CN1656217A - Modified phytases - Google Patents

Abstract

The present invention describes modified phytases. These phytases are modified as compared to a model phytase in various positions, in particular to increase the thermostability of the modified phytase as compared to that of the model phytase. The modified phytases have further retained favourable properties of Aspergillus niger phytase, in particular because specific amino acid residues of Aspergillus niger phytase are retained in the modified phytase.

Description

The phytase of modifying

Technical field

The phytase that the present invention relates to modify.

Background technology

Plant contains a large amount of phytates as phosphatic storage form.Monogastric animal can not disengage phosphoric acid salt from phytate, therefore need replenish phosphoric acid salt in feed.Nowadays can in animal-feed, replenish phytase in phytate, to disengage phosphoric acid salt.

Phytase generally is added in the animal-feed in the process of making feed.In some stage of animal-feed preparation process, phytase can meet and comparatively high temps and higher levels of humidity.This type of condition has negative impact for the activity of instability mode compound (for example enzyme).Be derived from the phytase of aspergillus niger (Aspergillusniger), owing to its favourable character is usually used in the feed purposes.For example, this enzyme have the broad acid range optimal pH, wide Substratspezifitaet, phytic acid is had relative high specific acitivity and high-affinity, even under low phytic acid concentration this enzyme phytic acid of also can degrading effectively.In addition, this enzyme can successfully remove 5 phosphoric acid in 6 phosphoric acid from phytate, and can not pile up intermediate significantly, and its activity and stability do not need cofactor to be kept, and its inhibition to feed composition and metal ion is very inresponsive.

Yet the thermotolerance of the phytase of aspergillus niger is lower.Therefore, need have the favourable character that equates and at high temperature have high stability and active phytase with the aspergillus niger phytase.

The present invention openly has favourable character, for example high temperature and humidity is had the phytase of the modification of resistance.

Description of drawings

Fig. 1. aspergillus niger reactive site residue.

Fig. 2. with the reactive site residue IHP-S model coordinate (IHP 550H) of phytic acid compound aspergillus niger phytase.

Fig. 3. the phytase productivity is with respect to the figure of temperature.

Summary of the invention

Among the present invention, but phytase is the enzyme that catalysis phytate (phytate) is hydrolyzed to one or more following compounds: inositol five-, four-, three-, two-and list-phosphoric acid salt and/or inositol.General known some phytase can not be hydrolyzed into inositol in a large number with inositol monophosphate salt.Phytase can be 3-phytase or 6-phytase (being respectively EC3.1.3.8 or EC3.1.3.26), and this is meant the position of the ester bond that first is hydrolyzed.

A first aspect of the present invention relates to the phytase polypeptide of modification.Compared to the model phytase, modified according to polypeptide of the present invention, so that when compare with the model phytase, polypeptide of the present invention contains and is selected from following modification: will be present in amino acid replacement in the model phytase and be different amino acid, lack the amino acid or the insertion amino acid that are present in the model phytase.Wherein, will make homology (consistent) residue that can between polypeptide of the present invention and model phytase, obtain maximum according to polypeptide of the present invention and the comparison of model phytase.

In the preferred embodiment of the invention, this is modified to alternative.

The number of modifying can be at least one, and preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 70, more preferably at least 80.

In the present invention, the representation such as " 5QS " means, and the amino acid of position 5 substitutes with Q or S in the correlation model phytase.The character of amino-acid residue originally may depend on used model phytase.Representation such as " Q5S " means, be present in the model phytase particular amino acid residue (for example Q) through different aminoacids for example S substitute.

Preferably compare with the model phytase, the phytase of modification column position under at least one is modified: 5,6,13,19,21,29,31,36,39,43,53,69,78,81,85,87,99,112,113,122,125,126,128,137,147,148,157,160,163,165,169,172,176,178,180,181,182,183,189,194,197,201,203,211,213,215,218,222,223,225,232,233,242,246,247,248,249,250,251,252,254,269,291,296,310,312,315,322,330,342,346,362,365,367,368,372,374,375,382,384,395,414,417,425,428,438,440; Or preferably modified: 13,19,21,29,31,36,39,43,53 at least one following column position, 69,78,81,85,87,99,112,113,122,125,126,128,137,147,148,157,160,163,165,169,172,176,178,180,181,182,183,189,194,197,201,203,211,213,215,218,222,223,225,232,233,242,246,247,248,249,250,251,252,254,269,291,296,310,312,315,322,330,342,346,362,365,367,368,372,374,375,382,384,395,414,417,425,428,438,440; Or preferably modified: 13,19,21,29,36,39,43,53 at least one following column position, 69,81,85,87,99,112,113,122,125,126,128,137,147,148,157,160,165,169,172,176,178,181,183,189,197,201,203,213,218,222,223,225,232,233,246,247,248,249,250,251,252,291,296,310,312,315,322,330,342,346,362,365,367,368,372,374,375,382,384,395,417,425,438,440.Even more preferably, the phytase of modification is modified on the column position down at least one compared to the model phytase: 31,78,163,180,182,194,211,215,242,254,269,414,428,440.

Especially, compared to the model phytase, the phytase of modification contains at least one following modification: 5QS, 6SH, 13G, 19P, 21I, 29S, 31FY, 36D, 39A, 43D, 53V, 69S, 78EA, 81K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 176I, 178P, 180AG, 181A, 182STG, 183Y, 189H, 194VA, 197E, 201G, 203D, 211TL, 213A, 215SA, 218A, 222A, 223H, 225P, 232E, 233D, 242SP, 246V, 247A, 248R, 249T, 250S, 251D, 252A, 254KE, 269NQ, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414PA, 417K, 425D, 428RKE, 438N, 440AE; Or more preferably, have following modification a: 5QS, 6SH, 13G, 19P, 21I, 29S, 31Y at least compared to the model phytase, 36D, 39A, 43D, 53V, 69S, 78A, 81K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163G, 165N, 169A, 172V, 176I, 178P, 180G, 181A, 182G, 183Y, 189H, 194A, 197E, 201G, 203D, 211L, 213A, 215A, 218A, 222A, 223H, 225P, 232E, 233D, 242P, 246V, 247A, 248R, 249T, 250S, 251D, 252A, 254E, 269Q, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414A, 417K, 425D, 428E, 438N, 440E.

Best, compared to the model phytase, the phytase of modification contains at least one following modification: 31Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.

The Position Number that the present invention uses is according to the Position Number of SEQ ID NO:1.

The model phytase that uses among the present invention is the phytase that can derive from the Aspergillus filamentous fungus, preferably derives from the phytase of aspergillus niger, or is derived from the varient phytase of any this type of phytase.Known in each bacterial strain of aspergillus niger phytase show the variation of low degree, promptly the homology of these phytases is at least 90%.Also known aspergillus niger species comprise the species that before are called Fructus Fici aspergillus (Aspergillus ficuum) and Aspergillus awamori (Aspergillus awamori).The best model phytase is for deriving from the phytase of aspergillus niger NRRL3135, i.e. phytase shown in SEQ ID NO:1.

Especially preferred model phytase is the phytase that contains the particular amino acid residue combination that is present in uniquely in the aspergillus niger phytase.

Especially preferred, the model phytase reactive site contain with aspergillus niger phytase correspondence position on the identical amino acid of amino-acid residue.For this reason, the invention discloses a kind of method, can determine to be arranged in aspergillus niger phytase activity position by this, appear at apart from the residue of a certain distance of bonded phytate.

Form the reactive site of aspergillus niger phytase and can use aspergillus niger phytase 3D structure to be confirmed at the process amino-acid residue relevant of aspergillus niger phytase degraded phytic acid with catalytic property, this 3D structure can be from Protein Data Bank (PDB), accession number 1IHP (Kostrewa et al.NatureStructural Biology, 1997,4,185).Aspergillus niger 3D structure does not contain substrate phytic acid (phytate).Yet, can obtain and the 3D structure of phytic acid compound intestinal bacteria phytase (PDB enter the mouth 1DKQ, Lim et al., Nature Structural Biology, 2000,7,108).Though sequence homology is low, these two kinds of phytases demonstrate substantial structural similarity.It is stacked only to use the alpha-carbon atom of showing those residues of similar folded pattern in aspergillus niger phytase (1IHP) and intestinal bacteria phytase to carry out the atomic coordinate of two kinds of phytases during beginning.With alternative manner enlarge the residue that stacked in comprise, up to this stacked can not again be improved till thereafter.Use is used for the root-mean-square deviation of stacked atom and judges stacked quality.In final stacked in, amino acid fragment 1DKQ:6-22,46-66,83-106,246-257,268-278,296-313,328-338,346-351,375-381,392-398 is stacked and placed on 1IHP:48-64,104-124,133-156,270-281,293-303,331-348,379-389,397-402,406-412 is on the 422-428.

The substrate phytic acid is taken out in stacked back from intestinal bacteria phytase activity position, be transferred to the corresponding site of aspergillus niger phytase.Then the aspergillus niger phytase with compound phytic acid carries out energy minimization, allows substrate and the displacement of reactive site residue and remaining structure is maintained fixed.Use Insight ﹠amp; Discover program (Accelrys, San Diego CA) is used SGI Octane workstation to use field of force CVFF and is carried out energy minimization.The model based coding of the aspergillus niger phytase of the compound phytic acid that produces is IHP-S.The solvent that is calculated as follows amino-acid residue can be near the surface, and described amino-acid residue has the distance of any atom of an atom and substrate phytic acid at least in 7 dusts, found that to touch off a smooth and continuous surface that can be close to the pocket that holds phytic acid ideally.The atomic coordinate that forms the residue of this reactive site pocket is shown in Fig. 1.In addition, the IHP-S model is used to confirm substrate different zones residue on every side.The result provides in Fig. 2.

Therefore, in the present invention, the reactive site amino-acid residue of aspergillus niger phytase be with at reactive site bonded phytic acid those residues in certain segment distance.Preferably at a distance of 6 dusts, more preferably 7 dusts.

Therefore, especially preferred model phytase contains amino acid Q27, Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, R142, V143, E179, D188, F243, KN277, K278, H282, S337, H338, D339, N340, F380 (in distance 6 dusts) preferably contains amino acid Q27, Y28, R58, H59, G60, R62, Y63, P64, T65, DE66, S67, K68, K71, Y72, D103, S140, R142, V143, E179, D188, E196, D239, F243, Q274, KN277, K278, H282, S337, H338, D339, N340, G341, V378, F380 (in distance 7 dusts).

Especially preferred model phytase also contains the following amino acid that is present in the aspergillus niger phytase: A35, A46, N130, S141, G167, Q168, D174, T191, E199, E205, L220, T235, D244,1268, H306, G341, K356, A381.

For the present invention, tool is not key to have which kind of amino-acid residue on the not concrete indicated position.These not concrete indicated positions are positions in aspergillus niger phytase activity position not, and are not above indicated extraly aspergillus niger amino acid, also do not carry out aforesaid specific modification.Use known comparison program comparison phytase can be disclosed on certain position which amino acid typically to occur.Any this amino acid can be present in all that this does not specifically indicate the position accordingly in the polypeptide of the present invention.

Therefore, be such phytase according to preferred polypeptide of the present invention, this enzyme contains the identical amino-acid residue of amino acid with aspergillus niger phytase corresponding position at reactive site, and indicated extraly aspergillus niger amino acid (is A35, A46, N130, S141, G167, Q168, D174, T191, E199, E205, L220, T235, D244, I268, H306, G341, K356 A381) and further contains above-described modification.

According to especially preferred polypeptide of the present invention is the phytase that also contains at least one following amino-acid residue: 31Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E and/or 440E.Contain at least one following amino-acid residue: 180G, 182G, 242P and/or 440E according to another especially preferred polypeptide of the present invention; Or preferably 180G, 182G and/or 242P at least.

Particularly, the invention discloses phytase polypeptide according to the modification of SEQ ID NO:3, SEQ ID NO:5 or SEQ IDNO:7.

Polypeptide of the present invention can comprise the modification that provides more than all.In addition, polypeptide of the present invention can comprise extra modification, and these additionally are modified at the position that relates in this polypeptide can not influence folding or active position of polypeptide for modifying.Typically, this modification can be conservative substituting, and is promptly nonpolar, polarity is uncharged, polarity is charged or aromatic amino acid is substituted by the different aminoacids of same type.

In a specific embodiments, the sequence that polypeptide of the present invention can comprise with SEQ ID NO:3, SEQ IDNO:5 or SEQ ID NO:7 has 91 at least, preferably at least 92, more preferably at least 93, more preferably at least 94, more preferably at least 95, more preferably at least 96, more preferably at least 97, the more preferably polypeptide of at least 98 or most preferably at least 99% homology (homogeny).

Compared to the model phytase, become the biological effect of ball stability and/or improvement according to the granulated feed to the enzyme optimal pH of the specificity of some substrate and/or change and/or improvement of the specific activity of modified thermostability with raising of polypeptide of the present invention and/or change and/or change, and/or improvement in the intravital expression of host living beings of the phytase that is used to produce modification or transportation or the like.

In preferred embodiments, the biochemical character that still keeps several aspergillus niger phytases (the especially phytase that can obtain from aspergillus niger NRRL 3135) according to polypeptide of the present invention.The biochemical character that keeps is Km value and/or at optimal pH and/or the specific activity and/or the high reactivity under physiological temp of about 5.5 and 2.5 2 pH values.

In preferred embodiments, has the thermostability of raising according to polypeptide of the present invention.Compared to the model phytase, phytase thermostability according to modification of the present invention increases, and this can show as in the feature of the folding/reactivate again of lifetime longer under the temperature of given rising and/or improvement and/or separate folding feature under higher temperature.

The favourable character that multiple aspergillus niger phytase is arranged after improving thermostability simultaneously according to polypeptide of the present invention surprisingly.

(for example to thermostability or active important) amino acid important to polypeptide of the present invention, and can be used as the amino acid of alternate potential object thus can be according to methods known in the art, for example site-directed mutagenesis or alanine scanning mutagenesis are confirmed and are modified.Sudden change is introduced in each residue position at molecule in one technology of back, and the biological activity (for example phytase activity) of the mutating molecule that test produces is to confirm the amino-acid residue to the molecular activity key.Technical measurement crystalline structure such as also available core mr, crystallography or light affinity tag or molecule modeling, the analyzing crystal structure is to determine enzyme substrates interaction site afterwards.

Polypeptide of the present invention is usually by the polynucleotide sequence of expressing coded polypeptide in the suitable host organisms preparation of recombinating, but also available synthetic method prepares.

Expection uses yeast and fungal host cells that posttranslational modification effect (for example proteolysis processing, myristylation effect, glycosylation, brachymemma and tyrosine, Serine or Threonine phosphorylation) can be provided, and this may be essential for the biological activity of giving recombinant expressed product the best of the present invention.

Polypeptide of the present invention can provide with the form of leaving its n cell environment.Therefore, it can be separated in fact or purifying (discussing as above) or contain its cell at non-natural, for example produces in other fungal species cell, zooblast, yeast or the bacterium.

Polypeptide of the present invention can be analyzed to measure its improvement compared to model phytase known in the art with the known any suitable test of those skilled in the art.

Second aspect the invention provides (for example separate and/or purifying) polynucleotide, and it comprises the polynucleotide sequence of the polypeptide of the first aspect of encoding.Especially, the invention provides polynucleotide, it comprises the polynucleotide sequence of aminoacid sequence shown in coding SEQ ID NO:3, SEQ ID NO:5 or the SEQ ID NO:7 or comprises SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

The polynucleotide of second aspect also comprise any degeneracy form of polynucleotide sequence of the polypeptide of the first aspect of encoding.For example, those skilled in the art can use routine techniques to use the protein sequence that carries out nucleotide substitution and do not influence polynucleotide encoding of the present invention according to any codon of waiting to express the specific host organism of polypeptide of the present invention.

The polynucleotide sequence of second aspect can be RNA or DNA and comprises genomic dna, synthetic DNA or cDNA.Preferably, polynucleotide are dna sequence dna.

Polynucleotide of the present invention can be synthetic according to methods known in the art.It can by combination according to and produce along the nucleotide sequence synthetic oligonucleotide of polynucleotide of the present invention.

Perhaps, it can synthesize by wanting the position to carry out mutagenesis parent's polynucleotide any.

For example, polynucleotide of the present invention can make up from a series of that to have about 20 Nucleotide eclipsed length mutually be the synthetic oligonucleotide of 80 Nucleotide.Carry out PCR (typical 10 steps) with having the active polysaccharase of check and correction, with the annealing of the oligonucleotide of all 80-mer and extend this oligonucleotide.And have the active polysaccharase of check and correction and be positioned at required segmental 5 ' and 3 ' terminal PCR primer carry out further PCR, synthetic complete required fragment.Complete fragment cloning is gone into appropriate carriers and is checked order whether obtain correct sequence with check.Can be optionally, the correct sequence mistake is for example used the QuickChange test kit from Stratagene, corrects according to the explanation of manufacturers.

Can use polynucleotide of the present invention to obtain the polynucleotide of the further modified polypeptides of coding, for example with induced-mutation technique with in addition mutagenesis of polynucleotide of the present invention.Can use site-directed mutagenesis to change polynucleotide of the present invention at one or more specific positions.Can use gene shuffling technology (for example referring to WO95/22625, WO98/27230, WO98/01581 and/or WO00/46344) to obtain the polynucleotide varient, combination at random takes place in the variation position that wherein is present among each member of the initial colony of polynucleotide, and this initial colony comprises that one or more are according to polynucleotide of the present invention.

The present invention also provides the carrier that comprises polynucleotide of the present invention, comprises cloning vector and expression vector.

The carrier that has wherein inserted expression cassette of the present invention or polynucleotide of the present invention can be any carrier that can use easily in recombinant DNA method, and the selection of carrier often depends on that carrier is with the host cell that imports.Therefore, carrier is the independent carrier that duplicates, and promptly carrier exists with the outer entity form of karyomit(e), and it duplicates with THE REPLICATION OF CHROMOSOME irrelevant, for example has plasmid, clay, virus or the phage vector of replication orgin usually.Perhaps, carrier can be to introduce the carrier that can be integrated into behind the host cell in the host cell gene group and duplicate jointly with its karyomit(e) of integrating.Carrier can be the polynucleotide of ring-type (for example plasmid) or linear (for example expression cassette).

Preferably, polynucleotide of the present invention can insert expression cassette.In expression cassette, polynucleotide of the present invention may be operably coupled to can be for host cell own coding sequence express polypeptide provides on the regulating and controlling sequence of condition, and promptly this carrier is an expression vector.This paper term " is operably connected " and means and put, and the position relation between the wherein described component makes them to work in its expection mode.Regulating and controlling sequence for example promotor, enhanser or other expression regulation signal " is operably connected " with encoding sequence, means that the position of regulating and controlling sequence will allow under the condition compatible with regulating and controlling sequence from the encoding sequence express polypeptide.

The expression cassette that is used for given host cell with the successive order from 5 '-end to 3 '-end (with respect to the coding strand of the sequence of coding first aspect polypeptide) comprises the following elements that is operably connected mutually: the promoter sequence that can instruct the dna sequence dna of coded polypeptide to transcribe in given host cell; Randomly, can instruct signal sequence from given secretory host cell polypeptide to substratum; The encoding mature form, the dna sequence dna of the polypeptide of preferred activity form; Preferably and in the dna sequence dna downstream of coded polypeptide can stop the Transcription Termination zone (terminator) that dna sequence dna is transcribed.

Except the natural promoter of the gene of the natural primary polypeptide of the present invention of encoding, can use other promotor to instruct expression of polypeptides of the present invention.Can in the expectation host, instruct the effectiveness of expression of polypeptides of the present invention to select promotor based on promotor.

Can select promotor/enhanser and other to express conditioning signal, so that and expression cassette or the designed host cell compatibility that is used for of carrier.Preferably, promoter sequence is derived from the gene of highly expressing.The gene that camber of the present invention is expressed refers to that its mRNA accounts for the gene of at least 0.01% (w/w) of total cell mRNA (for example under the inductive condition), or gene product accounts for the gene of total cell protein matter at least 0.2% (w/w), or secretory volume is at least the gene of 0.05 grams per liter for the gene with secretory dna product.The example that is preferred for deriving promotor and/or is included in the preferred heights expressing gene in the expression cassette preferred intended target locus to be integrated into comprises (but non-being limited to) coding glycolytic ferment, triose-phosphoric acid isomerase (TPI) for example, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphoglyceric kinase (PGK), pyruvate kinase (PYK), the gene of alcoholdehydrogenase (ADH), and coding amylase, glucoamylase, proteolytic enzyme, dextranase, cellobiohydrolase, beta-galactosidase enzymes, alcohol (methyl alcohol) oxydase, the gene of elongation factor and ribosomal protein.The particular instance of suitable highly expressing gene for example comprises: the LAC4 gene of kluyveromyces (kluyveromyces), the methanol oxidase gene of debaryomyces hansenii (Hansenula) and pichia spp (Pichia) (being AOX and MOX respectively), glucoamylase (glaA) gene of aspergillus niger (A.niger) and Aspergillus awamori (A.awamori), the TAKA-amylase gene of aspergillus oryzae (A.oryzae), the cellobiose hydrolase gene of the gpdA gene of Aspergillus nidulans (A.nidulans) and Trichodermareesei (T.reesei).

In order will in bacterium, to express, can use prokaryotic promoter, especially can use to be applicable to colibacillary prokaryotic promoter.The example of strong bacterium promotor is α-Dian Fenmei and SPo2 promotor, and the promotor of extracellular protease gene.

Yeast promoter comprises the nmt 1 and the adh promotor of the GAL4 of yeast saccharomyces cerevisiae (S.cerevisiae) and ADH promotor, schizosaccharomyces pombe (S.pombe).The example of strong Yeast promoter is can be from the promotor of alcoholdehydrogenase, Sumylact L, glycerol 3-phosphate acid kinase and triose-phosphate isomerase gene.

Being applied to expressed in fungi host's the strong composing type and/or the preferred embodiment of inducible promoter is the promotor that can take from fungal gene zytase (xlnA), phytase, ATP-synthetic enzyme, subunit 9 (oliC), triose-phosphate isomerase (tpi), alcoholdehydrogenase (AdhA), α-Dian Fenmei (amy), amyloglucosidase (AG-is from the glaA gene), acetamidase (amdS) and glyceraldehyde-3-phosphate dehydrogenase (gpd).

The promotor that is applicable to vegetable cell comprises the promotor of nopaline synthase (no), octopine synthase (ocs), mannopine synthase (mas), ribulose small subunit (rubico ssu), histone, rice Actin muscle, Kidney bean albumen, cauliflower mosaic virus (CMV) 35S and 19S and Orbivirus (circovirus).Can obtain these all promotors easily in the art.

If polypeptide will be prepared as secretary protein, then the polynucleotide sequence of encoding mature polypeptide form may be operably coupled to the polynucleotide sequence of coded signal peptide in the expression cassette.

Preferably, this signal sequence is natural (homologous) with respect to the polynucleotide sequence of coded polypeptide.Signal sequence derives from the aspergillus niger phytase gene in the preferred embodiments of the invention, especially as being disclosed in the signal sequence of EP 0 420 358.Perhaps, signal sequence can be external (allogenic) with respect to the polynucleotide sequence of coded polypeptide, and in this case, the preferred signals sequence is the endogenous sequence of expressing the host cell of this dna sequence dna.Signal sequence can with drive this signal sequence institute from the encoding sequence expression promoter make up with common use, the signal sequence of combination (deceive) aspergillus amyloglucosidase (also being called (gluco) amylase) promotor and amyloglucosidase (AG) gene (18 and 24 amino acid whose version all can) for example, signal sequence also can make up with other promotor.

Also can use the signal sequence of heterozygosis among the present invention.The example of the suitable signal sequence that is used for yeast host cell is the signal sequence that is derived from yeast α-factor gene.The suitable signal sequence that is used for bacterium is from alpha-amylase gene (genus bacillus).

In some cases, the cracking of signal sequence can take place during the path in more than one position via secretion in polypeptide, and this means can produce the mature polypeptide with variable N-end.The present invention includes the polypeptide that these have variable N-end.

The polynucleotide sequence downstream of coded polypeptide can be the 3 ' non-translational region that includes one or more Transcription Terminations site (for example terminator).The source of terminator is very unimportant.Terminator can be for example natural terminator of the polynucleotide sequence of coded polypeptide.Yet, the preferred terminator that in yeast host cell, uses the yeast terminator and in filamentous fungal host cell, use filamentous fungus.The more preferably endogenous terminator of host cell (wherein expressing the polynucleotide sequence of coded polypeptide).

Carrier can contain one or more selected markers, so that can select transformant from the no transformed cells of majority.

Preferred selected marker comprise (but non-being limited to) those can remedy the host cell defective or give the mark of drug resistance.It comprises the common tags gene that for example can be used for most of filamentous funguss and yeast conversion, for example acetamidase gene or cDNA (Aspergillus nidulans, aspergillus oryzae, or the amdS of aspergillus niger, niaD, facA gene or cDNA), or provide microbiotic such as G418, Totomycin, bleomycin, kantlex, the gene of phleomycin or benomyl (benA) resistance, perhaps, can use specific selective marker, for example need the nutrient defect type mark of corresponding sudden change host strain system: URA3 (from yeast saccharomyces cerevisiae or from the similar gene of other zymic) for example, pyrG or pyrA (from Aspergillus nidulans or aspergillus niger), argB (from Aspergillus nidulans or aspergillus niger) or trpC.In preferred embodiments, after introducing expression construct, in transformed host cells, delete selective marker so that obtain the transformed host cell that can produce polypeptide that does not contain selectable marker gene.

Other mark comprise ATP synthetic enzyme, subunit 9 (oliC), Orotidine-5 '-'-the intestinal bacteria uidA gene of the G418 resistant gene of phosphoric acid-decarboxylase (pvrA), bacterium (this also can be used for yeast, but non-fungi), anti-ampicillin resistance gene (intestinal bacteria), neomycin resistance gene (genus bacillus) and coding β-glucuronidase (GUS).Can for example be used to produce RNA or be used for transfection or transformed host cell at external use carrier.

The dna sequence dna of coded polypeptide is preferably introduced suitable host as the some of expression cassette.For transforming suitable host, can use method for transformation well known to those skilled in the art with expression cassette.But the expression cassette that is used to transform the host can be the some of the carrier that carries selective marker, but or expression cassette can be used as independent molecule and carry out cotransformation jointly with the carrier that carries selective marker.Described carrier can comprise one or more selectable marker gene.

For most filamentous fungus and yeast, carrier or expression construct preferably are incorporated in the host cell gene group to obtain the stable conversion body.Yet, also can obtain suitable episomal vector to some yeast, expression construct can be inserted and wherein obtain stable and high level expression.The example comprises 2 μ that are derived from yeast belong and genus kluyveromyces respectively and the carrier of pKD1 plasmid, or includes the carrier of AMA sequence (for example AMA1 of Aspergillus).When expression construct was integrated in the host cell gene group, construct can use homologous recombination to be incorporated into intended target locus or random integration in genomic locus, and in last situation, the selected objective target locus comprises the gene of highly expressing.The suitable example of many highly expressing genes is provided before.

The present invention also provides the host cell that comprises polynucleotide of the present invention or carrier of the present invention.Polynucleotide can be allogenic for the host cell gene group.This paper term " allogenic " means non-natural and is present in the polynucleotide in the host cell gene group or the polypeptide of the natural generation of non-this cell.

Suitable host cells for example is preferably prokaryotic micro-organisms: bacterium, or most eukaryotes more preferably, for example: fungi is yeast or filamentous fungus for example, or vegetable cell.

From the bacterium of bacillus is very suitable heterologous host, but because its secretory protein to substratum.Other suitable host bacterium is from streptomyces (streptomyces) and Rhodopseudomonas (Pseudomonas).

The preferred yeast host cell that is used to express the dna sequence dna of code book invention polypeptide is yeast belong, genus kluyveromyces, Hansenula, Pichia, Yarrowia and Schizosaccharomyces yeast.Preferred yeast host cell is selected from: yeast saccharomyces cerevisiae, Kluyveromyces lactis (kluyveromyces lactis) (also being called kluyveromyces marxianus lactic acid subspecies (kluyveromyces marxianus var.lactis)), multiple-shaped nuohan inferior yeast (Hansenulapolymorpha), pichia pastoris phaff (pichia Pastoris), Yarrowia lipolytica, and schizosaccharomyces pombe (Schizosaccharomyces pombe).

Filamentous fungal host cell most preferably.Preferred filamentous fungal host cell is selected from: Aspergillus (Aspergillus), Trichoderma (Trichoderma), fusarium (Fusarium), Disporotrichum, Penicillium (Penicillium), Acremonium (Acremonium), Neurospora (Neurospora), thermophilic ascomycete belong to (Thermoascus), myceliophthora (Myceliophtora), Sporotrichum (Sporotrichum), Thielavia (Thielavia) and Talaromyces.Better filamentous fungal host cell is aspergillus oryzae (Aspergillus oryzae), Aspergillus sojae (Asperigillus sojae), Aspergillus nidulans, or the bacterial classification of aspergillus niger group is (through Raper and Fennell definition, The GenusAspergillus, The Williams ﹠amp; Wilkins Company, Baltimore, pp 293-344,1965).This type of bacterial classification comprises (but non-being limited to): aspergillus niger, Aspergillus awamori, Tabin aspergillus (Aspergillustubingensis), microorganism Aspergillus aculeatus (Aspergillus aculeatus), smelly aspergillus (Aspergillusfoetidus), Aspergillus nidulans, aspergillus japonicus (Aspergillus Japonicus), aspergillus oryzae and Fructus Fici aspergillus (Asperigillus ficcum), and: bacterial classification Trichodermareesei (Trichoderma reesei), fusarium graminaria (Fusarium graminearum), Penicllium chrysogenum (Penicilliumchrysogenum), Acremonium alabamense, coarse arteries and veins spore mould (Neurospora crassa), the thermophilic silk mould (Myceliophtora thermophilum) of ruining, have a liking for Mierocrystalline cellulose side spore mould (Sporotrichum cellulophilum), Disporotrichum dimorphosporum and Thielavia terrestris.

The example of preferred expressive host is in the scope of the invention: fungi, for example Aspergillus and Trichoderma; Bacterium, for example subtilis, bacillus licheniformis and bacillus amyloliquefaciens of genus bacillus for example, pseudomonas; And yeast genus kluyveromyces for example, for example: Kluyveromyces lactis and yeast belong, for example yeast saccharomyces cerevisiae.

Also comprise vegetable cell according to host cell of the present invention, so the present invention prolongs and contains the transgenic organism of one or more cells of the present invention, for example plant with and partly.Therefore genetically modified (or genetic modification) plant can insert (for example stably) encode sequence of one or more polypeptide of the present invention in its genome.Can use known technology, for example use the Ti or the Ri plasmid transformed plant cells of agrobacterium tumefaciens.So, plasmid (or carrier) can contain the necessary sequence of infection plant, and can use the derivative of Ti and/or Ri plasmid.

Perhaps, can directly infect the some of plant, for example leaf, root or stem.But wound plant to be infected in this technology is for example with the blade cuts plant or with the needle penetration plant or with denuding thing friction plant.Then wound inoculation Agrobacterium.

Plant or plant partly can be grown on the suitable substratum and develop into sophisticated plant then.Can use the plant of known technology, for example use the bud of microbiotic selection conversion and upload foster this bud of being commissioned to train at the substratum that includes suitable nutrition, plant hormone etc. with transformant regeneration genetic modification.

So another aspect of the present invention provides through transforming or transfection comprises the host cell of polynucleotide of the present invention or carrier.Preferably polynucleotide are included in the carrier that is used for duplicating polynucleotide and express polypeptide.Can select and the compatible cell of this carrier energy, for example (for example bacterium), fungi, yeast or the vegetable cell of protokaryon.

Also can select heterologous host, polypeptide wherein of the present invention is not to contain the form generation that has similar active other polypeptide with polypeptide of the present invention in fact.Can select usually not produce host and reach this purpose with similar active this type of polypeptide.

If polynucleotide of the present invention are incorporated the reproducible carrier of reorganization into, then this carrier is used in and duplicates this polynucleotide in the compatible host cell.

So the present invention further provides the method that produces according to polynucleotide of the present invention, wherein will introduce reproducible carrier, carrier is introduced compatible host cell, and causing the host cell of growing under the condition that carrier duplicates according to polynucleotide of the present invention.The carrier that includes according to polynucleotide of the present invention can reclaim from host cell.Appropriate host cell comprises for example intestinal bacteria of bacterium.

The present invention further provides the method for preparing according to polypeptide of the present invention, wherein allowing to express (by vector expression) according to cultivating host cell (for example its conversion or transfection aforesaid expression vector) under the condition of polypeptide of the present invention and reclaiming polypeptide expressed alternatively.Preferably polypeptide is prepared into secretion type protein, the polynucleotide sequence of encoding mature polypeptide form may be operably coupled on the polynucleotide sequence of coded signal peptide in the expression construct in the case.

Can cultivate with methods known in the art according to recombinant host cell of the present invention.For the combination of each promotor and host cell, can obtain to help to express the culture condition of polypeptide of the present invention.After reaching desired cell density or polypeptide titre, can stop to cultivate, and reclaim polypeptide with known method.

Fermention medium can comprise known substratum, wherein contain carbon source (for example glucose, maltose, molasses), nitrogenous source (for example ammonium sulfate, ammonium nitrate, ammonium chloride, organic nitrogen source, for example yeast extract, wort, peptone) and other inorganic nutrition source (for example phosphoric acid salt, magnesium, potassium, zinc, iron, etc.).Alternatively, can comprise inductor.

The selection of appropriate culture medium can be based on expressive host and/or based on the regulation and control demand of expression construct and decide.This substratum is that those skilled in the art are known.Substratum can optionally contain additional composition, thereby makes the expressive host of conversion have more growth vigor than other possible contaminating microorganisms.

Fermentation can be carried out 0.5-30 days.Fermentation can be in batches, continuously or the fed-batch method, suitably temperature is between 0 to 45 ℃, and pH is between for example between 2 to 10.Preferred fermentation condition be temperature between 20 to 37 ℃ and/or pH between 3 to 9.Usually select felicity condition based on expressive host of selecting and expressed protein.

After the fermentation,, can use centrifugal or filter in the nutrient solution that ferments to remove cell if necessary.After fermentation stopped the back or removes cell, recyclable polypeptide of the present invention was optionally used the ordinary method purifying and is separated.

Easily, polypeptide of the present invention can mix to produce peptide composition with suitable (solid-state or liquid) carrier or thinner (comprising damping fluid).Polypeptide can combine with carrier or mix, and for example is fixed on the solid-state carrier.So the present invention further provides the composition that contains polypeptide of the present invention.This can be the form of packing, transporting and/or storing of being suitable for, and keeps the activity of polypeptide preferred this moment.Composition can be paste, liquid, emulsion, powder, thin slice, particle, ball or other extrudate form.

Composition can further comprise extra composition, for example one or more (extra) enzymes.

Generally, polypeptide can stably be mixed with liquid or dried forms.Generally, product can be made into and randomly comprise the composition of for example stablizing buffer reagent and/or sanitas.

The invention still further relates to the food or animal feedstuff compositions or the additive that comprise one or more polypeptide of the present invention.Polypeptide can be present in the feed, and its concentration is different from natural concentration.Preferred amount is 0.1 to 100, for example 0.5 to 50, be preferably 1 to 10mg/kg feed.

The present invention also relates to the method for preparing animal feedstuff compositions, and this method comprises polypeptide of the present invention is added in one or more edible feed substances or the composition.Polypeptide can separate individually with feed substances or composition or combine other fodder additives and is added in the animal feedstuff compositions.Polypeptide can be feed substances or composition component part or one of.

Polypeptide of the present invention also can be added in the animal-feed decomposition with improvement plant composition (for example phytate), and the improvement animal is to the utilization of plant nutrient.Advantageously, the polypeptide of the present invention phytate in the feed that can continue in vivo to degrade.Fungi polypeptide of the present invention has lower optimal pH especially usually and can discharge important nutrition in the sour environment such such as the animal stomach.

Polypeptide of the present invention also can be used for producing in the process of milk surrogate (or substitute) from soybean.This type of milk surrogate can be supplied the mankind and/or animal.

Described composition can comprise the amino acid, enzyme reinforce of (especially when its preparation is used for animal-feed) one or more ionophores, oxygenant, tensio-active agent, protection cud or the enzyme of natural generation in the gi tract of animal on the feed extraly.In the time of in being added into ruminating animal or monogastric animal (for example poultry or pig) feed (comprising silage), feed can comprise cereal, for example barley, wheat, corn, rye or oat or cereal by-products, for example wheat bran or corn bran, or other vegetable material, for example soybean and other beans.Enzyme can improve the degraded of vegetable material significantly, makes animal utilize plant nutrient better.The result can improve growth velocity and/or feed conversion.

Because polypeptide of the present invention still has activity at (for example in the animal stomach) under the condition of highly acidic, so it especially can be used for animal-feed.

A method of external source interpolation polypeptide of the present invention is the form adding polypeptide with transgenic plant material and/or (for example genetically modified) seed.So polypeptide can be synthetic via allogeneic gene expression, and for example the gene of the coding enzyme of wanting can be cloned into plant expression vector, and by suitable expression of plants signal, tissue-specificity promoter for example, and for example seed-specificity promoter is controlled.The expression carrier that includes coded polypeptide can then be transformed into vegetable cell, can select cell transformed with the regeneration whole plants.Can grow and gather in the crops the transgenic plant that so obtain, the plant that includes allos (for plant) polypeptide partly can directly or after further processing be included in the composition.Heterologous polypeptide can be contained in and maybe can be contained in other plant in the seeds of transgenic plant partly, for example in root, stem, leaf, xylem, flower, bark and/or the fruit.Suitable plant comprises cereal grass, for example: oat, barley, wheat, corn and rice.

With the transgenic plant material form, for example the transgenic seed form is added polypeptide may need vegetable material is processed so that animal can obtain polypeptide, or improves its utilization ratio at least.This processing technology can comprise that the processing of the technology of mechanicalness of all kinds (for example grind and/or grind) or hot mechanicalness for example pushes or extend.

So the present invention also relates to promotion simple stomach or the growth of non-ruminating animal and/or the method for feed conversion, and this method comprises with polypeptide feeding animals of the present invention.Suitable animal comprises the simple stomach and/or the non-ruminant animal on farm, for example pig (or piggy), poultry (for example chicken, turkey), calf or calf or aquatic products (for example marine products class) animal (for example fish).

Embodiment

Embodiment 1

Make up the bacterial strain that produces phytase

Synthetic dna fragmentation with SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 sequence.After confirming dna sequence dna, use PCR to merge these synthetic gene fragments, and be cloned under the control of glucoamylase promotor to aspergillus niger phytase signal sequence.For this reason, the phyA gene that will be present in the International Patent Application WO 98/46772 described pGBTOPFYT1 expression vector replaces with the phytase gene of aforesaid modification, produces carrier pTHFYT2, pTHFYT4 and pTHFYT6 respectively.

Expression vector pTHFYT2, pTHFYT4 and pTHFYT6 are introduced aspergillus niger CBS646.97 (being described in WO98/46772).Use PCR to select to include the transformant of pTHFYT2, pTHFYT4 or pTHFYT6.Whether can secreting active phytase in order to measure these transformants, transformant is cultivated in that (1998, Biotechnol.Technique12 is 759-761) on the described flat board that includes phytate as Chen.In this test, if secrete active phytase, then because the phytate degraded can be seen haloing near the aspergillus bacterium colony.Use this test confirm all expression vectors all cause can secreting active phytase FYT2, FYT4 or FYT6 to the transformant of substratum.

The transformant of clear display haloing is incubated at shakes in the bottle.With 10 of selected transformant and control strain ⁷Individual spore inoculating goes into to shake bottle, includes 20 milliliters pre-nutrient solution in the bottle, and wherein every liter of nutrient solution contains: 30 gram maltose H2O; 5 gram yeast extracts; The casein of 10 gram hydrolysis; 1 gram KH ₂PO ₄0.5 gram MgSO ₄7H ₂O; 0.03 gram ZnCl ₂0.02 gram CaCl ₂0.01 gram MnSO ₄4H ₂O; 0.3 gram FeSO ₄7H ₂O; 3 gram Tween80; 10 ml penicillins (5000IU/ milliliter)/Streptomycin sulphate (5000UG/ milliliter); PH5.5.These cultures were grown 20-24 hour down at 34 ℃.10 milliliters cultures are seeded to 100 milliliters of fermentation of Aspergillus niger nutrient solutions, contain in every liter of nutrient solution: 70 gram Star Dri 5s; The casein of 25 gram hydrolysis; 12.5 gram yeast extract; 1 gram KH ₂PO ₄2 gram K ₂SO ₄0.5 gram MgSO ₄7H ₂O; 0.03 gram ZnCl ₂0.02 gram CaCl ₂0.01 gram MnSO ₄4H ₂O; 0.3 gram FeSO ₄7H ₂O; 10 ml penicillins (5000IU/ milliliter)/Streptomycin sulphate (5000UG/ milliliter); Use 4N H ₂SO ₄Transfer to pH5.6.These cultures were grown about 6 days down at 34 ℃.With the sample of fermentation culture centrifugal (10 minutes, 5.000rpm, swingingbucket whizzer) and collect supernatant liquor.

Embodiment 2

The thermostability of FYT2, FYT4 and FYT6

In shaking bottle, produce FYT2, FYT4, FYT6 and wild-type Fructus Fici aspergillus niger phytase (EP 0 420 358) according to embodiment 1.Take a sample at interval and according to van.Engelen etc. with appropriate time. (Journal of AOAC International 1994,77:760-764) method of describing is measured the activity of phytase in the supernatant liquor to follow the trail of the generation of phytase.Activity represents that with FTU the enzyme amount of 1FTU (pH=5.5,37 ℃ of temperature, 5mM sodium phytate) per minute under the test condition disengages the inorganic orthophosphate of 1 μ mol.Measure the thermostability of enzyme in the supernatant liquor.Optionally, the phytase supernatant liquor further concentrates with ultrafiltration process.

Measure thermostability with three kinds of different methods.At first, measure the T50 of phytase.T50 (℃) be sample heating forfeiture 50% active temperature after 20 minutes.Experiment condition: stress test carries out under the pH=4.0 at 250mMHAc/NaAc/Tween20.The about 0.6FTU/ milliliter of the dosage of phytase.After the sample heating at once in cooled on ice.Then, measure remaining phytase activity among the pH=4.0 at 250mM HAc/NaAc/Tween20.Result such as table 1.High about 8-9 ℃ of the thermostability of FYT2 and FYT4.

Table 1: the thermostability of various phytases

Phytase	??T50(℃)	??Topt(℃)	??DSC?Td(℃)
				???FYT2	????74	????75	????79
???FYT4	????73	????75	????79
				???FYT6	????65	????68	????70
Wild-type	????65	????64	????70

Secondly, in heating period intermittent gauging decide the activity of phytase.When the change Heating temperature experimentizes, obtain the optimum temperuture (Topt) of the enzyme with regard to productivity.Incubation carries out 30 fens clock times of fixed.The activity that the amount of substrate conversion depends on enzyme is deactivation therewith.Therefore preferably use the term productivity and nonactive.Experiment condition: 250mM HAc/NaAc/Tween20 pH=4.0, the about 0.012FTU/ milliliter of phytase dosage.The phosphoric acid salt that disengages can be measured according to above-mentioned standard detecting method.The result as shown in Figure 3.FYT2 and FYT4 are the most effective with regard to catalytic productivity under 75 ℃, and the wild-type contrast has then completely lost its catalytic activity.Though begin to reduce in activity more than 75 ℃, Fig. 3 shows that FYT2 and FYT4 still have catalytic capability under up to about 85 ℃.The behavior of FYT6 is between wild-type and FYT2 or FYT4.

The 3rd, except measuring the thermotolerance via suitable activation analysis, the thermotolerance of phytase is also directly determined by the temperature of measuring phytase three-dimensional structure unfolding.Follow the heating effect of unfolding can use dsc (DSC) directly to measure.The experiment condition of DSC: 250mMHAc/NaAc pH=4.0, about 5 mg/ml phytases, heating rate is 2.5 ℃/minute.The result is as shown in table 1.As can be seen, with regard to the temperature of keeping the natural enzyme structure, the phytase FYT2 of modification and FYT4 exceed about 9 ℃ than wild-type phytase.

Embodiment 3

The granulated feed of FYT2, FYT4 and FYT6 becomes ball stability

Become the ball mould with two kinds of granulated feeds, and thus with the differing temps setting, test FYT2, FYT4 and FYT6 culture filtrate.

All particles are made by mixing/kneading by W-Gum (the C-gel is from Cerestar) and the water of cultivating filtrate and requirement.Consulting the wet mixture of table 2 and 3 forms.After mixing and the kneading, mixture extrudes with Nica E-220 extrusion machine and makes spherolite with Fuji Paudal QJ-400G pelletizer.The particle that obtains Glatt GPCG 1.1 fluidized bed dryer dryings.Seed activity restrains between 2500 to 3000FTU/.

The composition of table 2:RDS 05 granular mixture

Phytase	Enzyme liquid (gram)	Starch (gram)	Water (gram)
				??FYT2	????176	????748	????123
??FYT4	????238	????1137	????194
				??FYT6	????377	????1300	????156
Wild-type	????127	????1300	????352

The composition of table 3:RDS Al granular mixture

Phytase	Enzyme liquid (gram)	Starch (gram)	Water (gram)
				??FYT2	????241	????1300	????274
??FYT4	????271	????1300	????259
				??FYT6	????290	????1622	????362
Wild-type	????109	????1300	????363

Raise mixing 250 gram particles in section's (composition is according to table 4) at 25kg, and before facing test, mix with the same recipe of 225kg.This 25kg feed mixed 10 minutes with Collete MP90 planetary mixing tank.This 2.5kg mixes in 1200 liters of Nauta mixing tanks with the 225kg feed.Determine that with the sample of mixture granulated feed becomes ball stability.In mixing tank/condiment device, add this 250kg mixture with the 600kg/ speed at one hour rating, be heated to 80 ℃ by the open steam injection herein by the batching screw rod.The about 10-15 of residence time second, afterwards hot mixt is pushed into the ball squeezer.The mould that uses in the test is 5/45mm (width/height; RDS05) or 3/65mm (width/height; RDS Al).Temperature when piller leaves into the ball squeezer is 82-83 ℃ (RDS 05) or 91-93 ℃ (RDSAl).With piller push away drop down onto on the cooling zone after, carry out stability test from being with sampling.

Table 4: be used for the composition that RDS 05 and RDS Al granulated feed become the poultry feed of ball test

Raw material	Content (%)
			??RDS?05	??RDS?Al
	Corn	????45			????50
Pea (20.7%cp)			????5	????-
	Rapeseed meal				????4.5
The sunflower seed powder				????4.5
	Corn gluten meal				????2.5
Full soybean (baking)			????10	????6
	Soyflour (46.7%cp)	????27.50			????21
Cassava (62,5-67,5 starch)			????4.72	????3.85
	Soybean oil (vegetables oil)	????3.50			????1.0
Animal tallow			????-	????3.7
	Vitamin/mineral pre-composition Mervit 100	????1.00			????0.5
Wingdale			????1.35	????1.35
	Mono phosphoric acid ester calcium	????1.30			????0.2
Salt			????0.35	????0.18
	?NaHCO 3				????0.25
L-Methionin			????0.05	????0.26
	The DL-methionine(Met)	????0.23			????0.18
The L-Threonine				????0.03

Table 5: the one-tenth ball productive rate of thermally-stabilised phytase (RDS 05).The temperature of hot powder is 80 ℃.The ball temperature reaches 82-83 ℃ approximately.(77:760-764) activity of Ce Lianging is the basis to productive rate for van.Engelen etal, Journal of AOAC International 1994 with use standard phytase analysis before and after becoming ball.

Phytase	Become ball productive rate %
		????FYT2	????79
????FYT4	????81
		????FYT6	????81
Wild-type	????36

Table 6: the one-tenth ball productive rate of thermally-stabilised phytase (RDS 01).The temperature of hot powder is 80 ℃.The ball temperature reaches 92-93 ℃ approximately.The productive rate measurement result is as shown in table 5.

Phytase	Become ball productive rate %
		????FYT2	????39
????FYT4	????37
		????FYT6	????19
Wild-type	????12

Become the ball test to be presented under 82 ℃, compared to wild-type, the thermotolerance of FYT2, FYT4 and FYT6 all has similar increase, is higher than FYT6 in the stability of 92 ℃ of following FYT2 and FYT4.

Embodiment 4

The biochemical characteristic of phytase

After filtering fermentation culture,, then measure the phytase specific activity from filtrate purifying phytase.Combination purifying phytase with ion exchange chromatography or affinity chromatography or this two method.

Use ConA (the plain A of sword bean ball) affinity matrix (HiTrap Con A, AmershamPharmacia Biotech) to carry out the affinity chromatography of glycosylation phytase.At 20mM Tris/0.5MNaCl/1mM MnCl ₂/ 1mM CaCl ₂Among/the pH=7.4 phytase is incorporated on the post.After thoroughly cleaning pillar, use 20mM Tris/0.5M NaCl/0.5M methyl-α-Fu Nan glucoside/pH=7.4 wash-out phytase.With 20mM Tris pH=8.5 regeneration pillar.PH of buffer is regulated with 4N HCl.

Use anionite (Resource Q, Amersham Pharmacia Biotech) to carry out ion exchange chromatography.Use PD-10 gel-filtration column desalts and changes damping fluid.Use 50mMTris, pH=7.5 balance pillar.Behind the last sample phytase sample, use 0 to 1M gradient NaCl wash-out phytase in 50mM Tris pH=7.5.

Measure the protein content of determining the purifying phytase through E280,1 mg/ml phytase is equivalent to OD _280,1cm=0.938.The OD of 1 mg/ml FYT2, FYT4 and FYT6 _280,1cmBe equivalent to 0.995,0.995 and 0.963 respectively.The activity of measuring represents with FTU, method be described in vanEngelen et al. (Journal of AOAC International 1994,77:760-764) in.

As the function measurement initial reaction rate of concentration of substrate to determine the Km value of phytic acid.Test mixture includes 1.0,0.5,0.2,0.1,0.05,0.025,0.015mM phytic acid (in 250mM NaAc pH of buffer=5.5).Stop enzyme reaction with 15%TCA (1: 1).Mix 0.6M H ₂SO ₄-2% xitix-0.5% ammonium molybdate and terminated reaction mixture (1: 1), mixture was 50 ℃ of following incubations 20 minutes, (Wyss et al.Appl Env Microbiol 1999 65:367-373), therefore measures the inorganic phosphate that disengages in the absorption of measurement 820nm.The results are shown in Table 7.

Table 7: phytase uses the catalytic property of phytic acid as substrate

Biochemical property	Wild-type	??FYT2	??FYT4	??FYT6
					Specific activity (FTU/ milligram)	???100	??102	??103	??98
Km(μm，pH＝5.5)	???12	???8	???5	??5

Table 7 shows to be compared with wild-type, and the modification of being carried out does not influence specific activity and to the high-affinity of phytic acid.

Under different pH values, measure and discharge phosphatic speed from phytic acid, the pH dependency of mensuration phytase activity.Use standard phytase analytical test except changing pH in principle.Be decided to be 100% activity with the activity under the pH=5.6.Use following damping fluid to set the pH:250mM glycine of experiment, the pH scope is 2.8 to 3.2; 250mM NaAc, the pH scope is 3.6 to 5.6; 250mM imidazoles, pH scope are 6 to 7 and 250mM Tris, and the pH scope is 7.5 to 9.This results are shown in Figure 8.

Table 8: the pH dependency of phytase activity.Activity is expressed as the per-cent of observed maximum activity under the pH=5.6 (being set at 100%).

	With respect to the active active % under pH=5.6
						????FYT2	????FYT4	????FYT6	Wild-type
The pH value
					????2.8	????77.7	????78.7	????81.7	????70.4
????3.2	????77.0	????79.7	????67.9	????59.3
					????3.6	????52.9	????54.1	????45.5	????46.1
????4.0	????39.9	????43.2	????38.5	????39.3
					????4.4	????77.9	????76.6	????71.9	????70.6
????4.8	????85.5	????84.8	????84.1	????90.0
					????5.2	????90.0	????93.7	????92.9	????99.8
????5.6	????100.0	????100.0	????100.0	????100.0
					????6.0	????92.2	????91.8	????80.1	????80.5
????6.5	????65.6	????67.8	????48.2	????55.6
					????7.0	????46.5	????50.7	????32.7	????27.6
????7.5	????22.3	????23.7	????25.1	????4.2
					????7.9	????1.6	????1.7	????2.6	????0.4
????8.5	????0.2	????0.2	????0.7	????0.8
					????9.0	????0.4	????0.3	????0.6	????0.3

The active pH dependency of the phytase of modifying and wild-type closely similar.Especially, two optimal pHs that the wild-type phytase shows, this character is maintained.One of them optimal pH is about pH=2.5, and second optimal pH is about pH=5.5.Table 8 shows that this particular characteristics of wild-type aspergillus niger phytase is not subjected to the influence of the modification among FYT2, FYT4 and the FYT6.

At 250mM NaAc, pH=5.5, under 37 ℃, the progress curve of phytase degraded phytic acid is with function of time record.Reaction substrate concentration is the 0.2mM phytic acid, and the dosage of phytase is the 0.05FTU/ milliliter.Stop enzyme reaction with 15%TCA (1: 1).Mix 1400 microlitre 0.3M H ₂SO ₄The reaction mixture of-1% xitix-0.27% ammonium molybdate and 100 microlitres, then mixture is in the 50 ℃ of following incubations 20 minutes and the absorption of measuring 820nm, thereby measures the inorganic phosphate that disengages.The results are shown in Table 9.

Table 9: the progress curve of phytase degraded phytic acid

	OD under the 820nm
						????FYT2	????FYT4	??FYT6	Wild-type
The incubation time (minute)
					????0	????0	????0	????0	????0
????10	????0.31	????0.35	????0.36	????0.38
					????20	????0.59	????0.72	????0.75	????0.65
????45	????0.84	????0.84	????0.85	????0.83
					????90	????0.87	????0.90	????0.89	????0.86

The phytase that the result shows modification disengage from phytic acid aspect the phosphoric acid salt closely similar with the wild-type phytase.The progress curve arrives platform after one hour, disengages the phosphoric acid salt of 80-85% approximately.It is similar that all phytases arrive the speed of this platform, shows that the wild-type phytase discharges the influence of not modified in the phytase that phosphatic effect modifying from phytic acid.

Conclusion: the result shows that compared to the wild-type phytase, the modification among FYT2, FYT4 and the FYT6 does not exert an influence to catalytic performance.The result shows the sudden change of the amino acid of avoiding among any Fig. 1 of being showed in (residues around substrate in the 7 dust zones) and keeps the functional property that described extra aspergillus niger amino acid can keep wild-type aspergillus niger phytase further.

Embodiment 5

The biological effect of the phytase of modifying

The test of liquid phytase

Make the back at granulated feed and phytase is added granulated feed, use it for afterwards in the biological effect test with the relatively newer heat-stable phytase that produces with the liquid preparation form.By the phytase activity that adds will for 100,200 or these enzymes of dose application of 300FTU/kg feed test, wherein use broiler (5-33 days), feeding is based on the meals (preceding 14 days a kind of meals of feeding of test, back 14 days a kind of slightly different meals of feeding) of corn-soybean.Absorbable phosphorus content is 2.2 gram/kg feeds (5-19 days) and 1.7 gram/kg feeds (19-33 days) in the basal diet.These numerical value are far below the animal demand of estimating.For every kind of processing, animal rearing has 14 animals (chicken) in each cage in six layers chicken coop.(1964:Statistical methodin biological assay.Charles Griffin, method London.) is based on phytase content (FTU/kg) calculation result of analyzing to use Finney.Body weight the results are shown in Table 10.

Table 10.Calculate at whole different phytases of experimental session (5-33 days) (granulated feed make back with applied in liquid form) according to the phytase activity of analyzing and to compare the relative potency that body weight produces with wild-type (=100%).

Table 10

The test product	????BW
		????FYT2	????98
????FYT4	????68
		????FYT6	????103
Wild-type	????100

The slope of the tropic of all products is offset from zero significantly.As seen from Table 10, except that FYT4, almost there is not difference between product.Though the performance of the animal of this enzyme of feeding is good not as the animal of other phytase of feeding, difference is not remarkable statistically.

The test of particulate state phytase

The heat-stable phytase that adds the granular preparation form of granulated feed before forming granulated feed passes a test and compares.This meaning is promptly put into phytase in the pill process.Pillization is carried out with about 92 ℃ high temperature in this test.Because this target is to add 100,200 or 300FTU/kg in the feed of animal, test is estimating active forfeiture in this method before therefore granulating, and overtreatment provides product so that reach described activity.Use similar in appearance to the method for product liquid test and test, use the meals (all period only use a kind of meals) of broiler (5-33 days) feeding corn soybean for the basis, absorbable phosphorus content is far below the estimation requirement (1.9 gram/kg feed) of these animals in these meals.Every kind of processing, animal are raised in cages in six layers of chicken coop, and 14 chickens are arranged in each cage.The relative slope of the body weight increment tropic sees Table 11.

Table 11 compares the relative potency (except wild-type added in the granulated feed with liquid preparation, other was all used with particle) of body weight increment after granulating in whole experimental session (5-33 days) different phytases and wild-type (=100%) according to the phytase activity calculating of analyzing.

The test product	???BWG
		????FYT2	???147
????FYT4	???126
		????FYT6	???137
Wild-type	???100

Best in this test with phytase FYT2, next FYT6, FYT4 and wild-type.

The single sudden change of embodiment 6 phytase FYT2 and FYT6

The following single sudden change of preparation for phytase FYT2 is: Y31F, and A78E, G163R, G180A, G182S, A194V, L211T, A215S, P242S, E254K, Q269N, A414P, E428R and E440A, and for phytase FYT6 be: E440A.

To encode the in this regard gene pcr amplification of FYT-2 (SEQ ID NO:2) or FYT6 (SEQ ID NO:6), its cumulative volume is 50 μ l, use 2.5UPwo polysaccharase (Rochediagnostics, GmbH, Mannheim, Germany), 100ng dna profiling, 0.5mMdNTP, 1xPwo damping fluid, 10pmol DSM-1 F and 10pmol DSM-1R, amplification condition is: 94 ℃ of following 5 minutes, 30x (94 ℃ 30 seconds, 60 ℃ 1 second, 72 ℃ 2 minutes), 72 ℃ following 5 minutes.Amplified fragments is cloned into PCR ^-Blunt-TOPO (Invitrogen lifetechnologies, Carlsbad, CA, USA) carrier and use Stratagene (Stratagene, La Jolla, CA, QuickChange test kit USA) is introduced sudden change according to supplier's suggestion.

The sequence of DSM-1F and DSM-1R primer is as follows:

DSM-1F?5′GGCAGTCCCCGCCTCGAGAAAT3’

DSM-1R?5′GTCATCGCGATTAATTAATCTAAGC

AAAACACTCCTCCCAGTT3′

Use following primer to carry out mutagenesis, wherein Tu Bian codon is represented with boldface type.

Mutant primer is right

Y31F????5’-GGTCAATACTCCCCGTTCTTCTCTCTGGCAGAC-3’

5’-GTCTGCCAGAGAGAAGAACGGGGAGTATTGACC-3’

A78E????5’-TCCGCTCTCATTGAGGAGATCCAGAAGAACGCG-3’

5’-CGCGTTCTTCTGGATCTCCTCAATGAGAGCGGA-3’

G163R???5’-AAGCTGGCCGATCCTCGTGCCAACCCCGGCCAA-3’

5’-TTGGCCGGGGTTGGCACGAGGATCGGCCAGCTT-3’

G180A???5’-GTGATCATTCCCGAGGCCGCCGGCTACAACAAC-3’

5-GTTGTTGTAGCCGGCGGCCTCGGGAATGATCAC-3’

G182S???5’-ATTCCCGAGGGCGCCTCATACAACAACACTCTC-3’

5’-GAGAGTGTTGTTGTATGAGGCGCCCTCGGGAAT-3’

A194V???5’-CACGGCACCTGCACTGTCTTCGAAGAGAGCGAA-3’

5’-TTCGCTCTCTTCGAAGACAGTGCAGGTGCCGTG-3’

L211T???5’-GCCAATTTCACCGCCACGTTCGCCCCCGCCATT-3’

5’-AATGGCGGGGGCGAACGTGGCGGTGAAATTGGC-3’

A215S???5’-GCCCTGTTCGCCCCCTCCATTCGTGCCCGTCGT-3’

5’-ACGACGGGCACGAATGGAGGGGGCGAACAGGGC-3’

P242S???5’-CTCATGGACATGTGCTCCTTCGACACCGTCGCC-3’

5’-GGCGACGGTGTCGAAGGAGCACATGTCCATGAG-3’

E254K???5’-ACCTCCGACGCCACCAAGCTGTCCCCCTTCTGT-3’

5’-ACAGAAGGGGGACAGCTTGGTGGCGTCGGAGGT-3’

Q269N???5’-CATGACGAATGGATCAACTACGACTACCTCCAG-3’

5’-CTGGAGGTAGTCGTAGTTGATCCATTCGTCATG-3’

A414P???5’-CCGCTGCATGGGTGTCCGGTTGATAAGTTGGGG-3’

5’-CCCCAACTTATCAACCGGACACCCATGCAGCGG-3’

E428R???5’-CGGGATGACTTTGTGAGGGGGTTGAGCTTTGCT-3’

5’-AGCAAAGCTCAACCCCCTCACAAAGTCATCCCG-3’

E440A????5’-TCCGGGGGTAACTGGGCGGAGTGTTTTGCTTAG-3’

5’-CTAAGCAAAACACTCCGCCCAGTTACCCCCGGA-3’

The sequence of the phytase dna fragmentation that produces with the sequential analysis inspection.The phytase sequence clone is gone into pGBTOPFYTI and as is described in that method prepares culture supernatants among the embodiment 1.

Measure the T50 value (consulting embodiment 2) of the various single mutation of FYT2 and FYT6.This results are shown in Table 12.

Table 12: the T50 value of phytase mutant

Phytase	????T50℃
		????FYT2-Y31F	????74
????FYT2-A78E	????74
		????FYT2-G163R	????74
????FYT2-G180A	????71
		????FYT2-G182S	????73
????FYT2-A194V	????74
		????FYT2-L211T	????74
????FYT2-A215S	????74
		????FYT2-P242S	????73
????FYT2-E254K	????73
		????FYT2-Q269N	????74
????FYT2-A414P	????74
		????FYT2-E428R	????74
????FYT2-E440A	????74
		????FYT6-E440A	????65
????FYT2	????74
		????FYT6	????65

The most of mutant that obtain show that its T50 value and phytase FYT2's is suitable.Surprisingly, include the T50 value of FYT6 of combination of all single mutation far below the T50 value of each single mutation.

Sequence table

＜110〉BASF Aktiengesellchaft

＜120〉phytase of Xiu Shiing

<130>20720WO

<160>7

<170>PatentIn?version?3.1

<210>1

<211>444

<212>PRT

＜213〉the ripe phytase of aspergillus niger (ASPERGILLUS NIGER)

<400>1

Ala?Ser?Arg?Asn?Gln?Ser?Ser?Cys?Asp?Thr?Val?Asp?Gln?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

Cys?Phe?Ser?Glu?Thr?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ala?Pro?Phe?Phe

20??????????????????25??????????????????30

Ser?Leu?Ala?Asn?Glu?Ser?Val?Ile?Ser?Pro?Glu?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

Arg?Val?Thr?Phe?Ala?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50???????????????????55?????????????????60

Thr?Asp?Ser?Lys?Gly?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Glu?Ile?Gln

65??????????????????70??????????????????75??????????????????80

Gln?Asn?Ala?Thr?Thr?Phe?Asp?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

Asn?Tyr?Ser?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Glu

100?????????????????105?????????????????110

Leu?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Gln?Arg?Tyr?Glu?Ser?Leu?Thr

115?????????????????120?????????????????125

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ser?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

Ala?Ser?Gly?Lys?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Thr?Lys?Leu?Lys

145?????????????????150?????????????????155?????????????????160

Asp?Pro?Arg?Ala?Gln?Pro?Gly?Gln?Ser?Ser?Pro?Lys?Ile?Asp?Val?Val

165?????????????????170?????????????????175

Ile?Ser?Glu?Ala?Ser?Ser?Ser?Asn?Asn?Thr?Leu?Asp?Pro?Gly?Thr?Cys

180?????????????????185????????????????190

Thr?Val?Phe?Glu?Asp?Ser?Glu?Leu?Ala?Asp?Thr?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

Thr?Ala?Thr?Phe?Val?Pro?Ser?Ile?Arg?Gln?Arg?Leu?Glu?Asn?Asp?Leu

210?????????????????215?????????????????220

Ser?Gly?Val?Thr?Leu?Thr?Asp?Thr?Glu?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

Cys?Ser?Phe?Asp?Thr?Ile?Ser?Thr?Ser?Thr?Val?Asp?Thr?Lys?Leu?Ser

245?????????????????250?????????????????255

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Asn?Tyr?Asp?Tyr

260?????????????????265?????????????????270

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

Gly?Pro?Thr?Gln?Gly?Val?Gly?Tyr?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

Thr?His?Ser?Pro?Val?His?Asp?Asp?Thr?Ser?Ser?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

Ser?Ser?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ser?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

Ser?His?Asp?Asn?Gly?Ile?Ile?Ser?Ile?Leu?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Thr?Val?Glu?Asn?Ile?Thr?Gln

355?????????????????360?????????????????365

Thr?Asp?Gly?Phe?Ser?Ser?Ala?Trp?Thr?Val?Pro?phe?Ala?Ser?Arg?Leu

370?????????????????375?????????????????380

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Gln?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Pro?Val?Asp

405?????????????????410?????????????????415

Ala?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Ser?Phe?Val?Arg?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

Ala?Arg?Ser?Gly?Gly?Asp?Trp?Ala?Glu?Cys?Phe?Ala

435?????????????????440

<210>2

<211>1335

<212>DNA

＜213〉synthetic DNA

<220>

<221>CDS

<222>(1)..(1335)

<223>

<400>2

gcc?tcg?aga?aat?tcc?cac?agt?tgc?gat?acg?gtc?gat?ggc?ggg?tat?caa????48

Ala?Ser?Arg?Asn?Ser?His?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

tgc?ttc?ccc?gag?atc?tcg?cat?ctt?tgg?ggt?caa?tac?tcc?ccg?tac?ttc????96

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Tyr?Phe

20??????????????????25??????????????????30

tct?ctg?gca?gac?gaa?tcg?gcc?atc?tcc?cct?gac?gtg?ccc?gcc?gga?tgc????144

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

aga?gtc?act?ttc?gtc?cag?gtc?ctc?tcc?cgt?cat?gga?gcg?cgg?tat?ccg????192

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

acc?gac?tcc?aag?tcc?aag?aaa?tac?tcc?gct?ctc?att?gag?gcc?atc?cag????240

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Ala?Ile?Gln

65??????????????????70??????????????????75??????????????????80

aag?aac?gcg?acc?gcc?ttt?aag?gga?aaa?tat?gcc?ttc?ctg?aag?aca?tac????288

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

aac?tac?acc?ttg?ggt?gca?gat?gac?ctg?act?ccc?ttc?gga?gaa?cag?cag????336

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

atg?gtc?aac?tcc?ggc?atc?aag?ttc?tac?cgc?cgg?tac?aag?gcc?ctc?gcc????384

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

agg?aac?atc?gtt?cca?ttc?atc?cga?gcc?tct?ggc?tcc?agc?cgc?gtg?atc????432

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

gcc?tcc?gcc?gag?aaa?ttc?atc?gag?ggc?ttc?cag?agc?gcc?aag?ctg?gcc????480

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

gat?cct?ggc?gcc?aac?ccc?ggc?caa?gcc?tcg?ccc?gtc?atc?gac?gtg?atc????528

Asp?Pro?Gly?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165?????????????????170?????????????????175

att?ccc?gag?ggc?gcc?ggc?tac?aac?aac?act?ctc?gac?cac?ggc?acc?tgc????576

Ile?Pro?Glu?Gly?Ala?Gly?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

act?gcc?ttc?gaa?gag?agc?gaa?ttg?ggc?gat?gac?gtc?gaa?gcc?aat?ttc????624

Thr?Ala?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

acc?gcc?ctg?ttc?gcc?ccc?gcc?att?cgt?gcc?cgt?ctg?gag?gcc?cac?ctg????672

Thr?Ala?Leu?Phe?Ala?Pro?Ala?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

ccc?ggt?gtg?act?ctc?aca?gac?gag?gac?gtg?acc?tac?ctc?atg?gac?atg????720

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

tgc?ccc?ttc?gac?acc?gtc?gcc?cgc?acc?tcc?gac?gcc?acc?gag?ctg?tcc????768

Cys?Pro?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Glu?Leu?Ser

245?????????????????250?????????????????255

ccc?ttc?tgt?gac?ctg?ttc?acc?cat?gac?gaa?tgg?atc?cag?tac?gac?tac????816

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Gln?Tyr?Asp?Tyr

260?????????????????265?????????????????270

ctc?cag?tcc?ttg?aaa?aag?tat?tac?ggc?cat?ggt?gca?ggt?aac?ccg?ctc????864

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

ggc?ccg?gcc?cag?ggc?gtc?ggc?ttc?gct?aac?gag?ctc?atc?gcc?cgt?ctg????912

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

acc?cac?tcg?cct?gtc?cag?gat?cac?acc?agt?acc?aac?cac?act?ttg?gac????960

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

tcg?aac?ccg?gct?acc?ttt?ccg?ctc?aac?gcc?act?ctc?tac?gcg?gac?ttt????1008

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

tcg?cat?gac?aac?ggc?atg?atc?tcc?att?ttc?ttt?gct?tta?ggt?ctg?tac????1056

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

aac?ggc?act?aag?ccg?cta?tct?acc?acg?tcc?gtg?gag?tcc?atc?gag?gag????1104

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

aca?gat?gga?tac?tcg?gcc?tcc?tgg?acg?gtt?ccg?ttt?gct?gcc?cgt?gcc????1152

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

tac?gtc?gag?atg?atg?cag?tgt?cag?gcg?gag?aag?gag?ccg?ctg?gtc?cgt????1200

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

gtc?ttg?gtt?aat?gat?cgc?gtt?gtc?ccg?ctg?cat?ggg?tgt?gcc?gtt?gat????124?8

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Ala?Val?Asp

405?????????????????410?????????????????415

aag?ttg?ggg?aga?tgt?acc?cgg?gat?gac?ttt?gtg?gag?ggg?ttg?agc?ttt????1296

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Glu?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

gct?aga?tcc?ggg?ggt?aac?tgg?gag?gag?tgt?ttt?gct?tag????????????????1335

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

<210>3

<211>444

<212>PRT

＜213〉protein that produces from SEQ ID 2

<400>3

Ala?Ser?Arg?ASn?Ser?His?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Tyr?Phe

20??????????????????25??????????????????30

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Ala?Ile?Gln

65??????????????????70??????????????????75??????????????????80

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

Asp?Pro?Gly?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165????????????????170?????????????????175

Ile?Pro?Glu?Gly?Ala?Gly?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

Thr?Ala?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

Thr?Ala?Leu?Phe?Ala?Pro?Ala?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

Cys?Pro?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Glu?Leu?Ser

245?????????????????250?????????????????255

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Gln?Tyr?Asp?Tyr

260?????????????????265?????????????????270

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Ala?Val?Asp

405?????????????????410?????????????????415

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Glu?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

<210>4

<211>1335

<212>DNA

＜213〉synthetic DNA

<220>

<221>CDS

<222>(1)..(1335)

<223>

<400>4

gcc?tcg?aga?aat?caa?tcc?agt?tgc?gat?acg?gtc?gat?ggc?ggg?tat?caa????48

Ala?Ser?Arg?Asn?Gln?Ser?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

tgc?ttc?ccc?gag?atc?tcg?cat?ctt?tgg?ggt?caa?tac?tcc?ccg?tac?ttc????96

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Tyr?Phe

20??????????????????25??????????????????30

tct?ctg?gca?gac?gaa?tcg?gcc?atc?tcc?cct?gac?gtg?ccc?gcc?gga?tgc????144

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

aga?gtc?act?ttc?gtc?cag?gtc?ctc?tcc?cgt?cat?gga?gcg?cgg?tat?ccg????192

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

acc?gac?tcc?aag?tcc?aag?aaa?tac?tcc?gct?ctc?att?gag?gcc?atc?cag????240

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Ala?Ile?Gln

65??????????????????70??????????????????75??????????????????80

aag?aac?gcg?acc?gcc?ttt?aag?gga?aaa?tat?gcc?ttc?ctg?aag?aca?tac????288

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????????????????????90??????????????????95

aac?tac?acc?ttg?ggt?gca?gat?gac?ctg?act?ccc?ttc?gga?gaa?cag?cag????336

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

atg?gtc?aac?tcc?ggc?atc?aag?ttc?tac?cgc?cgg?tac?aag?gcc?ctc?gcc????384

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

agg?aac?atc?gtt?cca?ttc?atc?cga?gcc?tct?ggc?tcc?agc?cgc?gtg?atc????432

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

l30?????????????????135?????????????????140

gcc?tcc?gcc?gag?aaa?ttc?atc?gag?ggc?ttc?cag?agc?gcc?aag?ctg?gcc????480

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

gat?cct?ggc?gcc?aac?ccc?ggc?caa?gcc?tcg?ccc?gtc?atc?gac?gtg?atc????528

Asp?Pro?Gly?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165?????????????????170?????????????????175

att?ccc?gag?ggc?gcc?ggc?tac?aac?aac?act?ctc?gac?cac?ggc?acc?tgc????576

Ile?Pro?Glu?Gly?Ala?Gly?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

act?gcc?ttc?gaa?gag?agc?gaa?ttg?ggc?gat?gac?gtc?gaa?gcc?aat?ttc????624

Thr?Ala?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

acc?gcc?ctg?ttc?gcc?ccc?gcc?att?cgt?gcc?cgt?ctg?gag?gcc?cac?ctg????672

Thr?Ala?Leu?Phe?Ala?Pro?Ala?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

ccc?ggt?gtg?act?ctc?aca?gac?gag?gac?gtg?acc?tac?ctc?atg?gac?atg????720

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

tgc?ccc?ttc?gac?acc?gtc?gcc?cgc?acc?tcc?gac?gcc?acc?gag?ctg?tcc????768

Cys?Pro?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Glu?Leu?Ser

245?????????????????250?????????????????255

ccc?ttc?tgt?gac?ctg?ttc?acc?cat?gac?gaa?tgg?atc?cag?tac?gac?tac????816

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Gln?Tyr?Asp?Tyr

260?????????????????265?????????????????270

ctc?cag?tcc?ttg?aaa?aag?tat?tac?ggc?cat?ggt?gca?ggt?aac?ccg?ctc????864

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

ggc?ccg?gcc?cag?ggc?gtc?ggc?ttc?gct?aac?gag?ctc?atc?gcc?cgt?ctg????912

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

acc?cac?tcg?cct?gtc?cag?gat?cac?acc?agt?acc?aac?cac?act?ttg?gac????960

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

tcg?aac?ccg?gct?acc?ttt?ccg?ctc?aac?gcc?act?ctc?tac?gcg?gac?ttt????1?008

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

tcg?cat?gac?aac?ggc?atg?atc?tcc?att?ttc?ttt?gct?tta?ggt?ctg?tac????1056

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

aac?ggc?act?aag?ccg?cta?tct?acc?acg?tcc?gtg?gag?tcc?atc?gag?gag????1104

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

aca?gat?gga?tac?tcg?gcc?tcc?tgg?acg?gtt?ccg?ttt?gct?gcc?cgt?gcc????1152

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

tac?gtc?gag?atg?atg?cag?tgt?cag?gcg?gag?aag?gag?ccg?ctg?gtc?cgt????1200

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

gtc?ttg?gtt?aat?gat?cgc?gtt?gtc?ccg?ctg?cat?ggg?tgt?gcc?gtt?gat????1248

Val?Leu?Val?Asn?Asp?Arg?Va1?Val?Pro?Leu?His?Gly?Cys?Ala?Val?Asp

405?????????????????410?????????????????415

aag?ttg?ggg?aga?tgt?acc?cgg?gat?gac?ttt?gtg?gag?ggg?ttg?agc?ttt????1296

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Glu?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

gct?aga?tcc?ggg?ggt?aac?tgg?gag?gag?tgt?ttt?gct?tag????1335

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

<210>5

<211>444

<212>PRT

＜213〉protein that produces from SEQ ID 4

<40?0>5

Ala?Ser?Arg?Asn?Gln?Ser?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

l???????????????5???????????????????10??????????????????15

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Tyr?Phe

20??????????????????25??????????????????30

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35???????????????????40??????????????????45

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Ala?Ile?Gln

65??????????????????70??????????????????75??????????????????80

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

Asp?Pro?Gly?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165?????????????????170?????????????????175

Ile?Pro?Glu?Gly?Ala?Gly?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

Thr?Ala?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

Thr?Ala?Leu?Phe?Ala?Pro?Ala?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

Cys?Pro?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Glu?Leu?Ser

245?????????????????250?????????????????255

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Gln?Tyr?Asp?Tyr

260?????????????????265?????????????????270

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????345?????????????????????????350

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Ala?Val?Asp

405?????????????????410?????????????????415

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Glu?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

<210>6

<211>1335

<212>DNA

＜213〉synthetic DNA

<220>

<221>CDS

<222>(1)..(1335)

<223>

<400>6

gcc?tcg?aga?aat?caa?tcc?agt?tgc?gat?acg?gtc?gat?ggc?ggg?tat?caa????48

Ala?Ser?Arg?Asn?Gln?Ser?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

tgc?ttc?ccc?gag?atc?tcg?cat?ctt?tgg?ggt?caa?tac?tcc?ccg?ttc?ttc????96

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Phe?Phe

20??????????????????25??????????????????30

tct?ctg?gca?gac?gaa?tcg?gcc?atc?tcc?cct?gac?gtg?ccc?gcc?gga?tgc????144

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

aga?gtc?act?ttc?gtc?cag?gtc?ctc?tcc?cgt?cat?gga?gcg?cgg?tat?ccg????192

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

acc?gac?tcc?aag?tcc?aag?aaa?tac?tcc?gct?ctc?att?gag?gag?atc?cag????240

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Glu?Ile?Gln

65??????????????????70??????????????????75??????????????????80

aag?aac?gcg?acc?gcc?ttt?aag?gga?aaa?tat?gcc?ttc?ctg?aag?aca?tac????288

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

aac?tac?acc?ttg?ggt?gca?gat?gac?ctg?act?ccc?ttc?gga?gaa?cag?cag????336

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

atg?gtc?aac?tcc?ggc?atc?aag?ttc?tac?cgc?cgg?tac?aag?gcc?ctc?gcc????384

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

agg?aac?atc?gtt?cca?ttc?atc?cga?gcc?tct?ggc?tcc?agc?cgc?gtg?atc????432

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

gcc?tcc?gcc?gag?aaa?ttc?atc?gag?ggc?ttc?cag?agc?gcc?aag?ctg?gcc????480

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

gat?cct?cgt?gcc?aac?ccc?ggc?caa?gcc?tcg?ccc?gtc?atc?gac?gtg?atc????528

Asp?Pro?Arg?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165?????????????????170?????????????????175

att?ccc?gag?gcc?gcc?tca?tac?aac?aac?act?ctc?gac?cac?ggc?acc?tgc????576

Ile?Pro?Glu?Ala?Ala?Ser?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

act?gtc?ttc?gaa?gag?agc?gaa?ttg?ggc?gat?gac?gtc?gaa?gcc?aat?ttc????624

Thr?Val?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

acc?gcc?acg?ttc?gcc?ccc?tcc?att?cgt?gcc?cgt?ctg?gag?gcc?cac?ctg????672

Thr?Ala?Thr?Phe?Ala?Pro?Ser?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

ccc?ggt?gtg?act?ctc?aca?gac?gag?gac?gtg?acc?tac?ctc?atg?gac?atg????720

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

tgc?tcc?ttc?gac?acc?gtc?gcc?cgc?acc?tcc?gac?gcc?acc?aag?ctg?tcc????768

Cys?Ser?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Lys?Leu?Ser

245?????????????????250?????????????????255

ccc?ttc?tgt?gac?ctg?ttc?acc?cat?gac?gaa?tgg?atc?aac?tac?gac?tac????816

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?Trp?Ile?Asn?Tyr?Asp?Tyr

260?????????????????265?????????????????270

ctc?cag?tcc?ttg?aaa?aag?tat?tac?ggc?cat?ggt?gca?ggt?aac?ccg?ctc????864

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

ggc?ccg?gcc?cag?ggc?gtc?ggc?ttc?gct?aac?gag?ctc?atc?gcc?cgt?ctg????912

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

acc?cac?tcg?cct?gtc?cag?gat?cac?acc?agt?acc?aac?cac?act?ttg?gac????960

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

tcg?aac?ccg?gct?acc?ttt?ccg?ctc?aac?gcc?act?ctc?tac?gcg?gac?ttt????1?008

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

tcg?cat?gac?aac?ggc?atg?atc?tcc?att?ttc?ttt?gct?tta?ggt?ctg?tac????1056

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

aac?ggc?act?aag?ccg?cta?tct?acc?acg?tcc?gtg?gag?tcc?atc?gag?gag????1104

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

aca?gat?gga?tac?tcg?gcc?tcc?tgg?acg?gtt?ccg?ttt?gct?gcc?cgt?gcc????1152

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

tac?gtc?gag?atg?atg?cag?tgt?cag?gcg?gag?aag?gag?ccg?ctg?gtc?cgt????1200

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

gtc?ttg?gtt?aat?gat?cgc?gtt?gtc?ccg?ctg?cat?ggg?tgt?ccg?gtt?gat????124?8

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Pro?Val?Asp

405?????????????????410?????????????????415

aag?ttg?ggg?aga?tgt?acc?cgg?gat?gac?ttt?gtg?agg?ggg?ttg?agc?ttt????1296

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Arg?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

gct?aga?tcc?ggg?ggt?aac?tgg?gag?gag?tgt?ttt?gct?tag????????????????1335

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

<210>7

<211>444

<212>PRT

＜213〉protein that produces from SEQID 6

<4?00>7

Ala?Ser?Arg?Asn?Gln?Ser?Ser?Cys?Asp?Thr?Val?Asp?Gly?Gly?Tyr?Gln

1???????????????5???????????????????10??????????????????15

Cys?Phe?Pro?Glu?Ile?Ser?His?Leu?Trp?Gly?Gln?Tyr?Ser?Pro?Phe?Phe

20??????????????????25??????????????????30

Ser?Leu?Ala?Asp?Glu?Ser?Ala?Ile?Ser?Pro?Asp?Val?Pro?Ala?Gly?Cys

35??????????????????40??????????????????45

Arg?Val?Thr?Phe?Val?Gln?Val?Leu?Ser?Arg?His?Gly?Ala?Arg?Tyr?Pro

50??????????????????55??????????????????60

Thr?Asp?Ser?Lys?Ser?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Glu?Glu?Ile?Gln

65???????????????????70??????????????????75?????????????????80

Lys?Asn?Ala?Thr?Ala?Phe?Lys?Gly?Lys?Tyr?Ala?Phe?Leu?Lys?Thr?Tyr

85??????????????????90??????????????????95

Asn?Tyr?Thr?Leu?Gly?Ala?Asp?Asp?Leu?Thr?Pro?Phe?Gly?Glu?Gln?Gln

100?????????????????105?????????????????110

Met?Val?Asn?Ser?Gly?Ile?Lys?Phe?Tyr?Arg?Arg?Tyr?Lys?Ala?Leu?Ala

115?????????????????120?????????????????125

Arg?Asn?Ile?Val?Pro?Phe?Ile?Arg?Ala?Ser?Gly?Ser?Ser?Arg?Val?Ile

130?????????????????135?????????????????140

Ala?Ser?Ala?Glu?Lys?Phe?Ile?Glu?Gly?Phe?Gln?Ser?Ala?Lys?Leu?Ala

145?????????????????150?????????????????155?????????????????160

Asp?Pro?Arg?Ala?Asn?Pro?Gly?Gln?Ala?Ser?Pro?Val?Ile?Asp?Val?Ile

165?????????????????170?????????????????175

Ile?Pro?Glu?Ala?Ala?Ser?Tyr?Asn?Asn?Thr?Leu?Asp?His?Gly?Thr?Cys

180?????????????????185?????????????????190

Thr?Val?Phe?Glu?Glu?Ser?Glu?Leu?Gly?Asp?Asp?Val?Glu?Ala?Asn?Phe

195?????????????????200?????????????????205

Thr?Ala?Thr?Phe?Ala?Pro?Ser?Ile?Arg?Ala?Arg?Leu?Glu?Ala?His?Leu

210?????????????????215?????????????????220

Pro?Gly?Val?Thr?Leu?Thr?Asp?Glu?Asp?Val?Thr?Tyr?Leu?Met?Asp?Met

225?????????????????230?????????????????235?????????????????240

Cys?Ser?Phe?Asp?Thr?Val?Ala?Arg?Thr?Ser?Asp?Ala?Thr?Lys?Leu?Ser

245?????????????????250?????????????????255

Pro?Phe?Cys?Asp?Leu?Phe?Thr?His?Asp?Glu?TrpIle?Asn?Tyr?Asp?Tyr

260?????????????????265????????????????270

Leu?Gln?Ser?Leu?Lys?Lys?Tyr?Tyr?Gly?His?Gly?Ala?Gly?Asn?Pro?Leu

275?????????????????280?????????????????285

Gly?Pro?Ala?Gln?Gly?Val?Gly?Phe?Ala?Asn?Glu?Leu?Ile?Ala?Arg?Leu

290?????????????????295?????????????????300

Thr?His?Ser?Pro?Val?Gln?Asp?His?Thr?Ser?Thr?Asn?His?Thr?Leu?Asp

305?????????????????310?????????????????315?????????????????320

Ser?Asn?Pro?Ala?Thr?Phe?Pro?Leu?Asn?Ala?Thr?Leu?Tyr?Ala?Asp?Phe

325?????????????????330?????????????????335

Ser?His?Asp?Asn?Gly?Met?Ile?Ser?Ile?Phe?Phe?Ala?Leu?Gly?Leu?Tyr

340?????????????????345?????????????????350

Asn?Gly?Thr?Lys?Pro?Leu?Ser?Thr?Thr?Ser?Val?Glu?Ser?Ile?Glu?Glu

355?????????????????360?????????????????365

Thr?Asp?Gly?Tyr?Ser?Ala?Ser?Trp?Thr?Val?Pro?Phe?Ala?Ala?Arg?Ala

370?????????????????375?????????????????380

Tyr?Val?Glu?Met?Met?Gln?Cys?Gln?Ala?Glu?Lys?Glu?Pro?Leu?Val?Arg

385?????????????????390?????????????????395?????????????????400

Val?Leu?Val?Asn?Asp?Arg?Val?Val?Pro?Leu?His?Gly?Cys?Pro?Val?Asp

405?????????????????410?????????????????415

Lys?Leu?Gly?Arg?Cys?Thr?Arg?Asp?Asp?Phe?Val?Arg?Gly?Leu?Ser?Phe

420?????????????????425?????????????????430

Ala?Arg?Ser?Gly?Gly?Asn?Trp?Glu?Glu?Cys?Phe?Ala

435?????????????????440

Claims (19)

1. a peptide species, when comparing with the model phytase, it compares modified at least 1 following position with this model phytase: 5,6,13,19,21,29,31,36,39,43,53,69,78,81,85,87,99,112,113,122,125,126,128,137,147,148,157,160,163,165,169,172,176,178,180,181,182,183,189,194,197,201,203,211,213,215,218,222,223,225,232,233,242,246,247,248,249,250,251,252,254,269,291,296,310,312,315,322,330,342,346,362,365,367,368,372,374,375,382,384,395,414,417,425,428,438,440.

2. polypeptide as claimed in claim 1, it comprises at least one following modification: 5QS, 6SH, 13G, 19P, 21I, 29S, 31FY, 36D, 39A, 43D, 53V, 69S, 78EA, 81K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 176I, 178P, 180AG, 181A, 182STG, 183Y, 189H, 194VA, 197E, 201G, 203D, 211TL, 213A, 215SA, 218A, 222A, 223H, 225P, 232E, 233D, 242SP, 246V, 247A, 248R, 249T, 250S, 251D, 252A, 254KE, 269NQ, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414PA, 417K, 425D, 428RKE, 438N, 440AE.

3. polypeptide as claimed in claim 1, it comprises at least one following modification: 5QS, 6SH, 13G, 19P, 21I, 29S, 31Y, 36D, 39A, 43D, 53V, 69S, 78A, 81K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163G, 165N, 169A, 172V, 176I, 178P, 180G, 181A, 182G, 183Y, 189H, 194A, 197E, 201G, 203D, 211L, 213A, 215A, 218A, 222A, 223H, 225P, 232E, 233D, 242P, 246V, 247A, 248R, 249T, 250S, 251D, 252A, 254E, 269Q, 291A, 296F, 310Q, 312H, 315T, 322N, 330A, 342M, 346F, 362S, 365S, 367E, 368E, 372Y, 374A, 375S, 382A, 384A, 395K, 414A, 417K, 425D, 428E, 438N, 440E.

4. a peptide species, when comparing with the model phytase, it compares modified at least 1 following position with this model phytase:

31，78，163，180，182，194，211，215，242，254，269，414，428，440。

5. as each polypeptide in the claim 1 to 4, wherein this model phytase comprises following amino acid: Q27, Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, R142, V143, E179, D188, F243, KN277, K278, H282, S337, H338, D339, N340, F380, A35, A46, N130, S141, G167, Q168, D174, T191, E199, E205, L220, T235, D244, I268, H306, G341, K356, A381.

6. each polypeptide in the claim as described above, wherein this model phytase comprises following amino acid: Q27, Y28, R58, H59, G60, R62, Y63, P64, T65, DE66, S67, K68, K71, Y72, D103, S140, R142, V143, E179, D188, E196, D239, F243, G274, KN277, K278, H282, S337, H338, D339, N340, G341, V378, F380, A35, A46, N130, S141, G167, Q168, D174, T191, E199, E205, L220, T235, D244, I268, H306, G341, K356, A381.

7. each polypeptide in the claim as described above, wherein this polypeptide contains at least one following sudden change: 31Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.

8. each polypeptide of claim as described above, wherein this model phytase has the aminoacid sequence of SEQ IDNO:1.

9. polypeptide as claimed in claim 1, it is SEQ ID NO:3, SEQ ID NO:5 or SEQIN NO:7.

10. a peptide species, the polypeptide of itself and claim 9 has at least 91%, preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98% or most preferably at least 99% sequence homology (homogeny).

11. polynucleotide, it comprises the polynucleotide sequence of each polypeptide in the aforementioned claim of coding.

12. as the polynucleotide of claim 11, it is DNA.

13. as the polynucleotide of claim 11, it comprises

SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

14. a carrier, it comprises in the claim 11 to 13 each polynucleotide sequence.

15. as the carrier of claim 14, it is an expression vector, may be operably coupled to the expression vector of regulating and controlling sequence such as the polynucleotide sequence of coded polypeptide wherein.

16. a host cell, it is with each polypeptide in the heterologous protein formal representation claim 1 to 10.

17. a host cell, its each polynucleotide or carrier of claim 14 or 15 in claim 11 to 13 transforms.

18. a method for preparing each polypeptide in the claim 1 to 10, this method are included in the host cell of cultivating claim 16 or 17 under the condition that allows this polypeptide of expression.

19. a composition, it comprises in the claim 1 to 10 each polypeptide.

Images