EP1490112A1

EP1490112A1 - Method and agent for producing therapeutically active blood compositions

Info

Publication number: EP1490112A1
Application number: EP03727267A
Authority: EP
Inventors: Hans Meijer; Julio Reinecke; Peter Wehling
Original assignee: Orthogen AG
Current assignee: Orthogen AG
Priority date: 2002-03-22
Filing date: 2003-03-21
Publication date: 2004-12-29
Also published as: WO2003080122A1; DE10213780A1; JP2005529857A; AU2003233947A1

Abstract

The invention relates to a method for producing induced blood compositions from blood, whereby the blood cells, in a transient or stable manner, express and optionally secrete one or more therapeutically and/or diagnostically significant proteins and/or effector molecules.

Description

Methods and agents for the preparation of therapeutically effective blood compositions

description

The invention essentially relates to methods for producing induced blood compositions from blood, the blood cells transiently or stably expressing and possibly secreting one or more therapeutically or diagnostically important proteins and / or effector molecules.

The production of eukaryotic, recombinant proteins is complex and expensive. The correct processing of such proteins is also problematic. The strength of the therapeutic effect of the proteins is strongly dependent on the processing of these proteins. Conventional recombinant proteins show a lack of effectiveness due to incorrect processing, for example the lack of glycosylation. The correct processing of the recombinant proteins increases the therapeutic effectiveness many times over.

It is very complex to produce recombinant proteins without contaminants. However, the degree of purity plays an important role in their effectiveness and in avoiding side effects. Recombinant proteins produced in a conventional manner can lead to intolerance reactions, in particular due to the impurities contained in the protein preparations themselves and through possible reactions of the organism, in particular immune reactions, to the proteins and / or the Impurities. The aim is therefore to provide recombinant proteins obtained from, in particular autologous, cells of the animal or human body, which are also readily available.

So far, the transfection of various specific fractions of blood cells is known. Van Tendeloo et al., (Gene Therapy (2000) 7: 1431-1437) describe systems for gene transfer into primary human blood cells by means of electroporation, wherein human T-lymphocytes and / or adult bone marrow cells of the CD34 ⁺ type are activated as blood cells in their cultured form can be transfected by electroporation. In each case before the transfection, the T-lymphocytes are activated by the use of PHA or by CD3 “cross linking” and by interleukin-2 before the transfection. Harrison et al. (BioTechniques (1995) 19: 816-823) also describe this Gene transfer using cationic lipids in cell lines or in primary human cells, in particular mononuclear cells of peripheral blood and / or CD34 ⁺ -enriched hematopoietic cells.

Alternative methods for transfecting eukaryotic cells, for example by primarily mechanical stress, have been described. Costanzo and Fox (Genetics (1988) 120: 667-670) describe the transformation of yeast cells with plasmid DNA and small glass beads (“glass beads”) in YPD medium. The glass beads are used to mechanically “rub” the cells, which facilitates the penetration of the plasmid DNA into the yeast cells.

Starting from the prior art, the technical problem on which the present invention is based is that Development of methods and means for their implementation, which make it possible to obtain eukaryotic, therapeutically and / or diagnostically important proteins, in particular autologous proteins, from blood cells, in particular autologous blood cells.

The technical problem is essentially solved by a transient, genetic transformation of blood cells, the preferably subsequent cultivation of these cells in the serum and the preferred subsequent application of the protein produced in the serum, in particular without purification: According to the invention, the problem is solved by a method for producing a Induced blood composition dissolved from blood, wherein blood cells containing blood, in particular in whole blood, that is to say in the unpurified and / or fractionated blood, are transient, that is to say limited for a certain period of time, or stable, that is to say permanently, with at least one nucleic acid molecule , in particular DNA or RNA, are transformed. According to the invention, the at least one nucleic acid molecule preferably encodes at least one gene product, preferably a protein, particularly preferably a therapeutically and / or diagnostically important protein and / or at least one effector molecule, for example an effector protein, or preferably at least one nucleic acid molecule, in particular RNA, which is the therapeutic or serum concentration diagnostically relevant proteins modulated, preferably increased. In a further step of the method according to the invention, an induced blood composition is thus obtained which comprises at least one transformed blood cell which transiently or stably expresses the at least one gene product, in particular a therapeutically and / or diagnostically important protein and / or effector molecule, and this preferably optionally releases, that is, secretes, and, in particular in a further step, the at least one gene product, preferably the therapeutically and / or diagnostically important protein and / or effector molecule and / or at least one effector molecule-regulated therapeutically and / or from the induced blood composition or diagnostically important protein is obtained.

It is particularly advantageous here that the use of blood as a raw material on the one hand and as a production system for the at least one gene product on the other hand, preferably together with an application of the at least one preferably produced protein, is particularly simple and inexpensive, particularly in serum. It also shows that the eukaryotic blood cells process the proteins correctly. In addition, particularly advantageously, no contaminants or other immunogenic components occur in the production system according to the invention, which is preferably autologous or heterologous, which could lead to intolerance reactions in a recipient of the gene product. When using an effector molecule obtained according to the invention, that is to say a gene product which in particular modulates, preferably increases, the serum concentration of therapeutically and / or diagnostically important proteins, the blood composition particularly advantageously contains only autologous, that is to say from the donor, and therapeutically and / or diagnostically important proteins. An immunological reaction upon application, preferably re-application, of the blood composition thus produced can therefore be practically ruled out. If at least one effector molecule, in particular effector protein, coding nucleic acid molecule or effector molecule, which stimulates the production of a large number, preferably any, of proteins, is used for the transformation according to the invention, it is particularly advantageous that the production and / or release of several, preferably autologous, proteins simultaneously is stimulated in the blood cells. In particular, the proteins are produced and / or released in a natural quantitative relationship to one another. Examples of such effector molecules are transcription factors, proteins which are part of the signal transduction chain, extracellular signal molecules such as cytokines or anti-sense RNAs. Since many diseases have multifactorial causes, the, in particular simultaneous, production of several therapeutically active proteins in an individual, physiological ratio of the proteins to one another is particularly advantageous for the use of these proteins as active substances, in particular in a pharmaceutical composition for the treatment of the animal or human body ,

In a special embodiment of the method according to the invention, the blood composition induced according to the invention has at least one therapeutically and / or diagnostically important protein in a higher concentration than an untransformed blood composition. According to the invention, therapeutically and / or diagnostically important proteins such as cytokines, such as the natural or modified interleukin-1 receptor antagonist, IL-1 Ra, (IRAP) are preferred. According to the invention, at least one effector molecule, in particular effector protein, is preferably expressed in at least one blood cell of the blood composition induced according to the invention, which is not expressed at all in non-transformed blood cells or in an amount which is less than the amount which of the at least one, the effector molecule, in particular Effector protein, expressing blood cell of the blood composition induced according to the invention is produced.

In a further preferred embodiment of the method according to the invention, the blood for producing the induced blood composition is taken from an organism, in particular a human or animal body, patients or test subjects with at least one withdrawal system, preferably a syringe. According to the invention, the blood is preferably transformed with the at least one nucleic acid molecule within the syringe, the blood cells to be transformed not being separated beforehand from other blood components of the blood drawn, that is to say fractionated. In a variant of the method according to the invention, the blood is withdrawn with at least one withdrawal system, preferably with a syringe, and then filled into at least one further vessel. According to the invention, the blood withdrawn is preferably transformed in this at least one further vessel, preferably without first separating the blood cells to be transformed from other blood components, ie as non-fractionated blood, in particular as whole blood. In a variant, blood cells, in particular nuclear cells such as mononuclear cells, PBMC, are separated from other blood components from the blood drawn, and the blood cells are transformed and stored in medical to with or without serum, in particular autologous serum, preferably autologous serum, which was obtained as an isolated blood component in the above-mentioned separation, ie fractionation, or in pure, that is to say undiluted, serum, in particular pure, autologous serum, preferably pure , autologous serum, which was obtained as an isolated blood component in the above-mentioned separation.

According to the invention, the at least one nucleic acid molecule to be transformed is preferably contained in a vector, for example in a plasmid or in a virus.

According to the invention, the at least one nucleic acid molecule to be transformed is preferably functionally linked to at least one regulatory element, for example a promoter, enhancer or intron, in particular at least one blood cell-specific regulatory element. In one variant, the at least one nucleic acid molecule to be transformed is functionally linked to at least one nucleotide section encoding a signal peptide for protein secretion from the cell.

According to the invention, the nucleic acid molecule to be transformed, in particular DNA or RNA, is preferably labeled with at least one marker substance. In a variant, this marker substance is used to remove excess, that is to say untransformed, DNA after the transformation process has been completed.

According to the invention, the nucleic acid molecule to be transformed, in particular DNA or RNA, is preferred together with at least at least one further substance, which modulates, preferably increases, the transfection rate and / or the expression rate of the nucleic acid molecule to be transformed. According to the invention, the further substance preferably fulfills at least one of the following functions: a) recognition of the surfaces of specific cell types in order to specifically transform these cells, b) increasing the absorption efficiency of the nucleic acid molecule to be transformed into the cell, c) optimization of the nuclear transport of the nucleic acid molecule to be transformed, d) increasing the transcription efficiency of the transgene in the transformed cell.

In a particularly preferred embodiment of the method according to the invention, the at least one nucleic acid molecule to be transformed, in particular DNA or RNA, is immobilized on at least one solid support, in particular large or small balls, for example made of glass, on magnetic balls and / or on the wall of the Vessel in which the transformation takes place, in particular the syringe, is used for the transformation.

Transfection with spheres, preferably micro-glass spheres (“bead transfection”) is a system in which spheres, preferably glass spheres, are coated (“coated”) with nucleic acid molecules, preferably with plasmid DNA. In connection with the present invention, “micro-glass spheres” or “glass spheres” are not only understood to mean glass spheres made of glass, but also spheres made of other materials which are comparable in function to glass, in particular nucleic acid molecules that are covalent and / or non-covalent - You can, for example polymeric plastics such as polyethylene, polypropylene, polystyrene, polytetrafluoroethylene, polyacrylates, polyamides, polycarbonates, polyimides, polyacetates, polyolefins, silicones, polysilanes, latex and the like and / or mixtures thereof. According to the invention, the balls are preferably also designed as magnetic balls. The size of the balls or granulate particles is preferably between 2 and 4 mm in diameter, although smaller particles, in particular larger than 100 μm, can also be used. for example glass powder.

During the adherence of the cells to these spheres, nucleic acid molecules, in particular DNA or RNA, preferably plasmid DNA, are taken up in the cells, reach the cell nucleus and are expressed there. According to the invention, nucleic acid molecules on a solid support, for example on the large or small glass spheres and / or on the surface of the sampling system, preferably in the form of a syringe, and / or on other vessels containing blood or separated blood fractions To be brought in contact. Nucleated blood cells from the blood drawn adhere specifically to this carrier, as in the case of larger spheres, and / or phagocytize this carrier, as in the case of smaller spheres.

The balls are coated with the nucleic acid molecules preferably in a covalent or non-covalent manner. A covalent, especially an acid-labile covalent, bond is particularly effective when the carrier is broken up by phagocytosis. be taken. Non-covalent binding is particularly effective if the DNA is taken up after adherence.

Electroporation is provided as an alternative and / or additional transformation method. In a further preferred embodiment of the method according to the invention, the at least one nucleic acid molecule to be transformed, in particular DNA or RNA, is therefore transformed by electroporation of the blood cells to be transformed. In a preferred embodiment, the nucleic acid molecule to be transformed contains at least one nucleic acid molecule which induces, represses and / or regulates the expression of the body's own proteins, for example at least one antisense construct, RNA element, transposable element, transcription factor, in particular it consists of this.

When applying specific electrical fields, cells are transfected from a certain size depending on the selected electrical parameters. It is intended to transform nuclear blood cells in particular with the aid of electroporation; this happens in particular without prior purification of the nucleated blood cells from the blood. This means that coronary blood cells are transformed particularly advantageously in whole blood. It is envisaged to use “naked” DNA, which may be labeled, for example with, during the electroporation

Biotin to remove excess, that is, untransformed, DNA

To be able to remove the completion of the transformation process.

In a particularly preferred embodiment of the method according to the invention, after the transformation, the ex- Pression of the at least one transgenic gene product, in particular the therapeutically and / or diagnostically important protein and / or effector in the at least one transgenic blood cell and the secretion from the blood cell into the serum, the at least one blood cell and optionally at least one further non-transformed blood cell from the induced blood composition separated from the serum and an induced, preferably cell-free, serum obtained.

According to the invention, the nucleic acid molecule to be transformed is particularly preferably transformed with the aid of liposomes, viral vectors or bound to large and / or small spheres, in particular microglass spheres, in particular if appropriate the at least one nucleic acid molecule to be transformed being acid-labile to the large and / or small spheres is bound.

The present invention also relates to a method for transforming at least one cell, in particular in the blood, for example blood cells, with at least one nucleic acid molecule, the cell and / or blood cells being brought into contact with the nucleic acid molecules, the cells and / or the blood cells present in the blood are transformed and cells or / and blood cells transformed in a stable or transient manner are obtained. According to the invention, the nucleic acid molecules to be transformed are preferably bound, in particular covalently, in particular acid-labile, to large and / or small balls, in particular microglass balls, before the transformation.

Another object of the invention is a method for treating the human or animal body, wherein the human or animal body blood, preferably by means of at least one syringe, and an aforementioned method according to the invention is carried out, in particular to produce an induced blood composition. According to the invention, the induced blood composition is re-applied to, preferably the same, human or animal body, preferably reapplied. Preferably, essentially only the induced blood serum, in particular after separation of the blood cells and / or other blood components, in particular corpuscular components such as erythrocytes and / or fibrinogen, is applied to the human or animal body. In a variant of this method according to the invention, the induced blood composition or the induced blood serum is not re-applied in the same animal or human body, but rather is applied in another animal or human body.

Another object of the invention is the use of large and / or small spheres such as microglass beads, to which nucleic acid molecules are bound, preferably covalently, preferably acid-labile, for the transformation of blood, preferably of nuclear cells from blood, in particular in whole blood. According to the invention, preference is given to the use for the expression and secretion of proteins and / or effectors in the blood, in particular in blood cells. Another object of the invention is therefore also the use for the transformation of biological cells, in particular eukaryotic cells, particularly preferably plant, fungal or animal cells such as mammalian cells, in particular human cells. Finally, another subject of the invention is the use of blood, in particular whole blood, for the transformation of nucleic acid molecules encoding at least one therapeutically and / or diagnostically important protein and / or effector molecule, into at least one blood cell of the blood, in particular whole blood, for therapeutic, in particular gene therapy Purposes, preferably for gene therapy and / or the treatment of leukemia, the treatment of traumatic, degenerative, chronic inflammatory diseases of the nervous system, the musculoskeletal system or various internal organs. Another object of the invention is therefore the use of blood, in particular whole blood, for the production of pharmaceutical kits, in particular from an induced blood composition and / or induced serum produced according to the invention, for the aforementioned therapeutic purposes. Another object of the invention is also the use of nucleotide molecules, in particular coding for at least one therapeutically and / or diagnostically important protein and / or effector molecule, for the transformation of blood, in particular of at least one blood cell contained in the blood, and the expression and, if appropriate, secretion at least one therapeutically and / or diagnostically important protein and / or effector molecule for the aforementioned therapeutic purposes. Another object of the invention is the use of these nucleotide molecules, in particular coding for therapeutically and / or diagnostically important proteins and / or effector molecules, for the production of a pharmaceutical kit for this transformation. According to the invention, the pharmaceutical production of the at least one, in particular therapeutically and / or diagnostically significant, preferably autologous protein, preferably takes place by the patient's own blood cells and the subsequent autologous therapeutic application. As an alternative to this, transformation and incubation of the blood cells directly after the removal of the whole blood in a collection system, the processing and application of the serum are provided. Especially when the transformation after separation of blood components or the purification of mononuclear peripheral blood cells, PBMCs ("peripheral blood mononuclear cells").

the transformation is preferably carried out a) without growth induction with, for example, mitogenic or growth-stimulating substances such as interleukin-2 (IL-2) or b) with growth induction with, for example, mitogenic or growth-stimulating substances such as IL-2.

After the growth induction and the transformation, preferably with the aid of liposomes or by means of electroporation, it is provided that the cells are grown further without or with further growth induction. It has been shown that, in particular, the use of electrical fields, in particular in electroporation, stimulates cell growth and / or cell development. Electrostimulation is therefore also intended as an alternative to known growth-stimulating substances.

For the removal of the non-transformed nucleic acid molecules, in particular DNA and RNA, after transformation, in particular the removal of the DNA from human serum after incubation The following methods are essentially provided according to the invention: In a preferred variant, the nucleic acid molecules to be transformed are coupled to a support, the serum being centrifuged after the incubation, and the serum which contains the desired proteins removed and filtered after the centrifugation is used to remove the last carrier and cell residues, the untransformed nucleic acid molecules being removed together with the carriers. In a further variant, labeled nucleic acid molecules are used, additives, in particular carriers, which have an affinity for the labeled nucleic acid molecules being added to the serum after the incubation. In the case of nucleic acid molecules preferably labeled with biotin according to the invention, carriers coated with streptavidin are used which bind the biotin-labeled molecules. The carriers are then removed from the serum by means of centrifugation and / or, in the case of magnetic carriers, by means of magnetism, the non-transformed nucleic acid molecules bound to the carrier being removed from the serum. In a further variant, the serum with the untransformed nucleic acid molecules contained therein is purified by means of at least one filter which has an affinity for the nucleic acid molecules. For example, nucleic acid molecules labeled with biotin bind to a filter coated with streptavidin. In this variant, both cell residues and excess, non-transformed nucleic acid molecules are particularly advantageously removed from the serum in a single step.

The invention is described in more detail with reference to the following examples and figures. The figures show:

FIG. 1 shows the IL-1β content in the blood cell culture after the pyrogenicity test of the plasmid pcDNA-IL-1Ra,

FIG. 2 shows the dependence of the DNA binding on glass spheres on the pH of the buffer,

FIG. 3 shows the dependence of the DNA binding on glass balls on the incubation time in DNA-containing buffer,

Figure 4 - an agarose gel (2%) after PCR on a dilution series of pcDNA-IL-1 Ra in TE and on ball wash water, ethidium bromide staining. The arrows show the comparable dilution levels,

FIG. 5 - an agarose gel (2%) after the PCR on a dilution series of pcDNA-IL-1 Ra in human serum, ethidium bromide staining, the control contains no “template” DNA (“water control”),

FIG. 6 - an agarose gel (2%) after a “nested” PCR on a dilution series of pcDNA IL-1Ra in human serum, ethidium bromide staining, the control contains no “template” DNA (“water control”),

FIG. 7 - an agarose gel (2%) after PCR on a dilution series of pcDNA-IL-1Ra in human serum, sample material of the syringe system according to the invention with “bead transfection” and the ORTHOKIN® system, staining using ethidium bromide, FIG. 8 shows the IL-1 Ra content after “bead transfection” in the blood cell culture,

FIG. 9 shows the IL-1Ra content in the serum supernatant after 24 hours of incubation of whole blood, comparison of the syringe system according to the invention with “bead transfection” with the ORTHOKIN® system, a perfusor syringe without balls and with the zero sample,

FIG. 10 shows a representation of the specific activity of the β-galactosidase after electroporation of PBMCs with pVaxLacZ,

Figure 11 - a schematic representation of a syringe (1) according to the invention made of glass or plastic with a plunger (3), an optionally screwable closure (5), a closure attachment (13) and a removable cap (7) arranged thereon and closing it septum. The stamp (3) preferably has a predetermined breaking point (15). Granulate (9) coated according to the invention is also shown in the lumen of the syringe.

Example 1: Transformation of a blood cell culture with the aid of DNA-coated microglass beads (“bead transfection”).

a) Blood cell culture

Blood cell culture is a system that is mainly used in research and development. The blood cell culture is used to cultivate whole blood. This method is used for "bead transfection" and for the toxicity test of DNA. For this purpose, a 48-well cell culture plate (Nunc, Wiesbaden) is prepared according to the experimental approach by introducing microglass beads for "bead transfection" or DNA for a toxicity test. Subsequently, non-coagulated whole blood is added to the wells, whereby approximately 1 ml per cavity are used for a 48-well plate, and part of the whole blood is centrifuged as a zero sample for about 5 minutes at 5000 xg, after which the supernatant is removed and placed in a cavity of a 96-well plate. The plate with the zero sample is closed and stored frozen at -80 ° C. The 48-well cell culture plate is also closed and incubated for about 24 hours at about 37 ° C. with 5% CO ₂ saturation and saturated air humidity. After the incubation, the serum supernatant of the samples in the 48-well cell culture plate is removed and likewise placed in the 96-well plate stored frozen at -80 ° C until analysis.

The interleukin-1ß content is determined in a toxicity test or pyrogenicity test; in the transfection experiments, the content of an expressed reporter or target protein is determined.

For approaches in other formats, the volumes are adjusted accordingly.

b) Production of the plasmid DNA ocDNA-IL-1Ra

The plasmid pcDNA-IL-1Ra contains at least one sequence which codes for a protein (“coding region”) and a control unit (“promoter”) which is active in eukaryotic cells. It consists of the coding region, the IL-1 Ra cDNA, in a pcDNA-1 vector (company Invitrogen, Karlsruhe). Plasmid DNA is isolated from bacterial suspensions using a commercially available system (Qiagen Maxiprep ™ endofree-Kit ™, from Qiagen) according to the manufacturer's protocol. All checks suggested by the manufacturer are carried out. The quality control of the isolated plasmid is carried out in a manner known per se by means of specific PCR, restriction digestion and toxicity test or pyrogenicity test in a blood cell culture.

c) Pyrogenicity test of the plasmid DNA pcDNA-IL-1Ra

The DNA used must be non-pyrogenic. In a blood cell culture (see a) with pyrogenic DNA, the IL-1β content was 2500 pg / ml on average. DNA is not considered to be pyrogenic or endotoxin-free if the IL-1ß content after incubation with the potential pyrogen is the lowest standard of the IL-1ß-ELISA test, namely 15.2 pg / ml. does not exceed. The results of the pyrogenicity test are shown in FIG. 1:

No increase in the IL-1β content can be detected when incubated with pcDNA-IL-1Ra. The IL-1ß concentrations of the serum supernatant of the dilution series of pcDNA-IL-1 Ra incubated in the blood cell culture are less than 15.2 pg / ml, the DNA is not pyrogenic.

d) coating of the glass balls

Plasmid DNA is bound to the surface of glass spheres under specific pH and salt conditions. Not all types of glass and

-Qualities can bind DNA non-covalently. In the following way it is determined whether the carriers are suitable for binding DNA non-covalently:

First, it is determined how many washing steps are required to remove all residues such as glass dust and dirt from the balls to be coated. Glass balls from Roth (Karlsruhe) with the following properties are normally used as balls:

Size 2.85 to 3.3 mm,

Chem. Composition:

Si0 ₂ 68%,

CaO 3%,

BaO 6%,

K ₂ 0 8%,

Na ₂ 0 10%,

Al ₂ 0 ₃ 1%,

B ₂ 0 ₃ 2%, lead-free.

For this purpose, the balls are washed several times in succession by filling them into a 50 ml tube and this with phosphate buffer with pH 5.5 (1/15 mol / l KH ₂ P0 ₃ , 1/15 mol / l Na ₂ HP0 ₃ ) is replenished. The balls are washed by inverting them several times; the liquid is then poured off again.

It is advantageous to prewash first at extremely low pH, ie between 0.01 and 2, or at extremely high pH, ie between 10 and 14, or only at high pH and then at low pH, or only at low pH and then at high pH to increase the degree of cleaning of the glass to achieve carriers. The washing times are between 2 minutes and 1 hour, preferably 30 minutes, per wash cycle. The treatment times with acid and / or alkali are between 2 minutes and 1 hour, preferably 30 minutes. At the same time, this acid or alkali treatment modifies the glass surface. This pretreatment or modification takes place through the use of conventional organic and / or inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, citric acid or acetic acid, etc. and preferably chromium-sulfuric acid, preferably 50% chromium-sulfuric acid (e.g. Merck, Darmstadt, order no . 1.02499.2500, Chromosulphuric acid is diluted with Biochrom Ultra Pure Water No. L 0040 to the desired dilution), or alkalis such as sodium hydroxide solution, potassium hydroxide solution, ammonia, etc.

The degree of contamination is determined by photometric measurement of the optical density (OD) at one or more wavelengths between 200 and 800, preferably at 280 nm (OD ₂ see above).

After 4 washing steps, the OD ₂ usually remains so constant (see Table 1), which shows that removable dirt particles have been removed from the glass balls.

Optionally, the balls are additionally washed with pure water, conductivity up to a maximum of about 1 μS, until the conductivity of the wash water again corresponds to the original conductivity. Then the washing step is repeated again. This step removes any residual ions that can adversely affect DNA binding and clinical use. A physiological solution such as PBS is ideally used as the binding buffer, because then the ionic strength and composition of the buffer should not be adapted for cell physiological or clinical use. A pH gradient is created with PBS in the pH range from 5 to 7 and the binding of the DNA to the glass balls is tested. For this purpose, the balls are washed between 1 and 10 times, preferably 4 times, with the respective buffer and incubated with pcDNA-IL-1Ra (10 μg / ml PBS) for 90 min. Before and after the individual steps, the purity of the spheres and the binding of the DNA are checked by means of OD measurement at 260 and 280 nm.

Table 1 shows typical results of an OD measurement after 4 washing steps to remove dirt particles from the glass balls.

Table 1 :

For the investigation of the DNA coating of the spheres, the spheres are washed four times with PBS (pH as indicated in the table) in order to saturate the spheres with the ions from the buffer and then with DNA-containing buffer for different Incubated time periods (30, 60, 90, 120, 150 and 180 min). Before and after the individual steps, an OD measurement at 260 and 280 nm is used to check whether all the dust particles have been removed and then how much DNA remains. The pH of the buffer, at which the largest amount of DNA binds to the spheres, is 5.5 (see FIG. 2). The incubation time at which the largest amount of DNA remains adhering is 1.5 hours (see FIG. 3).

Table 2 shows the results of the OD measurement for checking the washing steps and determining the DNA content in samples from the ball coating. Table 2:

The glass spheres for the further studies are filled in 50 ml sterile tubes up to 15 ml (approx. 400 spheres) and washed 4 times in PBS with a pH value of 5.5, thorough mixing being carried out during the individual washing steps. The wash water is checked for dirt particles by means of OD measurement at 280 nm. Then phosphate buffer with a pH of 5.5 (1/15 mol / l KH ₂ P0 ₃ , 1/15 mol / l Na ₂ HP0 ₃ ) is mixed with plasmid DNA (15 μg / ml) and 10 ml of this Put solution on the washed balls. After 1.5 hours of incubation, the DNA solution is removed and the remaining amount of DNA is determined by OD measurement. The balls are washed repeatedly with PBS (pH 5.5) to remove unbound DNA.

e) sterilization of the balls

Sterilization should not damage DNA and binding. Therefore, steam sterilization (leads to denaturation of the DNA) or radiation (induces mutations in the DNA) is not used. The DNA-coated spheres are sterilized by adding 40 ml of 70% ethanol under the sterile bench. After 24 hours of incubation, the ethanol is removed and the balls are washed 4 times in PBS (PAA Laboratories, Cölbe). Ethanol and wash water are checked for DNA molecules by photometric absorption at 260 and 280 nm.

f) Detection of the DNA on the balls by means of PCR

Glass balls are coated and sterilized as described above. A sensitive PCR method is being developed to provide further clear evidence of the binding of the DNA to the glass spheres. For this purpose, a primer is developed using the DNASTAR ™ software and the reaction conditions of the primers (annealing temperature, MgCl ₂ concentration, elongation time, etc.) are optimized.

In order to detach the DNA from the coated spheres, a prepared and an unprepared sphere are heated in 200 μl TE to 95 ° C. and incubated on ice for 10 min. A comparison is then made with a comparison with a dilution series of a known concentration of plasmid DNA to determine whether DNA can be determined on the spheres (see FIG. 4). The bands are colored using ethidium bromide. The content of pcDNA-IL-1 Ra in the spherical supernatant can be determined by comparing the band strengths of the PCR on the spherical supernatant with the band strengths of the known plasmid concentration.

No DNA could be detected in the unprepared balls (not shown), and DNA is present on the coated balls. After detection using PCR and gel electrophoresis (see Fi gur 4) it could be calculated that the DNA concentration in the supernatant of the sphere is at least 1 μg / ml. 0.2 μg of DNA remain on each sphere.

) Transfection of the cells

The transfection takes place in a blood cell culture. The glass spheres coated with DNA are introduced into a 48-well cell culture plate MTP (from Nunc, Wiesbaden) and incubated with 1 ml of heparinized whole blood at 37 ° C., 5% CO ₂ . After 24 hours of incubation, the total protein content and the content of reporter or target protein in the serum supernatant are analyzed.

h) Determination of the PCR detection limit of plasmid DNA in human serum after transfection

For the application of the method in clinical practice, it must be ensured that there is no plasmid DNA in the serum. This is checked using the PCR:

DNA polymerase (Taq polymerase) and dNTP ^'s are purchased and used by Qiagen (Hilden) in the "Supermix ™". The primers are purchased from Invitrogen (Karlsruhe). Their concentrations are reduced to 20 μmol / l with distilled water set.

The following primer pair SEQ ID NO: 1 / SEQ ID NO: 2 are used for PCR amplification:

(SEQ ID NO: 1) GCGCTTGTCCTGCTTTCTGTTCTC

(SEQ ID NO: 2) TGGAGTTCCGCGTTACATA The PCR amplification is carried out at 94 ° C denaturation (30 sec), 58 ° C annealing (30 sec) and 72 ° C elongation (45 sec) in 30 cycles. The amplification is checked by means of agarose gel electrophoresis.

In order to determine the detection limit of the amounts of plasmid DNA, human serum is mixed 1: 1 with a dilution series of plasmid DNA. The minimum plasmid concentration detected by PCR is 10 ng / ml (see FIG. 5). A PCR sensitivity of 1 μg / ml can be determined by PCR on a dilution series of known plasmid concentration (see band 2 in FIG. 5).

In order to achieve a high sensitivity, a "nested" PCR is carried out. A further pair of primers SEQ ID NO: 3 / SEQ ID NO: 4 is used to carry out the "nested" PCR:

(SEQ ID NO: 3) GTCCTGCTTTCTGTTCTCGCTCAG

(SEQ ID NO: 4) AACTAGAGAACCCACTGCTTAC

A 1: 1 dilution series of plasmid DNA is added to the serum in order to detect the detection limit of the PCR. The final detectable concentration of pcDNA-IL-1 Ra in human serum is 10 pg / ml (FIG. 6).

/) Detection of ocDNA-IL-1Ra in human serum after application of the coated spheres

Human, non-transfected serum is mixed with a dilution series of plasmid DNA pcDNA-IL-1 Ra and compared with human serum after transfection in a PCR. Based on the The sensitivity of the PCR can be confirmed with the thinning series of pcDNA-IL-1 Ra, it is 10 pg / ml. FIG. 7 shows the analysis of the human serum after the transfection by means of PCR. No DNA amounts of 10 pg / ml or more can be detected in the human serum after the transfection. This means that no DNA remains in the serum after transfection.

k) Expression of the transgene

The target cells are incubated with the previously coated spheres for 24 h and then subjected to an IL-1 Ra and IL-1 β measurement. The following serves as a control:

1. Serum supernatant at the start of the experiment

2. Serum supernatant after incubation with the same treated but not coated balls

3. Serum supernatant after incubation without balls.

After analysis of the samples, an increase in the IL-1Ra content can be detected in the samples incubated with coated balls compared to the samples incubated with non-coated balls and samples incubated without balls (see FIG. 8). After the IL-1ß measurement, no increase could be detected, the measured values were between 8.32 and 11.51 pg / ml (not shown). This shows that IL-1 Ra production is not caused by a pyrogenic reaction and must be the result of the transient transformation. Example 2: Transformation with the aid of DNA-coated glass beads in a syringe

a) Creation of the syringe

Sterile glass granules are used, for example granules from Roth (Karlsruhe), Order No. 17557.1, or granules of the following types:

1) Roth

Size: 2.85 to 3.3 mm

Chem. Composition (%):

Si0 ₂ 68

CaO 3

BaO 6

K ₂ 0 8

Na ₂ 0 10 I ₃ 1

B ₂ 0 ₃ 2 lead-free

2) SiLi 5506 / 89-6

Size: 2.3 to 2.5 mm

Material: borosilicate glass

Treatment: 1st grinding process

2. Polishing process

Chem. Composition (%):

Si0 ₂ 82

Na ₂ 0 2

Al ₂ 0 ₃ 2 B ₂ 0 ₃ 14

Specific weight (kg / dm, 3 ° _\ ) .: 223

Mohs hardness: 7

Linear expansion coefficient (20-300 ° C): 325

Hydrolytic class (DIN ISO 719): 1

Acid class (DIN 12116): 1

Alkali class (DIN ISO 695): 2

Transformation temperature (° C): 530

3) SiLi 5004 / 99-5

Size: 2.5 mm

Material: quay soda glass

Treatment: pressing process

Chem. Composition (%):

Si0 ₂ 67

Na ₂ 0 16

CaO 7

Al ₂ 0 ₃ 5

B ₂ 0 ₃ 3

MgO 2

PbO free

Mohs hardness: greater than or equal to 6

4 Worf

Size. 2 up to 3.5 mm

Material: soda lime glass

Treatment polished and thermally hardened

Chem. Composition (%):

Si0 ₂ 65 Na ₂ 0 16

CaO 7

Al ₂ 0 ₃ 5

B ₂ 0 ₃ 3

MgO 2

Lead content: free

Density (g / dm ³ ) 2.54

Mohs hardness: 6

Hydrolytic I class: 3 D Deeffoorrmmaattiioonnsstteemmppeerraattuurr ((°° CC)) :: 530 +/- 10

5) Duran

Size: 2 up to 3.5 mm

Material: borosilicate glass

Treatment: 1st grinding process

2. Polishing process

Chem. Composition (%):

Si0 ₂ 81

Na ₂ 0, K ₂ 0 4

Al ₂ 0 ₃ 2

B ₂ 0 ₃ 13

Density (g / dm ³ ] i: 2.23

Linear expansion coefficient (20-300 ° C): 3.25 Hydrolytic class (DIN ISO 719): 1 Acid class (DIN 12116): 1

Alkali class (DIN ISO 695): 2

Transformation temperature (° C): 525 The surface of the granules is normally modified with the aid of a commercially available chromosulfuric acid preparation in a batch process, as set out in Example 1; however, any other acid and / or alkali listed in Example 1 can also be used. The granules are then rinsed with water in order to wash away the acid / alkali residues. The granules are then incubated at 121 ° C. under a pressure of 2 bar for at least 20 minutes in order to sterilize the granules and to saturate them with water. The granules are then dried at 80 ° C. for 20 minutes.

The first washing steps are carried out in sterile 50 ml tubes. About 150 glass balls are then transferred to a plastic perfusor syringe, for example type No. 00137 (Becton, Dickinson and Company, Heidelberg), and coated with DNA in the syringe. The DNA solution is drained and the balls are washed. All further steps are carried out under the sterile bench. For sterilization, 70% ethanol is filled in, the syringe is closed and incubated for approx. 24 hours. This is followed by the washing steps with PBS (PAA Laboratories, Cölbe), with PBS being filled in at the top and allowed to run off again. Adapted to the size of the syringe, approximately 1, 2, 4 or 10 cm ³ , or possibly more or less, of the prepared spheres are transferred to a second sterile syringe. If necessary, the syringe is filled in addition to the sterilized and modified granules with a sufficient amount of an anticoagulant such as heparin (Liquemin ™, heparin sodium ™ 2500 IU) or Na citrate. This syringe is closed and sealed. b) general use of the syringe

The user removes the sterile cutlery from the packaging and takes blood from the patient. The syringe has a septum at its opening in the closure attachment, which is pierced by the removal accessory, that is, the needle of the adapter, for removal. After removing the adapter, the septum closes again automatically. After taking blood, the syringe stamp is broken off at a predetermined breaking point. FIG. 12 shows a preferred embodiment of this syringe.

The syringe with blood is then incubated for 24 hours at about 37 ° C to 41 ° C. The incubation is carried out horizontally. The blood can preferably be decanted and centrifuged. After centrifugation, the plasma is then removed through a sterile front filter, for example 0.2 μm.

c) experimental use of the syringe for clinical replaceability

Blood is drawn from a volunteer donor using the prepared syringe. As a control, an ORTHOKINΘ syringe (from ORTHOGEN, Düsseldorf), a perfusor syringe without balls and a 10 ml serum tube (from Sarstedt, Nümbrecht) are taken as zero samples. The zero sample is centrifuged immediately after taking off at 4000 xg at 4 ° C for 10 min and the serum supernatant is frozen and stored at -20 ° C. The syringes are incubated at 37 ° C and 5% CO ₂ for 24 hours. After incubation, the serum is removed and centrifuged at 4000 xg, 4 ° C, 10 min to remove all blood cells. The supernatant is with a 20 ml syringe (Sarstedt, Nümbrecht) drawn up, sterile filtered with a 0.2 μm filter (Minisart ™, Sartorius) and filled into 1.8 ml tubes. The serum is frozen at -20 ° C and stored for analysis.

In order to assess the clinical applicability of the system, the serum obtained is carefully analyzed. In addition to the quality control of the blood product common in transfusion medicine, such as screening for HCV, HBV, HIV and syphillis, a sterility test and a measurement of the transgene activity are carried out. It must be ensured that a normal quality control can be carried out and is not adversely affected.

The use of a syringe as a withdrawal system permits clinical use. The quality controls of the blood product that are common in transfusion medicine, such as screening for HCV, HBV, HIV and syphillis, give the same result in all tested systems. The sterility test showed that no germs were found in all systems after the serum had been processed.

An increase in the IL-1 Ra content in the batch according to the invention compared to the zero sample and to the ORTHOKIN® syringe (comparative example) can be determined (see FIG. 9). However, no increase in the IL-1β content can be detected, the measured values are between 7.2 and 10.9 pg / ml (not shown). This shows that IL-1 Ra production is not caused by a pyrogenic reaction and must be the result of the transient transformation. d) Clinical success

In a patient collective, 18 therapeutic applications with the systems described here are carried out and clinically evaluated. These are patients with knee or ankle cartilage defects due to degenerative and inflammatory diseases of the musculoskeletal system.

The assessment of effectiveness and side effects is documented radiologically and assessed on the basis of the WOMAC score, VAS score and anamnestic data.

With regard to the effectiveness, a striking, surprising and highly significant pain relief, improvement in mobility and improvement in the general condition can be observed in the treated joints in the observation period of half a year. There were no serious side effects.

Example 3: Transformation of Mononuclear Blood Cells (PBMC)

a) Isolation and cultivation of PBMCs

A density gradient solution is used to isolate PBMCs (mononuclear blood cells). For this purpose, uncoagulated whole blood is diluted in equal parts with culture medium or physiological saline (eg Dulbecco ^'s PBS). 50 ml centrifuge tubes are provided with 12.5 ml separating solution (density 1.077 g / ml) and the diluted whole blood is carefully layered over the separating solution (up to approx. 25 ml per tube). The tubes are centrifuged at 400 xg for 30 min at 15 to 25 ° C. After centrifugation, mononuclear cells form a white boundary layer between the plasma and the gradient solution. Erythrocytes and granulocytes are in the sediment, and in the serum there are thrombocytes.

First, plasma and then mononuclear cells are carefully removed with a pipette and transferred separately into sterile tubes. The cell suspension with the mononuclear cells (PBMCs) is mixed in equal parts with culture medium or a physiological salt solution (Dulbecco ^'s PBS) and centrifuged at 250 × g, 10 min, 25 ° C. without braking. The pellet is resuspended and the cells are washed 2 to 3 times with RPMI 1640 cell culture medium (with L-glutamine) (Invitrogen, Karlsruhe, Order No .: 21875034).

b) electroporation

In electroporation, a cell suspension is exposed to one or more electrical pulses in the presence of a DNA solution. This creates pores in the cell membrane through which the DNA can enter the cell. The formation of the pores depends on various factors and the pores must be closed again after the electroporation. Temperature and electroporation medium are particularly important. After the uptake of the DNA, the DNA migrates into the nucleus and is transcribed in the nucleus. The migration to the core is supported electrophoretically with the help of the pulses. Different pulses are usually applied. The first or the first pulses are short and strong, that is to say they have a high field strength, the subsequent pulses are possibly weaker and can have different parameters (see below).

The following conditions are used for electroporation of PBMCs:

Cell number: 10 ⁴ to 10 ¹⁰ cells per ml, preferably 10 ⁷ cells per ml

Amount of DNA: 1 to 100 μg per batch, preferably 20 μg per batch

Field strength: 10 to 2500 V / cm, i.e. 4 to 1000V, with a 4mm cuvette: preferably 1500V / cm, i.e. 600 V

Pulse number: 1 to 100, preferably 10

Pulse duration: 1 to 1500 μsec, preferably 0.1 sec

Pulse interval: 0.01 to 1 sec, preferably 1 sec

Capacitance 10 to 4000 μF, preferably 1050 μF

Electroporation medium: RPMI,

RPMI + 10-30% FCS, RPMI + 10-30% AP, PBS, preferably RPMI + 10% AP c) Influence of growth-stimulating factors

The PBMCs are incubated in media with growth-stimulating factors. The cultivation takes place in RPMI 1640 at 37 ° C, 5% CO ₂ and 10% autologous plasma, expediently with the addition of growth-stimulating substances such as 10-30 U / ml IL-2 (Röche, Mannheim) or 2-10 μg / ml PHA -M (Röche, Mannheim).

After 3 days of incubation, electroporation is carried out. The composition of the medium is RPMI + 10% AP + 10 U / ml IL-2. The electroporation takes place under the following conditions: 10 ⁷ cells per ml, 20 μg DNA, 1500 V / cm in 4 mm cuvette, 10 pulses, 0.1 sec pulse duration, 1 sec pulse interval and subsequent incubation on ice for 15 min.

FIG. 10 shows the specific activity of the β-galactosidase after electroporation of PBMCs with pVaxLacZ. There is a significant increase in the specific activity of the β-galactosidase in samples electroporated with DNA compared to the controls that were not electroporated or electroporated without DNA.

Example 4: Production of a glass syringe with granules

To produce the syringe, the surface of the inner structure of the brand-new and originally packaged syringe and of the brand-new and originally packaged glass granulate is washed and modified in accordance with Example 1: the syringe is for this purpose completely and one-to-ten times, preferably three times, sprayed out and sprayed out with acid and / or Alkali treated and cleaned or modified. After the last draw up the syringe sealed at the bottom and incubated in the filled state for 5 to 30 min with the acid and / or alkali. The syringe plunger is then removed and washed two to ten times, preferably four times, by completely filling and draining the syringe barrel with fresh ultrapure water, care being taken that the wash water is completely filled and filled. The syringe plunger is then immersed in acid and / or alkali and washed off thoroughly with distilled water.

Any water remaining in the syringe is aspirated by dabbing the luer connector capillary to ensure that the syringe dries quickly. Pistons and syringes that are separated from one another, including any glass beads they may contain, are sealed in Melag film with an indicator field (Melag, Melafol 1502) (Melag, Melaseal). The syringes packaged in this way are dried in a drying cabinet (Melag dry sterilizer) at 80 ° C for at least 60 min. The dried packaged syringes are then autoclaved at 132 ° C. for 30 minutes at 2 bar (Wolf Autoclave HRM 242 II) and dried again at 80 ° C. for at least 60 minutes.

The granules are washed several times with saline / buffer and incubated in the plasmid saline for at least 2 hours. This plasmid contains at least one sequence which codes for a protein and / or effector molecule, and at least one regulatory element such as a promoter which is active in eukaryotic cells, for example the pcDNA1-IL-1Ra. The pyrogen-free nature of the DNA used is crucial for high protein and / or effector production. The coated balls or Granules are washed after the incubation and sterilized with ethanol or gas in a manner known per se, preferably as shown in Example 1.

Before using the glass syringe, heparin (e.g. Liquemin ™ N 2500, Heparin-Sodium ™ 2500 IU) or citrate (e.g. ACDA) is introduced into the syringe to prevent coagulation of the blood later taken. The use of coagulants has also proven to be advantageous in the processing of IL-1 Ra-containing serum.

Claims

Expectations

1. A method for producing an induced blood composition from blood, wherein blood cells contained in the blood are transformed transiently or stably with at least one nucleic acid molecule, preferably with a nucleic acid molecule which encodes at least one therapeutically and / or diagnostically important protein or an effector molecule and obtain an induced blood composition whose blood cells transiently or stably express and, if necessary, secrete the therapeutically and / or diagnostically important protein and / or the effector molecule.

2. The method of claim 1, wherein the induced blood composition is a blood composition containing at least one therapeutically and / or diagnostically important protein in higher concentration than an untransformed blood composition, for example cytokines such as natural or modified IL-1 Ra (IRAP; Interleukin 1 receptor antagonist).

3. The method according to claim 1, wherein the induced blood composition is a blood composition, in the blood cells of which at least one effector molecule, preferably protein or RNA, is expressed, which is not or not expressed in this amount in non-transformed blood cells.

4. The method according to any one of the preceding claims, wherein the blood is drawn from a patient with a sampling system and the blood with the at least one nucleic acid molecule in the Removal system is transformed without first separating the blood cells to be transformed from other blood components.

5. The method according to any one of claims 1 to 4, wherein the blood is taken from a patient, blood cells, in particular nuclear cells, separated from other blood components, the blood cells are transformed and incubated in medium with or without serum or in pure serum.

6. The method according to any one of claims 1 to 3, wherein the blood is withdrawn from a patient with a withdrawal system, filled into another vessel and transformed in this vessel without first separating the blood cells to be transformed from other blood components.

7. The method according to any one of the preceding claims, wherein the nucleic acid molecule, in particular DNA or RNA, immobilized on solid supports, for example large or small balls, for example made of glass, or magnetic beads or the wall of the syringe, is used for transformation.

8. The method according to any one of the preceding claims, wherein the nucleic acid molecule, in particular DNA or RNA, optionally labeled with a marker substance, is used for the transformation.

9. The method according to any one of the preceding claims, wherein the nucleic acid molecule, in particular the DNA or RNA, is transformed together with an additive which increases the transfection and / or expression of the nucleic acid molecule.

10. The method according to any one of the preceding claims, wherein the nucleic acid molecule is transformed by electroporation.

11. The method according to any one of the preceding claims, wherein the nucleic acid molecule encodes an expression of the body's own protein-inducing, repressing or regulating molecule, for example an antisense construct, RNA element, transcription factor or a transposable element.

12. The method according to any one of the preceding claims, wherein the nucleic acid molecule is contained in a vector, for example in a plasmid or in a virus.

13. The method according to any one of the preceding claims, wherein the nucleic acid molecule is functionally linked to at least one regulatory element, for example a promoter, enhancer or intron, in particular a blood cell-specific regulatory element.

14. The method according to any one of the preceding claims, wherein the nucleic acid molecule is functionally linked to a nucleotide section coding a signal peptide for protein secretion from the cell.

15. The method according to any one of the preceding claims, wherein after the transformation, expression and secretion of the at least one induced therapeutically and / or diagnostically significant protein from the transformed cells in the serum, the cells are separated from the serum and an induced serum is obtained.

16. The method according to any one of the preceding claims, wherein the at least one nucleic acid molecule is transformed with the aid of liposomes, viral vectors or bound to microglass beads.

17. A method for transforming cells, in particular cells present in the blood, for example blood cells, with nucleic acid molecules, the cells or blood cells being brought into contact with the nucleic acid molecules, the cells or the blood cells present in the blood being transformed and cells being stably or transiently transformed or blood cells can be obtained.

18. The method according to claim 17, wherein the nucleic acid molecules are in particular covalently, in particular acid-labile, bound to microglass beads before the transformation.

19. A method for the treatment of the human or animal body, wherein blood, preferably by means of a syringe, is drawn from the human or animal body, a method according to one of the preceding claims is carried out and the induced blood composition is reapplied to the human or animal body, if appropriate only that Blood serum after separation from the transformed blood cells and other blood components.

20. Use of microglass beads, in particular microglass beads containing bound nucleic acids, for the transformation of whole blood, in particular nuclear cells in whole blood, in particular for the expression and secretion of proteins in blood, in particular blood cells.

21. Use of microglass beads, in particular microglass beads having bound nucleic acids, for the transformation of biological cells, in particular animal, plant or human cells.

22. Use of blood, in particular whole blood, for the transformation of nucleic acid molecules, coding for therapeutically and / or diagnostically important proteins or effector molecules, into the blood cells of the blood, in particular for gene therapy and / or the treatment of leukemia, for the treatment of traumatic, degenerative, chronic inflammatory diseases of the nervous system, the musculoskeletal system or various internal organs.

23. Use of blood for the manufacture of a drug kit for gene therapy purposes and / or the treatment of leukemia, for the treatment of traumatic, degenerative, chronic inflammatory diseases of the nervous system, the musculoskeletal system or various internal organs.

24. Use of nucleotide molecules, in particular coding for therapeutically and / or diagnostically important proteins or effector molecules, for the transformation of blood or blood cells and the expression and, if appropriate, secretion of the therapeutically and / or diagnostically important protein or effector molecule, for example for the treatment of leukemia the treatment of traumatic, degenerative, chronic inflammatory diseases of the nervous system, the musculoskeletal system or various internal organs.

25. Use of nucleotide molecules, in particular coding for therapeutically and / or diagnostically important proteins or effector molecules, for the production of a medicament kit, for the transformation of blood or blood cells and the expression and optionally secretion of the therapeutically and / or diagnostically important protein or effector molecule for Example for the treatment of traumatic, degenerative, chronic inflammatory diseases of the nervous system, the musculoskeletal system or various internal organs.