EP1513931A2 - Modified phytases - Google Patents

Abstract

The present invention describes modified phytases. These phytases are modified as compared to a model phytase in various positions, in particular to increase the thermostability of the modified phytase as compared to that of the model phytase. The modified phytases have further retained favourable properties of Aspergillus niger phytase, in particular because specific amino acid residues of Aspergillus niger phytase are retained in the modified phytase.

Description

MODIFIED PHYTASES

Field of the invention

The present invention relates to modified phytases.

Background of the invention

Phytate is abundant in plants as a storage form of phosphate. Monogastric animals are not able to liberate phosphate from phytate and therefore require supplementation of phosphate to their feed. Nowadays, the enzyme phytase is supplemented to animal feed to liberate phosphate from phytate. Typically, phytase is added to animal feed during the process of feed preparation. In some stages of the animal feed production process, phytase is subjected to conditions of relatively high temperature and relatively high humidity. These conditions have a negative influence on the activity of labile compounds like enzymes. The phytase derived from Aspergillus niger is commonly used for feed applications due to favourable properties of this phytase. For instance, it has a broad pH optimum in the acidic range, a broad specificity coupled to a relatively high specific activity and a high affinity for phytic acid, so that even at low phytic acid concentrations the enzyme degrades phytic acid effectively. It further quite smoothly removes 5 of the 6 phosphates from phytate without significant accumulation of intermediates, it does not need co-factors for activity or stability and it is not very sensitive to inhibition by feed ingredient and metal ions.

However, the thermostability of Aspergillus niger phytase is relatively low. Therefore, there is a need for a phytase with the same favourable properties as Aspergillus niger phytase combined with a high stability and activity at high temperatures.

The present invention discloses modified phytases with favourable properties, for - instance with respect to resistance to high temperature and humidity. Description of the Figures

Figure 1. Aspergillus niger active site residues.

Figure 2. IHP-S model coordinates of active site residues of Aspergillus niger phytase complexed with phytic acid (I HP 550H)

Figure 3. Productivity of phytases versus temperature.

Detailed description of the invention

In the context of the present invention, a phytase is an enzyme which catalyses the hydrolysis of phytate (myoinositol hexakisphosphate) to one or more of the following compounds: myoinositol penta-, tetra-, tri-, di- and mono-phosphate and/or myoinositol. It is thereby generally known that some phytases are not able to substantially hydrolyse myoinositol monophosphate to myoinositol. Phytase enzymes can be 3-phytases or 6- phytases (EC 3.1.3.8 or EC 3.1.3.26, respectively), referring to the position of the first ester bond that is hydrolysed.

A first aspect of the present invention relates to a polypeptide that is a modified phytase. The polypeptide according to the invention is modified as compared to a model phytase in such a way that the polypeptide according to the invention, when aligned to the model phytase, contains a modification selected from the group consisting of: a substitution of an amino acid as present in the model phytase for a different amino acid, a deletion of an amino acid as present in the model phytase, or an insertion of an amino acid. The alignment of the polypeptide according to the invention to a model phytase is done in such a way as to obtain a maximal amount of homologous (identical) residues between the polypeptide according to the invention and the model phytase.

In a preferred embodiment of the invention, the^' modification is a substitution. The number of modifications may be at least one, preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 70, more preferably at least 80.

In the present invention, a denotation like e.g. "5QS" means that the amino acid in position 5 of the model phytase in question is substituted with either Q or S. The nature of the original amino acid residue may depend on the model phytase that is used. A denotation like e.g. "Q5S" means that a specific amino acid residue present in the model phytase, e.g. Q, is substituted with a different amino acid, e.g. S.

The modified phytase is modified as compared to the model phytase in preferably at least one of the following positions: 5, 6, 13, 19, 21 , 29, 31 , 36, 39, 43, 53, 69, 78, 81 , 85, 87, 99, 112, 113, 122, 125, 126, 128, 137, 147, 148, 157, 160, 163, 165, 169, 172, 176, 178, 180, 181 , 182, 183, 189, 194, 197, 201 , 203, 211 , 213, 215, 218, 222, 223, 225, 232, 233, 242, 246, 247, 248, 249, 250, 251 , 252, 254, 269, 291 , 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382, 384, 395, 414, 417, 425, 428, 438, 440; or in preferably at least one of the following positions: 13, 19, 21 , 29, 31 , 36, 39, 43, 53, 69, 78, 81 , 85, 87, 99, 112, 113, 122, 125, 126, 128, 137,

147, 148, 157, 160, 163, 165, 169, 172, 176, 178, 180, 181, 182, 183, 189, 194, 197, 201 , 203, 211 , 213, 215, 218, 222, 223, 225, 232, 233, 242, 246, 247, 248, 249, 250, 251, 252, 254, 269, 291, 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382, 384, 395, 414, 417, 425, 428, 438, 440; or in preferably at least one of the following positions: 13, 19, 21 , 29, 36, 39, 43, 53, 69, 81 , 85, 87, 99, 112, 113, 122, 125, 126, 128, 137, 147, 148, 157, 160, 165, 169, 172, 176, 178, 181 , 183, 189, 197, 201 , 203, 213, 218, 222, 223, 225, 232, 233, 246, 247, 248, 249, 250, 251 , 252, 291 , 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382, 384, 395, 417, 425, 438, 440. Even more preferably, the modified phytase is modified as compared to the model phytase in at least one of the following positions 31 , 78, 163, 180, 182, 194, 211 , 215, 242, 254, 269, 414, 428, 440.

In particular, the modified phytase contains at least one of the following modifications as compared to the model phytase: 5QS, 6SH, 13G, 19P, 211, 29S, 31 FY, 36D, 39A, 43D, 53V, 69S, 78EA, 81 K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 1761, 178P, 180AG,

181A, 182STG, 183Y, 189H, 194VA, 197E, 201G, 203D, 211TL, 213A, 215SA, 218A, 222A, 223H, 225P, 232E, 233D, 242SP, 246V, 247A, 248R, 249T, 250S, 251 D, 252A, 254KE, 269NQ, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414PA, 417K, 425D, 428RKE, 438N, 440AE; or more preferably at least one of the following modifications as compared to the model phytase: 5QS, 6SH, 13G, 19P, 211, 29S, 31 Y, 36D, 39A, 43D, 53V, 69S, 78A, 81 K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163G, 165N, 169A, 172V, 1761, 178P, 180G, 181 A, 182G, 183Y, 189H, 194A, 197E, 201 G, 203D, 211 L, 213A, 215A, 218A, 222A, 223H, 225P, 232E, 233D, 242P, 246V, 247A, 248R, 249T, 250S, 251 D, 252A, 254E, 269Q, 291 A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414A, 417K, 425D, 428E, 438N, 440E.

Most preferably, the modified phytase contains at least one of the following modifications as compared to the model phytase: 31 Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.

The position numbering as used throughout the present invention is according to the position numbering of SEQ ID NO:1.

The model phytase as used in the present invention is a phytase obtainable from a filamentous fungus from the genus Aspergillus, preferably from the species

Aspergillus niger, or a variant phytase derived from any of these phytases. It is thereby known that phytases within individual strains of the species Aspergillus niger show a low degree of variation, i.e. the homology of these phytases is at least 90%. It is also known that the species Aspergillus niger comprises species formerly known as Aspergillus ficuum and Aspergillus awamori. Most preferably, the model phytase is the phytase obtainable from Aspergillus niger NRRL 3135, as indicated in SEQ ID NO:1.

An especially preferred model phytase is a phytase containing a combination of specific amino acid residues that are uniquely present in Aspergillus niger phytase.

The especially preferred model phytase contains the same amino acid residues in the active site as the amino acids present in Aspergillus niger phytase at the corresponding positions. To this end, the present invention discloses a method to define those residues in the active site of Aspergillus niger phytase that are present within a certain distance of bound phytate.

The amino acid residues which form the active site of Aspergillus niger phytase and which are relevant for the catalytic properties in the degradation of phytic acid by Aspergillus niger phytase were identified using the 3D structure of the Aspergillus niger phytase which is available from the Protein Data Bank (PDB) as entry 11HP (Kostrewa et al. Nature Structural Biology, 1997, 4, 185). The Aspergillus niger 3D structure does not contain the substrate phytic acid (myo-inositol hexakisphosphate). However, the 3D structure of an E.coli phytase complexed with phytic acid is available (PDB entry 1 DKQ, Lim et al., Nature Structural Biology, 2000, 7, 108). Although sequence homology is low, both phytases show substantial structural resemblance. The superposition of the atomic coordinates for Aspergillus niger phytase(IIHP) and E.coli phytase was started using only the alpha carbon atoms of those residues which exhibit a similar folding pattern in both phytases. Subsequently, the number of residues which were included in the superposition were extended in an iterative process until no further improvement of the superposition could be obtained. Quality of the superposition was judged using the root mean square deviation of the atoms used for the superposition. In the final superposition the amino acid segments 1DKQ: 6-22, 46-66, 83-106, 246-257, 268-278, 296-313, 328- 338, 346-351 , 375-381 , 392-398 were superimposed onto 1 IHP:48-64, 104-124, 133- 156, 270-281 , 293-303, 331-348, 379-389, 397-402, 406-412, 422-428.

After the superposition the substrate phytic acid was taken from the E.coli phytase active site and transferred to the corresponding site in Aspergillus niger phytase. Subsequently the Aspergillus niger phytase complexed with the phytic acid was subjected to energy minimization allowing substrate and active site residues to shift while keeping the remainder of the structure fixed. The energy minimizations were conducted with the Insight & Discover program (Accelrys, San Diego CA) with the forcefield CVFF using a SGI Octane workstation. The resulting model for Aspergillus niger phytase complexed with phytic acid was coded IHP-S. It was found that calculation of the solvent accessible surface for those amino acid residues, which had at least one atom within a distance of 7 Angstroms from any atom of the substrate phytic acid, resulted in a smooth continuous surface outlining a pocket that accomodated the phytic acid almost perfectly. The atomic coordinates of the residues that contribute to this active site pocket are given in Figure 1. In addition the IHP-S model was used to identify different zones of residues around the substrate. Results are given in Figure 2.

Thus, in the context of the present invention, the active site amino acid residues of Aspergillus niger phytase are those amino acid residues that are within a certain distance from phytic acid when bound in the active site. Preferably, said distance is 6 Angstrom, more preferably 7 Angstrom.

Thus, the especially preferred model phytase contains the amino acids Q27, Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, R142, V143, E179, D188, F243, KN277, K278, H282, S337, H338, D339, N340, F380 (within 6 Angstrom distance), preferably the amino acids Q27, Y28, R58, H59, G60, R62, Y63, P64, T65, DE66, S67, K68, K71 , Y72, D103, S140, R142, V143, E179, D188, E196, D239, F243,

Q274, KN277, K278, H282, S337, H338, D339, N340, G341 , V378, F380 (within 7 Angstrom distance). The especially preferred model phytase additionally contains the following amino acids as present in Aspergillus niger phytase: A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381.

At a non-specified position, it is not critical to the invention which amino acid residue may be present. Such a non-specified position is a position that is not within the active site of Aspergillus niger phytase and that is not an Aspergillus niger amino acid as additionally specified above and that is not subjected to specific modifications as specified above.Alignment of phytases using a commonly known alignment program will reveal which amino acid(s) typically will occur at a certain position. At a corresponding non-specified position in the polypeptide of the invention, any one of such an amino acid may be present.

Thus, a preferred polypeptide according to the invention is a phytase that contains the same amino acid residues in the active site as the amino acids present in Aspergillus niger phytase at the corresponding positions, as well as the additionally specified Aspergillus niger amino acids (i.e. A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381), and that further contains a modification as specified above.

An especially preferred polypeptide according to the invention is a phytase that further contains at least one of the following amino acid residues: 31 Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E and/or 440E. Another especially preferred polypeptide according to the invention contains at least one of the following amino acid residues: 180G, 182G, 242P and/or 440E; or preferably at least 180G, 182G and/or 242P.

In particular, the present invention discloses a polypeptide that is a modified phytase according to SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.

A polypeptide of the invention may comprise all of the modifications set out above. In addition, the polypeptide of the invention may comprise additional modifications that concern positions in the polypeptide wherein a modification does not affect the folding or activity of the polypeptide. Typically, such modifications may be conservative substitutions, i.e. substitutions wherein a non-polar, polar uncharged, polar charged or aromatic amino acid is substituted for a different amino acid from the same category.

In one embodiment, the polypeptide of the invention may comprise a polypeptide with at least 91 , preferably at least 92, more preferably at least 93, more preferably at least 94, more preferably at least 95, more preferably at least 96, more preferably at least 97, more preferably at least 98 or most preferably at least 99% sequence homology (identity) to SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.

The polypeptide according to the invention is modified to increase thermostability and/or to modify specific activity and/or to modify specificity for a certain substrate and/or to modify the pH optimum of the enzyme and/or to improve pelleting stability and/or to improve bioefficacy, and/or to improve expression, transport, maturation, and the like, in the host organism used to produce the modified phytase, when compared with the model phytase. In a preferred embodiment, the polypeptide according to the invention has retained several of the biochemical properties of Aspergillus niger phytase, in particular of the phytase obtainable from Aspergillus niger NRRL 3135. The biochemical property that is retained is the Km value and/or the pH optimum at two pH values of about 5.5 and 2.5 and/or the specific activity and/or the high activity at a physiological temperature.

In a preferred embodiment, the polypeptide according to the invention is obtained an increased thermostability. An increased thermostability of a modified phytase according to the invention as compared to a model phytase may be expressed by a longer life-time at a given elevated temperature and/or improved refolding / reactivation characteristics and/or an unfolding at a higher temperature.

Surprisingly, the polypeptide according to the invention combines several favourable properties of Aspergillus niger phytase with an increased thermostability.

Amino acids important for e.g. thermostability or activity of the polypeptide of the invention, and therefore potentially subject to substitution, may be identified and modified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis. In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (e.g phytase activity) to identify amino acid residues that are critical to the activity of the molecule. Sites of enzyme-substrate interaction can also be determined by analysis of crystal structure as determined by such techniques as nuclear magnetic resonance, crystallography or photo-affinity labelling or molecular modelling.

Polypeptides of the invention may be produced by synthetic means although usually they will be made recombinantly by expression of a polynucleotide sequence encoding the polypeptide in a suitable host organism. The use of yeast and fungal host cells is expected to provide for such post- translational modifications (e.g. proteolytic processing, myristilation, glycosylation, truncation, and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Polypeptides of the invention may be provided in a form such that they are outside their natural cellular environment. Thus, they may be substantially isolated or purified, as discussed above, or produced in a cell in which they do not occur in nature, e.g. a cell of other fungal species, animals, yeast or bacteria.

Polypeptides of the invention may be analysed by any suitable assay known to the skilled person to measure an improvement as compared to a model phytase known in the art.

In a second aspect, the present invention provides an (e.g. isolated and/or purified) polynucleotide comprising a polynucleotide sequence encoding the polypeptide of the first aspect. In particular, the present invention provides a polynucleotide comprising a polynucleotide sequence encoding the amino acid sequence set out in SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7 or a polynucleotide comprising SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6. The polynucleotides of the second aspect further include any degenerate versions of a polynucleotide sequence encoding the polypeptide of the first aspect. For instance, the skilled person may, using routine techniques, make nucleotide substitutions that do not affect the protein sequence encoded in the polynucleotides of the invention to reflect the codon usage of any particular host organism in which the polypeptides of the invention are to be expressed.

The polynucleotide sequence of the second aspect may be RNA or DNA and includes genomic DNA, synthetic DNA or cDNA. Preferably, the polynucleotide is a DNA sequence.

Polynucleotides of the invention can be synthesized according to methods well known in the art. They may be produced by combining oligonucleotides synthesized according to and along the nucleotide sequence of the polynucleotide of the invention. Alternatively, they may be synthesized by mutagenising a parental polynucleotide at any desired position.

For instance, the polynucleotide of the invention is constructed from a series of synthetic oligonucleotides with a length of 80 nucleotides, having an overlap of about 20 nucleotides. A PCR, typically of 10 steps, is performed with a polymerase with proofreading activity on all 80-mer oligonucleotides to anneal and extend the oligonucleotides. A further PCR with a proofreading polymerase is performed with PCR primers situated at the 5' and 3' end of the desired fragment, to synthesise the complete desired fragment. The complete fragment is cloned in a suitable vector and sequenced to establish whether or not a correct sequence is obtained. Optionally, sequence errors may be corrected, for instance using the QuickChange kit from Stratagene according to the Manufacturer's instructions.

Polynucleotides of the invention may be used to obtain polynucleotides encoding a further modified polypeptide, e.g. by subjecting polynucleotides of the invention to mutagenesis techniques. Site-directed mutagenesis may be used to alter the polynucleotides of the invention at one or more specific positions. Gene shuffling technology (for instance as disclosed in WO95/22625, WO98/27230, WO98/01581 and/or WO00/46344) may be used to obtain polynucleotide variants with a random combination of any variant position present in any member of a starting population of polynucleotides, said starting population including one or more polynucleotides according to the invention.

The invention also provides vectors comprising a polynucleotide of the invention, including cloning and expression vectors.

The vector into which the expression cassette or polynucleotide of the invention is inserted may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of the vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid, cosmid, virus or phage vector, usually provided with an origin of replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. The vector may be a circular, e.g. a plasmid, or a linear, e.g. an expression cassette, polynucleotide.

Preferably, the polynucleotide of the invention may be inserted into an expression cassette. In an expression cassette, the polynucleotide of the invention is operably linked to a regulatory sequence that is capable of providing for the expression of a polypeptide from its coding sequence by the host cell, i.e. the vector is an expression vector. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence such as a promoter, an enhancer or another expression regulatory signal "operably linked" to a coding sequence is positioned in such a way that expression of a polypeptide from its coding sequence is achieved under conditions compatible with the regulatory sequences.

An expression cassette for a given host cell may comprise the following elements operably linked to each other in a consecutive order from the 5'-end to 3'-end relative to the coding strand of the sequence encoding the polypeptide of the first aspect: a promoter sequence capable of directing transcription of the DNA sequence encoding the polypeptide in the given host cell; optionally, a signal sequence capable of directing secretion of the polypeptide from the given host cell into a culture medium; a DNA sequence encoding a mature and preferably active form of the polypeptide; and preferably also a transcription termination region (terminator) capable of terminating transcription downstream of the DNA sequence encoding the polypeptide.

Aside from the promoter native to the gene encoding a naturally occurring predecessor of the polypeptide of the invention, other promoters may be used to direct expression of the polypeptide of the invention. The promoter may be selected for its efficiency in directing the expression of the polypeptide of the invention in the desired expression host.

Promoters/enhancers and other expression regulatory signals may be selected to be compatible with the host cell for which the expression cassette or vector is designed. Preferably the promoter sequence is derived from a highly expressed gene. In the context of this invention, a highly expressed gene is a gene whose mRNA can make up at least 0.01% (w/w) of the total cellular mRNA, e.g. under induced conditions, or alternatively, a gene whose gene product can make up at least 0.2% (w/w) of the total cellular protein, or, in case of a secreted gene product, can be secreted to a level of at least 0.05g/l. Examples of preferred highly expressed genes from which promoters are preferably derived and/or which are comprised in preferred predetermined target loci for integration of expression cassettes, include but are not limited to genes encoding glycolytic enzymes such as triose-phosphate isomerases (TPI), glyceraldehyde- phosphate dehydrogenases (GAPDH), phosphoglycerate kinases (PGK), pyruvate kinases (PYK), alcohol dehydrogenases (ADH), as well as genes encoding amylases, glucoamylases, proteases, glucanases, cellobiohydrolases, β-galactosidases, alcohol (methanol) oxidases, elongation factors and ribosomal proteins. Specific examples of suitable highly expressed genes include e.g. the LAC4 gene from Kluyveromyces sp., the methanol oxidase genes (AOX and MOX) from Hansenula and Pichia, respectively, the glucoamylase (glaA) genes from A.niger and A.awamori, the A.oryzae TAKA- amylase gene, the A.nidulans gpdA gene and the T.reesei cellobiohydrolase genes.

To effect expression in bacteria, prokaryotic promoters may be used, in particular those suitable for use in E.coli strains. Examples of strong bacterial promoters are the -amylase and SPo2 promoters as well as promoters from extracellular protease genes. Yeast promoters include S. cerevisiae GAL4 and ADH promoters, the S. pombe nmt 1 and adh promoter. Examples of strong yeast promoters are those obtainable from the genes for alcohol dehydrogenase, lactase, 3-phosphoglycerate kinase and triosephosphate isomerase. Examples of strong constitutive and/or inducible promoters which are preferred for use in fungal expression hosts are those which are obtainable from the fungal genes for xylanase (xlnA), phytase, ATP-synthetase, subunit 9 (o//C), triose phosphate isomerase (tpi), alcohol dehydrogenase (AdhA), α-amylase (amy), amyloglucosidase (AG - from the glaA gene), acetamidase (amdS) and glyceraldehyde-3-phosphate dehydrogenase (gpd) promoters.

Promoters suitable for plant cells include nopaline synthase (nos), octopine synthase (ocs), mannopine synthase (mas), ribulose small subunit (rubisco ssu), histone, rice actin, phaseolin, cauliflower mosaic virus (CMV) 35S and 19S and circovirus promoters. All these promoters are readily available in the art. If the polypeptide is produced as a secreted protein, the polynucleotide sequence encoding a mature form of the polypeptide in the expression cassette is operably linked to a polynucleotide sequence encoding a signal peptide.

Preferably the signal sequence is native (homologous) to the polynucleotide sequence encoding the polypeptide. In a preferred embodiment of the invention, the signal sequence is obtained from the Aspergillus niger phytase gene, in particular the signal sequence as disclosed in EP 0 420 358. Alternatively, the signal sequence is foreign (heterologous) to the polynucleotide sequence encoding the polypeptide, in which case the signal sequence is preferably endogenous to the host cell in which the DNA sequence is expressed. The signal sequence may be used in combination with the promoter driving expression of the coding sequence wherefrom the signal sequence is obtained, e.g. the Aspergillus (niger) amyloglucosidase (also called (gluco)amylase) promoter in combination with the signal sequence from the amyloglucosidase (AG) gene, both the18 and 24 amino acid versions, as well as in combination with other promoters. Hybrid signal sequences may also be used within the context of the present invention. Examples of suitable signal sequences for yeast host cells are the signal sequences derived from yeast α-factor genes. A suitable signal sequence for bacteria is derived from the α-amylase gene (Bacillus). In some cases, the cleavage of the signal peptide during passage of a polypeptide through the secretory pathway may occur at more than one position, implicating a mature polypeptide with a variable N-terminus. The present invention encompasses polypeptides with such variable N-termini.

Downstream of the polynucleotide sequence encoding the polypeptide there may be a 3' untranslated region containing one or more transcription termination sites (e.g. a terminator). The origin of the terminator is less critical. The terminator can e.g. be native to the polynucleotide sequence encoding the polypeptide. However, preferably a yeast terminator is used in yeast host cells and a filamentous fungal terminator is used in filamentous fungal host cells. More preferably, the terminator is endogenous to the host cell (in which the polynucleotide sequence encoding the polypeptide is to be expressed). The vector may contain one or more selectable marker genes, to enable selection of transformed cells from the majority of untransformed cells.

Preferred selectable markers include but are not limited to those that complement a defect in the host cell or confer resistance to a drug. They include e.g. versatile marker genes that can be used for transformation of most filamentous fungi and yeasts such as acetamidase genes or cDNAs (the amdS, niaD, facA genes or cDNAs from A.nidulans, A.oryzae, or A. niger), or genes providing resistance to antibiotics like G418, hygromycin, bleomycin, kanamycin, phleomycin or benomyl resistance (benA). Alternatively, specific selection markers can be used such as auxotrophic markers which require corresponding mutant host strains: e.g. URA3 (from S.cerevisiae or analogous genes from other yeasts), pyrG or pyrA (from A.nidulans or A.niger), argB (from A.nidulans or A.niger) or trpC. In a preferred embodiment the selection marker is deleted from the transformed host cell after introduction of the expression construct so as to obtain transformed host cells capable of producing the polypeptide which are free of selection marker genes.

Other markers include ATP synthetase, subunit 9 (o//C), orotidine-5'-phosphate- decarboxylase (pvrA), the bacterial G418 resistance gene (this may also be used in yeast, but not in fungi), the ampicillin resistance gene (£. coli), the neo ycin resistance gene (Bacillus) and the E. coli uidA gene, coding for β-glucuronidase (GUS). Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

The DNA sequence encoding the polypeptide is preferably introduced into a suitable host as part of an expression cassette. For transformation of the suitable host with the expression cassette, transformation procedures are available which are well known to the skilled person. The expression cassette can be used for transformation of the host as part of a vector carrying a selectable marker, or the expression cassette may be co-transformed as a separate molecule together with the vector carrying a selectable marker. The vector may comprise one or more selectable marker genes. For most filamentous fungi and yeasts, the vector or expression construct is preferably integrated in the genome of the host cell in order to obtain stable transformants. However, for certain yeasts also suitable episomal vectors are available into which the expression construct can be incorporated for stable and high level expression. Examples thereof include vectors derived from the 2μ and pKD1 plasmids of Saccharomyces and Kluyveromyces, respectively, or vectors containing an AMA sequence (e.g. AMA1 from Aspergillus). In case the expression constructs are integrated in the host cells genome, the constructs are either integrated at random loci in the genome, or at predetermined target loci using homologous recombination, in which case the target loci preferably comprise a highly expressed gene. A number of examples of suitable highly expressed genes are provided earlier.

Provided also are host cells comprising a polynucleotide or vector of the invention. The polynucleotide may be heterologous to the genome of the host cell. In this context, the term "heterologous" means that the polynucleotide does not naturally occur in the genome of the host cell or that the polypeptide is not naturally produced by that cell.

Suitable host cells are preferably prokaryotic microorganisms such as bacteria, or more preferably eukaryotic organisms, for example fungi, such as yeasts or filamentous fungi, or plant cells.

Bacteria from the genus Bacillus are very suitable as heterologous hosts because of their capability to secrete proteins into the culture medium. Other bacteria suitable as hosts are those from the genera Streptomyces and Pseudomonas.

A preferred yeast host cell for the expression of the DNA sequence encoding the polypeptide of the invention is of the genera Saccharomyces, Kluyveromyces, Hansenula, Pichia, Yarrowia, and Schizosaccharomyces. More preferably a yeast host cell is selected from the group consisting of the species Saccharomyces cerevisiae, Kluyveromyces lactis (also known as Kluyveromyces marxianus var. lactis), Hansenula polymorpha, Pichia pastoris, Yarrowia lipolytica,and Schizosaccharomyces pombe. Most preferred are filamentous fungal host cells. Preferred filamentous fungal host cells are selected from the group consisting of the genera Aspergillus,

Trichoderma, Fusarium, Disporotrichum, Penicillium, Acremonium, Neurospora, Thermoascus, Myceliophtora, Sporotrichum, Thielavia, and Talaromyces. More preferably a filamentous fungal host cell is of the species Aspergillus oyzae, Aspergillus sojae, Aspergillus nidulans, or a species from the Aspergillus niger Group (as defined by Raper and Fennell, The Genus Aspergillus, The Williams & Wilkins Company,

Baltimore, pp 293-344, 1965). These include but are not limited to Aspergillus niger, Aspergillus awamori, Aspergillus tubingensis, Aspergillus aculeatus, Aspergillus foetidus, Aspergillus nidulans, Aspergillus japonicus, Aspergillus oryzae and Aspergillus ficuum, and further consisting of the species Trichoderma reesei, Fusarium graminearum, Penicillium chrysogenum, Acremonium alabamense, Neurospora crassa, Myceliophtora thermophilum, Sporotrichum cellulophilum, Disporotrichum dimorphosporum and Thielavia terrestris.

Examples of preferred expression hosts within the scope of the present invention are fungi such as Aspergillus species and Trichoderma species; bacteria such as Bacillus species e.g. Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Pseudomonas species; and yeasts such as Kluyveromyces species e.g. Kluyveromyces lactis and Saccharomyces species, e.g. Saccharomyces cerevisiae.

Host cells according to the invention further include plant cells, and the invention therefore extends to transgenic organisms, such as plants and parts thereof, which contain one or more cells of the invention. The transgenic (or genetically modified) plant may therefore have inserted (e.g. stably) into its genome a sequence encoding one or more of the polypeptides of the invention. The transformation of plant cells can be performed using known techniques, for example using a Ti or a Ri plasmid from Agrobacterium tumefaciens. The plasmid (or vector) may thus contain sequences necessary to infect a plant, and derivatives of the Ti and/or Ri plasmids may be employed.

Alternatively direct infection of a part of a plant, such as a leaf, root or stem can be effected. In this technique the plant to be infected can be wounded, for example by cutting the plant with a razor or puncturing the plant with a needle or rubbing the plant with an abrasive. The wound is then innoculated with the Agrobacterium.

The plant or plant part can then be grown on a suitable culture medium and allowed to develop into a mature plant. Regeneration of transformed cells into genetically modified plants can be achieved by using known techniques, for example by selecting transformed shoots using an antibiotic and by sub-culturing the shoots on a medium containing the appropriate nutrients, plant hormones and the like.

A further aspect of the invention thus provides host cells transformed or transfected with or comprising a polynucleotide or vector of the invention. Preferably the polynucleotide is carried in a vector for replication of the polynucleotide and expression of the polypeptide. The cells will be chosen to be compatible with the said vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells.

A heterologous host may also be chosen wherein the polypeptide of the invention is produced in a form which is substantially free from other polypeptides with a similar activity as the polypeptide of the invention. This may be achieved by choosing a host which does not normally produce such polypeptides with similar activity.

If the polynucleotides of the invention are incorporated into a recombinant replicable vector, the vector may be used to replicate the polynucleotide in a compatible host cell. Thus in a further aspect, the invention provides a method of producing a polynucleotide according to the invention by introducing a polynucleotide according to the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector containing the polynucleotide according to the invention may be recovered from the host cell. Suitable host cells include bacteria such as E. coli.

In a further aspect the invention provides a process for preparing a polypeptide according to the invention by cultivating a host cell (e.g. transformed or transfected with an expression vector as described above) under conditions to provide for expression (by the vector) of the polypeptide according to the invention, and optionally recovering the expressed polypeptide. Preferably the polypeptide is produced as a secreted protein in which case the polynucleotide sequence encoding a mature form of the polypeptide in the expression construct is operably linked to a polynucleotide sequence encoding a signal peptide. The recombinant host cells according to the invention may be cultured using procedures known in the art. For each combination of a promoter and a host cell, culture conditions are available which are conducive to expression of the polypeptide of the invention. After reaching the desired cell density or titre of the polypeptide the culture is stopped and the polypeptide is recovered using known procedures.

The fermentation medium may comprise a known culture medium containing a carbon source (e.g. glucose, maltose, molasses), a nitrogen source (e.g. ammonium sulphate, ammonium nitrate, ammonium chloride, organic nitrogen sources e.g. yeast extract, malt extract, peptone), and other inorganic nutrient sources (e.g. phosphate, magnesium, potassium, zinc, iron, etc.). Optionally, an inducer may be included. The selection of the appropriate medium may be based on the choice of expression host and/or based on the regulatory requirements of the expression construct. Such media are known to those skilled in the art. The medium may, if desired, contain additional components favouring the transformed expression hosts over other potentially contaminating microorganisms.

The fermentation can be performed over a period of 0.5-30 days. It may be a batch, continuous or fed-batch process, suitably at a temperature in the range of between 0 and 45°C and, for example, at a pH between 2 and 10. Preferred fermentation conditions are a temperature in the range of between 20 and 37°C and/or a pH between 3 and 9. The appropriate conditions are usually selected based on the choice of the expression host and the protein to be expressed.

After fermentation, if necessary, the cells can be removed from the fermentation broth by means of centrifugation or filtration. After fermentation has stopped or after removal of the cells, the polypeptide of the invention may then be recovered and, if desired, purified and isolated by conventional means.

Conveniently, the polypeptide of the invention is combined with suitable (solid or liquid) carriers or diluents including buffers to produce a polypeptide composition. The polypeptide may be attached to or mixed with a carrier, e.g. immobilized on a solid carrier. Thus the present invention provides in a further aspect a composition comprising a polypeptide of the invention. This may be in a form suitable for packaging, transport and/or storage, preferably where the activity of the polypeptide is retained. Compositions may be of paste, liquid, emulsion, powder, flake, granulate, pellet or other extrudate form. The composition may further comprise additional ingredients such as one or more (additional) enzymes.

The polypeptide is typically stably formulated either in liquid or dry form. . Typically, the product is made as a composition which will optionally include, for example, a stabilising buffer and/or preservative.

The invention additionally relates to foodstuffs or an animal feed composition or additive comprising one or more polypeptides of the invention. The polypeptide may be present in the feed at a concentration different from its natural concentration. Preferred amounts are from 0.1 to 100, such as 0.5 to 50, preferably 1 to 10, mg per kg feed. The invention also relates to a process for the preparation of an animal feed composition, the process comprising adding to one or more edible feed substance(s) or ingredient(s), a polypeptide of the invention. The polypeptides can be added to the animal feed composition separately from the feed substances or ingredients, individually or in combination with other feed additives. The polypeptide can be an integral part of one of the feed substances or ingredients.

The polypeptides of the invention may also be added to animal feeds to improve the breakdown of plant constituents, e.g. phytate, leading to improved utilisation of the plant nutrients by the animal. Advantageously, the polypeptides of the invention may continue to degrade phytate in the feed in vivo. Fungal based polypeptides of the invention in particular generally have lower pH optima and are capable of releasing important nutrients in such acidic environments as the stomach of an animal.

The polypeptides of the invention may also be used during the production of milk substitutes (or replacers) from soybean. These milk substitutes can be consumed by humans and/or animals. The composition may additionally comprise (particularly when being formulated for use in animal feed) one or more ionophores, oxidising agents, surfactants, rumen protected amino acids, enzyme enhancers or enzymes which may be produced naturally in the gastro-intestinal tract of the animals to be fed. When added to feeds (including silage) for ruminants or monogastric animals (eg. poultry or swine) the feeds may comprise cereals such as barley, wheat, maize, rye or oats or cereal by-products such as wheat bran or maize bran, or other plant materials such as soy beans and other legumes. The enzyme(s) may significantly improve the break-down of plant material which leads to better utilisation of the plant nutrients by the animal. As a consequence, growth rate and/or feed conversion may be improved. The polypeptides of the invention are particularly applicable to animal feeds as they may still be active under highly acidic conditions, such as in the stomach of animals.

One method for the (exogenous) addition of the polypeptide of the invention is to add the polypeptide as transgenic plant material and/or (e.g. transgenic) seed. The polypeptide may thus have been synthesized through heterologous gene expression, for example the gene encoding the desired enzyme may be cloned in to a plant expression vector, under control of the appropriate plant expression signals, e.g. a tissue-specific promoter, such as a seed-specific promoter. The expression vector containing the gene encoding the polypeptide can be subsequently transformed into plant cells, and transformed cells can be selected for regeneration into whole plants. The thus obtained transgenic plants can be grown and harvested, and those parts of the plants containing the heterologous (to the plant) polypeptide can be included in one of the compositions, either as such or after further processing. The heterologous polypeptide may be contained in the seed of the transgenic plants or it may be contained in other plant parts such as roots, stems, leaves, wood, flowers, bark and/or fruit. Suitable plants include cereals, such as oats, barley, wheat, maize and rice.

The addition of the polypeptide in the form of transgenic plant material, e.g. in transgenic seed may require the processing of the plant material so as to make the polypeptide available, or at least improve its availability. Such processing techniques may include various mechanical (eg. milling and/or grinding) techniques or thermomechanical treatments such as extrusion or expansion.

The present invention thus also relates to a process for promoting growth and/or feed conversion in a monogastric or non-ruminant animal, the process comprising feeding the animal the polypeptide of the invention. Suitable animals include farm, monogastric and/or non-ruminant animals such as pigs (or piglets), poultry (such as chickens, turkeys), calves or veal or aquatic (e.g. marine) animals (for example fish). Example 1 Construction of phvtase-producing strains

DNA fragments having a sequence according to SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 were made synthetically. After verifying the DNA sequence, these synthetic gene fragments were fused to the A. niger phytase signal sequence using PCR and cloned under the control of the glucoamylase promoter. To this end, the phyA gene as present in the expression vector pGBTOPFYTI as described in international patent application WO 98/46772 was replaced with the modified phytase genes described above, yielding the vectors pTHFYT2, pTHFYT4 and pTHFYT6, respectively. The expression vectors pTHFYT2, pTHFYT4 and pTHFYTδ were introduced into Aspergillus niger CBS 646.97 (described in WO 98/46772). Using PCR, transformants containing pTHFYT2, pTHFYT4 or pTHFYT6 were selected. In order to determine whether these transformants were able to secrete active phytase, the transformants were grown on plates containing phytate as described by Chen (1998, Biotechnol. Techniques, 759-761). In this assay halo's around the Aspergillus colonies become visible if active phytase is secreted, due to the degradation of phytate. Using this assay it was shown that all expression vectors resulted in transformants secreting active phytase FYT2, FYT4 or FYT6 into the medium. Transformants showing clear halo's were grown in shake flask. 10⁷ spores of selected transformants and control strains were inoculated into shake flasks, containing 20 ml of liquid preculture medium containing per liter: 30 g maltose. H₂O; 5 g yeast extract; 10 g hydrolyzed casein; 1 g KH₂PO₄; 0.5 g MgSO₄.7H₂O; 0.03 g ZnCI₂; 0.02 g CaCI₂; 0.01 g MnSO₄ . 4H₂O; 0.3 g FeSO₄ . 7H₂0; 3 g Tween 80; 10 ml penicillin (5000 IU/ml)/Streptomycin (5000 UG/ml); pH 5.5. These cultures were grown at 34°C for 20-24 hours. 10 ml of this culture was inoculated into 100 ml of A. niger fermentation medium containing per liter: 70 g maltodextrines; 25 g hydrolyzed casein; 12.5 g yeast extract; 1 g KH₂PO₄; 2 g K₂SO₄; 0.5 g MgSO₄.7H₂O; 0.03 g ZnCI₂; 0.02 g CaCI₂; 0.01 g MnS0₄.4H₂O; 0.3 g FeSO₄.7H₂O; 10 ml penicillin (5000 IU/ml)/Streptomycin (5000 UG/ml); adjusted to pH 5.6 with 4 N H₂S0₄. These cultures were grown at 34°C for about 6 days. Samples taken from the fermentation broth were centrifuged (10', 5.000 rpm in a swinging bucket centrifuge) and supernatants collected. Example 2 Thermostability FYT2, FYT4 and FYT6

FYT2, FYT4, FYT6 and the wild type A.ficuum phytase (EP 0 420 358) were produced in shake flasks according to Example 1. Phytase production was followed by taking samples at appropriate time intervals and assaying the supernatant for phytase activity according to the method as described by van.Engelen et al. (Journal of AOAC International 1994, 77:760-764). Activity is expressed in FTU, where 1 FTU is the amount of enzyme that liberates 1 μmol of inorganic orthophosphate per minute under test conditions (pH=5.5, temperature 37°C, 5mM sodium phytate). The thermostability was measured on supernatants as such. When required, phytase supematants were further concentrated by ultrafiltration.

Thermostability was measured in three different ways. Firstly, the T50 of the phytase was determined. T50 (in °C) is the temperature at which 50% of the activity is lost after having heated the samples for 20 minutes. Experimental conditions: Stress test is performed in 250mM HAc/NaAc/Tween20 pH=4.0. The phytase is dosed at about 0.6 FTU/ml. After heating the samples were immediately cooled on ice. Subsequently the residual phytase activity was measured in 250mM HAc/NaAc/Tween20 pH=4.0. Results are shown in Table 1. FYT2 and FYT4 are about 8-9°C more stable.

Table 1 : Thermostability of various phytases

Secondly, the activity of the phytases was determined during heating. When carried out as a function of the heating temperature, the experiment gives the optimal temperature (Topt) of the enzyme with regard to the productivity. The incubation is carried out over a fixed time span of 30 minutes. The amount of substrate converted is dependent on the enzymatic activity as well as the inactivation. Therefore preferably the term productivity is used instead of activity. Experimental conditions: 250mM HAc/NaAc/Tween20 pH=4.0, phytase dosage about 0.012 FTU/ml. The released phosphate can be measured according standard assay methods as described before. Results are shown in Figure 3. FYT2 as well as FYT4 are most effective with respect to catalytic productivity at 75°C where the wild type control has lost its catalytic activity completely. Although activity starts to decrease above 75°C, Figure 3 shows that FYT2 as well as FYT4 are catalytically competent up to about 85°C. The behaviour of FYT6 is in between that of wild type and FYT2 or FYT4.

Thirdly, in addition to measuring the thermostability via an appropriate activity assay, the thermostability of the phytases was also determined directly by determining the temperature at which the 3-dimensional structure of the phytase enzyme unfolds. The heat effect that accompanies the unfolding can be measured directly by Differential Scanning Calorimetry (DSC). DSC experimental conditions: 250mM HAc/NaAc pH=4.0, about 5mg/ml phytase, heating rate is 2.5°C/min. The results are shown in Table 1. It can be seen that the structure of the native enzyme is maintained at a temperature that is about 9°C higher for the modified phytases FYT2 and FYT4 than for the wild type phytase.

Example 3 Pelleting stability of FYT2, FYT4 and FYT6

Tests with two pelleting matrices, and therefore temperature settings, were carried out with FYT2, FYT4 and FYT6 culture filtrates.

All granulates were made by mixing / kneading culture filtrate with the required amount of corn starch (C-gel from Cerestar) and water. See Tables 2 and 3 for composition of the wet mix. After mixing and kneading, the mixture was extruded with a Nica E-220 extruder and spheronised with a Fuji Paudal QJ-400G spheroniser. The obtained particles were dried in a Glatt GPCG 1.1 fluid bed dryer. Activity of the granules was between 2500 and 3000 FTU/g.

Table 2: Composition of RDS 05 granule mixture

Table 3: Composition of RDS A1 granule mixture

250 grams of granules were mixed in 25 kg feed with a composition according to

Table 4, and mixed just before the test with 225 kg of the same recipe. The 25 kg of feed was mixed in a Collete MP90 planetary mixer for 10 minutes. The 25 kg and 225 kg of feed were mixed in a 1200 liter Nauta mixer. Samples of this mixture were taken for determining the pelleting stability. This 250 kg mixture was dosed in a mixer / conditioners by a dosing screw, at a speed of 600 kg/h, where it was heated by direct steam injection till 80°C. The residence time was about 10-15 seconds, whereupon the hot mixture was pushed into the pelleting press. The matrix used in the tests was 5/45 mm (width / length; RDS 05) or 3/65 mm (width / length; RDS A1). The temperature of the pellets leaving the pelleting press was 82-83°C (RDS 05) or 91-93°C (RDS A1). After pressing the pellets fell on a cooling belt, from this belt samples were taken for stability testing.

Table 4: Composition of the poultry feed used in the RDS 05 and RDS A1 pelleting trials

Table 5: Pelleting yields of the thermostable phytases (RDS 05). The hot meal temperature was 80°C. The pellet temperature reached was about 82-83 °C. Yields are based on activity measurement before and after pelleting using the standard phytase assay (van.Engelen et al., Journal of AOAC International 1994, 77:760-764).

Table 6: Pelleting yields of the thermostable phytases (RDS 01). The hot meal temperature was 80°C. The pellet temperature reached was about 92-93 °C. Yields are determined as in Table 5.

The pelleting trials show a similar increase in thermostability of FYT2, FYT4 and FYT6 as compared to wild type at 82°C, whereas at 92°C FYT2 and FYT4 show a higher stability as compared to FYT6.

Example 4

Biochemical characteristics of phytases

The specific activity of the phytases was determined after purification of the phytases from filtrates which were obtained after filtration of fermentation broth. Purification of phytase was done by ion-exchange chromatography or affinity chromatography or a combination of both methods.

Affinity chromatography of glycosylated phytases was carried out using a ConA

(Concanavalin A) affinity matrix (HiTrap Con A, Amersham Pharmacia Biotech). The phytase was bound to column in 20mM Tris/0.5 M NaCI/1mM MnCI₂/1mM CaCI₂ / pH=7.4. After extensive washing of the column the phytase was eluted with 20mM Tris/

0.5 M NaCI/ 0.5M methyl-α-glucopyranoside/ pH=7.4. Regeneration of the column was conducted with 20mM Tris pH=8.5. The pH of the buffers was set with 4N HCl. Ion exchange chromatography was carried out using a anion exchanger

(Resource Q, Amersham Pharmacia Biotech ). Desalting and buffer changes were done using a PD-10 gelfiltration column. The equilibration of the column was done in 50mM

Tris, pH=7.5. After loading the phytase sample, the phytase was eluted using a gradient

0 to 1M NaCI in 50mM Tris pH=7.5.

The protein content of the purified phytase was determined by an E280 measurement, where 1 mg/ml phytase corresponds with OD₂₈₀,ι_Cπ_. = 0.938. For FYT2, FYT4 and FYT6, the OD₂₈₀,_1Cm at 1 mg/ml corresponds with 0.995, 0.995 and 0.963, respectively. The activity was determined in FTU as described by van Engelen et al.

(Journal of AOAC International 1994, 77:760-764). The Km values for phytic acid were determined by measuring the initial reaction rate as a function of the substrate concentration. The assay mixtures contained either 1.0, 0.5, 0.2, 0,1,0.05, 0.025, 0.015 mM phytic acid in 250 mM NaAc buffer pH=5.5. The enzyme reaction was stopped with 15 % TCA (1:1). The liberated inorganic phosphate was determined by mixing stopped reaction mixture with 0.6M H2SO4-2% ascorbic acid- 0.5% ammonium molybdate (1:1), incubating the mixture for 20 minutes at 50 °C and measuring the adsorbance at 820nm (Wyss et al. Appl Env Microbiol 1999, 65 : 367- 373). Results are shown in Table 7.

Table 7: Catalytic properties of phytases using phytic acid as a substrate

Table 7 shows that as compared to the wild type the specific activity as well as the high affinity for phytic acid is not affected by the modifications made. The pH dependency of the activity of the phytases was determined by measuring the rate of liberation of phosphate from phytic acid at different pH values. In principle the standard phytase assay was used, except that the pH was varied. The activity at pH=5.6 was taken as 100% activity. The following buffers were used to set the pH of the experiment: 250mM glycine in the pH range 2.8 to 3.2; 250mM NaAc in the pH range 3.6 to 5.6; 250mM imidazol in the pH range 6 to 7 and 250mM Tris in the pH range 7.5 to 9. The results are shown in Table 8.

Table 8: pH dependence of phytase enzymatic activity. The activity is given as the percentage of the observed maximal activity at pH = 5.6, which was set to 100%.

The pH dependence of the activity of the modified phytases is very similar as that of wild type. In particular the feature that the wild type phytase exhibits two pH optima is maintained. One pH optimum is found around pH=2.5 and the second optimum is around pH=5.5. Table 8 shows that this particular feature of wild type Aspergillus niger phytase is not affected by the modifications resulting in FYT2, FYT4 and FYT6.

Progress curves following degradation of phytic acid by phytase as a function of time were recorded in 250mM NaAc, pH=5.5 at 37°C. The dosing of the phytase was 0.05 FTU/ml at a substrate concentration of 0.2 mM phytic acid. The enzymatic reaction was stopped with 15 % TCA (1 :1). The liberated inorganic phosphate was determined by mixing 100 μl of reaction mixture with 1400 μl 0.3M H2SO4-1% ascorbic acid-0.27 % ammonium molybdate, subsequently incubating the mixture for 20 minutes at 50°C and measuring the adsorbance at 820nm. Results are shown in Table 9. Table 9: Progress curves for degradation phytic acid by phytases

It is shown that the modified phytases behave very similar to wild type phytase in liberating phosphate from phytic acid. After one hour the progress curves reach a plateau at about 80-85% of the phosphates released. All phytase reach this plateau at a similar rate, which indicates that the efficacy of wild type phytase in releasing phosphates from phytic acid is not affected by the modifications in the modified phytases.

In conclusion, the results show that the modifications of FYT2, FYT4 and FYT6 do not affect the catalytic performance of the given modified phytases as compared to the wild type. It shows that avoiding any mutation of the amino acids that are shown in Figure 1 (Residues within 7Angstroms zone around the substrate) and further retaining additional Aspergillus niger amino acids does maintain the functional properties of the wild type Aspergillus niger phytase.

Example 5 Bioefficacv of modified phytases

Trial with liquid phytases

A bioefficay test comparing the newly generated thermostable phytases was performed using them in a liquid formulation applied to the pellets after pelleting. The enzymes were applied in such doses that the added phytase activity would be 100, 200 or 300 FTU/kg feed. The test was performed in broilers (5-33 days) fed a maize-soy based diet (one feed for the first 14 days of the trial, and one, slightly different, diet during the last 14 days). The absorbable phosphorus content of the basal diets was 2.2 g/kg feed (day 5-19) and 1.7 g/kg feed (day 19-33). These values are well below the estimated requirement of the animals. Animals were housed in six floor pens per treatment, each pen containing 14 birds. The results were calculated on the basis of the analyzed phytase contents (FTU/kg), using the methods outlined by Finney (1964: Statistical method in biological assay. Charles Griffin, London.). The results for body weight are presented in Table 10.

Table 10. Relative efficacy of the different phytases (applied after pelleting as liquids) on body weight, compared to wild type (= 100%.), calculated over the whole experimental period (5-33 days), based on analyzed phytase activity.

The slopes of the regression lines for all products were significantly different from zero. As evident from table 10, there appeared little difference between the products, with the exception of FYT4. Animals fed this enzyme performed not as well as those fed with the other phytases, but the difference was not statistically significant.

Trial with granulated phytases

A test was performed to compare the thermostable phytases in a granulated formulation, applied to the pellets before pelleting. This means the phytases were put through the pelleting process. In this trial pelleting was performed at really high temperatures: pellets were approximately 92 °C. Because the aim was to obtain additions of 100, 200 or 300 FTU/kg to the feed as offered to the animals, a pre- pelleting trial was performed to estimate the activity loss during this process, and the products were overdosed to such an extent that the activities mentioned were realized. The test was performed in a similar way as the liquid product-trial, using broilers (5-33 days) fed a maize-soy based diet (only one diet for the whole period), having an absorbable phosphorus content well below the estimated requirement of these animals (1.9 g/kg feed). Animals were housed in six floor pens per treatment, each pen containing 14 birds. The results of the relative slopes of the regression lines for body weight gain are presented in Table 11. Table 11. . Relative efficacy of the different phytases on body weight gain (applied as granulates, except wild type which was applied to the pellets as liquid formulation after pelleting) compared to wild type (= 100%), calculated over the whole experimental period (5-33 days), based on analyzed phytase activity.

The phytase FYT2 performed best in this trial, followed by FYT6, FYT4 and wild type.

Example 6

Single mutants of phytase FYT2 and FYT6

The following single mutants were prepared of phytase FYT2: Y31 F, A78E, G163R, G180A, G182S, A194V, L211T, A215S, P242S, E254K, Q269N, A414P, E428R and E440A, and of phytase FYT6: E440A.

To this end the gene encoding FYT-2 (SEQ ID NO:2) or FYT6 (SEQ ID NO:6) was amplified by PCR in a total volume of 50 μl using 2.5 U Pwo polymerase (Roche diagnostics, GmbH, Mannheim, Germany), 100 ng DNA template, 0.5 mM dNTP, 1 x Pwo buffer, 10 pmol DSM-1 F and 10 pmol DSM-1 R under the following conditions 5' 94 °C, 30x (.30" 94 °C 1" 60 °C 2' 72 °C), 5' 72 °C The amplified fragment was cloned into the PCR^®-Blunt-TOPO (Invitrogen life technologies, Carlsbad, CA, USA) vector and mutations were introduced using the QuickChange kit from Stratagene (Stratagene, La Jolla, CA, USA) according to the recommendations of the supplier.

The sequence of the primers DSM-1 F and DSM-1 R was as follows:

DSM-1 F 5' GGCAGTCCCCGCCTCGAGAAAT 3"

DSM-1 R 5' GTCATCGCGATTAATTAATCTAAGCAAAACACTCCTCCCAGTT 3'

The following primers were used for mutagenesis, wherein the mutated codons are highlighted in bold. Mutation Primer set

Y31 F 5'- GGTCAATACTCCCCGTTCTTCTCTCTGGCAGAC - 3' 5'- GTCTGCCAGAGAGAAGAACGGGGAGTATTGACC - 3'

A78E 5' - TCCGCTCTCATTGAGGAGATCCAGAAGAACGCG - 3' 5' - CGCGTTCTTCTGGATCTCCTCAATGAGAGCGGA - 3'

G163R 5' - AAGCTGGCCGATCCTCGTGCCAACCCCGGCCAA - 3'

5' - TTGGCCGGGGTTGGCACGAGGATCGGCCAGCTT - 3'

G180A 5' - GTGATCATTCCCGAGGCCGCCGGCTACAACAAC - 3' 5 - GTTGTTGTAGCCGGCGGCCTCGGGAATGATCAC - 3'

G 182S 5' - ATTCCCGAGGGCGCCTCATACAACAACACTCTC - 3'

5' - GAGAGTGTTGTTGTATGAGGCGCCCTCGGGAAT - 3'

A194V 5' - CACGGCACCTGCACTGTCTTCGAAGAGAGCGAA - 3'

5' - TTCGCTCTCTTCGAAGACAGTGCAGGTGCCGTG - 3'

L211 T 5' - GCCAATTTCACCGCCACGTTCGCCCCCGCCATT - 3'

5' - AATGGCGGGGGCGAACGTGGCGGTGAAATTGGC - 3'

A215S 5' - GCCCTGTTCGCCCCCTCCATTCGTGCCCGTCGT - 3'

5' - ACGACGGGCACGAATGGAGGGGGCGAACAGGGC - 3'

P242S 5' - CTCATGGACATGTGCTCCTTCGACACCGTCGCC - 3' 5' - GGCGACGGTGTCGAAGGAGCACATGTCCATGAG - 3'

E254K 5' - ACCTCCGACGCCACCAAGCTGTCCCCCTTCTGT - 3'

5' - ACAGAAGGGGGACAGCTTGGTGGCGTCGGAGGT - 3'

Q269N 5' - CATGACGAATGGATCAACTACGACTACCTCCAG - 3'

5' - CTGGAGGTAGTCGTAGTTGATCCATTCGTCATG - 3'

A414P 5' - CCGCTGCATGGGTGTCCGGTTGATAAGTTGGGG - 3'

5' - CCCCAACTTATCAACCGGACACCCATGCAGCGG - 3' E428R 5' -CGGGATGACTTTGTGAGGGGGTTGAGCTTTGCT - 3'

5' - AGCAAAGCTCAACCCCCTCACAAAGTCATCCCG - 3'

E440A 5' - TCCGGGGGTAACTGGGCGGAGTGTTTTGCTTAG - 3'

5' - CTAAGCAAAACACTCCGCCCAGTTACCCCCGGA - 3'

The sequence of the resulting phytase DNA fragments was checked by sequence analysis. The phytase sequences were cloned in pGBTOPFYTI and culture supernatants were prepared as described in Example 1.

Of each single mutant and of FYT2 and FYT6 the T50 value was determined (see Example 2). The results are shown in Table 12.

Table 12: T50 values of phytase mutants

Most of the obtained mutants show a T50 value that is comparable to phytase FYT2. Surprisingly, the T50 value of FYT6, containing a combination of all single mutations, is considerably lower than that of the individual mutants.

Claims

1. A polypeptide which, when aligned to a model phytase, is modified as compared said model phytase in at least one of the following positions:

5, 6, 13, 19, 21 , 29, 31 , 36, 39, 43, 53, 69, 78, 81 , 85, 87, 99, 112, 113, 122, 125, 126, 128, 137, 147, 148, 157, 160, 163, 165, 169, 172, 176, 178, 180, 181 , 182, 183, 189, 194, 197, 201, 203, 211, 213, 215, 218, 222, 223, 225, 232, 233, 242, 246, 247, 248, 249, 250, 251 , 252, 254, 269, 291 , 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382, 384, 395, 414, 417, 425, 428,

438, 440.

2. A polypeptide according to claim 1 which comprises at least one of the following modifications: 5QS, 6SH, 13G, 19P, 211, 29S, 31FY, 36D, 39A, 43D, 53V, 69S, 78EA, 81K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 1761, 178P, 180AG, 181A, 182STG, 183Y, 189H, 194VA, 197E, 201G, 203D, 211TL, 213A, 215SA, 218A, 222A, 223H, 225P, 232E, 233D, 242SP, 246V, 247A, 248R, 249T, 250S, 251D, 252A, 254KE, 269NQ, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414PA, 417K, 425D, 428RKE, 438N, 440AE.

3. A polypeptide according to claim 1 which comprises at least one of the following modifications: 5QS, 6SH, 13G, 19P, 211, 29S, 31 Y, 36D, 39A, 43D, 53V, 69S, 78A, 81 K, 85A, 87K,

99T, 112Q, 1 13M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163G, 165N, 169A, 172V, 1761, 178P, 180G, 181 A, 182G, 183Y, 189H, 194A, 197E, 201 G, 203D, 21 1 L, 213A, 215A, 218A, 222A, 223H, 225P, 232E, 233D, 242P, 246V, 247A, 248R, 249T, 250S, 251 D, 252A, 254E, 269Q, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A,

395K, 414A, 417K, 425D, 428E, 438N, 440E.

4. A polypeptide which, when aligned to a model phytase, is modified as compared said model phytase in at least one of the following positions: 31 , 78, 163, 180, 182, 194, 211, 215, 242, 254, 269, 414, 428, 440.

5. A polypeptide according to any one of the preceding claims, wherein the model ^• phytase comprises the following amino acids: Q27, Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, R142, V143,

E179, D188, F243, KN277, K278, H282, S337, H338, D339, N340, F380, A35, A46, N130, S141, G167, Q168, D174, T191, E199, E205, L220, T235, D244, I268, H306, G341. K356, A381.

6. A polypeptide according to any one of the preceding claims, wherein the model phytase comprises the following amino acids:

Q27, Y28, R58, H59, G60, R62, Y63, P64, T65, DE66, S67, K68, K71, Y72, D103, S140, R142, V143, E179, D188, E196, D239, F243, G274, KN277, K278, H282, S337, H338, D339, N340, G341 , V378, F380, A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381.

7. A polypeptide according to any one of the preceding claims, wherein the polypeptide contains at least one of the following mutations: 31 Y, 78A, 163G, 180G, 182G, 194A, 211 L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.

8. A polypeptide according to any one of the preceding claims, wherein the model phytase has an amino acid sequence according to SEQ ID NO:1.

9. A polypeptide according to claim 1 , which is SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO: 7.

10. A polypeptide with at least 91 , preferably at least 92, more preferably at least 93, more preferably at least 94, more preferably at least 95, more preferably at least 96, more preferably at least 97, more preferably at least 98 or most preferably at least 99%) sequence homology (identity) to a polypeptide according to claim 9.

11. A polynucleotide comprising a polynucleotide sequence encoding the polypeptide according to any one of the preceding claims.

12. A polynucleotide according to claim 11 which is DNA.

13. A polynucleotide according to claim 11 comprising SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

14. A vector comprising a polynucleotide sequence according to any one of claims 11 to 13.

15. A vector according to claim 14 which is an expression vector, such as where the polypeptide-encoding polynucleotide sequence is operably linked to a regulatory sequence.

16. A host cell which expresses, as a heterologous protein, a polypeptide according to any one of claims 1 to 10.

17. A host cell transformed with the polynucleotide of claims 11 to 13 or the vector of claim 14 or 15.

18. A process of producing a polypeptide according to any of claims 1 to 10, the process comprising culturing a host cell as defined in claim 16 or 17 under conditions that provide for expression of the polypeptide.

19. A composition comprising a polypeptide according to any one of claims 1 to 10.