredients and/or immunizing antigens.
  • Also included in the invention is a method of vaccinating a host, including but not limited to mammals such as a humans, against vaccinia virus infection or heterologously expressed proteins with the novel vaccine compositions of the invention.
  • the vaccine compositions including one or more of the recombinant vaccinia viruses described herein, are administered using routes typically used for immunization, i.e., subcutaneous, oral, or nasal administration, in a suitable dose.
  • the dosage regimen involved in the method for vaccination including the timing, number and amounts of booster vaccines, will be determined considering various hosts and environmental factors, e.g., the age of the patients, time of administration and the geographical location and environment.
  • Example 1 Construction of Recombinant Vaccinia Virus.
  • the ⁇ -galactosidase gene under the control of the vaccinia virus I l k promoter was cloned into PMPE3delGPT plasmid. This plasmid was used for in vivo recombination with the WR strain of vaccinia virus. Recombinants were isolated by three rounds of plaque purification on a monolayer of BHK-13 cells stained with X- Gal. Deletion of the E3L gene was confirmed by western blotting with E3L specific antibody. PMPE3LdelGPT plasmid, the process of in vivo recombination and isolation of recombinants have been previously described in Kibler et al. (1997, J Virol 71 (3): 1992-2003).
  • Example 2 Survival of Mice Following Mranasal Infection with Vaccinia Virus.
  • mice Groups of 5 C57BL/6 mice were infected with different doses of wild type (wt) vaccinia virus (VV) and W deleted for the E3L gene (VV ⁇ E3L), by intranasal route. There was 100% survival of mice infected with the highest dose (10 6 ) of the mutant virus while wtVV had an LD 50 or approximately 10 3 pfu. The mutant W construct was over 1000-fold less pathogenic than wtVV ( Figure 1).
  • wt wild type
  • VV ⁇ E3L E3L gene
  • Example 3 Tissue Distribution of Virus.
  • Groups of 3 C57BL/6 mice were infected with 10 6 plaque-forming units of wtVV and VV ⁇ E3L by intranasal route. Tissues were harvested, processed and titrated in RK-13 cell line. The figure represents the average titer per gram of tissue of the 3 mice infected with each virus. Wild type VV was detected in the nasal turbinates, lungs, and brain by 5 days post infection. VV ⁇ E3L was detected in the nasal turbinates, but they did not spread to the lung and brain. 4 of the 5 VV mutants replicated to high titers in the nose following infection ( Figure 2).
  • Example 4 Mracranial Infection of Mice with wtVV and VV ⁇ E3L.
  • mice Groups of 5 C57BL/6 mice were infected with different doses of wtW and VV ⁇ E3L by intracranial injection. The infected mice were observed for 2 weeks following infection and all mortalities were recorded. VV ⁇ E3L was greater than 4 logs less neurovirulent than wtVV ( Figure 3).
  • Example 5 Intranasal Mection of SCTD Mice with wtVV and VV ⁇ E3L.
  • mice Groups of 5 SCTD mice were infected intranasally with different doses of wtVV or with VV ⁇ E3L.
  • the LD 50 for wtVV was less than 100 pfu.
  • VV ⁇ E3L did not kill mice, even at the highest dose administered ( Figure 4).
  • Example 6 Resistance of VV ⁇ E3L- Vaccinated Mice. Groups of 5 C57BL/6 mice were immunized with different doses
  • Example 7 Virus Replication in the Nose of Infected Mice.
  • VV ⁇ E3L Low doses of VV ⁇ E3L (10, 100, and 1000 pfu) were administered by intranasal route to C57BL/6 mice.
  • the noses of 3 mice infected with each dose of each virus were harvested on post-infection days 2, 4, and 6.
  • the harvested tissues were processed and titrated in RK-13 cell line.
  • the average viral load in the nose of mice infected on each of those days is shown in Figure 6.
  • Example 8 Resistance of Mice Vaccinated with UV-Inactivated Virus. Groups of 5 C57BL/6 mice were immunized with different doses
  • mice Groups of 5 C57BL/6 mice were infected intranasally with 10 4 pfu of wtVV (approximately 1 LD 50 ). One day later animals were immunized with 10° pfu of VV ⁇ E3L. All unimmunized animals died, while animals immunized post- exposure with VV ⁇ E3L survived (Figure 8).
  • Example 10 Merferon Sensitivity Assay.
  • RK-13 cells were set down at 50% confhiency in 6 well plates. Four hours later the media overlaying the cells were replaced with media containing different doses of rabbit interferon (480 U/ ⁇ l, Lee Biomolecular) so that the final concentration of IFN ranged from 0 U/ml to 1000 U/ml of cell culture media. Sixteen hours following IFN treatment these cells were infected with 100 pfu of each virus. Wt VV was used as a positive control since it is resistant to the effects of IFN. VVdelE3L was used as a negative control. The infected cells were incubated at 37°C and 5% CO 2 for 36-48 hours following which they were stained with 0.1% crystal violet in 20% ethanol for 1 minute at room temperature. The plaques were counted in each well and plaque reduction with increasing doses of LFN was computed as a percentage.
  • rabbit interferon 480 U/ ⁇ l, Lee Biomolecular
  • VV ⁇ E3L was sensitive to IFN and unable to plaque in RK-13 cells pretreated with 100 and 1000 U/ml of rabbit IFN ⁇ . This virus was also unable to plaque in HeLa cells even in the absence of IFN treatment (Beattie E et al., 1996, Virus Genes 12(1), 89-94).
  • Rabbit kidney (RK-13) cells were maintained in Eagle's Minimal Essential Medium (Gibco BRL) supplemented with 5% fetal bovine serum (Irvine Scientific), 50 ⁇ g/ml gentamycin sulfate and 0.1 mM non-essential amino acids and vitamins (Gibco BRL).
  • Baby Hamster Kidney (BHK-21) cells were maintained in the same media containing the same amount of non-essential amino acids, vitamins and gentamycin but supplemented with 10% fetal bovine serum.
  • HeLa cells S3 HeLa cells from ATCC and S3 HeLa cells generously provided by Frederick
  • DMEM Dulbecco's Modified-Minimal Essential Medium
  • HeLa cells used in this study were S3 HeLa cells from Frederick. All cells were incubated at 37°C in the presence of 5% C0 2 .
  • the eIF2 ⁇ homolog gene was attained by PCR from the plasmid pSTBlue-1 (clone was kindly provided by James Jancovich), with primers containing a BamHI site at the 5 'end and a Sail at the 3' end of the gene (5' ATT AGG ATC CGC CAT GGC ACA CAA CAG GTT TTA CAG 3', SEQ ID NO:4; 5' ATT AGT CGA CAT ATC ACA CAA AGG GGC ACA GTC C 3', SEQ ID NO:5).
  • PCR products were gel extracted (Qiagen), purified and digested with BamHI and Sail, and ligated into pMPE3L ⁇ gptMCS digested with the same enzymes. Colonies were screened by restriction digests with BamHI and Sail and also by sequencing. Thus this ligation resulted in the formation of ⁇ MPE3L ⁇ g ⁇ tMCS-ATV eIF2 ⁇ .
  • Example 13 Transfection and In Vivo Recombination In vivo recombination (IVR) was performed as described by Kibler et al. (1997, J Virol 71(3):1992-2003).
  • the recombination vector ⁇ MPE3L ⁇ gptMCS has the E. coli gpt gene as a selectable marker and regions homologous to the flanking arms of the E3L gene in VV on either side of the multiple cloning site to facilitate recombination into the E3L locus.
  • Ecogpt is the E. coli guanosine phosphoribosyl transferase gene.
  • This gene allows conversion of xanthine to guanine monophosphate (GMP), without needing the intermediate steps of converting inosine monophosphate (IMP) to xanthine monophosphate (XMP), ultimately resulting in GMP.
  • GMP guanine monophosphate
  • IMP inosine monophosphate
  • XMP xanthine monophosphate
  • MPA mycophenolic acid
  • VV ⁇ E3L the virus used for recombining this gene into the E3L locus of VV, has a LacZ gene in place of E3L thus allowing for blue white selection of the recombinant virus using X-gal substrate at a final concentration of 200 ⁇ g/ml.
  • Subconfluent BHK cells were used for both transfection and in vivo recombination. Cells were set down in 35mm dishes and were pretreated for 30 minutes with 2ml of Opti-MEM (Gibco BRL) at 37°C.
  • the cells were fransfected with 1 ⁇ g of plasmid DNA using LipofectACE (Gibco BRL) as per manufacturer's instructions.
  • the cells were simultaneously infected with VV ⁇ E3L at a multiplicity of infection (moi) of 0.05, allowed to incubate for 1 hour, with rocking at 37°C, 5% CO 2 and overlaid with Opti-MEM containing 1% FBS.
  • moi multiplicity of infection
  • the cells were harvested , pelleted by centrifugation at 1000 rpm, 4°C for 10 minutes and resuspended in 200 ⁇ l of 1 mM Tris HCI pH 8.8. Cells were then subjected to three rounds of freezing and thawing in order to release the virus from the cells.
  • the resultant recombinant virus from above was used to infect 60 mm dishes of confluent BHK cells which had been pretreated for 6 hours prior to infection with ecogpt selection media (complete BHK media containing 10% FBS, 10 ⁇ g/ml MPA, 250 ⁇ g/ml xanthine and 15 ⁇ g/ml hypoxanthine).
  • ecogpt selection media complete BHK media containing 10% FBS, 10 ⁇ g/ml MPA, 250 ⁇ g/ml xanthine and 15 ⁇ g/ml hypoxanthine.
  • the infection was carried out for 1 hour and then overlaid with 5ml of ecogpt selection media.
  • the liquid overlay media was replaced with 1.5% agarose supplemented with complete 2X MEM media, 10 ⁇ g/ml MPA, 250 ⁇ g/ml xanthine, 15 ⁇ g/ml hypoxanthine and 200 ⁇ g/ml X-gal (Gold Biotechnology, Inc.). 6 hours later blue plaques were picked into 200 ⁇ l of 1 mM Tris HCI pH 8.8 and three rounds of freeze thaws were completed. This whole process was repeated three times in order to pick a purified blue plaque. After this selection, the removal of the ecogpt media causes a second recombination event to occur.
  • VV ⁇ E3L By removing the MPA selective pressure, VV ⁇ E3L either removes the lacZ gene in place of the E3L gene, keeping the ATV eTF2 ⁇ homolog gene or, it can remove the ATV eTF2 ⁇ homolog gene and retain the original lacZ in place.
  • Virus that has retained the lacZ gene will appear as blue plaques in the presence of X-gal, and viral plaques that have retained the ATV eIF2 ⁇ homolog gene will be clear or colorless.
  • the fourth round of plaquing was done in RK-13 cells in the absence of ecogpt selection media and when plaques were visible the cells were overlaid with 1.5% agarose, complete 2X MEM media and 0.2 mg/ml X-gal. Both clear and blue plaques were visible. 6 hours later the clear plaques were picked in 200 ⁇ l of 1 mM Tris HCI pH 8.8 and plaque purified for two more rounds when only clear plaques were visible.
  • Example 15 Amplification of Virus
  • BHK cells were set down in five 100 mm dishes with a confluency of 100%». Each dish was infected with a mixture of 40 ⁇ l of the viral plaque resuspended in 160 ⁇ l of IX MEM, 2% FBS and 50 ⁇ g/ml gentamycin sulfate. After one hour of infection at 37°C, 5% CO 2 cells were overlaid with complete BHK media. The infection was allowed to proceed to 100% cytopathic effect (CPE). Cells were then harvested and pelleted by centrifugation at 1000 rpm, 4°C, for 10 minutes.
  • CPE cytopathic effect
  • the supernatant was removed and the pellet was resuspended in 1 ml of IX MEM containing 2% FBS and 50 ⁇ g/ml gentamycin sulfate. Three rounds of freeze thaws were done to release the virus from the cells and the cells were centrifuged at 1000 rpm, 4°C, for 10 minutes to spin down the cell debris. Aliquots of 200 ⁇ l of the supernatant were transferred into cryogenic tubes and stored at -80°C.
  • Example 16 Calculating the Titer of the Virus RK- 13 cells were used to calculate the titer of the virus in plaque- forming units per ml (pfu/ml). Cells were set down at 100% in 6 well plates and infected with serial dilutions of the amplified virus. The dilutions ranged from 10 "3 to 10 "8 and each well of the plate was infected with 100 ⁇ l of each dilution. The infection was allowed to proceed until the plaques were visible. Cells were then stained with 0.1 % crystal violet in 20% ethanol. The number of plaques were counted in a well that has 30-300 plaques and the titer was determined by multiplying the number of plaques with the dilution factor.
  • 100 ⁇ l of ATV virus stock of 10 8 pfu/ml titer was used to extract DNA for viral PCR.
  • 100 ⁇ l of virus stock 100 ⁇ l of phenol was added and centrifuged at 10000 rpm for 5 minutes at 4°C.
  • the aqueous layer from this step was re-extracted with 50 ⁇ l phenol and 50 ⁇ l chloroform isoamyl alcohol (24:1) and centrifuged as above.
  • the aqueous layer from this step was again extracted with 100 ⁇ l chloroform isoamyl alcohol (24:1) and precipitated with 2.5 volumes of 100% ethanol and 1/10 volume of 3 M sodium acetate, pH 5.2.
  • the DNA was rinsed twice with 70% ethanol, dried and resuspended in 10 ⁇ l glass distilled water.
  • the ATV eTF2 ⁇ , gene was amplified from this viral DNA by PCR using primers that anneal to the flanking regions of the E3L gene (5' CGAACCACCAGAGGATG 3' (SEQ ID NO:6) and 5'
  • TAGTCGCGTTAATAGTACTAC 3' (SEQ ID NO:7)).
  • the amplified product was run on 0.8%> GTG agarose (FMC Bioproducts) gel and the band was cut out.
  • the DNA was extracted from the band of interest by first freezing the band overnight at - 80°C and then thawing it at 37°C for 30 minutes. The supernatant was separated by centrifugation at 4° C for 15 minutes at 10,000g and subjected to ethanol precipitation.
  • the DNA was resuspended in 10 ⁇ l of glass distilled water. 1 ⁇ l of each of the primers (10 ⁇ M stock) used for PCR was added to 5 ⁇ l of DNA and sequenced by Dideoxy method.
  • Example 18 Recombinant Vaccinia Virus Construction
  • the eIF2 ⁇ homolog from ATV has sequence homology to the eukaryotic translation initiation factor, eIF2 ⁇ and also to the K3L of vaccinia virus ( Figure 9).
  • eIF2 ⁇ homolog was inserted into the E3L locus of VV (VV ⁇ E3L/ATV eIF2 ⁇ ) utilizing in vivo recombination as described in Example 13.
  • viral DNA was extracted and amplified by PCR using E3L flanking primers.
  • a product of correct size (780 bp) was obtained indicating that eIF2 ⁇ homolog is in the E3L locus of VV.
  • the band of the amplified product was cut out from the gel, gel extracted, purified and the DNA was sequenced by dideoxy method.
  • RK-13 cells were seeded at 50%> confluency in 6 well plates. 4 hours later the wells were treated with 0, 1, 10, 100 and 1000 U/ml of rabbit interferon (Lee Biomolecular). 16 hours post interferon treatment, cells were infected with 200 pfu of wtVV, VV ⁇ E3L, and VV ⁇ E3L/ATV eIF2 ⁇ virus. Wild type vaccinia virus (wtVV) was used as a positive control as it is resistant to the effects of IFN and VV ⁇ E3L was used as a negative control as it is sensitive to TEN. The infected cells were incubated at 37°C, 5% CO 2 for 24 hours. Then they were stained with 0.1% crystal violet in 20% ethanol. The plaques were counted in each well and plaque reduction with increasing doses of LFN was computed as a percentage.
  • wtVV Wild type vaccinia virus
  • Wild type vaccinia virus (wtVV) is resistant to the antiviral effects of IFN and plaques in RK-13 cells pretreated with rabbit interferon up to 1000 units/ml. It has been shown that the N-terminal domain of E3L is necessary and sufficient for JEN resistance (Kibler et al, 1997, J Virol 71(3):1992-2003; Shors et al, 1997, Virology 239(2):269-76). VV ⁇ E3L is IFN sensitive (Shors et al, 1997, Virology 239(2):269-76) and is totally unable to replicate in the presence of 100 units/ml in RK-13 cells.
  • VV ⁇ E3L is IFN sensitive and is not able to grow in 100 units/ml of IFN.
  • the recombinant virus, VV ⁇ E3L/ATV eIF2 ⁇ is also LFN sensitive and doesn't grow in the presence of 100 units/ml of IFN.
  • HeLa cells and RK-13 cells (+/-IFN) were infected with 200 Pfu's of wt VV, VV ⁇ E3L, VV ⁇ E3L/ATV eLF2 ⁇ and 24 hours post infection plates were stained with 0.1% crystal violet in 20% ethanol and the number of plaques were counted and shown in the table above.
  • Example 20 Host Range wtVV has a broad host range and is able to form plaques in HeLa cells while VV ⁇ E3L is unable to replicate in HeLa cells, and therefore has a limited host range.
  • the ability of the recombinant virus (VV ⁇ E3L/ATV eIF2 ⁇ ) to plaque in HeLa and RK-13 cells was determined by infecting 6 well plates of these cell lines at 90% confluency. Cells were infected with serial dilutions of each of the viruses. In some assays, cells were infected with 200 pfu of the virus. wtVV and VV ⁇ E3L were used as positive and negative controls respectively. Infection was continued until the formation of visible plaques, following which cells were stained with 0.1% crystal violet in 20%) ethanol and the plaques were counted.
  • the recombinant virus was able to form plaques in RK-13 cells but unable to plaque in HeLa cells.
  • the plaquing efficiency in HeLa cells is shown in Table 1. Despite this, it has a broad host range as it replicates like wtVV in HeLa cells and is described in the next section.
  • PKR TFN-induced enzymes
  • OAS TFN-induced enzymes
  • 60 mm dishes containing confluent monolayers of RK-13 cells in the presence or absence of 100 U/ml of rabbit interferon and HeLa cells in the presence or absence of 100 U/ml of human ⁇ A/D interferon were mock infected or infected with wtVV, VV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5.
  • the infected cells were allowed to incubate for 5 hours and 30 minutes. Cells were washed twice with IX PBS and incubated for 30 minutes (at 37°C, 5% CO 2 ) in 2 ml labeling media (methionine-free, serum-free MEM (Sigma)) to starve the cells of methionine.
  • V V ⁇ E3L/AT V eIF2 ⁇ shows a shut-off of protein translation similar to VV ⁇ E3L at 6 hpi in RK-13 cells in the presence of IFN ( Figure 11, lanes 6 and 8) but no shut-off of protein translation similar to wtVV at 6 hpi in HeLa cells in the absence of LFN ( Figure 12, lanes 3 and 7).
  • the recombinant virus can replicate normally in HeLa cells but is not able to form plaques.
  • HeLa cells were seeded in 60 mm dishes and were mock infected or infected with wtVV, VV ⁇ E3L, VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5.
  • wtVV wtVV
  • VV ⁇ E3L VV ⁇ E3L/ATV eIF2 ⁇
  • hpi six hours post infection the cells were scraped into the medium and pelleted by centrifugation at 1000 rpm, 4°C, for 10 minutes. The supernatant was removed and the cell pellet was washed in 1 ml of IX PBS.
  • the infected cells were then lysed using 100 ⁇ l of PJPA buffer (1 X PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SIDS and 50 mM sodium fluoride), incubated on ice for 10 minutes and then centrifuged at 10,000g at 4°C for 10 minutes. 80 ⁇ l of the supernatant was transferred to a fresh micro fiige tube containing 80 ⁇ l of 2x SDS sample buffer and stored at — 80°C until use in western blot analysis. Cytoplasmic extracts from the above assay were subjected to SDS PAGE electrophoresis in a 12% polyacrylamide gel at 188 volts for 1 hour.
  • the proteins were transferred to nitrocellulose membrane (Osmonics) at 100 volts for 45 minutes in transfer buffer (10 mM CAPS, pH 11.0, 20% methanol, 14 mM ⁇ -ME).
  • transfer buffer 10 mM CAPS, pH 11.0, 20% methanol, 14 mM ⁇ -ME.
  • the nitrocellulose membrane was blocked for one hour in blotto with milk (20 mM Tris-HCI, pH 7.8, 180 mM NaCI, 3% carnation nonfat dry milk).
  • the blot was incubated overnight at 4°C with the primary antibody raised in rabbit (1 :500 dilution), which recognizes only the phosphorylated form of eIF2 (Research Genetics).
  • the primary antibodies were removed and the blot was washed 3 times with blotto containing milk for 1 hour at room temperature. Then the blot was probed with
  • HeLa cells were mock infected or infected with wtVV, VV ⁇ E3L, VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5. Cells were harvested at 6 hpi and the resulting total cell lysates were analyzed by chemiluminiscent western blot as described in Examples 1 and 23. eIF2 ⁇ was found to be phosphorylated in cells infected with VV ⁇ E3L but not with wtVV or VV ⁇ E3L/ATV eLF2 ⁇ ( Figure 13).
  • Virus infection leads to the production of dsRNA in the infected cell.
  • dsRNA is required for the activation of PKR which then becomes autophosphorylated and acts on its substrates.
  • PKR activation can be easily detected by looking for its phosphorylation using a chemiluminiscent western blot.
  • HeLa cells were seeded at 50% confluency in 60 mm dishes and mock infected or infected with wtVV, VV ⁇ E3L and VV ⁇ E3L/ATV elF2 ⁇ at a moi of 5.
  • Cells were harvested at 2, 4 and 6 hpi by scraping cells into the medium and pelleting by centrifugation at 1000 rpm, 4°C, for 10 minutes. The supernatant was removed and the cell pellet was washed in 1 ml of IX PBS.
  • the infected cells were then lysed using 100 ⁇ l of RIP A buffer (IX PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM sodium fluoride), incubated on ice for 10 minutes and then centrifuged at 10,000g at 4°C for 10 minutes. 80 ⁇ l of the supernatant was transferred to a fresh micro fuge tube containing 80 ⁇ l of 2x SDS sample buffer and stored at - 80°C until use in western blot analysis.
  • RIP A buffer IX PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM sodium fluoride
  • the same assay was also performed by treating cells with Cytosine ⁇ -D arabinofuranoside (AraC, Sigma, 5 mg/ml stock) to a final concentration of 40 ⁇ g/ml, one hour prior to the infection. Arac was also added to the inoculum and also to the medium used to overlay HeLa cells after infection, frifected cells were harvested 6 hpi and analyzed in the same way as described above.
  • Cytosine ⁇ -D arabinofuranoside AraC, Sigma, 5 mg/ml stock
  • Figure 14A shows the results of the assay.
  • Mock shows only non- phosphorylated form of PKR (lane 1 at all time points).
  • Infection with wtVV does not lead to the activation of PKR as E3L gene inhibits PKR activity by sequestering dsRNA and thus shows only the non-phosphorylated form (lane 2 at all time points).
  • Infection with VV ⁇ E3L leads to the activation of PKR as there is no E3L to bind and sequester dsRNA.
  • PKR is not activated at 2 hpi as it has only non-phosphorylated form (lane 3) whereas it gets activated by 4 hpi which is indicated by a shift in the phosphorylated band of PKR although the shift is more prominent at 6 hpi (lane 3).
  • infection with VV ⁇ E3L/ATV eTF2 ⁇ leads to the degradation of PKR by 4 hpi (lane 4), thus indicating that somehow the eIF2 homolog is acting as a PKR inhibitor.
  • HeLa cells were pretreated with AraC for one hour prior to infection. AraC inhibits DNA synthesis, thus blocking the formation of dsRNA at late times post infection.
  • the top layer was transferred to a sterile eppendorf tube and a 1 : 1 dilution of chloroform ⁇ soarnyl alcohol was added. The samples were again centrifuged and the top layer was transferred into a sterile eppendorf tube. The samples were then treated with 1/10 volume of DEPC treated 3 M sodium acetate, pH 5.0 and then 2.5 volumes of ethanol was added. The RNA was allowed to precipitate for 30 minutes at-80°C. The samples were centrifuged at 10,000 rpm, 4°C for 30 minutes to pellet the RNA. The RNA pellet was dried and resuspended in 20 ⁇ l of 0.5% SDS-DEPC water. For analysis, denatured RNA was fractionated on 1.8% formaldehyde-agarose gels and stained using ethidium bromide buffer.
  • RNA Equal amounts of RNA were fractionated in 1.8% agarose- formaldehyde gels as shown in Figure 15. No fragmentation of RNA was observed in mock or wtVV infected cells in either cell line, indicating that the 2-5A pathway is inhibited in wtVV infected cells (lanes 1 and 2). Infection with VV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ leads to the fragmentation of rRNA indicative of activation of the 2-5A pathway in both the cell lines (lanes 3 and 4), although the pathway is more active in S3 HeLa cells from ATCC.
  • HeLa cells Single step growth curves were performed in HeLa cells.
  • HeLa cells were seeded at 80%o confluency in 60 mm dishes and infected with wtW, NV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5. After one hour, the inoculum was removed by washing cells with IX PBS and overlaid with complete HeLa media.
  • Cells were harvested at 0 hpi and 30 hpi by scraping cells into the media and pelleting down by centrifugation at 1000 rpm, 4°C for 10 minutes. The pellet was resuspended in 200 ⁇ l of 1 mM Tris HCI, pH 8.8 and subjected to three rounds of freeze thaws. The resultant virus was titered in RK-13 cells.
  • VV ⁇ E3L did not replicate in HeLa cells in agreement with the results obtained under plaque assay conditions (Table 1).
  • VV ⁇ E3L/ATV eIF2 was able to replicate in HeLa cells almost to the same extent of wtVV, in contrast to the results obtained in the plaque assay (Table 1).
  • the recombinant virus was able to replicate normally in the infected cells. This led to assays to determine how the virus behaves under multi-cycle conditions, which reveal whether the virus is being released from the infected cell and whether it is spreading to the neighboring cells.
  • HeLa cells were seeded at 50% confluency in 60 mm dishes and infected with wtVV, VV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 0.01. After one hour, the inoculum was removed by washing cells with IX PBS and overlaid with complete HeLa media. Cells were harvested at 0 hpi and 72 hpi by scraping cells into the media and pelleting down by centrifugation at 1000 rpm, 4°C for 10 minutes. The supernatant was saved and the pellet was resuspended in 200 ⁇ l of 1 mM Tris HCI, pH 8.8 and subjected to three rounds of freeze thaws.
  • the resultant virus was titered in RK-13 cells. As shown in Figure 17, the recombinant virus was unable to grow as well as wtVV under multi-cycle conditions. The cultured supernatant from these infected cells was also tested for viral release from the infected cells and it has been found that the recombinant virus was getting released into the media from the infected cell (data not shown). Thus, productive secondary infections of the virus are somehow inhibited and, therefore, the virus is unable to plaque in HeLa cells (Table 1). This is probably due to the induction of IFN in the infected cell which is then secreted out into the media and is thus responsible for inhibiting productive secondary infections of the virus.
  • VSV Vesicular Stomatitis Virus
  • Sub confluent HeLa cells were mock treated or treated with the cultured supernatant from the above multi-step growth curve in the presence or absence of 3000 neutralization units of human anti IFN- ⁇ antibody (Calbiochem). 16 hours post treatment, cells were infected with 100 pfu of Vesicular Stomatitis Virus (VSV). After one hour the cells were overlaid with 1.5% agarose supplemented with complete 2X MEM media. 24 hours later cells were overlaid with 1.5% agarose supplemented with complete 2X MEM media containing neutral red solution (1.5 ml of a 3.33 g/L solution (GIBCO) per 50 ml of medium) and 6 hours later the number of plaques of VSV were counted.
  • VSV Vesicular Stomatitis Virus
  • TRF-3 is a transcription factor that is activated upon virus infection by phosphorylation (Lin et al, 1998, Mol Cell Biol 19:2986-96; Sato et al; 1998, FEBSLett 452:112-16; Weaver et al, 1998, Mol Cell Biol 18:1359-68; Yoneyama etal, 1998, EMBOJ 17: 1087-95), translocates to the nucleus (Sato et al, 1998, FEBSLett 452:112-16; Yoneyama et al, 1998, EMBOJ 17:1087-95) and leads to the induction of IFN- ⁇ and JFN- ⁇ genes (Juang et al., 1998, Proc Natl Acad Sci USA 95:9837-42; Sato et al, 1998, FEBSLett 452:112-16; Schafer et al, 1998, J
  • HeLa cells were seeded at 80% confluency in 100 mm dishes and infected with wtVV, VV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ at a moi of 5.
  • Cells were harvested at 6 hpi and nuclear extracts were prepared as described elsewhere (Servant et al, 2001, JBiol Chem 276(l):355-63). The extracts were then run on 10% SDS- PAGE gel, proteins were transferred onto the nitrocellulose membrane and probed with rabbit anti-IRF-3 antibody (kindly provided by Dr. Michael David, University of California at San Diego). The western blot was developed by chemiluminiscence.
  • IRF-3 was detected in the nucleus only in VV ⁇ E3L and VV ⁇ E3L/ATV eIF2 ⁇ infected cells but not in mock or wtVV infected cells ( Figure 19), indicating that the recombinant virus leads to the activation of TRF-3, which then subsequently translocates to the nucleus and leads to the induction of IFN- ⁇ .
  • Example 29 Weight loss on Challenging Mice Vaccinated with VV ⁇ E3L/ATV eIF2 ⁇
  • mice 4 male C57BL/6 mice were immunized with different doses (ranging from 2 to 5,000 plaque forming units) of recombinant vaccinia virus with ATV eIF2 ⁇ homolog in place of its E3L and with 1000 pfu's of VV ⁇ E3L.
  • doses ranging from 2 to 5,000 plaque forming units
  • ATV eIF2 ⁇ homolog in place of its E3L
  • VV ⁇ E3L 1000 pfu's of VV ⁇ E3L.
  • Weight loss was used as an indicator of disease due to wt VV. Severe weight loss was observed in the unimmunized control.
  • Example 30 Survival of Mice Following intranasal Infection with VV ⁇ E3L/ATV eIF2 ⁇ Four C57BL/6 mice were infected with each dilution of
  • Example 31 Similarity Between ATV eTF2 ⁇ and Vaccinia Viral E3L and K3L
  • the present invention relates, in part, to experiments directed to elucidating the role of the eJE2 homolog from ATV, a member of the genus Ranavirus, family Iridoviridae.
  • ATV a member of the genus Ranavirus
  • family Iridoviridae family Iridoviridae.
  • isolates exhibit a gene encoding a protein with homology to eukaryotic eIF-2 and the corresponding VV protein, K3L (Essbauer et al, 2001, Virus Genes 23(3):347-59).
  • eTF2 homolog from ATV has 35%o identity with and 55% similarity to the human eIF2 protein and 30% identity with and 51 % similarity to the K3L protein of vaccinia virus.
  • K3L of VV binds to PKR as a pseudosubstrate (Sharp et al, 1997, Eur J Biochem 250(1):85-91) and acts as an inhibitor of PKR. Since a high sequence similarity exists between K3L and eIF2 ⁇ homolog, the latter could potentially act as a PKR inhibitor.
  • VV is a useM recombinant vector as it is easy to delete and insert genes from its genome.
  • the E3L gene of VV confers the interferon resistance phenotype to the virus. So VV deleted of the E3L gene has turned out to be an excellent system for in vivo analysis of function of exogenous proteins (Jacobs et al, 1998, Methods: A comparison to methods in enzymology 15:225-232). Insertion of ATV eIF2 ⁇ homolog into the E3L locus of VV allows its ability to regulate the IFN response to be examined.
  • ATV eJE2 ⁇ is homologous to K3L of VV, it was the E3L gene of VV that was replaced with ATV eTF2 ⁇ homolog because the phenotypic characteristics of VV ⁇ E3L are more readily observable and allow examination the entire IFN response.
  • the results of this work established that the eIF2 ⁇ homolog from iridoviruses acts a novel inhibitor of PKR by leading to its proteolytic degradation.
  • PKR undergoes some conformational change upon interaction with dsRNA and this alteration in structure then enables a cellular protease to degrade the kinase or alternatively, the dsRNA and protease act in concert, possibly as a ribonucleoprotein complex, to proteolyze the kinase directly and completely.
  • the Ranaviruses with an eIF2 ⁇ homolog might regulate PKR by a similar mechanism.
  • FV-3 type species of the genus Ranavirus
  • phosphorylation of the ⁇ subunit of eIF2 has been observed in these infected cells thus suggesting that translational shut-off may be due to activation of a kinase that selectively phosphorylates eIF2 ⁇ (Chinchar and Dholakia, 1989, Virus Res 14(3):207-23).
  • FV-3 can synthesize more than 60 virus-specific polypeptides (Chinchar and Yu, 1990, Virus Res 16(2): 163 -74).
  • IRF3/7 activation can be stimulated by dsRNA and a novel cellular kinase distinct from PKR is responsible for its phosphorylation.
  • E3L protein of VV exerts its anti-TFN effect by inhibiting not only PKR but also the distinct IRF3/7 kinase(s) (Smith et al, 2001, JBiol Chem 276(12):8951-7). While wtVV inhibits JJRF-3 phosphorylation, infection with VV ⁇ E3L leads to its phosphorylation. Infection with VV ⁇ E3L/ATV eIF2 ⁇ also leads to the phosphorylation of IRF-3 suggesting that the ATV eIF2 ⁇ homolog is not able to inhibit the induction of TEN.
  • TRF-3 Translocation of TRF-3 to the nucleus was seen even in the absence of PKR in VV ⁇ E3L/ATV eTF2 ⁇ infected cells, supporting the data that PKR is not the kinase responsible for phosphorylating IRF-3.
  • CEC-32 chicken embryo fibroblast cells were fransfected with iridoviral eIF2 and then infected with VSV (Essbauer et al, 2001, Virus Genes 23(3):347-59). Their results found no significant differences between the viability of control cells and eIF2 fransfected CEC-32 cells. Also, their attempts to counteract the antiviral effects of chicken IFN by iridoviral eIF2 have failed. The results indicate that the ATV eJE2 ⁇ can partially counteract the antiviral effects of mammalian JEN by inhibiting PKR.
  • ATV eTF2 ⁇ homolog is able to recognize mammalian PKR, suggesting the presence of a PKR-like enzyme in salamanders. Subsequently, ATV eIF2 ⁇ might be involved in evading host defenses in salamanders.
  • the homolog has a better effect than K3L as the recombinant virus was able to partially rescue VV ⁇ E3L. Since the C-terminus of the homolog has no homology to any known protein, further work is needed to explore the function of the C-terminus.
  • K3L binds to PKR and acts as a pseudosubstrate, it would be interesting to see if the homolog can also interact directly with PKR.
  • KGYID amino acids 73-78 of SEQ ID NO:2
  • the motif required for interaction of K3L with PKR is modified to KGYVD (amino acids 81-85 of SEQ ID NO: 1) in all iridoviral elE2 ⁇ proteins. This modification may have an effect on the possible interaction of eIF2 ⁇ homolog with PKR.
  • salamander virus ATV contains a novel gene that may counteract host defenses, emphasizing that there is an evolutionary significance in obtaining this gene in its genome. Since the eIF2 ⁇ homolog was able to inhibit part of the mammalian IFN system, salamanders may have an antiviral state similar to mammals .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention se rapporte à des vaccins présentant un niveau de sécurité accru, qui renferment des virus de la vaccine recombinants contenant une région E3L inactivée. L'invention concerne également des méthodes destinées à stimuler une réponse immunitaire protectrice chez un hôte immunisé, au moyen des vaccins selon l'invention. L'invention se fonde sur la découverte selon laquelle des mutants du virus de la vaccine possédant des délétions dans la région E3L présentent une pathogénie considérablement réduite, tout en restant hautement immunogènes. De plus, l'invention a trait à des virus de la vaccine recombinants modifiés, mis au point pour exprimer des polypeptides hétérologues, et à l'utilisation de tels virus dans des vaccins conçus pour stimuler une réponse immunitaire protectrice contre de tels polypeptides chez un hôte. L'invention concerne aussi un virus de la vaccine recombinant sensible à l'interféron, qui dispose d'une large gamme d'hôtes, un eIF2α étant inséré dans le génome viral à la place d'au moins une partie du gène E3L.
EP03765541A 2002-07-24 2003-07-11 Utilisation du virus de la vaccine avec deletion du gene e3l en tant que vecteur de vaccin Withdrawn EP1523333A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US39790702P 2002-07-24 2002-07-24
US397907P 2002-07-24
US39981502P 2002-07-31 2002-07-31
US399815P 2002-07-31
PCT/US2003/021764 WO2004009763A2 (fr) 2002-07-24 2003-07-11 Utilisation du virus de la vaccine avec deletion du gene e3l en tant que vecteur de vaccin

Publications (2)

Publication Number Publication Date
EP1523333A2 true EP1523333A2 (fr) 2005-04-20
EP1523333A4 EP1523333A4 (fr) 2007-01-24

Family

ID=30773046

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03765541A Withdrawn EP1523333A4 (fr) 2002-07-24 2003-07-11 Utilisation du virus de la vaccine avec deletion du gene e3l en tant que vecteur de vaccin

Country Status (4)

Country Link
US (1) US7431929B2 (fr)
EP (1) EP1523333A4 (fr)
AU (1) AU2003249059A1 (fr)
WO (1) WO2004009763A2 (fr)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006047537B4 (de) 2006-10-07 2024-05-16 Sanofi-Aventis Deutschland Gmbh Verfahren und Vorrichtung zur Bestimmung der Position eines Stopfens einer Ampulle für ein Arzneimittel in einem medizinischen Gerät sowie deren Verwendung, ein entsprechendes medizinisches Gerät sowie Herstellung eines medizinischen Geräts
US9670506B2 (en) 2009-04-30 2017-06-06 Consejo Superior De Investigaciones Cientificas Modified immunization vectors
WO2011156470A1 (fr) * 2010-06-08 2011-12-15 Arizona Board of Regents, a body corporate acting for and on behalf of Arizona State University Procédé d'insertion de matériel génétique dans de l'adn génomique
NZ759538A (en) * 2013-11-28 2022-10-28 Bavarian Nordic As Compositions and methods vectors for inducing an enhanced immune response using poxvirus vectors
AU2016229408A1 (en) 2015-02-25 2017-09-14 Memorial Sloan-Kettering Cancer Center Use of inactivated nonreplicating modified vaccinia virus ankara (mva) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors
CN107847534B (zh) 2015-04-17 2022-10-04 纪念斯隆凯特琳癌症中心 Mva或mvaδe3l作为抗实体瘤的免疫治疗剂的应用
BR112018016948A2 (pt) 2016-02-25 2019-01-08 Memorial Sloan Kettering Cancer Center mva recombinante ou mva¿e3l que expressa flt3l humano e uso do mesmo como agente imunoterapêutico contra tumores sólidos
MX2018010204A (es) 2016-02-25 2019-05-06 Memorial Sloan Kettering Cancer Center Virus de la vaccinia atenuada competentes para replicacion con la supresion de timidina quinasa con y sin la expresion del flt3l o gm-csf humanos para inmunoterapia del cancer.
WO2017205674A1 (fr) * 2016-05-25 2017-11-30 Arizona Board Of Regents On Behalf Of Arizona State University Mutants de virus oncolytiques de la vaccine et leur utilisation pour le traitement du cancer
WO2018209315A1 (fr) 2017-05-12 2018-11-15 Memorial Sloan Kettering Cancer Center Mutants du virus de la vaccine utiles pour l'immunothérapie anticancéreuse

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5378457A (en) * 1981-12-24 1995-01-03 Virogenetics Corporation Interferon sensitive recombinant poxvirus vaccine
US6004777A (en) * 1997-03-12 1999-12-21 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US20030044384A1 (en) * 1997-10-09 2003-03-06 Pro-Virus, Inc. Treatment of neoplasms with viruses
WO1999055910A1 (fr) * 1998-04-24 1999-11-04 Arizona Board Of Regents Methode permettant d'induire l'apoptose dans une cellule cible
CA2335508A1 (fr) * 1998-06-26 2000-01-06 Aventis Pasteur Utilisation de poxvirus en tant que renforcateurs d'immunite specifique
IL145899A0 (en) 1999-04-15 2002-07-25 Pro Virus Inc Treatment of neoplasms with viruses
WO2000073487A1 (fr) 1999-05-27 2000-12-07 Arizona Board Of Regents Nouveaux vecteurs viraux ayant une efficacité augmentée et une virulence fortement réduite
ZA200203041B (en) 1999-11-12 2003-12-09 Oncolytics Biotech Inc Viruses for the treatment of cellular proliferative disorders.
US7306902B2 (en) 2002-06-28 2007-12-11 Oncolyties Biotech Inc. Oncolytic viruses as phenotyping agents for neoplasms
US6372455B1 (en) * 2001-04-19 2002-04-16 Arizona Board Of Regents Recombinant vaccinia viral vectors
US6750043B2 (en) * 2001-04-19 2004-06-15 Arizona Board Of Regents Viral vectors having reduced virulence
US6848652B2 (en) * 2003-02-28 2005-02-01 Sikorsky Aircraft Corporation Aircraft heater

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BRANDT T A ET AL: "BOTH CARBOXY- AND AMINO-TERMINAL DOMAINS OF THE VACCINIA VIRUS INTERFERON RESISTANCE GENE, E3L, ARE REQUIRED FOR PATHOGENESIS IN A MOUSE MODEL" JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 75, no. 2, January 2001 (2001-01), pages 850-856, XP002951113 ISSN: 0022-538X *
LANGLAND ET AL: "Inhibition of PKR by RNA and DNA viruses" VIRUS RESEARCH, AMSTERDAM, NL, vol. 119, no. 1, July 2006 (2006-07), pages 100-110, XP005455777 ISSN: 0168-1702 *
See also references of WO2004009763A2 *
VIJAYSRI S ET AL: "The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo" VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 314, no. 1, 15 September 2003 (2003-09-15), pages 305-314, XP004457949 ISSN: 0042-6822 *
XIANG YING ET AL: "Blockade of interferon induction and action by the E3L double-stranded RNA binding proteins of vaccinia virus" JOURNAL OF VIROLOGY, vol. 76, no. 10, May 2002 (2002-05), pages 5251-5259, XP002410981 ISSN: 0022-538X & XIANG YING ET AL: "Vaccinia virus E3L suppresses the IFN system by preventing activation of antiviral enzymes and IRF3 phosphorylation" JOURNAL OF INTERFERON AND CYTOKINE RESEARCH, vol. 24, no. Supplement 1, 2001, pages S.70-S.71, XP008072611 & ANNUAL MEETING OF THE INTERNATIONAL SOCIETY FOR INTERFERON AND CYTOKINE RESEARCH; CLEVELAND,, OH, USA; OCTOBER 07-11, 2001 ISSN: 1079-9907 *

Also Published As

Publication number Publication date
AU2003249059A8 (en) 2004-02-09
US20060008470A1 (en) 2006-01-12
US7431929B2 (en) 2008-10-07
AU2003249059A1 (en) 2004-02-09
EP1523333A4 (fr) 2007-01-24
WO2004009763A3 (fr) 2004-06-17
WO2004009763A2 (fr) 2004-01-29

Similar Documents

Publication Publication Date Title
Volz et al. Modified vaccinia virus Ankara: history, value in basic research, and current perspectives for vaccine development
JP4693092B2 (ja) ポックスウイルスゲノムに挿入された相同遺伝子を発現させる組換えポックスウイルス
JP3826055B2 (ja) 組換えアビポックスウイルスによる免疫方法
Romero et al. Single capripoxvirus recombinant vaccine for the protection of cattle against rinderpest and lumpy skin disease
US20060216312A1 (en) Mutants of replication competent vaccinia virus
US20060099181A1 (en) Viral vectors having reduced virulence
US7431929B2 (en) Use of vaccinia virus deleted for the E3L gene as a vaccine vector
EP2326712B1 (fr) Souches virales dérivées du virus du vaccin lister vacv-107 et leurs utilisations
US8084248B2 (en) Reverse genetic system for rift valley fever virus and uses thereof
JP2007254489A (ja) Htlv抗原を発現する組換え弱毒化ポックスウイルスを含有する免疫原性組成物
US6846652B2 (en) Viral vectors having enhanced effectiveness with reduced virulence
US6372455B1 (en) Recombinant vaccinia viral vectors
Smith Genus Orthopoxvirus: vaccinia virus
EP3280438B1 (fr) Mutant inactivé de virus de dermatose nodulaire recombinant et ses utilisations
Auperin Construction and evaluation of recombinant virus vaccines for Lassa fever
AU2000279480B2 (en) Methods for producing temperature-sensitive morbillivirus
US20050163805A1 (en) Orthopoxvirus vectors, genes and products thereof
Pan et al. Thymidine kinase gene mutation leads to reduced virulence of pseudorabies virus
Yilma Virus vector vaccines
Douglass Molecular and evolutionary analysis of a gene conserved in most Orthopoxviruses
Lescott Characterization of the Recombinant Vaccinia Viruses Expressing the Lassa Virus Glycoprotein Genes
Basavarajappa Improved infectious laryngotracheitis virus vaccines using Newcastle disease virus vector

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041222

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RBV Designated contracting states (corrected)

Designated state(s): DE FR GB

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/863 20060101ALI20061213BHEP

Ipc: C07K 14/07 20060101ALI20061213BHEP

Ipc: C07K 14/065 20060101AFI20061213BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20061229

17Q First examination report despatched

Effective date: 20080306

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100603