EP1507787B1 - Compositions associées au cancer the la prostate, procédés et trousses dérivés de plate-formes protéomiques à haute densité d'adn - Google Patents

Compositions associées au cancer the la prostate, procédés et trousses dérivés de plate-formes protéomiques à haute densité d'adn Download PDF

Info

Publication number
EP1507787B1
EP1507787B1 EP20030733941 EP03733941A EP1507787B1 EP 1507787 B1 EP1507787 B1 EP 1507787B1 EP 20030733941 EP20030733941 EP 20030733941 EP 03733941 A EP03733941 A EP 03733941A EP 1507787 B1 EP1507787 B1 EP 1507787B1
Authority
EP
European Patent Office
Prior art keywords
pcadm
antibody
protein
prostate cancer
mammal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP20030733941
Other languages
German (de)
English (en)
Other versions
EP1507787A4 (fr
EP1507787A2 (fr
Inventor
Mark Stearns
Youji Hu
Min Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Philadelphia Health and Education Corp
Original Assignee
Philadelphia Health and Education Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Philadelphia Health and Education Corp filed Critical Philadelphia Health and Education Corp
Publication of EP1507787A2 publication Critical patent/EP1507787A2/fr
Publication of EP1507787A4 publication Critical patent/EP1507787A4/fr
Application granted granted Critical
Publication of EP1507787B1 publication Critical patent/EP1507787B1/fr
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57434—Specifically defined cancers of prostate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • ribosomal proteins might play an important role in certain diseases, disorders or conditions. More specifically, there are many reports demonstrating a connection between over expression of the mRNA of genes encoding ribosomal proteins and cancer ( Chiao et al., 1992, Mol. Carcinog. 5:219-231 ; Fernandez-Pol et al., 1993, J. Biol. Chem. 268:21198-211204 ; Fernandez-Pol et al., 1994, Cell Growth & Differentiation 5:821-825 ; Fernandez-Pol, 1996, Anticancer Res. 16:2177-2186 ; Chan et al., 1996, Biochem. and Biophys. Res. Comm.
  • rat ribosomal protein L10 is homologous to a putative Wilm's tumor suppressor gene ( Chan et al., 1996, Biochem. Biophys. Res. Comm. 225:952-956 ). Malignant cells may express mutant 'ribosomal-like' proteins. However, there is currently no evidence that any of these ribosomal proteins are over expressed or that the proteins acquire DNA binding activities in malignant cells.
  • T-ALL T cell acute lymphoblastic leukemia
  • TCR T cell receptor
  • V-(D)-J recombination that joins two or three germline segments (i.e ., variable-V; diversity-D; and joining-J) segments into a variable-gene exon by site-specific recombination contributes to amplification of the V-region diversity.
  • Comparison of the nucleotide sequences of the flanking regions of the V, D, and J segments has demonstrated that two common blocks of nucleotide sequences are conserved ( Early et al., 1980, Cell 19:981-992 ), including a heptamer CACTGTG and a T-rich nonamer GGTTTTTGT, which are separated by a spacer sequence of either 12 or 23 bases.
  • DNA binding protein(s) that recognize the conserved recombination signal sequence may be involved in the recombinational machinery that cleaves DNA at the juncture between the signal and coding region sequences and ligates the cleaved ends.
  • RS proteins as being located in lymphoid cells ( Aguilera et al., 1987, Cell 51:909-917 ; Halligan and Desiderio, 1987, Proc. Natl. Acad. Sci. USA 84:7019-7023 ; Hamaguchi et al., 1989, Nucleic Acid Res. 17:9015-9026 ; and Mak, 1994, Nucleic Acid Res. 22:383-390 ).
  • RS proteins have been identified. For example, a DNA binding protein for kappaB binding and recognition component of the V(D)J recombination signal sequence has been identified. Activation of this family of transcription factors is thought to provide a mechanism by which oncogenic tyrosine kinases regulate genes with kappaB-controlled gene regulatory elements.
  • prostate cancer is one of the leading causes of cancer-related mortality and morbidity in men, there are few effective diagnostics and therapeutics for this disease, and none are based on detection of a DNA binding protein, including proteins, which bind BPCRs.
  • tissue markers identified in the scientific literature, but only one has been developed as a clinical marker approved by the FDA, i.e ., prostate specific antigen (PSA) and it's derivatives.
  • PSA prostate specific antigen
  • development of markers for the early detection of cancers is essential to improved treatment of cancer.
  • PSA prostate specific antigen
  • the invention includes an antibody that specifically binds with a mammalian prostate cancer antigen diagnostic marker (PCADM-1) polypeptide sharing at least 99% sequence identity with the amino acid sequence of SEQ ID NO:2.
  • PCADM-1 mammalian prostate cancer antigen diagnostic marker
  • the antibody is selected from the group consisting of a polyclonal antibody, a monoclonal antibody, a humanized antibody, a chimeric antibody, and a synthetic antibody.
  • the invention includes a composition comprising an antibody that specifically binds with a mammalian prostate cancer antigen, diagnostic marker 1 (PCADM-1) polypeptide, as defined above, and a pharmaceutically-acceptable carrier.
  • PCADM-1 diagnostic marker 1
  • the invention includes a use of the above antibody for preparing a medicament for treating a disease mediated by mal-expression of a prostate cancer antigen diagnostic marker I in a mammal, wherein the disease is prostate cancer.
  • the medicament may be administered to a human afflicted with prostate cancer
  • the mammal is selected from the group consisting of a human and a dog.
  • the invention includes an in vitro method of diagnosing prostate cancer in a mammal.
  • the method comprises assessing the level of PCADM-1 in a biological sample obtained from said mammal, and comparing the level of PCADM-1 in said biological sample with the level of PCADM-1 in a biological sample obtained from a like mammal not afflicted with prostate cancer, wherein a higher level of PCADM-1 in said biological sample from said mammal compared with the level of PCADM-1 in said biological sample from said like mammal is an indication that said mammal is afflicted with prostate cancer, thereby diagnosing prostate cancer in said mammal.
  • the PCADM-1 has a sequence that shares at least 99% sequence identity with the amino acid sequence of SEQ ID NO:2.
  • the mammal is selected from the group consisting of a human and a dog.
  • the invention includes an in vitro method of diagnosing prostate cancer in a mammal.
  • the method comprises assessing the level of antibody that specifically binds with prostate cancer antigen diagnostic marker 1 (PCADM-1) in the biological sample obtained form said mammal, and comparing the level of antibody that specifically binds with PCADM-1 in said biological sample with the level of antibody that specifically binds with PCADM-1 in a biological sample obtained from a like mammal not afflicted with prostate cancer, wherein a higher level of antibody that specifically binds with PCADM-1 in the biological sample from said mammal compared with the level of antibody that specifically binds with PCADM-1 in said biological sample from said like mammal is an indication that the mammal is afflicted with prostate cancer, thereby diagnosing prostate cancer in a mammal.
  • the PCADM-1 has a sequence that shares at least 99% sequence identity with the amino acid sequence of SEQ ID NO:2.
  • the mammal is selected from the group consisting of a human and a dog.
  • the invention includes a kit for alleviating prostate cancer in a mammal.
  • the kit comprises an antibody as defined above, an applicator, and an instructional material for the use thereof.
  • the invention includes a kit for treating prostate cancer in a mammal, the kit comprising an antibody as defined above, an applicator, and an instructional material for the use thereof.
  • the invention includes a kit for assessing the level of prostate cancer antigen diagnostic marker 1 (PCADM-1) in a sample.
  • the kit comprises an antibody that specifically binds with prostate cancer antigen diagnostic marker 1, the kit further comprising an applicator, and an instructional material for the use thereof.
  • the prostate cancer antigen diagnostic marker 1 (PCADM-1) polypeptide shares greater than 99% amino acid sequence identity with the sequence of SEQ ID NO:2.
  • the present invention relates to inter alia PCADM-1-based assays that easily and efficiently assess the presence or absence of prostate cancer in a patient by assessing the level of PCADM-1 in a biological sample compared to the level of PCADM-1 in an otherwise identical biological sample obtained from a human known not to have prostate cancer.
  • PCADM-1 is increased in prostate cancer tissue and in urine of prostate cancer patients. Further, expression of PCADM-1 is particularly increased in nuclear protein extracts from prostate cancer tumors compared with the level of PCADM-1 in matching seminal vesicle (SV), benign prostatic hyperplasia (BPH) or high-grade prostatic intraepithelial neoplasm (HGPIN) foci. Moreover, the data disclosed herein demonstrate a correlation between the level of PCADM-1 protein in a biological sample and the Gleason Score (GS) of the prostate cancer examined thereby indicating that PCADM-1 can be a stage specific prostate cancer marker useful for proper staging of prostate cancer.
  • GS Gleason Score
  • the present invention relates to uses of anti-PCAM-1 antibodies in preparing medicaments for treating prostate cancer.
  • the data disclosed herein suggests that expression of PCADM-1 is associated with prostate cancer and the invention provides methods of diagnosis as well as for the development of therapeutics useful for treating and diagnosing diseases, disorders or conditions associated with altered expression of PCADM-1, including prostate cancer.
  • an element means one element or more than one element.
  • adjacent is used to refer to nucleotide sequences, which are directly attached to one another, having no intervening nucleotides.
  • the pentanucleotide 5'-AAAAA-3' is adjacent the trinucleotide 5'-TTT-3' when the two are connected thus: 5'-AAA.AATTT-3' or 5'-TTTAAAAA-3', but not when the two are connected thus: 5'-AAAAACTTT-3'.
  • amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table: Full Name Three-Letter Code One-Letter Code Aspartic Acid Asp D Glutamic Acid Glu E Lysine Lys K Arginine Arg R Histidine His H Tyrosine Tyr Y Cysteine Cys C Asparagine Asn N Glutamine Gln Q Serine Ser S Threonine Thr T Glycine Gly G Alanine Ala A Valine Val V Leucine Leu L Isoleucine Ile I Methionine Met M Proline Pro P Phenylalanine Phe F Tryptophan Trp W
  • to "alleviate” cancer means reducing the severity of one or more symptoms of prostate cancer. This can include, but is not limited to, reducing the level of PCADM-1 expressed in a cell or tissue, reducing the level of cell proliferation, reducing or increasing the level of PCADM-1 in the bloodstream or in the urine or other bodily fluid, and the like, in a patient, compared with the level of PCADM-1 in the patient prior to or in the absence of the method of treatment.
  • altered expression of PCADM-1 is meant that the level of expression of a PCADM-1 in a cell, tissue, organ or bodily fluid is detectably higher or lower than the level of expression of PCADM-1 in an otherwise identical cell, tissue, organ or bodily fluid where the otherwise identical cell, tissue, organ or bodily fluid is obtained from normal patients that do not exhibit any detectable disease, disorder or condition associated with or mediated by expression of PCADM-1, such as, but not limited to, prostate cancer, other cancers and degenerative disorders such as osteoporosis, immune suppressive disorders or inflammatory disorders.
  • Antisense refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence, which is substantially homologous to the non-coding strand.
  • an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule.
  • the antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
  • apper any device including, but not limited to, a hypodermic syringe, a pipette, and the like, for administering the PCADM-1 nucleic acid, protein, and/or composition of the invention to a mammal.
  • Biological sample means a sample obtained from an animal that can be used to assess the level of expression of a PCADM-1, the level of PCADM-1 protein present, or both.
  • a sample includes, but is not limited to, a blood sample, a prostate biopsy, a urine sample, prostatic fluid, semen, lymph fluid, perineal cavity fluid sample, a peritoneal cavity fluid sample, pleural cavity fluid sample, a bone marrow sample, a salivary gland fluid, and a seminal vesicle tissue sample.
  • Secondreak point cluster region refers to nucleic acid sequences associated with a chromosomal translocation site, such as, but not limited, those identified in studies relating to leukemia.
  • candidate anti-PCADM-1 drug is meant a compound that when contacted with a cell, reduces the level of expression of a nucleic acid encoding a PCADM-1 in the cell compared with the level of PCADM-1 expression in that cell prior to contacting the cell with the compound, or which compound reduces the level of expression in the cell compared with the level of PCADM-1 expression in an otherwise identical cell which is not contacted with the compound.
  • nucleic acid encoding PCADM-1 By “complementary to a portion or all of the nucleic acid encoding PCADM-1" is meant a sequence of a nucleic acid, which does not encode a PCADM-1 protein. Rather, the sequence, which is being expressed in the cells, is identical to the non-coding strand of the nucleic acid encoding a PCADM-1 protein and thus, does not encode PCADM-1 protein.
  • complementary and antisense refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence, which is substantially homologous to the non-coding strand.
  • “Complementary” as used herein refers to the broad concept of subunit sequence complementary between two nucleic acids, e.g ., two DNA molecules. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position.
  • two nucleic acids are complementary to each other when a substantial number (at least 50%) of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g ., A:T and G:C nucleotide pairs).
  • a "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene (i.e ., exon) and the nucleotides of the non-coding strand of the gene, which are homologous with or complementary to, respectively, the coding region of an mRNA molecule, which is produced by transcription of the gene.
  • a "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anticodon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon.
  • the coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule ( e.g ., amino acid residues in a protein export signal sequence).
  • RNA sequence which has been re-sequenced to resolve un-called bases, or which has been extended using RT-PCR extension kit (such as, e.g ., that available from Perkin Elmer, Norwalk, CT) in the 5' and/or 3' direction and re-sequenced, or which has been assembled from the overlapping sequences of more that one derived clone (or which have been both extended and assembled).
  • RT-PCR extension kit such as, e.g ., that available from Perkin Elmer, Norwalk, CT
  • a “non-coding" region of a gene consists of the nucleotide residues of the gene (i.e ., introns) including "leader sequences" which are important for mRNA binding to ribosomal proteins involved in mRNA translation to proteins.
  • PCADM-1 DNAZYM-1 means a DNAZYM comprising SEQ ID NO:9, which specifically targets PCADM-1 mRNA
  • PCADM-1 DNAZYM-2 is meant a DNAZYM comprising SEQ ID NO:10, which enzyme specifically targets PCADM-1 mRNA.
  • DNA-protein hybridization assay refers to a binding assay for identification of protein(s), which bind with specific DNA sequences, and for assessing the amounts of protein binding to the DNA.
  • substrate complementary arm is meant that portion of a DNAZYM, which is complementary to (i.e ., able to base-pair with) a portion of its substrate.
  • complementary sequence is 100% for a 8 base pair sequence, but can be less or more if desired. For example, as few as 4 bases out of 8 to 10 may be base-paired.
  • Electrophoretic mobility shift assay refers to a gel based assay for identification of protein(s), which bind specific DNA sequences, and for assessing the amounts of protein binding to the DNA.
  • encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e ., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting there from.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • enhanced enzymatic activity is meant to include activity measured in cells and/or in vivo where the activity is a reflection of both catalytic activity and PCADM-1 DNAZYMs stability.
  • enzyme linked immuno-sandwich assay is an antibody based assay for identification of protein and for measurements of protein levels in cell or tissue preparations.
  • catalytic or enzymatic domain is meant that part of the DNA enzyme essential for cleavage of an RNA substrate.
  • RNA to PCADM-1 is meant to include those naturally occurring RNA molecules associated with cancer in various animals, including human.
  • complementary is meant a nucleic acid that can form hydrogen bond(s) with another RNA sequence by either traditional Watson-Crick or other non-traditional types of base-paired interactions.
  • “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, such as cosmids, plasmids ( e.g ., naked or contained in liposomes) and viruses ( e.g ., retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
  • a first region of an oligonucleotide "flanks" a second region of the oligonucleotide if the two regions are adjacent one another or if the two regions are separated by no more than about 100 nucleotides, and preferably no more than about 50 nucleotides, more preferably, no more than about 40 nucleotides, even more preferably, no more than about 30 nucleotides, yet more preferably, no more than about 20 nucleotides, preferably, no more than about 10 nucleotides, and even more preferably, by no more than about 5 nucleotides.
  • fragment as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, typically, at least about 30 nucleotides, more typically, from about 50 to about 100 nucleotides, preferably, at least about 100 to about 200 nucleotides, even more preferably, at least about 200 nucleotides to about 300 nucleotides, yet even more preferably, at least about 300 to about 350, even more preferably, at least about 350 nucleotides to about 500 nucleotides, yet even more preferably, at least about 500 to about 600, even more preferably, at least about 600 nucleotides to about 620 nucleotides, yet even more preferably, at least about 620 to about 650, and most preferably, the nucleic acid fragment will be greater than about 650 nucleotides in length.
  • a "fragment" of PCADM-1 is about 20 amino acids in length. More preferably, the fragment of a PCADM-1 is about 30 amino acids, even more preferably, at least about 40, yet more preferably, at least about 60, even more preferably, at least about 80, yet more preferably, at least about 100, even more preferably, about 100, and more preferably, greater than 110 amino acids in length.
  • genomic DNA is a DNA strand which has a nucleotide sequence homologous with a gene.
  • genomic DNA is a DNA strand which has a nucleotide sequence homologous with a gene.
  • genomic DNAs are genomic DNAs.
  • a double-stranded oligonucleotide binds with "greatest affinity,” as the term is used herein, when the double-stranded oligonucleotide produces the highest detectable signal indicating protein/DNA binding compared with any signal produced by any other member of the semi-random double-stranded oligonucleotide set of which the double-stranded oligonucleotide is a member.
  • Homologous refers to the subunit sequence similarity between two polymeric molecules, e.g ., between two nucleic acid molecules, e.g ., two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g ., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions, e.g ., if half (e.g ., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g ., 9 of 10, are matched or homologous, the two sequences share 90% homology.
  • the DNA sequences 3'-ATTGCC-5' and 3'-TATGGC-5' share 75% homology.
  • a first oligonucleotide anneals with a second oligonucleotide with "high stringency” or "under high stringency conditions” if the two oligonucleotides anneal under conditions whereby only oligonucleotides which are at least about 60%, more preferably at least about 65%, even more preferably at least about 70%, yet more preferably at least about 80%, and preferably at least about 90% or, more preferably, at least about 95% complementary anneal with one another.
  • the stringency of conditions used to anneal two oligonucleotides is a function of, among other factors, temperature, ionic strength of the annealing medium, the incubation period, the length of the oligonucleotides, the G-C content of the oligonucleotides, and the expected degree of non-homology between the two oligonucleotides, if known.
  • Methods of adjusting the stringency of annealing conditions are known ( see, e.g ., Sambrook et al.,1989, In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York ).
  • the determination of percent identity between two nucleotide or amino acid sequences can be accomplished using a mathematical algorithm.
  • a mathematical algorithm useful for comparing two sequences is the algorithm of Karlin and Altschul (1990, Proc. Natl. Acad. Sci. USA 87:2264-2268 ), modified as in Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 90:5873-5877 ).
  • This algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990, J. Mol. Biol. 215:403-410 ), and can be accessed, for example, at the National Center for Biotechnology Information (NCBI) world wide web site having the universal resource locator.
  • NCBI National Center for Biotechnology Information
  • BLAST protein searches can be performed with the XBLAST program (designated "blastn” at the NCBI web site) or the NCBI “blastp” program, using the following parameters: expectation value 10.0, BLOSUM62 scoring matrix to obtain amino acid sequences homologous to a protein molecule described herein.
  • Gapped BLAST can be utilized as described in Altschul et al. (1997, Nucleic Acids Res. 25:3389-3402 ).
  • PSI-Blast or PHI-Blast can be used to perform an iterated search, which detects distant relationships between molecules ( id .) and relationships between molecules, which share a common pattern.
  • the default parameters of the respective programs e.g ., XBLAST and NBLAST
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
  • inhibitor PCADM-1 is meant that the activity of PCADM-1 or level of mRNAs encoded by PCADM-1 is reduced below that detected in the absence of the nucleic acid. More preferably, inhibition with DNAZYMs or DNA enzymes is below that level observed in the presence of an inactive RNA molecule able to bind to the same site on the mRNA, but unable to cleave the RNA.
  • Gleason Score refers to the pathological scoring system developed by Gleason et al. (1993, J. Urol. 149:1568-1576 ).
  • the terms "gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide of the invention.
  • Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene.
  • Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the invention.
  • nucleic acid molecules encoding proteins of the invention from other species which have a nucleotide sequence which, differs from that of the human proteins described herein, are within the scope of the invention.
  • Nucleic acid molecules corresponding to natural allelic variants and homologs of a cDNA of the invention can be isolated based on their identity to human nucleic acid molecules using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • a homolog of a human PCADM-1 protein of the invention can be isolated based on its hybridization with a nucleic acid molecule encoding all or part of human PCADM-1 under high stringency conditions.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression, which can be used to communicate the usefulness of the nucleic acid, peptide, and/or composition of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
  • the instructional material may describe one or more methods of alleviation the diseases or disorders in a cell or a tissue of a mammal.
  • the instructional material of the kit of the invention may, for example, be affixed to a container, which contains the nucleic acid, peptide, DNAZYM and/or composition of the invention or be shipped together with a container, which contains the nucleic acid, peptide, and/or composition.
  • the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
  • isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g ., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g ., the sequences adjacent to the fragment in a genome in which it naturally occurs.
  • nucleic acids which have been substantially purified from other components, which naturally accompany the nucleic acid, e.g ., RNA or DNA or proteins, which naturally accompany it in the cell.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule ( e.g ., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA, which is part of a hybrid gene encoding additional polypeptide sequence.
  • A refers to adenosine
  • C refers to cytidine
  • G refers to guanosine
  • T refers to thymidine
  • U refers to uridine.
  • mal-expression of a PCADM-1 molecule is meant that the level of expression of a PCADM-1 in a cell is detectably higher or lower than the level of expression of PCADM-1 in an otherwise identical cell where the otherwise identical cell is obtained from normal tissue that does not exhibit any detectable disease, disorder or condition associated with or mediated by expression of PCADM-1, such as, but not limited to, prostate cancer, other cancers and degenerative disorders such as osteoporosis, immune suppressive disorders or inflammatory disorders, and the like, such that mal-expression is associated with or mediates a disease, disorder or condition.
  • “Monte-Carlo-like” screening assay refers to the production of random 7 base pair (bp), 8 bp, and 9 bp DNA sequences and protein binding assays employed to identify the 7 bp, 8 bp, and/or 9 bp sequence which binds a DNA-binding protein(s) produced by tumor tissue where the DNA-binding protein is either not produced, or produced at a lower level, or otherwise not detected, in otherwise identical non-tumor tissue.
  • two polynucleotides as "operably linked” is meant that a single-stranded or double-stranded nucleic acid moiety comprises the two polynucleotides arranged within the nucleic acid moiety in such a manner that at least one of the two polynucleotides is able to exert a physiological effect by which it is characterized, upon the other.
  • a promoter operably linked to the coding region of a gene is able to promote transcription of the coding region.
  • the nucleic acid encoding the desired protein further comprises a promoter/regulatory sequence
  • the promoter/regulatory sequence is positioned at the 5' end of the desired protein coding sequence such that it drives expression of the desired protein in a cell.
  • the nucleic acid encoding the desired protein and its promoter/regulatory sequence comprise a "transgene.”
  • a patient is meant an organism, which, is a donor or recipient of explanted cells or the cells themselves.
  • atient also refers to an organism to which enzymatic nucleic acid molecules can be administered.
  • a patient is a mammal or mammalian cells. More preferably, a patient is a human or human cells or human tumors.
  • PCADM-1 refers to the amino acid sequences of purified recombinant or native "PCADM-1" protein obtained from any species or tissue or cells or from recombinant, synthetic or semi-synthetic sources.
  • the PCADM-1 is encoded by a nucleic acid that hybridizes with a nucleic acid having the sequence SEQ ID NO:1 under stringent conditions.
  • the PCADM-1 shares at least 99% sequence identity with the amino acid sequence SEQ ID NO:2.
  • the PCADM-1 is over-expressed, i.e ., expressed at a level higher than the level present in a cell or tissue known not to have a disease, disorder, or condition.
  • the PCADM-1 is a cytoplasmic and nuclear protein of about 32 kDa with six (6) nucleotide substitutions relative to the human S2 gene. More specifically, a nucleic acid encoding PCADM-1 comprises a change from a T to A at nucleotide number 190, a A to C at nucleotide number 191, a G to C at nucleotide number 465, a change from C to G at nucleotide number 475, a change from C to G at nucleotide number 488, and a T to a C at nucleotide number 505 where the nucleotide numbers relate to SEQ ID NO:1.
  • PCADM-1 comprises a A at nt 190, a C at nt 191, a C at nt 465, a G at nt 475, a G at nt 488, a C at nt 505 relative to the AGT translation start site.
  • the mRNA encoding PCADM-1 is cleaved by a PCADM-1 DNAZYM disclosed herein, e.g ., a DNA enzyme having the sequence GATCTTCAGGCTAGCTACAACGAGTCCTTGA (SEQ ID NO:9), GTTCCCCAGGCTAGCTACAACGACCCAGGGC (SEQ ID NO:10), and the like.
  • PCADM-1 and "prostate cancer antigen diagnostic marker 1" are used alternatively and refer to the polypeptide encoded by the nucleic acid encoding PCADM-1.
  • the nucleic acid encoding PCADM-1 shares greater than 99% identity with the sequence SEQ ID NO:1.
  • the polypeptide preferably binds at least one double-stranded nucleic acid oligomer that specifically binds with PCADM-1, e.g ., the oligonucleotides having the sequence SEQ ID NOs:3-6.
  • the amino acid sequence of PCADM-1 shares at least about 98% sequence identity with the amino acid sequence of SEQ ID NO:2.
  • PCADM-1 comprises five (5) amino acid substitution at amino acid residue numbers 64, 155, 159, 163 and 169 relative to the amino acid sequence of SEQ ID NO:2. Even more specifically, it would be understood that PCADM-1 comprises a T (threonine) at amino acid residue number 64, an N (asparagine) at amino acid residue number 155, an A (alanine) at residue number 159, an R (arginine) at residue number 163, and an R (arginine) at residue number 169, relative to the amino acid sequence of SEQ ID NO:2.
  • promoter/regulatory sequence means a nucleic acid sequence, which is required for expression of a gene product operably linked to the promoter/regulatory sequence.
  • this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements, which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one, which expresses the gene product in a tissue specific manner.
  • a “constitutive" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living human cell under most or all physiological conditions of the cell.
  • an “inducible" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living human cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • tissue-specific promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a living human cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • a "polyadenylation sequence” is a polynucleotide sequence, which directs the addition of a poly A tail onto a transcribed messenger RNA sequence.
  • a "polynucleotide” means a single strand or parallel and anti-parallel strands of a nucleic acid.
  • a polynucleotide may be either a single-stranded or a double-stranded nucleic acid.
  • nucleic acid typically refers to large polynucleotides.
  • oligonucleotide typically refers to short polynucleotides, generally, no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e ., A, T, G, C), this also includes an RNA sequence (i.e ., A, U, G, C) in which "U" replaces "T"..
  • the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction
  • the DNA strand having the same sequence as an mRNA is referred to as the "coding strand”; sequences on the DNA strand which, are located 5' to a reference point on the DNA are referred to as “upstream sequences”; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences.”
  • a "portion,” of a polynucleotide means at least at least about twenty sequential nucleotide residues of the polynucleotide. It is understood that a portion of a polynucleotide may include every nucleotide residue of the polynucleotide.
  • Primer refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e ., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase.
  • a primer is typically single-stranded, but may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications.
  • a primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g ., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
  • Probe refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide.
  • a probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions.
  • Probes can be labeled with, e.g ., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
  • Recombinant polynucleotide refers to a polynucleotide having sequences that are not naturally joined together.
  • An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
  • a recombinant polynucleotide may serve a non-coding function (e.g ., promoter, origin of replication, ribosome-binding site, etc.) as well.
  • a non-coding function e.g ., promoter, origin of replication, ribosome-binding site, etc.
  • a "recombinant polypeptide” is one, which is produced upon expression of a recombinant polynucleotide.
  • Polypeptide refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer.
  • protein typically refers to large polypeptides.
  • peptide typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.
  • reporter gene means a gene, the expression of which can be detected using a known method.
  • the Escherichia coli lacZ gene may be used as a reporter gene in a medium because expression of the lacZ gene can be detected using known methods by adding the chromogenic substrate o -nitrophenyl- ⁇ -galactoside to the medium ( Gerhardt et al., eds., 1994, Methods for General and Molecular Bacteriology, American Society for Microbiology, Washington, DC, p. 574 ).
  • PCADM-1-inhibiting amount means any amount of a substance or molecule that detectably decreases the level of PCADM-1 expression, amount, and/or activity compared with the level of PCADM-1 expression, amount, and/or activity in the absence of the substance or molecule.
  • any amount that mediates a detectable decrease in: the amount of PCADM-1 present and/or the level of PCADM-1 mRNA or protein expression is encompassed in the present invention.
  • the assays by which these conditions are examined are well-known in the art and several are exemplified herein.
  • PCADM-1 activity refers to the ability of a molecule or compound to ensure cell survival and growth, to be detected in prostate cancer tissue but not in non-cancer tissue, and the like. Further, PCADM-1 activity encompasses the ability of a polypeptide to specifically bind with a nucleic acid having the sequence of a least one of SEQ ID NOs:5-8 as more fully set forth elsewhere herein.
  • PCADM-1 DNAZYM a nucleic acid molecule, which has complementary sequence in a substrate binding region to a specified gene target, and also has an enzymatic or catalytic activity, which is active to specifically cleave RNA in that target. That is, the enzymatic nucleic acid molecule is able to intermolecularly cleave RNA and thereby inactivate a target RNA molecule. This complementary matching of sequence functions to allow sufficient hybridization of the enzymatic nucleic acid molecule to the target RNA to allow the cleavage to occur.
  • DNAZYMs DNA enzymes or “enzymatic nucleic acid” or "PCADM-1 DNAZYM” specifically refers to a DNA sequence complementary, or partially complimentary, to the PCADM-1 mRNA sequence and the terms are used interchangeably herein. However, because they share a common functional capability, the term “DNAZYM” is used interchangeably with phrases such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, nucleozyme, RNA enzyme, endo-ribonuclease, mini-zyme, or leadzyme, oligozyme, as used in the art. All of these terminologies describe nucleic acid molecules with enzymatic activity.
  • a “restriction site” is a portion of a double-stranded nucleic acid, which is recognized by a restriction endonuclease.
  • a portion of a double-stranded nucleic acid is "recognized" by a restriction endonuclease if the endonuclease is capable of cleaving both strands of the nucleic acid at the portion when the nucleic acid and the endonuclease are contacted.
  • telomere binding binds By the term “specifically binds,” as used herein, is meant a compound, e.g ., a protein, a nucleic acid, or an antibody, enzyme, DNAZYM and the like, which recognizes and binds a specific molecule, but does not substantially recognize or bind other molecules in a sample.
  • a compound e.g ., a protein, a nucleic acid, or an antibody, enzyme, DNAZYM and the like, which recognizes and binds a specific molecule, but does not substantially recognize or bind other molecules in a sample.
  • a first oligonucleotide anneals with a second oligonucleotide "with high stringency" if the two oligonucleotides anneal under conditions whereby only oligonucleotides which have complementary regions of 2-10 bp flanking the catalytic core can anneal with one another.
  • the stringency of conditions used to anneal two oligonucleotides is a function of, among other factors, temperature, ionic conditions, ionic strength of the annealing medium, the incubation period, the length of the oligonucleotides, the G-C content of the oligonucleotides, and the expected degree of non-homology between the two oligonucleotides, if known.
  • Methods of adjusting the stringency of annealing conditions are known ( see , e.g ., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York ).
  • transgene means an exogenous nucleic acid sequence which exogenous nucleic acid is encoded by a transgenic cell or mammal.
  • a “recombinant cell” is a cell that comprises a transgene.
  • a cell may be a eukaryotic cell or a prokaryotic cell.
  • the transgenic cell encompasses, but is not limited to, a non-human embryonic stem cell comprising the transgene, a cell obtained from a chimeric non-human mammal derived from a transgenic ES cell where the cell comprises the transgene, a cell obtained from a non-human transgenic mammal, or fetal or placental tissue thereof, and a prokaryotic cell comprising the transgene.
  • exogenous nucleic acid is meant that the nucleic acid has been introduced into a cell or an animal using technology, which, has been developed for the purpose of facilitating the introduction of a nucleic acid into a cell or an animal.
  • substrate flanking region is meant that portion of a DNAZYM, which, is located on either side of the catalytic care and which is complementary to ( i.e ., able to base-pair with) a portion of its substrate.
  • complementary sequence is 100%, For example, as few as 2 bases out of 8 to 10 may be base-paired.
  • tag polypeptide any protein which, when linked by a peptide bond to a protein of interest, may be used to localize the protein, to purify it from a cell extract, to immobilize it for use in binding assays, or to otherwise study its biological properties and/or function.
  • transgenic mammal means a non-human mammal, the germ cells of which, comprise an exogenous nucleic acid.
  • to "treat” means reducing the frequency with which symptoms of the prostate cancer, are experienced by a patient.
  • vector any plasmid or virus encoding an exogenous nucleic acid.
  • the term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into virions or cells, such as, for example, polylysine compounds and the like.
  • the vector may be a viral vector which is suitable as a delivery vehicle for delivery of the PCADM-1 protein or nucleic acid encoding a mammalian PCADM-1, or a DNAZYM complementary to a nucleic acid encoding PCADM-1, or a portion thereof, to the patient, or the vector may be a non-viral vector which is suitable for the same purpose.
  • viral and non-viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U.S.A. 94:12744-12746 ).
  • viral vectors include, but are not limited to, a recombinant vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like ( Cranage et al., 1986, EMBO J. 5:3057-3063 ; International Patent Application No.
  • non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like.
  • a “knock-out targeting vector,” as the term is used herein, means a vector comprising two nucleic acid sequences each of which is complementary to a nucleic acid regions flanking a target sequence of interest, which is to be deleted and/or replaced, by another nucleic acid sequence. The two nucleic acid sequences therefore flank the target sequence, which is to be removed by the process of homologous recombination.
  • the invention includes an antibody that specifically binds to a mammalian PCADM-1 wherein said mammalian PCADM-1 shares at least 99% sequence identity with the amino acid sequence of SEQ ID NO:2.
  • Polyclonal antibodies are generated by immunizing rabbits according to standard immunological techniques well-known in the art (see, e.g ., Harlow et al., 1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY ).
  • the antibodies exemplified herein were produced using standard techniques whereby the animal was immunized with recombinantly produced antigen and boosted repeatedly using antigen according to standard art-recognized methodologies.
  • antibodies can be produced by such methods, but not limited to, as immunizing an animal with a chimeric protein comprising a portion of another protein such as a maltose binding protein or glutathione (GSH) tag polypeptide portion, and/or a moiety such that the PCADM-1 portion is rendered immunogenic (e.g ., PCADM-1 conjugated with keyhole limpet hemocyanin; KLH) and a portion comprising the respective rodent and/or human PCADM-1 amino acid residues.
  • GSH glutathione
  • the chimeric proteins are produced by cloning the appropriate nucleic acids encoding PCADM-1 (e.g ., SBQ ID NO:1) into a plasmid vector suitable for this purpose, such as but not limited to, pBK-CMV, pMAL-2 or pCMX.
  • a plasmid vector suitable for this purpose such as but not limited to, pBK-CMV, pMAL-2 or pCMX.
  • the invention should not be construed as being limited solely to these antibodies or to these portions of the protein antigens. Rather, the invention should be construed to include other antibodies as defined above, as that term is defined elsewhere herein, that specifically bind with mouse and human PCADM-1, or portions thereof.
  • the present invention should be construed to encompass antibodies that, inter alia , bind to PCADM-1 and they are able to bind PCADM-1 present on Western blots, in solution in enzyme linked immunoassays, in fluorescence activated cells sorting (FACS) assays, in immunohistochemical staining of tissues thereby localizing PCADM-1 in the tissues, and in immunofluorescence microscopy of a cell transiently transfected with a nucleic acid encoding at least a portion of PCADM-1.
  • FACS fluorescence activated cells sorting
  • the antibody can specifically bind with any portion of the protein and the full-length protein can be used to generate antibodies specific therefor.
  • the present invention is not limited to using the full-length protein as an immunogen. Rather, the present invention includes using an immunogenic portion of the protein to produce an antibody that specifically binds with mammalian PCADM-1. That is, the invention includes immunizing an animal using an immunogenic portion, or antigenic determinant, of the PCADM-1 protein.
  • the antibodies can be produced by immunizing an animal such as, but not limited to, a rabbit or a mouse, with a protein of the invention, or a portion thereof, or by immunizing an animal using a protein comprising at least a portion of PCADM-1, or a fusion protein including a tag polypeptide portion comprising, for example, a maltose binding protein tag polypeptide portion, covalently linked with a portion comprising the appropriate PCADM-1 amino acid residues.
  • a protein comprising at least a portion of PCADM-1 or a fusion protein including a tag polypeptide portion comprising, for example, a maltose binding protein tag polypeptide portion, covalently linked with a portion comprising the appropriate PCADM-1 amino acid residues.
  • a protein comprising at least a portion of PCADM-1 or a fusion protein including a tag polypeptide portion comprising, for example, a maltose binding protein tag polypeptide portion, covalently linked with a portion comprising the
  • non-conserved regions of a protein of interest can be more immunogenic than the highly conserved regions, which are conserved among various organisms. Further, immunization using a non-conserved immunogenic portion can produce antibodies specific for the non-conserved region thereby producing antibodies that do not cross-react with other proteins, which, can share one or more conserved portions.
  • each PCADM-1 molecule can be used to produce antibodies that are specific only for that PCADM-1 and do not cross-react non-specifically with other PCADM-1s or with other proteins, e.g ., with human S2.
  • PCADM-1 and S2 differ in that PCADM-1 comprises five amino acids that differ from the same residues of S2, i.e ., PCADM-1 comprises an T (threonine) at amino acid residue number 64, N (asparagine) at amino acid residue number 155, an A (alanine) at residue number 159, an R (arginine) at residue number 163, and an R (arginine) at residue number 169 relative to the amino acid sequence of SEQ ID NO:2, all of which differ from the amino acid residue at that same position of the amino acid sequence of human S2 (see, e.g., GenBank Accession No. XM045032, Human S2 40S ribosomal protein).
  • antibodies developed using a region that is conserved among one or more PCADM-1 molecule can be used to produce antibodies that react specifically with one or more PCADM-1 molecule and with human S2, which shares about 98% amino acid homology with PCADM-1. That is, the skilled artisan would understand that portions of S2 and PCADM-1 that do not comprise the region of amino acid substitutions (i.e ., amino acid residue numbers 64, 155, 159, 163 and 169) can be used to produce antibodies that specifically bind with S2 and with PCADM-1.
  • the sequence of S2 is well known in the art and includes, but is not limited to, the sequence of GenBank Accession No. XM045032, and the like.
  • Methods for producing antibodies that specifically bind with a conserved protein domain which may otherwise be less immunogenic than other portions of the protein are well-known in the art and include, but are not limited to, conjugating the protein fragment of interest to a molecule (e.g ., keyhole limpet hemocyanin, and the like), thereby rendering the protein domain immunogenic, or by the use of adjuvants (e.g ., Freund's complete and/or incomplete adjuvant, and the like), or both.
  • a molecule e.g ., keyhole limpet hemocyanin, and the like
  • adjuvants e.g ., Freund's complete and/or incomplete adjuvant, and the like
  • the present invention encompasses antibodies that neutralize and/or inhibit PCADM-1 activity (e.g ., by necessary PCADM-1/DNA binding interactions, and the like), which antibodies scan recognize one or more PCADM-1s.
  • the invention should not be construed as being limited solely to the antibodies disclosed herein or to any particular immunogenic portion of the proteins of the invention. Rather, the invention should be construed to include other antibodies as described above to PCADM-1.
  • the polypeptide shares at least 99% sequence identity with human PCADM-1 (SEQ ID NO:2).
  • the polypeptide that specifically binds with an antibody specific for mammalian PCADM-1 is human PCADM-1.
  • the polypeptide that specifically binds with an antibody that specifically binds with a mammalian PCADM-1 is SEQ ID NO:2.
  • the invention encompasses polyclonal, monoclonal, synthetic antibodies, and the like.
  • the crucial feature of the antibody of the invention is that the antibody bind specifically with PCADM-1. That is, the antibody of the invention recognizes PCADM-1, or a fragment thereof (e.g ., an immunogenic portion or antigenic determinant thereof, on Western blots, in immunostaining of cells, and immunoprecipitates PCADM-1 using standard methods well-known in the art.
  • the antibodies can be used to localize the relevant protein in a cell and to study the role(s) of the antigen recognized thereby in cell processes. Moreover, the antibodies can be used to detect and or measure the amount of protein present in a biological sample using well-known methods such as, but not limited to, Western blotting and enzyme-linked immunosorbent assay (ELISA). Moreover, the antibodies can be used to immunoprecipitate and/or immuno-affinity purify their cognate antigen using methods well-known in the art. In addition, the antibody can be used to decrease the level of PCADM-1 in a cell thereby inhibiting the effect(s) of PCADM-1 in a cell.
  • ELISA enzyme-linked immunosorbent assay
  • the required PCADM-1 receptor/ligand interactions are.therefore inhibited such that the effect of PCADM-1 mediated signaling are also inhibited.
  • detectable effects upon inhibiting PCADM-1 protein/nucleic acid binding interaction using an anti-PCADM-1 antibody can include, but are not limited to, decreased proliferation of prostate tumor cells, and the like.
  • polyclonal antibodies The generation of polyclonal antibodies is accomplished by inoculating the desired animal with the antigen and isolating antibodies, which specifically bind the antigen there from using standard antibody production methods such as those described in, for example, Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY ).
  • Monoclonal antibodies directed against full length or peptide fragments of a protein or peptide may be prepared using any well known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY ) and in Tuszynski et al. (1988, Blood, 72:109-115 ). Quantities of the desired peptide may also be synthesized using chemical synthesis technology. Alternatively, DNA encoding the desired peptide may be cloned and expressed from an appropriate promoter sequence in cells suitable for the generation of large quantities of peptide. Monoclonal antibodies directed against the peptide are generated from mice immunized with the peptide using standard procedures as referenced herein.
  • Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. Immunol. 12:125-168 ), and the references cited therein.
  • the antibody of the invention may be "humanized” using the technology described in, for example, Wright et al., id ., and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77:755-759 ), and other methods of humanizing antibodies well-known in the art or to be developed.
  • a cDNA library is first obtained from mRNA which is isolated from cells, e.g ., the hybridoma, which express the desired protein to be expressed on the phage surface, e.g ., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA, which specifies immunoglobulin fragments are obtained, by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes.
  • the procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al., supra.
  • Bacteriophage which encode the desired antibody, may be engineered such that the protein is displayed on the surface thereof in such a manner that it is available for binding to its corresponding binding protein, e.g ., the antigen against which the antibody is directed.
  • its corresponding binding protein e.g ., the antigen against which the antibody is directed.
  • Bacteriophage which, do not express the antibody, will not bind to the cell.
  • panning techniques are well known in the art and are described for example, in Wright et al. ( supra ).
  • a cDNA library is generated from mRNA obtained from a population of antibody-producing cells.
  • the mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same.
  • Amplified cDNA is cloned into M13 expression vectors creating a library of phage which express human Fab fragments on their surface.
  • Phage, which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin.
  • this procedure immortalizes DNA encoding human immunoglobulin rather than cells, which express human immunoglobulin.
  • phage which, encode the Fab portion of an antibody molecule.
  • the invention should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the invention.
  • Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CH1) of the heavy chain.
  • Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment.
  • An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein.
  • Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al. (1991, J. Mol. Biol. 222:581-597 ). Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.
  • the invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities ( Barbas, 1995, Nature Medicine 1:837-839 ; de Kruif et aL 1995, J. Mol. Biol. 248:97-105 ).
  • an immunotoxin comprising an antibody component that specifically binds with PCADM-1 linked to another agent, particularly a cytotoxic or otherwise anticellular agent, having the ability to kill or suppress the growth or cell division of cells.
  • an immunotoxin comprising an antibody component that specifically binds with PCADM-1 linked to another agent, particularly a cytotoxic or otherwise anticellular agent, having the ability to kill or suppress the growth or cell division of cells.
  • Such immunotoxins, or immunoconjugates are well known in the art and there are a plethora of toxic agents that can be used to produce them such as, but not limited to, ricin toxin, staphyloaoccal enterotoxin A (SEA) ( Dohlsten et aL, 1994, Proc. Natl. Acad. Sci.
  • SEA staphyloaoccal enterotoxin A
  • the invention encompasses antibodies that specifically bind with PCADM-1 and that preferentially target cytotoxic agents to tumor cells while minimizing the cytotoxic effect(s) to normal cells and tissues since, as disclosed herein, tumor cells express higher level of PCADM-1 than normal, non-tumor cells.
  • the invention also includes a composition comprising an antibody as described above, and a pharmaceutically-acceptable carrier.
  • compositions comprising at least one of an antibody as defined above.
  • compositions encompassed in the invention also comprise those comprising various antibodies that specifically bind with various epitopes of the PCADM-1 polypeptide.
  • compositions comprising mixtures of the above-discussed compounds, i.e. , antibodies are encompassed in the invention.
  • compositions comprising at least one of the afore-mentioned antibodies where the compositions further comprise additional compounds, such as, but not limited to, small molecules, peptidomimetics, DNAZYMs or DNA enzymes, ribozymes and antisense nucleic acids specific for other proteins (e.g ., VEGF-1 and MMP-2, and the like), drugs, chemotherapeutic agents, and the like, are also contemplated in the present invention.
  • additional compounds such as, but not limited to, small molecules, peptidomimetics, DNAZYMs or DNA enzymes, ribozymes and antisense nucleic acids specific for other proteins (e.g ., VEGF-1 and MMP-2, and the like), drugs, chemotherapeutic agents, and the like.
  • additional compounds such as, but not limited to, small molecules, peptidomimetics, DNAZYMs or DNA enzymes, ribozymes and antisense nucleic acids specific for other proteins (e.g .,
  • compositions which are useful include, but are not limited to, glycerol, water, saline, ethanol and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey ).
  • compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3-butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
  • compositions that are useful in the methods of the invention may be administered, prepared, packaged, and/or sold in formulations suitable for oral, rectal, vaginal, peritoneal, topical, pulmonary, intranasal, buccal, ophthalmic, or another route of administration.
  • Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
  • compositions of the invention may be administered via numerous routes, including, but not limited to, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, or ophthalmic administration routes.
  • routes including, but not limited to, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, or ophthalmic administration routes.
  • the route(s) of administration will be readily apparent to the skilled artisan and will depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like.
  • compositions that are useful in the methods of the invention may be administered systemically in oral solid formulations, ophthalmic, suppository, aerosol, topical or other similar formulations.
  • such pharmaceutical compositions may contain pharmaceutically-acceptable carriers and other ingredients known to enhance and facilitate drug administration.
  • Other possible formulations, such as nanoparticles, liposomes, resealed erythrocytes, and immunologically based systems may also be used to administer PCADM-1 and/or a nucleic acid encoding the same according to the methods of the invention.
  • Antibodies as defined above, which are identified using any of the methods described herein may be formulated and administered to a mammal for treatment of prostate cancer are now described.
  • the invention encompasses the preparation and use of pharmaceutical compositions comprising an antibody as described above for treatment of prostate cancer as an active ingredient.
  • a pharmaceutical composition may consist of the active ingredient alone, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or some combination of these.
  • the active ingredient may be present in the pharmaceutical composition in the form of a physiologically acceptable ester or salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art
  • the term "pharmaceutically acceptable carrier” means a chemical composition with which the active ingredient may be combined and which, following the combination, can be used to administer the active ingredient to a subject.
  • physiologically acceptable ester or salt means an ester or salt form of the active ingredient which is compatible with any other ingredients of the pharmaceutical composition, which is not deleterious to the subject to which the composition is to be administered.
  • compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
  • compositions are principally directed to pharmaceutical compositions, which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.
  • compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, intrathecal or another route of administration.
  • Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses.
  • a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient, which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • compositions of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1 % and 100% (w/w) active ingredient.
  • a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
  • additional agents include anti-emetics and scavengers such as cyanide and cyanate scavengers.
  • Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
  • a formulation of a pharmaceutical composition of the invention suitable for oral administration may be prepared, packaged, or sold in the form of a discrete solid dose unit including, but not limited to, a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient.
  • Other formulations suitable for oral administration include, but are not limited to, a powdered or granular formulation, an aqueous or oily suspension, an aqueous or oily solution, or an emulsion.
  • an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a less polar character than water.
  • a tablet comprising the active ingredient may, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients.
  • Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent.
  • Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture.
  • compositions used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents.
  • Known dispersing agents include, but are not limited to, potato starch and sodium starch glycollate.
  • Known surface active agents include, but are not limited to, sodium lauryl sulphate.
  • Known diluents include, but are not limited to, calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate.
  • Known granulating and disintegrating agents include, but are not limited to, corn starch and alginic acid.
  • binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose.
  • Known lubricating agents include, but are not limited to, magnesium stearate, stearic acid, silica, and talc.
  • Tablets may be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient.
  • a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets.
  • tablets may be coated using methods described in U.S. Patents numbers 4,256,108 ; 4,160,452 ; and 4,265,874 to form osmotically-controlled release tablets.
  • Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide pharmaceutically elegant and palatable preparation.
  • Hard capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin. Such hard capsules comprise the active ingredient, and may further comprise additional ingredients including, for example, an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin.
  • Soft gelatin capsules comprising the active ingredient may be made using a physiologically degradable composition, such as gelatin.
  • Such soft capsules comprise the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.
  • Liquid formulations of a pharmaceutical composition of the invention which are suitable for oral administration may be prepared, packaged, and sold either in liquid form or in the form of a dry product intended for reconstitution with water or another suitable vehicle prior to use.
  • Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle.
  • Aqueous vehicles include, for example, water and isotonic saline.
  • Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents.
  • Oily suspensions may further comprise a thickening agent.
  • suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose.
  • Known dispersing or wetting agents include, but are not limited to, naturally-occurring phosphates such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g ., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively).
  • naturally-occurring phosphates such as lecithin
  • condensation products of an alkylene oxide with a fatty acid with a long chain aliphatic alcohol
  • a partial ester derived from a fatty acid and a hexitol or with a partial ester derived from a fatty acid and a hex
  • emulsifying agents include, but are not limited to, lecithin and acacia.
  • preservatives include, but are not limited to, methyl, ethyl, or n-propyl-para- hydroxybenzoates, ascorbic acid, and sorbic acid.
  • Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.
  • Known thickening agents for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.
  • Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent.
  • Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent.
  • Aqueous solvents include, for example, water and isotonic saline.
  • Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.
  • Powdered and granular formulations of a pharmaceutical preparation of the invention may be prepared using known methods. Such formulations may be administered directly to a subject, used, for example, to form tablets, to fill capsules, or to prepare an aqueous or oily suspension or solution by addition of an aqueous or oily vehicle thereto. Each of these formulations may further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, may also be included in these formulations.
  • a pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in-water emulsion or a water-in-oil emulsion.
  • the oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these.
  • compositions may further comprise one or more emulsifying agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate.
  • emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for rectal administration
  • a composition may be in the form of, for example, a suppository, a retention enema preparation, and a solution for rectal or colonic irrigation.
  • Suppository formulations may be made by combining the active ingredient with a non-irritating pharmaceutically acceptable excipient which is solid at ordinary room temperature (i.e ., about 20°C) and which is liquid at the rectal temperature of the subject ( i.e ., about 37°C in a healthy human).
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, cocoa butter, polyethylene glycols, and various glycerides.
  • Suppository formulations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • Retention enema preparations or solutions for rectal or colonic irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier.
  • enema preparations may be administered using, and may be packaged within, a delivery device adapted to the rectal anatomy of the subject.
  • Enema preparations may further comprise various additional ingredients including, but not limited to, antioxidants and preservatives.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for vaginal administration.
  • a composition may be in the form of, for example, a suppository, an impregnated or coated vaginally-insertable material such as a tampon, a douche preparation, or gel or cream or a solution for vaginal irrigation.
  • Methods for impregnating or coating a material with a chemical composition include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material ( i.e. , such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying.
  • Douche preparations or solutions for vaginal irrigation may be made by combining the active ingredient with a pharmaceutically acceptable liquid carrier.
  • douche preparations may be administered using, and may be packaged within, a delivery device adapted to the vaginal anatomy of the subject.
  • Douche preparations may further comprise various additional ingredients including, but not limited to, antioxidants, antibiotics, antifungal agents, and preservatives.
  • parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue.
  • Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like.
  • parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques.
  • Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative.
  • Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations, Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
  • the active ingredient is provided in dry (i.e. , powder or granular) form for reconstitution with a suitable vehicle (e.g. , sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
  • a suitable vehicle e.g. , sterile pyrogen-free water
  • compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution.
  • This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein.
  • Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example.
  • Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides.
  • compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
  • Formulations suitable for topical administration include, but are not limited to, liquid or semi-liquid preparations such as liniments, lotions, oil-in-water or water-in-oil emulsions such as creams, ointments or pastes, and solutions or suspensions.
  • Topically-administrable formulations may, for example, comprise from about 1% to about 10% (w/w) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent.
  • Formulations for topical administration may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity.
  • a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, and preferably from about 1 to about 6 nanometers.
  • Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent/powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container.
  • such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. More preferably, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers.
  • Dry powder compositions preferably include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
  • Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w/w) of the composition, and the active ingredient may constitute 0.1 to 20% (w/w) of the composition.
  • the propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (preferably having a particle size of the same order as particles comprising the active ingredient).
  • compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension.
  • Such formulations may be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and may conveniently be administered using any nebulization or atomization device.
  • Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate.
  • the droplets provided by this route of administration preferably have an average diameter in the range from about 0.1 to about 200 nanometers.
  • formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the invention.
  • Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers.
  • Such a formulation is administered in the manner in which snuff is taken, i.e ., by rapid inhalation through the nasal passage from a container of the powder held close to the nares.
  • Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for buccal administration.
  • Such formulations may, for example, be in the form of tablets or lozenges made using conventional methods, and may, for example, 0.1 to 20% (w/w) active ingredient, the balance comprising an orally dissolvable or degradable composition and, optionally, one or more of the additional ingredients described herein.
  • formulations suitable for buccal administration may comprise a powder or an aerosolized or atomized solution or suspension comprising the active ingredient.
  • Such powdered or aerosolized formulations, when dispersed preferably have an average particle or droplet size in the range from about 0.1 to about 200 nanometers, and may further comprise one or more of the additional ingredients described herein.
  • a pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for ophthalmic administration.
  • Such formulations may, for example, be in the form of eye drops including, for example, a 0.1-1.0% (w/w) solution or suspension of the active ingredient in an aqueous or oily liquid carrier.
  • Such drops may further comprise buffering agents, salts, or one or more other of the additional ingredients described herein.
  • Other ophthalmalmically-administrable formulations, which are useful, include those, which comprise the active ingredient in microcrystalline form or in a liposomal preparation.
  • additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials.
  • compositions of the invention are known in the art and described, for example in Genaro, ed. (1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA ), which is incorporated herein by reference.
  • dosages of the compound of the invention which may be administered to an animal, preferably a human, will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration.
  • the compound can be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even lees frequently, such as once every several months or even once a year or less.
  • the frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, and the like.
  • PCADM-1 may be useful to increase the level or activity of PCADM-1 in a cell. That is, it can be useful to treat or alleviate a disease, disorder of condition associated with or mediated by decreased expression, level, or activity of PCADM-1 by administering PCADM-1.
  • diseases, disorders or conditions include, but are not limited to prostate cancer, and possibly other solid cancers or leukemias, AIDS, HIV infection, immune disorders and inflammatory or degenerative disorders, and the like.
  • an antibody of the invention as defined above that specifically binds with PCADM-1 is used for preparing a medicament for administration to an animal either to increase or reduce the level of PCADM-1 present in the animal
  • the amount of the antibody to be administered to the animal can be titrated by assessing the level of PCADM-1 and/or sugar present in the blood/urine/other fluids or by determining the level of expression of PCADM-1 mRNA or the level of PCADM-1 polypeptide or nucleic acid encoding PCADM-1 present in the tissues of the animal.
  • a mixture of any compound that inhibits the effect of PCADM-1 can also be used for preparing a medicament to alleviate and/or treat a disease, disorder or condition associated with or mediated by altered PCADM-1 expression.
  • a PCADM-1 DNAZYM an antibody as defined above a double-stranded nucleic acid that specifically binds with PCADM-1 thereby disrupting PCADM-1/DNA binding necessary for PCADM-1 activity
  • PCADM-1 e.g. , a PCADM-1 DNAZYM, an antibody as defined above a double-stranded nucleic acid that specifically binds with PCADM-1 thereby disrupting PCADM-1/DNA binding necessary for PCADM-1 activity
  • the invention encompasses uses of anti-PCADM-1 antibody as defined above, with PCADM-1 DNAZYM, double-stranded nucleic acid that specifically binds with PCADM-1 either alone or in combination with each other and with substances including, but not limited to, DNAZYMs, or directed to other proteins (e.g. , VEGF-1, MMP-2, and the like), peptidomimetics, small molecules, and drugs (e.g. , chemotherapeutic agents), and various permutations thereof as the skilled artisan would determine using methods well-known in the art and methods that are developed in the future with respect to administration of such molecules.
  • Methods for assessing the level of PCADM-1 e.g. , using anti-PCADM-1 antibodies in Western blot or other immune-based analyses such as, FACS analysis, or enzyme linked immunosorbent assay); methods for assessing the level of PCADM-1 expression in a cell and/or tissues (e.g. , using Northern blot analysis, and the like); and/or methods such as "Monte Carlo-like" DNA/protein binding assays based on detection of binding of a duplex nucleic acid, (e.g. , PCADM-1 probe 1 (SEQ ID NO:5) and PCADM-1 probe 2 (SEQ ID NO:6)), with PCADM-1 (e.g.
  • the present invention includes methods of diagnosis of prostate cancer.
  • the invention includes an in vitro method of diagnosing a prostate tumor in a previously undiagnosed mammal.
  • the method comprises assessing the level of PCAM-1 in a biological sample obtained form said mammal and comparing the level of PCADM-1 (expression, amount, activity) in said sample with the level of PCADM-1 in a biological sample obtained from an otherwise identical normal mammal that is not afflicted with a prostate tumor.
  • a higher level of PCADM-1 in the sample from the mammal in question compared with the level of PCADM-1 in the sample obtained from a mammal known not to be afflicted with prostate tumor is an indication that the mammal is afflicted with a prostate tumor.
  • an increased level of PCADM-1 expression and/or activity is associated with the presence of prostate cancer.
  • detection of increased level of PCADM-1 protein, nucleic acid encoding PCADM-1, and/or increased level of PCADM-1 binding with a double-stranded nucleic acid that specifically binds with PCADM-1, in a sample obtained from mammal is an indication that the mammal is afflicted with prostate cancer:
  • the PCADM-1 has a sequence that shares at least 99% sequence identity with the amino acid sequence of SEQ ID No:2.
  • the data disclosed elsewhere herein demonstrate that there is a correlation between the level of PCADM-1 in the sample and the Gleason Score of the various tumor tissues indicating that the level of PCADM-1 is a staging marker for such tumors.
  • detection of an altered level of expression of PCADM-1 (whether detected using antibody-based methods or methods based on detection of nucleic acids), or detection of increased PCADM-1 binding of a nucleic acid that specifically binds with PCADM-1 (e.g ., such as a nucleic acid having the sequence of SEQ m NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8), is indicative of the stage of a prostate tumor since the data disclosed herewith demonstrates that the level of expression of PCADM-1 is correlated with the Gleason Score of the tumor.
  • a prostate tumor can be "staged” by assessing the level of PCADM-1 in a sample obtained from a mammal compared with the level of PCADM-1 detecting in a sample obtained from an otherwise normal mammal known not to have a prostate cancer tumor or known to have a prostate cancer tumor of a known specific stage and/or having a known Gleason Score.
  • the biological sample is selected from the group consisting of a blood sample, a prostate biopsy, a urine sample, a prostatic fluid sample, a semen sample, a lymph fluid sample, a seminal vesicle tissue sample, a pleural cavity fluid sample, a perineal cavity fluid sample, a peritoneal cavity fluid sample, a bone marrow sample, a salivary gland fluid sample, and prostate cancer tumor sample, and a sample obtained from other cancer tissues, and the like.
  • Such methods include, but are not limited to, antibody-based detection methods (e.g. , using anti-PCADM-1 or other cross-reactive antibodies in Western blot or other immune-based analyses such as ELISA, FACS assay, and enzyme linked immuno-sandwich assay); methods for assessing the level of PCADM-1 expression in a cell and/or tissues (e.g ., using Northern blot analysis, and the like), and/or methods such as "Monte Carlo-like" DNA/protein binding assays based on detection of binding of a duplex nucleic acid, e.g.
  • PCADM-1 probe 1 SEQ ID NO:5
  • PCADM-1 probe 2 SEQ ID NO:6
  • PCADM-1 polypeptide e.g. , using nylon membrane-based detection of double-stranded nucleic acid and/or EMSAs to assess binding of PCADM-1 with a double-stranded nucleic acid that specifically binds with PCADM-1).
  • methods of detecting PCADM-1 either by detecting a PCADM-1 polypeptide or a nucleic acid encoding PCADM-1 (i.e.
  • RNA or DNA RNA or DNA
  • a nucleic acid that specifically binds with PCADM-1 polypeptide are disclosed herein or are well known to those skilled in the art and are encompassed in the present invention.
  • the present invention encompasses similar assays for the detection of a specific protein or nucleic acid in a sample as may be developed in the future.
  • kits which comprise an antibody as described above that specifically binds PCADM-1 an applicator, and instructional materials which describe use of the compound to perform the methods of the invention. Exemplary kits are described below.
  • the invention includes a kit for alleviating prostate cancer.
  • the kit is used pursuant to the methods disclosed in the invention. Briefly, the kit may be used to contact a cell with an antibody that specifically binds with PCADM-1, wherein the decreased expression, amount, or activity of PCADM-1 mediates a beneficial effect.
  • the kit comprises an applicator and an instructional material for the use of the kit. These instructions simply embody the examples provided herein.
  • the kit includes a pharmaceutically-acceptable carrier.
  • the composition is provided in an appropriate amount as set forth elsewhere herein. Further, the route of administration and the frequency of administration are as previously set forth elsewhere herein.
  • Reference Example 1 Novel assay for identification of DNA binding proteins and the DNA molecules that specifically_bind therewith
  • the example relates to the development of a "proteomics" platform for rapid identification of double stranded DNA sequences, which preferentially bind protein(s), expressed in diseased tissue compared with benign or normal tissue from the same patient.
  • the basic approach entails the systematic synthesis of 7 base pair, 8 base pair, and 9 base pair double stranded DNA sequences starting with the degenerate sequences and ending with "completed” sequences (see Table 2).
  • a quantitative "DNA-protein” binding assay on a solid support e.g.
  • nylon membrane is employed to assess 'DNA-protein' binding affinity and to identify the DNA sequence(s), which preferentially bind protein(s) from diseased tissue (i.e., cancer), compared to benign or normal tissue from the same patient, i.e. , otherwise identical tissue known not to have any detectable disease, disorder or condition.
  • diseased tissue i.e., cancer
  • benign or normal tissue from the same patient, i.e. , otherwise identical tissue known not to have any detectable disease, disorder or condition.
  • the example field relates to identification of novel DNA sequences, which can uniquely bind protein(s) in diseased tissue and/or normal or benign tissue.
  • the invention further relates to the diagnosis, prevention and treatment of diseases (including cancer) relating to dis-regulation (also referred to mal-regulation or mal-expression) of nucleic acid expression.
  • the data disclosed herein demonstrate the discovery of a novel "Monte Carlo-like” assay for the identification of DNA binding proteins and the DNA molecule that specifically binds with the proteins.
  • the present example discloses a novel rapid "quantitative" screening assay for identification of novel double-stranded oligonucleotides ranging in length from about 7 to 9 base pairs (also referred to as 7 to 9 base pairs) where the oligonucleotides bind a protein in a protein extract prepared using a tissue having a detectable disease, disorder or condition (i.e., cancer), but which oligonucleotides do not detectably bind with proteins obtained from otherwise identical tissue that does not demonstrate a disease, disorder or condition (i.e., normal or benign tissue).
  • a tissue having a detectable disease, disorder or condition i.e., cancer
  • DNA sequence lengths represent the average length of known DNA sequences which normally bind transcription factors or co-factors involved in the regulation of gene expression in cells and tissue (Sambrook et al. 1989). Therefore, the "semi-random" screening for DNA sequences which bind protein over expressed in matching tissues from the same patient should identify novel DNA sequences which uniquely bind protein(s) involved in the regulation of gene transcription and gene expression associated with normal, benign or diseased tissue.
  • the present example is not limited to any particular length of oligonucleotide to be interrogated for DNA-binding ability.
  • oligonucleotides having a length of about 7 to 9 base pairs are exemplified herein, oligonucleotides having other lengths, including from having a length from about 7 to 16 base pairs (7-16 bps or 7-16 mers), are encompassed in the present example.
  • the present example relates to the synthesis of either 7 base pair, 8 base pair or 9-mer double stranded DNA sequences, which selectively bind protein(s) from crude tissue extracts.
  • the DNA sequences are synthesized and ( ⁇ ATP) 32 P-radiolabeled and purified by column chromatography according to standard methods of Sambrook et al. (1989).
  • Crude protein extracts were prepared from dissected human tissue of the same patient ( i.e. , normal, benign and cancer, and tissue not exhibiting in any detectable disease, disorder or condition) and increased amounts of protein (1, 5, 10 and 20 ⁇ g total protein) was applied to nylon membrane filters.
  • nylon membranes were then incubated using a constant amount of radiolabeled double stranded DNA and the filters were washed with phosphate buffer to remove non-specifically bound DNA and protein which failed to bind DNA according to established methods (Sambrook et al., 1987).
  • Table 1 provides an example of the DNA double stranded sequences (8 base pair) screened using the "Monte Carlo-like" array protocol disclosed herein.
  • the amount of radiolabeled probe binding to crude protein extracts from different regions of a human prostate i.e., prostate cancer, benign prostate hyperplasia, and prostate stroma
  • Background levels (0 or zero) of radiolabeled probe binding to bovine serum albumin were measured for each probe.
  • Routine screening for probes of interest was done in sequential rounds where the initial sequence had a core of 4N ( i.e. , random sequence).
  • sequence from this batch with the highest binding level was then used to generate 4 different sequences with a random unknown core sequence of 3N and the binding assays were repeated to identify the sequence with highest binding activity for the tissue site of interest (i.e., cancer in this case).
  • sequence from this batch was subsequently selected and 4 sequences were produced having a core of 2N, 1N and zero N, respectively, useful to identify the sequence with highest binding activity for the tissue site of interest (i.e., cancer).
  • Example 2 Identification of a novel DNA binding protein, PCADM-1, and the DNA molecules that specifically bind therewith
  • the data disclosed herein demonstrate the discovery of a novel nucleic acid encoding a prostate cancer marker protein and a novel DNA molecule that specifically binds with the protein. These nucleic and amino acid sequences can be used to detect prostate cancer.
  • This example relates to nucleic acid and amino acid sequences of DNA consensus domains, which, bind a novel marker protein for cancer, herein referred to as "PCADM-1" protein.
  • PCADM-1 a novel marker protein for cancer
  • the example further relates to the use of these sequences and probes which specifically recognize the PCADM-1 protein in the diagnosis, prevention and treatment of diseases related to disregulated cell growth and proliferation and cancer.
  • a novel "Monte Carlo-like" type screening assay for identification of novel DNA binding proteins i.e., transcription factors involved in chromosomal recombination
  • DNA binding proteins i.e., transcription factors involved in chromosomal recombination
  • each member of a set of stranded DNA sequences was screened individual to assess protein binding by the oligonucleotide on nitrocellulose filters and in electrophoretic mobility gel shift assays (EMSAs).
  • CACGGATG [SEQ ID NO:5]
  • PCADM-1 probe 1 nuclear protein(s) from prostate cancer glands specifically bound a novel DNA sequence (CACGGATG [SEQ ID NO:5]), designated as "PCADM-1 probe 1."
  • the CACGGATG sequence was very similar to known break point cluster region sequences ( Rabbitts and Boehm, 1991, Advances in Immunology 50:119-146 ) associated with chromosomal breakage in T-cells and B-cells.
  • double-stranded oligonucleotide CACAATGA [SEQ ID NO:6]
  • PCADM-1 probe 2 double-stranded oligonucleotide that specifically bind with PCADM-1.
  • the PCADM-1 nucleic acid sequence is at least 99% homologous with that of the S2-ribosomal protein, and exhibiting at least 3 specific base pair mutations, which, render the PCADM-1 protein distinct from S2.
  • S2 is a totally different protein which is part of the ribosomal complex in normal cells and which does not appear to be present as a 'free entity' separate from ribosomal complexes in the cell or demonstrate any DNA binding activity. Accordingly, the data disclosed herein demonstrate, surprisingly, that even though S2 and PCADM-1 differ at only five amino acid residues, the two proteins demonstrate vastly different biological characteristics as exemplified and discussed elsewhere herein.
  • PCADM-1 is over expressed in prostate tumor cells and tissues and not found in normal cells and tissue. It should be noted that there are several reports demonstrating a connection between over-expression of mRNAs encoding ribosomal proteins and cancer ( Chiao et al., 1992, Mol. Carcinog. 5:219-231 ; Fernandez-Pol et al., 1993, J. Biol. Chem. 268: 21198-211204 ; Fernandez-Pol et al., 1994, Cell Growth & Differentiation 5:821-825 ; Fernandez-Pol, 1996, Anticancer Res. 16:2177-2186 ; Chan et al., 1996, Biochem. and Biophys. Res. Comm.
  • the rat ribosomal protein S3a is identical to the product of the rat v-fos transformation effector gene ( Chan et al., 1996, Biochem. and Biophys. Res. Comm. 228:141-147 ). S3a is involved in initiation of protein synthesis and is also related to proteins involved in the regulation of growth and the cell cycle ( Chan et al., 1996, Biochem. and Biophys. Res. Comm. 228:141-147 ).
  • the rat ribosomal protein L10 is homologous to a DNA-binding protein and to a putative Wilm's tumor suppressor gene ( Chan et al., 1996, Biochem. and Biophys. Res. Comm. 225:952-956 ).
  • mutant "ribosomal-like" proteins might be prognostic or diagnostic for cancer and play important roles in regulating chromosomal DNA activities, gene expression, and the behavior of cancer cells:
  • PSA prostate specific antigen
  • the present example relates to nucleic acid sequences, which can be used in screening assays to identify novel DNA binding proteins in nuclear extracts derived from human tissues.
  • the screening assay is useful in identifying novel transcription factors over-expressed in nuclear protein extracts of prostate tissue (i.e. , glands).
  • ESAs electrophoretic mobility gel shift assays
  • Polyclonal and monoclonal antibodies were generated in rabbits and mice, respectively, using standard methods familiar to those schooled in the art of producing antibodies utilizing purified recombinant protein, in this case, PCADM-1, as an antigen.
  • Antibodies were characterized as being specific for the 33 kDa PCADM-1 antigen using Western dot blotting analysis, EIAs and immunostaining techniques according to standard methods familiar to those schooled in the art. The results disclosed herein demonstrate that the PCADM-1 antibody specifically recognizes PCADM-1 in recombinant plasmid protein extracts, in prostate tumor cell protein extracts and cells, and in urine and serum samples obtained from patients with prostate cancer.
  • PCADM-1 is a significantly better prognostic and diagnostic marker for prostate cancer compared with PSA in prostate tissue extracts.
  • nuclear protein extracts from microdissected regions of the prostate expressed significantly elevated levels of PCADM-1 compared to very low levels detected in matching seminal vesicle (SV), benign prostatic hyperplasia (BPH) or high grade prostatic intraepithelial neoplasm (HGPIN) foci.
  • SV seminal vesicle
  • BPH benign prostatic hyperplasia
  • HGPIN high grade prostatic intraepithelial neoplasm
  • PSA levels ( ⁇ g/mg DNA) were elevated in BPH, HGPIN, and GS specimens, but were significantly reduced in tissue extracts from GS 6, GS 7, and GS 8-10 foci.
  • the PSA levels in the tissue extracts were inversely proportional to the serum PSA levels (ng/ml) detected prior to prostatectomy.
  • Serum PSA levels increased as a function of the Gleason Score (Table 4). TABLE 4 PCADM-1 and PSA in microdissected tissues.
  • All BPH and HGPIN specimens came from the same prostates exhibiting cancer. Samples were assayed at least 3 times and the data were averaged for all the patients in the cohort studied. *(range of PSA detected). #PCADM-1 and PSA levels ( ⁇ g/mg DNA). NA- not applicable. All serum PSA measurements were from routine diagnostic tests taken upon examination of the patient by the Urologist and prior to radical prostatectomy.
  • the EIA studies on human urine were carried out with freshly collected urine or urine stored frozen according to methods familiar to those schooled in the art.
  • the urine sample (100-200 ⁇ l) was applied to 96 well titer plates, the antigen allowed to attach for several hours, the plates washed with buffer, primary and secondary antibody were applied, and antibody detecting reagents were added, and the plates were read in a MicroTiter Plate ELISA reader (set at A450 nm) (BioRad, Hercules, CA).
  • the urine PCADM-1 levels were elevated and these patients also had elevated serum PSA levels ( i.e. , greater than about 5 ng/ml).
  • serum PSA levels i.e. , greater than about 5 ng/ml
  • the present example also relates to the screening assay and 8 base pair nucleic acid sequences identified, which, are capable of detecting PCADM-1.
  • the nucleic acid is a probe comprising the nucleic sequence of SEQ ID NO:5, and the sequence SEQ ID NO:6.
  • the double-stranded oligonucleotides having the sequence SEQ ID NO:7 and SEQ ID NO:8, also bind specifically with PCADM-1 and can be used to detect and assess the level of PCADM-1.
  • nucleic acid sequences which encode the PCADM-1 protein (SEQ ID NO:1), and the amino acid sequence of the PCADM-1 protein encoded by these nucleic acid sequences (SBQ ID NO:2) are provided.
  • the present example also relates to expression vectors and host cells containing expression vectors which comprise these nucleic acid sequences.
  • Expression vectors and host cells which can be transfected with an expression vector, are well known in the art. Methods for incorporating a selected nucleic acid sequence such as that of the present invention into a vector and ultimately into a host cells are also well known.
  • the nucleic acid and amino acid sequences of the present example are useful in developing screening assays for detection of PCADM-1 protein in biological samples.
  • antibodies can be raised against the PCADM-1 protein and used in an immunoassay such as an EIA or ELISA to detect PCADM-1 protein in a biological sample such as tissue, sputum, urine or serum.
  • Antibodies can be raised against this protein in accordance with well known procedures.
  • labeled nucleic acid probes can be prepared from the nucleic acid sequences of the present invention and used in EMSAs to detect PCADM-1 in nuclear extracts of tissue biopsy samples.
  • another aspect of the present invention relates to methods and kits for detection of PCADM-1 in biological samples.
  • detection of PCADM-1 levels in a biological sample of a patient is useful in diagnosing and prognosticating prostate cancer or other cancers in the patient
  • a biological obtained from a patient is contacted with a means for detecting PCADM-1 in the biological sample.
  • This means can comprise an antibody raised against the PCADM-1 protein, which is capable of detecting PCADM-1 protein in biological samples such as tissue, sputum, urine and serum.
  • this means can comprise a labeled nucleic acid probe such as CACGGATG, which is capable of detecting PCADM-1 protein in biological samples such as tissue biopsies.
  • kits of the present invention a means for detecting pCADM-1 protein in a sample and a PCADM-1 protein standard is provided.
  • Means for detecting PCADM-1 protein may comprise an antibody raised against the PCADM-1 protein.
  • the presence of PCADM-1 in the biological sample is indicative of the patient having prostate cancer.
  • kits of the present invention can also be used in patients with prostate cancer to assess their prognosis and evaluate treatments by monitoring changes in levels of PCADM-1 in the patient over time. Increases in the level of PCADM-1 over time is indicative of the cancer progressing while decreases in the level of PCADM-1 over time is indicative of regression of the cancer.
  • kits, for detecting PCADM-1 protein levels may also be useful in diagnosing and prognosticating other types of cancer, inflammatory conditions, infections and genetic mutations.
  • Example 3 Modulation of PCADM-1 expression using enzymatic nucleic acids and treatment of diseases, disorders or conditions associated with PCADM-1 expression
  • the prostate cancer antigen diagnostic marker 1 is a 33 kDa cytoplasmic protein, which, as more fully disclosed elsewhere previously herein, is over-expressed in human prostate cancer tissue and is detected in the urine of patients afflicted with prostate cancer. Without wishing to be bound by any particular theory, expression of PCADM-1 can convey a selective growth and/or survival advantage to tumor cells and/or cause chromosomal alteration(s), which lead to the development of prostate cancer or other cancers.
  • the data disclosed elsewhere herein suggest that increased expression of PCADM-1, compared with the level of expression in a tissue known not to have a disease or condition, is correlated with, associated with, and/or can mediate a disease or condition, e.g., prostate cancer. Therefore, therapeutic strategies based on modulation of PCADM-1 expression, which can potentially inhibit or reduce the aberrant ( i.e. , increased) expression of PCADM-1, were examined as potential anti-cancer therapies.
  • the data disclosed herein demonstrate the use of a PCADM-1 specific PCADM-1 DNAZYM, designated pCADM-1 DNAZYM-1 (SEQ ID NO:9), to inhibit PCADM-1 expression and the significant therapeutic effects related thereto.
  • Targets for useful DNA enzyme can be determined as disclosed in Draper et al., WO 93/23569 ; Sullivan et al., WO 93/23057 ; Thompson et al., WO 94/02595 ; Draper et al., WO 95/04758 ; McSwiggen et al., U.S. Pat. No. 5,525,468 . Rather than repeat the guidance provided in those documents here, below are provided specific examples of such methods, not limited to those in the art or to be developed in the future.
  • DNAZYMs to such target mRNAs were designed as described in those applications and were synthesized to be tested in vitro and in vivo, as also described in standard treatises. DNAZYMs can also be optimized and delivered as described therein.
  • PCADM-1 DNAZYM target sites were selected by analyzing cDNA sequences of human PCADM-1 and prioritizing the cleavage sites on translational initiation site of PCADM-1 gene.
  • PCADM-1 DNAZYMs were designed that could bind each target and were individually analyzed by computer folding ( Christoffersen et al., 1994 J. Mol. Struc. Theochem. 311:273 ; Jaeger et al., 1989, Proc. Natl. Acad. Sci.
  • PCADM-1 DNAZYMs with unfavorable intramolecular interactions between the binding arms and the catalytic core were eliminated from consideration.
  • varying binding arm lengths can be chosen to optimize activity. Generally, at least 8 to 10 bases on each arm flanking a catalytic core are sufficient for binding to, or otherwise interacting with, the target mRNA.
  • DNAZYM uptake was mediated by passive diffusion of the anionic nucleic acid across the cell membrane.
  • efficacy can be greatly enhanced by directly coupling a ligand to the DNAZYM.
  • the DNAZYMs can be delivered to the cells by receptor-mediated uptake. Using such conjugated adducts, cellular uptake can be increased by several orders of magnitude without having to alter the phosphodiester linkages necessary for PCADM-1-DNAZYM cleavage activity.
  • DNAZYMs can be administered to cells using a variety of methods known to those familiar to the art, including, but not restricted to, antennapae peptide coupled DNAZYM delivery, encapsulation in liposomes, by ionophoresis, or by incorporation into other vehicles, as well as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
  • the DNA/vehicle combination is delivered locally by direct injection or by use of a needle, catheter, infusion pump or stent
  • Alternative routes of delivery include, but are not limited to, intramuscular injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of DNAZYM delivery and administration are provided in Sullivan, et al., WO 93/23057 , and Draper et al., WO 95/04818 .
  • PCADM-1 DNAZYM sequences and PCADM-1 DNAZYM-1 motifs described in this invention are meant to be non-limiting examples, and those skilled in the art will recognize that other modifications (base, sugar and phosphate modifications) to enhance nuclease stability of a PCADM-1 DNAZYM can be readily generated using standard techniques.
  • the data disclosed herein demonstrate that increased expression of PCADM-1 is associated with prostate cancer. Further, the data disclosed herein demonstrate that inhibition of PCADM-1 expression (for example using DNAZYMs) reduced cell proliferation of a number of prostate tumor cell lines, both in vitro and in vivo . Further, the data disclosed herein demonstrate that inhibition of PCADM-1 expression, such as, but not limited to, using a DNAZYM, reduce the proliferative potential of prostate tumor cell lines, while inducing cell death ( i.e., greater than about 80% PC-3 ML cell death by 48-72 hours) ( Figure 4 ).
  • DNAZYMs represent a potent and safe therapeutic molecule for the treatment of cancer.
  • PCADM-1 DNAZYM-1 did not inhibit smooth muscle, fibroblast, or normal prostate epithelial cell survival or proliferation.
  • PCADM-1 DNAZYM-1 was administered as a single agent, i.v. via the tail vein
  • PCADM-1 DNAZYM-1 can be delivered in a similar fashion to cancer cells in patients and can inhibit their proliferation and survival and metastases.
  • a PCADM-1 DNAZYM-1 can be used in conjunction with existing cancer therapies and physical treatments (e.g., cryoablation and radiation treatment), or by itself, to improve overall patient survival rates.
  • the data disclosed herein demonstrate that administering DNAZYMs that specifically cleave RNA encoding other proteins, e.g., VEGF-1 and MMP-2, further increased the therapeutic effect of administering PCADM-1 DNAZYM with localized delivery.
  • the present example encompasses methods where PCADM-1 DNAZYMs are co-administered with other DNA enzymes that cleave RNAs encoding proteins such as growth factors and the like.
  • DNAZYMs provide diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of PCADM-1 RNA in a cell, tissues or body fluids.
  • the close relationship between DNAZYM activity and the structure of the target RNA allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA.
  • DNAZYM targeting the PCADM-1 mRNA one can map nucleotide changes which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with DNAZYMs can be used to inhibit gene expression and define the role of specified gene products in the progression of disease.
  • RNAs associated with PCADM-1 related condition include detection of the presence of mRNAs associated with PCADM-1 related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a PCADM-1 DNAZYMs using standard methodology.
  • anti-S2 antibodies can be used as a diagnostic agent for prostate cancer in an antibody-based assay
  • Antibodies to the S2 protein described in the present specification can be produced according to methods well-known to those of skill in the art.
  • Anti-S2 antibodies can be used in an antibody-based urine assay for prostate cancer, wherein the anti-S2 antibody is used to detect PCADM-1, as more fully set forth elsewhere herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Urology & Nephrology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Claims (11)

  1. Anticorps qui se lie spécifiquement à un PCADM-1 de mammifère, dans lequel ledit PCADM-1 de mammifère partage une identité de séquence d'au moins 99 % avec la séquence d'acides aminés de la SEQ ID NO : 2.
  2. Anticorps selon la revendication 1, lequel anticorps est choisi dans l'ensemble constitué par un anticorps polyclonal, un anticorps monoclonal, un anticorps humanisé, un anticorps chimère, et un anticorps synthétique.
  3. Composition comprenant un anticorps selon la revendication 1 ou 2 et un véhicule pharmaceutiquement acceptable.
  4. Utilisation d'un anticorps qui se lie spécifiquement à un PCADM-1 de mammifère pour la préparation d'un médicament destiné à traiter une maladie à médiation par une mal-expression d'un PCADM-1 chez un mammifère, dans laquelle ladite maladie est un cancer de la prostate, et dans laquelle ledit PCADM-1 de mammifère partage une identité de séquence d'au moins 99 % avec la séquence d'acides aminés de la SEQ ID NO : 2.
  5. Utilisation selon la revendication 4, dans laquelle ledit mammifère est choisi dans l'ensemble constitué par un humain et un chien.
  6. Procédé in vitro, lequel procédé in vitro est un procédé in vitro pour diagnostiquer un cancer de la prostate chez un mammifère, ledit procédé consistant à déterminer le niveau de PCADM-1 dans un échantillon biologique obtenu à partir dudit mammifère, et à comparer le niveau de PCADM-1 dans ledit échantillon biologique avec le niveau de PCADM-1 dans un échantillon biologique obtenu à partir d'un mammifère analogue non affligé d'un cancer de la prostate, dans lequel un niveau plus élevé de PCADM-1 dans ledit échantillon biologique provenant dudit mammifère, comparé au niveau de PCADM-1 dans ledit échantillon biologique provenant dudit mammifère analogue, est une indication du fait que ledit mammifère est affligé d'un cancer de la prostate, de façon à diagnostiquer un cancer de la prostate chez ledit mammifère, dans lequel ledit PCADM-1 a une séquence qui partage une identité de séquence d'au moins 99 % avec la séquence d'acides aminés de la SEQ ID NO : 2.
  7. Procédé in vitro, lequel procédé in vitro est un procédé in vitro pour diagnostiquer un cancer de la prostate chez un mammifère, ledit procédé consistant à déterminer le niveau d'un anticorps qui se lie spécifiquement à PCADM-1 dans un échantillon biologique obtenu à partir dudit mammifère, et à comparer le niveau d'anticorps qui se lie spécifiquement à PCADM-1 dans ledit échantillon biologique avec le niveau d'anticorps qui se lie spécifiquement à PCADM-1 dans un échantillon biologique obtenu à partir d'un mammifère analogue non affligé d'un cancer de la prostate, dans lequel un niveau plus élevé d'anticorps qui se lie spécifiquement à PCADM-1 dans ledit échantillon biologique provenant dudit mammifère, comparé au niveau d'anticorps qui se lie spécifiquement à PCADM-1 dans ledit échantillon biologique provenant dudit mammifère analogue, est une indication du fait que ledit mammifère est affligé d'un cancer de la prostate, de façon à diagnostiquer un cancer de la prostate chez un mammifère, et dans lequel ledit PCADM-1 a une séquence qui partage une identité de séquence d'au moins 99 % avec la séquence d'acides aminés de la SEQ ID NO : 2.
  8. Procédé selon la revendication 6 ou 7, dans lequel ledit mammifère est choisi dans l'ensemble constitué par un humain et un chien.
  9. Kit pour utilisation dans le soulagement d'une maladie à médiation par une mal-expression d'un PCADM-1 chez un mammifère, ledit kit comprenant un anticorps selon la revendication 1, ledit kit comprenant en outre un applicateur, et un matériel didactique pour son utilisation, et dans lequel ladite maladie est un cancer de la prostate.
  10. Kit pour utilisation dans le traitement d'une maladie à médiation par une mal-expression d'un PCADM-1 chez un mammifère, ledit kit comprenant un anticorps selon la revendication 1, ledit kit comprenant en outre un applicateur, et un matériel didactique pour son utilisation, et dans lequel ladite maladie est un cancer de la prostate.
  11. Kit pour déterminer le niveau de PCADM-1 dans un échantillon, ledit kit comprenant un anticorps qui se lie spécifiquement à PCADM-1, ledit PCADM-1 partageant une identité de séquence d'au moins 99 % avec la séquence d'acides aminés de la SEQ ID NO : 2, ledit kit comprenant en outre un applicateur, et un matériel didactique pour son utilisation.
EP20030733941 2002-05-07 2003-05-07 Compositions associées au cancer the la prostate, procédés et trousses dérivés de plate-formes protéomiques à haute densité d'adn Expired - Lifetime EP1507787B1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US10/140,602 US7790861B2 (en) 1999-09-24 2002-05-07 Prostate cancer-related compositions, methods, and kits based on DNA macroarray proteomics platforms
US140602 2002-05-07
PCT/US2003/014098 WO2003094844A2 (fr) 2002-05-07 2003-05-07 Compositions associees au cancer de la prostate, procedes et trousses fondes sur des plates-formes proteomiques de jeux ordonnes de macro-echantillons

Publications (3)

Publication Number Publication Date
EP1507787A2 EP1507787A2 (fr) 2005-02-23
EP1507787A4 EP1507787A4 (fr) 2006-04-19
EP1507787B1 true EP1507787B1 (fr) 2011-11-23

Family

ID=29418388

Family Applications (1)

Application Number Title Priority Date Filing Date
EP20030733941 Expired - Lifetime EP1507787B1 (fr) 2002-05-07 2003-05-07 Compositions associées au cancer the la prostate, procédés et trousses dérivés de plate-formes protéomiques à haute densité d'adn

Country Status (8)

Country Link
US (1) US7790861B2 (fr)
EP (1) EP1507787B1 (fr)
JP (2) JP2006518182A (fr)
AT (1) ATE534654T1 (fr)
AU (1) AU2003239357B2 (fr)
CA (1) CA2484845A1 (fr)
RU (1) RU2004133036A (fr)
WO (1) WO2003094844A2 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007035766A2 (fr) * 2005-09-19 2007-03-29 The Johns Hopkins University Biomarqueur servant a detecter un cancer de la prostate
JP2007222160A (ja) * 2006-01-26 2007-09-06 National Institute Of Advanced Industrial & Technology 生体由来試料中の蛋白質の解析方法
JP2010540534A (ja) 2007-09-28 2010-12-24 イントレキソン コーポレーション 生体治療分子の発現のための治療遺伝子スイッチ構築物およびバイオリアクター、ならびにその使用
CN101469348B (zh) * 2008-08-29 2011-07-20 苏州福英基因科技有限公司 一种前列腺癌症早期的原位杂交检测试剂盒及其检测方法和应用
AU2016261770B2 (en) * 2015-05-12 2022-06-02 Drexel University Compounds and compositions useful for treating or preventing cancer metastasis, and methods using same
CN108659062B (zh) * 2018-04-18 2021-06-22 中国农业科学院兰州畜牧与兽药研究所 唾液酸寡糖-磁纳米酶及其制备方法和应用

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763209A (en) 1988-09-26 1998-06-09 Arch Development Corporation Methods and materials relating to the functional domains of DNA binding proteins
US5578444A (en) 1991-06-27 1996-11-26 Genelabs Technologies, Inc. Sequence-directed DNA-binding molecules compositions and methods
US6066452A (en) 1997-08-06 2000-05-23 Yale University Multiplex selection technique for identifying protein-binding sites and DNA-binding proteins
US20020042062A1 (en) * 1999-09-24 2002-04-11 Mark Stearns Prostate cancer-related compositions, methods, and kits based on DNA macroarray proteomics platforms
WO2001021828A1 (fr) * 1999-09-24 2001-03-29 Philadelphia, Health And Education Corporation Proteine de marquage pcam-1, sequences d'acide nucleique codant pcam-1 et immuno-essais de detection de pcam-1
AU2001234944A1 (en) * 2000-02-03 2001-08-14 Hyseq, Inc. Novel nucleic acids and polypeptides
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
US7749695B2 (en) * 2003-03-03 2010-07-06 Alexander Abbas PRO polypeptides for diagnosis of systemic lupus erythematosis

Also Published As

Publication number Publication date
EP1507787A4 (fr) 2006-04-19
RU2004133036A (ru) 2005-06-27
AU2003239357A1 (en) 2003-11-11
ATE534654T1 (de) 2011-12-15
CA2484845A1 (fr) 2003-11-20
JP2010131022A (ja) 2010-06-17
AU2003239357B2 (en) 2010-05-20
WO2003094844A2 (fr) 2003-11-20
EP1507787A2 (fr) 2005-02-23
WO2003094844A3 (fr) 2004-09-10
JP2006518182A (ja) 2006-08-10
US20030100033A1 (en) 2003-05-29
US7790861B2 (en) 2010-09-07

Similar Documents

Publication Publication Date Title
US8206899B2 (en) Prostate cancer-related compositions, methods and kits based on DNA microarray proteomics platforms
JP4404381B2 (ja) Ｐｓｃａ：前立腺幹細胞抗原
US7557204B2 (en) CUDR as biomarker for cancer progression and therapeutic response
JP5603145B2 (ja) 疾患のイメージング、診断、及び治療
US20020051990A1 (en) Novel gene targets and ligands that bind thereto for treatment and diagnosis of ovarian carcinomas
AU2003222103A8 (en) Novel gene targets and ligands that bind thereto for treatment and diagnosis of colon carcinomas
CA2504419A1 (fr) Recepteurs wnt et frizzled utilises comme cibles en immunotherapi e contre un carcinome spinocellulaire cervico-facial
JP2007525196A5 (fr)
JP2002508963A (ja) ヒトケモカインおよび乳房疾患の検出と治療へのその利用
WO2007137279A2 (fr) Antigènes du herv-k, anticorps et méthodes
JP2010131022A (ja) Ｄｎａマクロアレイプロテオミクスプラットフォームに基づく前立腺癌関連組成物、方法およびキット
US7351811B2 (en) Gene SCC-112 and diagnostic and therapeutic uses thereof
US6884619B2 (en) Inhibition of BEHAB cleavage and primary central nervous system (CNS) tumors
US20030211521A1 (en) Breast cancer antigen
US20080089895A1 (en) Use of T-cell immune response cDNA 7 (TIRC7) in angiogenic and anti-angiogenic therapy
US7754435B2 (en) Prostate cancer-related compositions, methods, and kits based on DNA macroarray proteomics platforms
JP4190291B2 (ja) 癌細胞の増殖を調節するのに有用なポリヌクレオチド
US20240239857A1 (en) Il-13ralpha2 targeted immunotoxins and methods of use
US20040087772A1 (en) Xage-1, a gene expressed in multiple cancers, and uses thereof
US20030207339A1 (en) PCAM-1 marker protein, nucleic acid sequences encoding PCAM-1 and immunoassays for detection of PCAM-1
JPH10146195A (ja) 良性前立腺肥大と関連するポリヌクレオチドおよびポリペプチド
AU2002318241B2 (en) Inhibition of behab cleavage and primary central nervous system (CNS) tumors
US20030049651A1 (en) Tumor associated proteins
ES2303595T3 (es) Moleculas marcadoras asociadas con tumores pulmonares.
US20060089493A1 (en) Novel gene targets and ligands that bind thereto for treatment and diagnosis of colon carcinomas

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041207

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1072057

Country of ref document: HK

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20060308

17Q First examination report despatched

Effective date: 20060913

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1072057

Country of ref document: HK

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 60339204

Country of ref document: DE

Effective date: 20120126

REG Reference to a national code

Ref country code: NL

Ref legal event code: VDEP

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20120224

Ref country code: BE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20120323

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20120223

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 534654

Country of ref document: AT

Kind code of ref document: T

Effective date: 20111123

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20120824

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 60339204

Country of ref document: DE

Effective date: 20120824

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120531

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120531

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120531

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120507

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20120305

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20111123

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120507

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20030507

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 14

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20220324

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20220408

Year of fee payment: 20

Ref country code: DE

Payment date: 20220329

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60339204

Country of ref document: DE

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20230506

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230506