EP1482987B1 - Multivalente konstrukte für therapeutische und diagnostische anwendungen - Google Patents

Multivalente konstrukte für therapeutische und diagnostische anwendungen Download PDF

Info

Publication number
EP1482987B1
EP1482987B1 EP03726024.7A EP03726024A EP1482987B1 EP 1482987 B1 EP1482987 B1 EP 1482987B1 EP 03726024 A EP03726024 A EP 03726024A EP 1482987 B1 EP1482987 B1 EP 1482987B1
Authority
EP
European Patent Office
Prior art keywords
kdr
binding
peptide
group
vegf
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP03726024.7A
Other languages
English (en)
French (fr)
Other versions
EP1482987A1 (de
EP1482987A4 (de
Inventor
Christophe Arbogast
Philippe Bussat
Daniel T. Dransfield
Hong Fan
Karen E. Linder
Edmund R. Marinelli
Palaniappa Nanjappan
Adrian D. Nunn
Radhakrishna K. Pillai
Sibylle Pochon
Kondareddiar Ramalingam
Aaron Sato
Ajay Shrivastava
Bo Song
Rolf E. Swenson
Mathew A. Von Wronski
Sharon Michele Walker
Feng Yan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bracco Suisse SA
Dyax Corp
Original Assignee
Bracco Suisse SA
Dyax Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bracco Suisse SA, Dyax Corp filed Critical Bracco Suisse SA
Priority to SI200332395T priority Critical patent/SI1482987T1/sl
Publication of EP1482987A1 publication Critical patent/EP1482987A1/de
Publication of EP1482987A4 publication Critical patent/EP1482987A4/de
Application granted granted Critical
Publication of EP1482987B1 publication Critical patent/EP1482987B1/de
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/64—Cyclic peptides containing only normal peptide links

Definitions

  • the invention relates to compositions and methods for therapeutic and diagnostic applications.
  • Targets or ligands bind to specific cells (via receptors or otherwise) to target compositions such as detectable labels or therapeutic agents to particular tissues of an animal (especially a human).
  • target compositions such as detectable labels or therapeutic agents to particular tissues of an animal (especially a human).
  • the ability of the targeting moiety to bind to the target significantly impacts the ability to successfully target the desired tissues.
  • the building blocks are typically single-chain Fv fragments (scFv) which are monovalent. Combining fragments of this type so that they have the bivalent or multivalent properties of the antibodies has been problematic.
  • scFv single-chain Fv fragments
  • the two binding sites on the antibody are connected via a flexible hinge to the constant region.
  • scFv fragments can be joined together as well as more than the customary two scFv moieties present in natural antibodies.
  • Certain scFv fragments depending both on the VH/VL interface and the linker length, can spontaneously dimerize or multimerize. These "diabodies" are smaller than the natural antibody and do not have the immunological properties of the Fc portion (which activates complement and/or binds to Fc receptors), which they lack. The two (or more) binding sites are rotated relative to each other, and thus the antigen must be correctly positioned to accommodate this presentation.
  • miniantibodies have properties similar to those of diabodies, but rather than a short 5-20 amino acid linker they have a relatively more flexible linker that allows freer orientation of the binding sites relative to each other, similar to in a natural antibody. Like diabodies, miniantibodies do not have the high molecular weight, immunologically active Fc dimer fragment. They can also be made by bacterial systems. Although they have desired advantages over natural antibodies, miniantibodies still suffer from having a relatively large size, which affects their pharmacokinetics, and must be made using biological methods. The smallest miniantibody is about 120 kDa in size.
  • bispecific antibodies e.g. antibodies that bind to two separate targets
  • pretargeting This approach uses a two-step protocol.
  • a bispecific antibody with at least one arm that recognizes a tumor-associated antigen and at least one other arm that recognizes an epitope on a diagnostic or therapy agent is given as a first injection. After the unbound antibody has substantially cleared non-target tissues and has reached a maximum level in the tumor, the smaller, bispecific antibody-recognizable diagnostic or therapeutic agent is given. It is hoped that the latter agents distribute more rapidly throughout the body, and either bind to the bispecific antibody localized at the tumor, or are cleared via the kidneys.
  • An alternative to this approach attempts to use a mixed antibody avidin/biotin system in a two-step procedure.
  • a targeting antibody is conjugated with either avidin or biotin and then is injected whereupon it localizes in the tumor of interest.
  • biotin or avidin depending on which was coupled to the targeting antibody
  • an imaging or radiotherapeutic radionuclide is injected and becomes localized at the site of the primary antibody by binding to avidin or biotin respectively.
  • Another approach to the use of antibodies as targeting moieties for radiopharmaceuticals or other diagnostic imagining agents has attempted to use a bivalent hapten to increase the avidity for the cell bound bispecific antibody over that of the circulating antibody.
  • This approach relies on bidentate binding occurring with the cell bound antibodies, because the surface density on the cells is sufficiently high, but not occurring with the circulating antibodies, because the concentration is too low. In effect, the system makes use of the increase in avidity caused by the closer presentation of the antibodies/antigen on the cells.
  • Peptides have also been used as targeting moieties.
  • two or more peptide based targeting agents selective for different targets.
  • a hybrid peptide having ligands to two targets selected from the somatostatin-, GRP-, CCK-, Substance P-, or VIP receptor and ⁇ v ⁇ 3 integrin was reportedly made and tested for the ability to bind to tumor cells.
  • the initial evaluation showed no improved tumor uptake for the multiple ligand systems investigated.
  • the investigators assumed that steric impairment leads to a reduction of the receptor affinities of the dimeric structures.
  • a variation of these approaches uses a bispecific diabody targeted to two different epitopes on the same antigen.
  • This approach attempts to increase the avidity of the construct for the target, because, although the binding is monovalent for each epitope, the construct as a whole is bivalent to its target, as each of the binding epitopes is located within the same target molecule.
  • scFv fragments have been found to have insufficient affinity and an increase in avidity was required.
  • the first rationale uses two different targeting moieties to overcome some of the pharmacokinetic problems associated with the delivery of antibodies to solid tumors.
  • the second rationale uses two different targeting moieties to increase the avidity of the construct for a given target, such as a single molecule or a whole tumor.
  • all of the approaches described suffer from various drawbacks.
  • diagnostic and therapeutic agents with increased affinity and or avidity for a target of interest.
  • diagnostic and therapeutic agents that, when administered in vivo to a mammal, have acceptable pharmacokinetic properties.
  • Angiogenesis the formation of new blood vessels, occurs not only during embryonic development and normal tissue growth and repair, but is also involved in the female reproductive cycle, establishment and maintenance of pregnancy, and repair of wounds and fractures.
  • angiogenic events are involved in a number of pathological processes, notably tumor growth and metastasis, and other conditions in which blood vessel proliferation is increased, such as diabetic retinopathy, psoriasis and arthropathies.
  • Angiogenesis is so important in the transition of a tumor from hyperplastic to neoplastic growth, that inhibition of angiogenesis has become an active cancer therapy research field.
  • VEGF vascular endothelial growth factor
  • VEGF also referred to as VEGF-A
  • VEGF-A is synthesized as five different splice isoforms of 121, 145, 165, 189, and 206 amino acids.
  • VEGF 121 and VEGF 165 are the main forms produced, particularly in tumors (see, Cohen et al. 1999, supra ).
  • VEGF 121 lacks a basic domain encoded by exons 6 and 7 of the VEGF gene and does not bind to heparin or extracellular matrix, unlike VEGF 165 .
  • VEGF family members act primarily by binding to receptor tyrosine kinases.
  • receptor tyrosine kinases are glycoproteins having an extracellular domain capable of binding one or more specific growth factors, a transmembrane domain (usually an alpha helix), a juxtamembrane domain (where the receptor may be regulated, e.g., by phosphorylation), a tyrosine kinase domain (the catalytic component of the receptor), and a carboxy-terminal tail, which in many receptors is involved in recognition and binding of the substrates for the tyrosine kinase.
  • Flt-1 Flt-1
  • VEGFR-2 VEGFR-2
  • Flk-1 VEGFR-3
  • Flt4 Flt-1 and KDR have been identified as the primary high affinity VEGF receptors. While Flt-1 has higher affinity for VEGF, KDR displays more abundant endothelial cell expression ( Bikfalvi et al., J. Cell. Physiol., 149: 50-59 (1991 )). Moreover, KDR is thought to dominate the angiogenic response and is therefore of greater therapeutic and diagnostic interest (see, Cohen et al. 1999, supra ).
  • KDR KDR-induced angiogenic vessel
  • angiogenic vessels especially in tumors that induce a strong angiogenic response
  • the critical role of KDR in angiogenesis is highlighted by the complete lack of vascular development in homozygous KDR knockout mouse embryos ( Folkman et al., Cancer Medicine, 5th Edition (B.C. Decker Inc.; Ontario, Canada, 2000) pp. 132-152 ).
  • KDR kinase domain region
  • the glycosylated form of KDR migrates on an SDS-PAGE gel with an apparent molecular weight of about 205 kDa.
  • KDR contains seven immunoglobulin-like domains in its extracellular domain, of which the first three are the most important in VEGF binding (Cohen et al. 1999, supra ).
  • VEGF itself is a homodimer capable of binding to two KDR molecules simultaneously. The result is that two KDR molecules become dimerized upon binding and autophosphorylate, becoming much more active. The increased kinase activity in turn initiates a signaling pathway that mediates the KDR-specific biological effects of VEGF.
  • VEGF binding activity of KDR in vivo critical to angiogenesis, but the ability to detect KDR upregulation on endothelial cells or to detect VEGF/KDR binding complexes would be extremely beneficial in detecting or monitoring angiogenesis. Diagnostic applications, such as detecting malignant tumor growth, and therapeutic applications, such as targeting tumoricidal agents or angiogenesis inhibitors to the tumor site, would be particularly beneficial.
  • Hepatocyte growth factor (also known as scatter factor) is a multi-functional growth factor involved in various physiological processes such as embryogenesis, wound healing and angiogenesis. It has become apparent that HGF, through interactions with its high affinity receptor (cMet), is involved in tumor growth, invasion and metastasis. In fact, dysregulated cMet expression (for example, the overexpression of cMet in neoplastic epithelium of colorectal adenomas and in other carcinomas as compared to normal mucosa) and/or activity, as well as hyperactivity of the cMet receptor through an autocrine stimulatory loop with HGF, has been demonstrated in a variety of tumor tissues and induces oncogenic transformation of specific cell lines.
  • cMet high affinity receptor
  • HGF is produced by the stromal cells, which form part of many epithelial tumors; however, it is believed that the production of HGF by tumor cells themselves comprises the main pathway leading to the hyperproliferation of specific tumors.
  • HGF/cMet autocrine stimulatory loops have been detected in gliomas, osteosarcomas, and mammary, prostate, breast, lung and other carcinomas.
  • HGF Interrupting the HGF interaction with the cMet receptor slows tumor progression in animal models.
  • HGF In addition to stimulating proliferation of certain cancer cells through activation of cMet, HGF also protects against DNA-damaging agent-induced cytotoxicity in a variety of cell lines susceptible to hyperproliferative phenotypes (e.g., breast cancer). Therefore, preventing HGF from binding to cMet could predispose certain cancer cells to the cytotoxicity of certain drugs.
  • cMet In addition to hyperproliferative disorders, cMet also has been linked to angiogenesis. For example, stimulation of cMet leads to the production of vascular endothelial growth factor (VEGF), which, in turn, stimulates angiogenesis. Additionally, stimulation of cMet also has been implicated in promoting wound healing.
  • VEGF vascular endothelial growth factor
  • cMet receptor As a therapeutic target for hyperproliferative disorders, angiogenesis and wound healing, the large discrepancy between expression levels of neoplastic and corresponding normal tissues indicates that cMet is an attractive target for imaging applications directed to hyperproliferative disorders.
  • WO 01/528575 A discloses hetero- and homodimeric bicyclic peptides to target KDR.
  • Publication WO 00/63380 A discloses VEGF variants containing two sites that bind to a high kinase domain region target. None of these documents, however, discloses multivalent compounds as claimed hereinafter.
  • a multivalent compound comprising two polypeptides having specificity for different epitopes on a protein-tyrosine kinase receptor and an ultrasound contrast agent as defined in the attached claims allowing for improved localization to the target, and providing an improved means for detecting, imaging and/or treating the target site.
  • targeting constructs may be linked or conjugated to a detectable label and/or a therapeutic agent (as defined herein) and used to deliver the detectable label and/or therapeutic agent to the target of interest.
  • a detectable label and/or a therapeutic agent as defined herein
  • the invention includes diagnostic imaging agents and therapeutic agents useful in diagnostic imaging and treating various disease states.
  • the targeting constructs of the invention themselves are useful to treat disease.
  • the target is a receptor involved in angiogenesis, hyperproliferative disorders or wound healing.
  • the target is KDR or the KDR/VEGF complex, and the binding peptides, bind to different epitopes on KDR or the KDR/VEGF complex.
  • the target is the hepatocyte growth factor (HGF) receptor (cMet) or the HGF/cMet complex
  • HGF hepatocyte growth factor
  • cMet hepatocyte growth factor receptor
  • the binding polypeptides bind to different epitopes on cMet or the HGF/cMet complex.
  • the affinity constant of a compound according to the claims for its target is greater than the affinity constant of a constituent polypeptide for the target.
  • the compounds according to the claims include a labelling group or a therapeutic agent.
  • the compounds of the invention include a linker between a binding moiety and the labelling group.
  • the linker may include a substituted alkyl chain, an unsubstituted alkyl chain, a polyethylene glycol derivative, an amino acid spacer, a sugar, an aliphatic spacer, an aromatic spacer, a lipid molecule, or combination thereof.
  • Preferred labelling groups include a radionuclide, a paramagnetic metal ion, an ultrasound contrast agent, and/or a photolabel.
  • preferred paramagnetic metal ions used in compounds of the invention include Mn 2+ , Cu 2+ , Fe 2+ , Co 2+ , Ni 2+ , Gd 3+ , Eu 3+ , Dy 3+ , Pr 3+ , Cr 3+ , Co 3+ , Fe 3+ , Ti 3+ , Tb 3+ , Nd 3+ , Sm 3+ , Ho 3+ , Er 3+ , Pa 4+ , and Eu 2+ .
  • Radionuclides are also preferred detectable labels and therapeutic agents. The choice of radionuclide will be determined based on the desired therapeutic or diagnostic application.
  • the compounds of the invention include a chelator or chelating group.
  • Preferable chelators inlcude DTPA, DOTA, DO3A, EDTA, TETA, EHPG, HBED, NOTA, DOTMA, TETMA, PDTA, TTHA, LICAM, or MECAM.
  • a peptide may be complexed with one of the various positron emitting metal ions, such as 51 Mn, 52 Fe, 60 Cu, 68 Ga, 72 As, 94m Tc, or 111 In.
  • the heteromultimeric constructs can also be labeled by halogenation using radionuclides, such as 18 F, 124 I, 125 I, 131 I, 123 I, 77 Br, and 76 Br.
  • Preferred metal radionuclides for scintigraphy or radiotherapy include 99m Tic, 51 Cr, 67 Ga, 68 Ga, 47 Sc, 51 Cr, 167 Tm, 141 Ce, 111 In, 168 Yb, 175 Yb 140 La, 90 Y, 88 Y, 153 Sm, 166 Ho, 165 Dy, 166 Dy, 62 Cu, 64 Cu, 67 Cu, 97 Ru, 103 Ru, 186 Re, 188 Re, 203 Pb, 211 Bi, 212 Bi, 213 Bi, 214 Bi, 105 Rh, 109 Pd, 117m Sn, 149 Pm, 161 Tb, 177 Lu, 198 Au and 199 Au.
  • the preferred radionuclides include 64 Cu, 67 Ga, 68 Ga, 99m Tc, and 111 In.
  • the preferred radionuclides include 64 Cu, 90 Y, 105 Rh, 111 In, 117m Sn, 149 Pm, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 175 Yb, 177 Lu, 186/188 Re, and 199 Au.
  • a most preferred chelator used in compounds of the invention is 1-substituted 4,7,10-tricarboxymethyl 1,4,7,10 tetraazacyclododecane triacetic acid (DO3A).
  • DO3A 1-substituted 4,7,10-tricarboxymethyl 1,4,7,10 tetraazacyclododecane triacetic acid
  • a radioactive lanthanide such as, for example, 177 Lu, 90 Y, 153 Sm, 111 In, or 166 Ho is used with DOTA or DO3A in compounds of the invention
  • chelators having the following structure:
  • compounds of the the invention include a chelator having the following structure: Most preferably, the compound further includes 99m Tc, 186 Re, or 188 Re.
  • the chelator comprises a compound having the following structure: Most preferably, the compound further includes 99m Tc.
  • compounds of the invention include a chelator having the following structure: where R is an alkyl group, such as CH 3 . Most preferably, the compound further includes 177 Lu, 90 Y, 153 Sm, 111 In, or 166 Ho.
  • compounds of the invention include a chelator having the following structure: where R is an alkyl group, such as CH 3 . Most preferably, the compound further includes 177 Lu, 90 Y, 153 Sm, 111 In, or 166 Ho.
  • the compound of the invention includes a chelator having the following structure: Most preferably, the compound further includes 177 Lu, 90 Y, 153 Sm, 111 In, or 166 Ho.
  • Preferred ultrasound contrast agents for use in compounds of the invention include phospholipid stabilized microbubbles or microballoons comprising a fluorinated gas.
  • One preferred embodiment of the invention includes compounds comprising two binding moieties with specificity for different binding sites on a target as specified in the claims.
  • the target is KDR or the KDR/VEGF complex or cMet of the cMet/VEGF complex.
  • the binding moieties bind to different epitopes on the receptor or receptor/ligand complex.
  • the binding moiety is a polypeptide.
  • such compounds further include a labelling group or therapeutic agent as described herein.
  • the invention features diagnostic imaging methods using compounds of the invention that include a labelling group.
  • Methods of the invention include the steps of administering to a patient a pharmaceutical preparation that includes a compound of the invention having a labelling group, and imaging the compound after administration to the patient.
  • the imaging step includes magnetic resonance imaging, ultrasound imaging, optical imaging, sonoluminescence imaging, photoacoustic imaging, or nuclear imaging.
  • the administering step may include inhaling, transdermal absorbing, intramuscular injecting, subcutaneous injecting, intravenous injecting, intraperitoneally injecting, intraarterial injecting or parenteral administration.
  • the compounds of the invention serve as therapeutic agents themselves and/or include a therapeutic agent.
  • the compounds of the invention include a linker between a binding moiety and the therapeutic agent.
  • the linker may include a substituted alkyl chain, an unsubstituted alkyl chain, a polyethylene glycol derivative, an amino acid or peptide spacer, a sugar, an aliphatic spacer, an aromatic spacer, a lipid molecule, or combination thereof.
  • Preferred therapeutic agents for use with compounds of the invention include a bioactive agent, a cytotoxic agent, a drug, a chemotherapeutic agent, or a radiotherapeutic agent.
  • the invention features the compounds according to the claims for use in a method of treating a disease by administering to a patient a pharmaceutical preparation including said compound.
  • the compound may be administered to treat that disease state.
  • the binding moieties may inhibit the biological process by preventing or diminishing the activity of the receptor(e.g. by competition with the natural ligand for the receptor, by directly inhibiting the receptor activity whether or not the natural ligand is bound, or by a combination of the two).
  • a heteromultimeric compound of the invention may inhibit the activity of, for instance KDR or cMet, and thus inhibit angiogenesis and/or hyperproliferation and consequently the diseases these processes contribute to. Therefore, the invention features the compounds according to the claims for use in a method of treating a disease by administering to a patient a pharmaceutical preparation including a compound of the invention alone or attached or linked to a separate therapeutic agent. In preferred embodiments, the invention features the compounds according to the claims for use in a method of treating a disease associated with angiogenesis or hyperproliferation. In a most preferred embodiment, the disease is neoplastic tumor growth.
  • the invention features dimeric targeting constructs which include two KDR or VEGF/KDR complex binding polypeptides which bind to different binding sites of KDR or the VEGF/KDR complex. These constructs are referred to herein as "KDR - targeting constructs.”
  • KDR - targeting constructs exhibit improved binding to KDR (e.g. increased specificity and/or affinity and/or avidity) compared to monomeric KDR or VEGF/KDR complex binding polypeptides, and compared to dimeric or multimeric constructs of a single KDR-binding polypeptide.
  • KDR - targeting constructs exhibit improved binding to KDR (e.g. increased specificity and/or affinity and/or avidity) compared to monomeric KDR or VEGF/KDR complex binding polypeptides, and compared to dimeric or multimeric constructs of a single KDR-binding polypeptide.
  • These preferred compounds may be linked or conjugated to a detectable moiety and used to target these compositions to KDR-expressing cells, permitting
  • the invention features dimeric targeting constructs which include two cMet or HGF/cMet complex binding polypeptides which bind to different binding sites of cMet or the HGF/cMet complex. These constructs are referred to herein as "cMet - targeting constructs.”
  • the cMet targeting constructs exhibit improved binding to cMet (e.g. increased specificity and/or affinity and/or avidity) compared to monomeric cMet or HGF/cMet complex binding polypeptides, and compared to dimeric or multimeric constructs of a single cMet-binding polypeptide.
  • cMet and KDR targeting constructs of the invention may be linked or conjugated to a therapeutic agent and used to localize the therapeutic agent to cMet- or KDR-expressing tissue.
  • the cMet or KDR targeting constructs of the invention may also be used as therapeutics themselves, as described herein.
  • Constructs comprising two KDR or KDR/VEGF binding polypeptides show improved ability to bind the target molecule compared to the corresponding monomeric binding polypeptides. For instance, as shown in Example 6 below, tetrameric constructs of KDR binding polypeptides provided herein showed improved ability to bind KDR-transfected 293H cells. Combining two or more binding polypeptides in a single molecular construct appears to improve the avidity of the construct over the monomeric binding polypeptides a shown by a decrease in K D .
  • constructs comprising two or more binding polypeptides specific for different epitopes of KDR and/or KDR/VEGF (e.g., "heteromeric" constructs) were made.
  • Constructs comprising two or more binding polypeptide provided herein are expected to block multiple sites on KDR or VEGF/KDR.
  • the heteromeric constructs show superior binding ability over both the corresponding monomers, as well as tetrameric constructs comprising multiple copies of the same binding polypetide.
  • heteromeric constructs comprising two or more binding peptides specific for different epitopes were also able to efficiently bind KDR-transfected 293H cells.
  • inclusion of two or more binding polypeptides that recognize different epitopes further improves the avidity of the construct for the target molecule, as demonstrated by a decrease in K D .
  • Heteromeric constructs of the binding polypeptides provided herein show improved ability to inhibit receptor tyrosine kinase function.
  • dimeric and other multimeric constructs comprising at least two binding polypeptides specific for different epitopes of KDR and/or KDR/VEGF are expected to inhibit the function of receptor tyrosine kinases.
  • such constructs are expected to inhibit the function of VEGFR-2/KDR, VEGFR-1/Flt-1 and VEGFR-3/Flt-4.
  • heteromultimeric constructs of the invention comprising two or more binding moieties specific for different epitopes of cMet and/or cMet/HGF are expected to inhibit the function of receptor tyrosine kinases and, in particular the function of cMet.
  • receptor tyrosine kinase function can include any one of: oligomerization of the receptor, receptor phosphorylation, kinase activity of the receptor, recruitment of downstream signaling molecules, induction of genes induction of cell proliferation, induction of cell migration, or combination thereof.
  • heteromeric constructs of binding polypeptides provided herein inhibit VEGF-induced KDR receptor inactivation in human endothelial cells, demonstrated by the inhibition of VEGF-induced phosphorylation of the KDR receptor.
  • heteromeric constructs of binding peptides provided herein inhibit VEGF-stimulated endothelial cell migration.
  • binding peptides with weak ability to block receptor activity can be used to generate heteromeric constructs having improved ability to block VEGF-induced receptor function.
  • constructs comprising two or more binding polypeptides specific for different epitopes of cMet were made.
  • Constructs containing two or more cMet binding polypeptide provided herein are expected to block multiple sites on cMet.
  • These heteromeric cMet targeting constructs show superior binding ability over the corresponding monomers.
  • the present application is drawn to constructs comprising two binding polypeptides as defined in the claims.
  • the multimeric constructs of the present invention comprise two binding polypeptides, such that two binding polypeptides in the construct are specific for different epitopes of KDR and/or KDR/VEGF and cMet and/or cMet/HGF.
  • These constructs are also referred to herein as “heteromeric constructs,” “hetermultimers” and/or “heteromultimeric constructs.”
  • the present invention is based, in part, on the discovery that compounds having two or more binding moieties, wherein at least two of the binding moieties bind to different binding sites on the same target, have unexpected and significantly improved ability to bind the target.
  • the target is a receptor or a receptor/ligand complex.
  • the improved ability of compounds of the invention (variously referred to as "multivalent targeting constructs,” “heterodimers,” “heterotetramers,” “heteromultimers” and/or “heteromultimeric constructs” herein) to bind a target may be demonstrated by comparison to the ability of an individual, constituent, binding moiety to bind the target.
  • the binding strength of a heteromultimer of the invention may be compared to the binding strength of one of its monomers.
  • a heteromultimer of the invention exhibits an increase in affinity (as determined, for example, by dissociation constants), compared to an individual, constituent monomer.
  • cMet binding polypeptide is a binding polypeptide that forms a complex in vitro or in vivo with the HGF receptor, cMet;
  • cMet/HGF complex binding polypeptide is a binding polypeptide that forms a complex in vitro or in vivo with a binding complex formed between hepatocyte growth factor (HGF) and cMet.
  • a “labelling group” or “detectable label,” as used herein, is a group or moiety capable of generating a signal for diagnostic imaging, such as magnetic resonance imaging, radioimaging, ultrasound imaging, x-ray imaging, light imaging, or carrying a moiety such as a radioactive metal or other entity that may be used in radiotherapy or other forms of therapy.
  • binding polypeptides of the invention have a dissociation constant for a desired target that is lower than about 10 ⁇ M, more preferably lower than about 1 ⁇ M, and most preferably less than about 0.5 ⁇ M or even lower.
  • KDR specificity refers to a KDR binding moiety having a higher affinity for KDR than an irrelevant target.
  • VEGF/KDR specificity refers to a VEGF/KDR complex binding moiety having a higher affinity for a VEGF/KDR complex than an irrelevant target.
  • heteromultimers according to the present invention are specific for KDR or the VEGF/KDR complex, and preferably have a dissociation constant that is lower than about 10 ⁇ M, more preferably less than about 1 ⁇ M, most preferably less than about 0.5 ⁇ M or even lower.
  • cMet specificity refers to a cMet binding moiety having a higher affinity for cMet than an irrelevant target.
  • cMet/HGF specificity refers to a cMet/HGF complex binding moiety having a higher affinity for a cMet/HGF complex than an irrelevant target.
  • binding heteromultimers according to the present invention are specific for cMet or the cMet/HGF complex, and preferably have a dissociation constant that is lower than about 10 ⁇ M, more preferably less than about 1 ⁇ M, most preferably less than about 0.5 ⁇ M or even lower.
  • pharmaceutically acceptable carrier or excipient refers to a non-toxic carrier or excipient that may be administered to a patient, together with a compound of this invention, and which does not destroy the pharmacological activity thereof.
  • therapeutic agent refers to a compound or an agent having a beneficial, therapeutic or cytotoxic effect in vivo.
  • Therapeutic agents include those compositions referred to as, for example, bioactive agents, cytotoxic agents, drugs, chemotherapy agents, radiotherapeutic agents, genetic material.
  • a di-lysine derivative can be constructed on 2-chlorotrityl resin. See Barlos, K. and Gatos, D. "Convergent Peptide Synthesis” in Fmoc Solid Phase Peptide Synthesis, Chan, W.C. and White, P.D. eds, Oxford University Press, New York, 2000, Chap 9: pp 215-228 .
  • a binding peptide is first assembled on a Rink-amide resin by automated or manual peptide coupling methods, usually employing Fmoc peptide synthesis protocols.
  • the peptide may possess a C-terminus or N-terminus functionalized with a linker or a linker-labelling group construct that may possess an additional nucleophilic group such as the N ⁇ -amino group of a lysine moiety, for example.
  • Cleavage of the protecting groups is accomplished by employing trifluoroacetic acid with appropriate modifiers, depending on the nature of the peptide.
  • the fully deprotected peptide is then reacted with a large excess of a bifunctional electrophile such as glutaric acid bis-N-hydroxysuccinimide ester (commercially available from Tyger Scientific Inc., 324 Stokes Avenue, Ewing, NJ, 08638).
  • a bifunctional electrophile such as glutaric acid bis-N-hydroxysuccinimide ester (commercially available from Tyger Scientific Inc., 324 Stokes Avenue, Ewing, NJ, 08638).
  • the resulting monoamidated, mono-N-hydroxysuccinimidyl ester of glutaric acid is then treated with an additional equivalent of the same peptide, or an equivalent of a different binding peptide. Purification of the resulting material by HPLC affords the desired homo- or hetero-dimeric construct bearing a suitable labelling group.
  • a modular scheme can be employed to prepare dimeric or comparative higher multimeric constructs bearing suitable labelling groups as defined above.
  • fmoc-lysine(iV-Dde) Rink amide resin is treated with piperidine to remove the fmoc moiety.
  • a labelling function such as biotin, 5-carboxyfluorescein or N,N-Dimethyl-Gly-Ser(O-t-Bu)-Cys(Acm)-Gly-OH is coupled to the nitrogen atom.
  • the resin is next treated with hydrazine to remove the iV-Dde group.
  • the resin is treated with cyanuric chloride and a hindered base such as diisopropylethylamine in a suitable solvent such as DMF, NMP or dichloromethane to provide a monofunctionalized dichlorotriazine bound to the resin.
  • a suitable solvent such as DMF, NMP or dichloromethane
  • Subsequent successive displacement of the remaining chlorine atoms either by two equivalents of a binding peptide or one equivalent of a binding peptide, followed by a second binding peptide provides a resin-bound, hetero- or comparative homo-dimeric, labelling group-functionalized construct. See, e.g., Falorni, M., et al., Tetrahedron Lett.
  • the incoming peptides may be protected or unprotected as the situation warrants.
  • Cleavage of protecting groups is accomplished employing trifluoroacetic acid-based deprotection reagents as described above and the desired materials are purified by high performance liquid chromatography.
  • Direct synthesis of the binding polypeptides may be accomplished using conventional techniques, including solid-phase peptide synthesis, solution-phase synthesis, etc. Solid-phase synthesis is preferred. See Stewart et al., Solid-Phase Peptide Synthesis (1989), W. H. Freeman Co., San Francisco ; Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963 ); Bodanszky and Bodanszky, The Practice of Peptide Synthesis (Springer-Verlag, New York 1984 ).
  • Polypeptides of the invention may also be prepared commercially by companies providing peptide synthesis as a service (e.g., BACHEM Bioscience, Inc., King of Prussia, PA; Quality Controlled Biochemicals, Inc., Hopkinton, MA). Automated peptide synthesis machines, such as manufactured by Perkin-Elmer Applied Biosystems, also are available.
  • the polypeptide compound is preferably purified once it has been isolated or synthesized by either chemical or recombinant techniques.
  • purification purposes there are many standard methods that may be employed, including reverse-phase high-pressure liquid chromatography (RP-HPLC) using an alkylated silica column such as C 4 -, C 8 - or C 18 -silica.
  • RP-HPLC reverse-phase high-pressure liquid chromatography
  • a gradient mobile phase of increasing organic content is generally used to achieve purification, for example, acetonitrile in an aqueous buffer, usually containing a small amount of trifluoroacetic acid.
  • Ion-exchange chromatography can also be used to separate peptides based on their charge, The degree of purity of the polypeptide may be determined by various methods, including identification of a major large peak on HPLC.
  • a polypeptide that produces a single peak that is at least 95% of the input material on an HPLC column is preferred. Even more preferable is a polypeptide that produces a single peak that is at least 97%, at least 98%, at least 99% or even 99.5% or more of the input material on an HPLC column.
  • composition analysis may be carried out.
  • Such composition analysis may be conducted using high resolution mass spectrometry to determine the molecular weight of the peptide.
  • the amino acid content of the peptide can be confirmed by hydrolyzing the peptide in aqueous acid, and separating, identifying and quantifying the components of the mixture using HPLC, or an amino acid analyzer. Protein sequenators, which sequentially degrade the peptide and identify the amino acids in order, may also be used to determine the sequence of the peptide.
  • binding polypeptides also may be produced using recombinant DNA techniques, utilizing nucleic acids (polynucleotides) encoding the polypeptides of the invention, and then expressing them recombinantly, i.e., by manipulating host cells by introduction of exogenous nucleic acid molecules in known ways to cause such host cells to produce the desired binding polypeptides.
  • nucleic acids polynucleotides
  • expressing them recombinantly i.e., by manipulating host cells by introduction of exogenous nucleic acid molecules in known ways to cause such host cells to produce the desired binding polypeptides.
  • a determination of the affinity of the heteromultimer or a constituent binding moiety for the target relative to another protein or target is a useful measure, and is referred to as affinity for the target.
  • Standard assays for quantitating binding and determining affinity include equilibrium dialysis, equilibrium binding, gel filtration, or the monitoring of numerous spectroscopic changes (such as a change in fluorescence polarization) that may result from the interaction of the binding moiety and its target. These techniques or modifications thereof measure the concentration of bound and free ligand as a function of ligand (or protein) concentration.
  • a solution of the data to this equation yields the association constant, K a , a quantitative measure of the binding affinity.
  • the association constant, K a is the reciprocal of the dissociation constant, K D .
  • the K D is more frequently reported in measurements of affinity.
  • heteromultimers of the invention and constituent binding polypeptides bind to the target, e.g. KDR, VEGF/KDR complex, cMet or cMet/HGF and have a K D for the target in the range of 1 nanomolar (nM) to 100 micromolar ( ⁇ M) and preferably have K D values less than 50 ⁇ M, preferably less than 1 ⁇ M, more preferably less than 50 nM, and most preferably less than 10 nM.
  • imaging agents operate in a dynamic system in that binding of the imaging agent to the target (such as KDR or VEGF/KDR complex, e.g., on activated endothelium) is not in a stable equilibrium state throughout the imaging procedure.
  • the concentration of imaging agent and of agent-target complex rapidly increases. Shortly after injection, however, the circulating (free) imaging agent starts to clear through the kidneys or liver, and the plasma concentration of imaging agent begins to drop. This drop in the concentration of free imaging agent in the plasma eventually causes the agent-target complex to dissociate.
  • the usefulness of an imaging agent depends on the difference in rate of agent-target dissociation relative to the clearing rate of the agent. Ideally, the dissociation rate will be slow compared to the clearing rate, resulting in a long imaging time during which there is a high concentration of agent-target complex and a low concentration of free imaging agent (background signal) in the plasma.
  • heteromultimeric binding compounds such as those of the present invention
  • they generally possess very slow dissociation rates relative to their constituent monomers (see Tissot et al., J. Immunol. Methods 236(1-2):147-165 (2000 )).
  • heteromultimeric compounds capable of binding to two distinct epitopes on a target molecule simultaneously can achieve multimeric binding regardless of the distance between target molecules on the cell surface.
  • Homomultimeric binding compounds on the other hand, depend on the presence of two or more target molecules being in close enough proximity such that the homomultimer can span the distance between them.
  • the heteromultimeric binding compounds of the present invention are particularly well suited for binding to receptors and other cell surface molecules that are less abundant and therefore more distant from each other on the cell surface.
  • Quantitative measurement of dissociation rates may be easily performed using several methods known in the art, such as fiber optic fluorimetry (see, e.g., Anderson and Miller, Clin. Chem., 34(7):1417-21 (1988 )), surface plasmon resonance (see, Malmborg et al., J. Immunol. Methods, 198(1):51-7 (1996 ) and Schuck, Current Opinion in Biotechnology, 8:498-502 (1997 )), resonant mirror, and grating coupled planar waveguiding (see, e.g., Hutchinson, Molec. Biotechnology, 3:47-54 (1995 )).
  • fiber optic fluorimetry see, e.g., Anderson and Miller, Clin. Chem., 34(7):1417-21 (1988 )
  • surface plasmon resonance see, Malmborg et al., J. Immunol. Methods, 198(1):51-7 (1996 ) and Schuck, Current Opinion in Biotechnology, 8:498-502 (1997
  • BIAcore surface plasmon resonance sensor Biacore AB, Uppsala SE
  • IAsys resonant mirror sensor Fiber Applied Sensor Technology, Cambridge GB
  • BIOS-1 grated coupled planar waveguiding sensor Articleificial Sensor Instruments, Zurich CH.
  • linkers or spacers between the targeting sequence of the binding moiety or binding polypeptide and the detectable label or therapeutic agent.
  • linkers/spacers may improve the relevant properties of the binding peptides (e.g. increase serum stability, etc.).
  • linkers may include, substituted or unsubstituted alkyl chains, polyethylene glycol derivatives, amino acid spacers, sugars, or aliphatic or aromatic spacers common in the art.
  • suitable linkers include homobi functional and heterobifunctional cross-linking molecules.
  • the homobifunctional molecules have at least two reactive functional groups, which are the same.
  • the reactive functional groups on a homobifunctional molecule include, for example, aldehyde groups and active ester groups.
  • Homobifunctional molecules having aldehyde groups include, for example, glutaraldehyde and subaraldehyde.
  • Homobifunctional linker molecules having at least two active ester units include esters of dicarboxylic acids and N-hydroxysuccinimide.
  • N-succinimidyl esters include disuccinimidyl suberate and dithio-bis-(succinimidyl propionate), and their soluble bis-sulfonic acid and bis-sulfonate salts such as their sodium and potassium salts.
  • Heterobifunctional linker molecules have at least two different reactive groups.
  • Some examples of heterobifunctional reagents containing reactive disulfide bonds include N-succinimidyl 3-(2-pyridyl-dithio)propionate ( Carlsson et al., 1978, Biochem J. 173:723-737 ), sodium S-4-succinimidyloxycarbonyl-alpha-methylbenzylthiosulfate, and 4-succinimidyloxycarbonyl-alpha-methyl-(2-pyridyldithio)toluene. N-succinimidyl 3-(2-pyridyldithio)propionate is preferred.
  • Other heterobifunctional molecules include succinimidyl 3-(maleimido)propionate, sulfosuccinimidyl 4-(p-maleimidophenyl)butyrate, sulfosuccinimidyl 4-(N-maleimidomethyl-cyclohexane)-1-carboxylate, maleimidobenzoyl-5N-hydroxy-succinimide ester.
  • linkers which are combinations of the molecules and/or moieties described above, can also be employed to confer special advantage to the properties of the peptide.
  • Lipid molecules with linkers may be attached to allow formulation of ultrasound bubbles, liposomes or other aggregation based constructs. Such constructs could be employed as agents for targeting and delivery of a diagnostic reporter, a therapeutic agent (e.g. a chemical "warhead" for therapy), or a combination of these.
  • Heteromultimeric constructs of the present invention can be used in a multitude of applications, including immunoassays (e.g., ELISA), as pharmaceuticals useful for treatments of various diseases, as well as in in vivo diagnostic and therapeutic uses.
  • immunoassays e.g., ELISA
  • the heteromultimeric constructs described herein will be extremely useful for detection and/or imaging of target containing tissue in vitro or in vivo.
  • KDR or VEGF/KDR complex binding heteromultimeric constructs will be extremely useful for detection and/or imaging of KDR or VEGF/KDR complex containing tissue, and particularly for detection and/or imaging of sites of angiogenesis, in which VEGF and KDR are intimately involved, as explained above.
  • Any suitable method of assaying or imaging KDR or VEGF/KDR complex may be employed.
  • cMet or HGF/cMet complex binding heteromultimeric constructs will be extremely useful for detection and/or imaging of cMet or HGF/cMet complex containing tissue, and particularly for detection and/or imaging tumors or other sites of hyperproliferation , in which HGF and cMet are intimately involved, as explained above.
  • Any suitable method of assaying or imaging cMet or HGF/cMet complex may be employed.
  • the compounds of the invention also have utility in the treatment of a variety of disease states, whether used alone or in combination with another therapeutic agent.
  • a compound of the invention that inhibits a biological process that contributes to a disease state may itself be used as a therapeutic or pharmaceutical composition.
  • a compound of the invention may include one or more additional therapeutic agents.
  • the invention includes heteromultimers including KDR or VEGF/KDR complex binding moieties which may themselves be used as therapeutics or may be used to localize one or more therapeutic agents (e.g. a chemotherapeutic, a radiotherapeutic, genetic material, etc.) to KDR expressing cells, including sites of angiogenesis, or those associated with a number of pathogens..
  • the invention includes heteromultimers including cMet or HGF/cMet complex binding moieties which may themselves be used as therapeutics or may be used to localize one or more therapeutic agents (e.g. a chemotherapeutic, a radiotherapeutic, genetic material, etc.) to cMet expressing cells, including tumors, sites of hyperproliferation or sites of angiogenesis.
  • therapeutic agents e.g. a chemotherapeutic, a radiotherapeutic, genetic material, etc.
  • the heteromultimeric constructs of the present invention are particularly useful as therapeutic agents for treating conditions that involve endothelial cells.
  • an important function of endothelial cells is angiogenesis, or the formation of blood vessels
  • the heteromultimers of the invention are particularly useful for treating conditions that involve angiogenesis include, for example, solid tumors, tumor metastases and benign tumors.
  • tumors and related disorders are well known in the art and include, for example, melanoma, central nervous system tumors, neuroendocrine tumors, sarcoma, multiple myeloma as well as cancer of the breast, lung, prostate, colon, head & neck, and ovaries. Additional tumors and related disorders are listed in Table 1 of U.S. Patent No.
  • Benign tumors include, for example, hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas.
  • Other relevant diseases that involve angiogenesis include for example, rheumatoid arthritis, psoriasis, and ocular disease, such as diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasias, rebeosis, Osler-Webber syndrome, myocardial angiogenesis, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma and wound granulation.
  • heteromultimers of the present invention can be used to reduce or prevent uterine neovascularization required for embryo implantation, for example, as a birth control agent.
  • a heteromultimer according to the invention can be detectably labeled, e.g., fluorescently labeled, enzymatically labeled, or labeled with a radionuclide or paramagnetic metal or attached to bubbles, then contacted with the solution, and thereafter formation of a complex between the heteromultimer and the target can be detected.
  • a fluorescently labeled KDR or VEGF/KDR complex binding heteromultimeric construct may be used for in vitro KDR or VEGF/KDR complex detection assays, wherein the heteromultimeric construct is added to a solution to be tested for KDR or VEGF/KDR complex under conditions allowing binding to occur.
  • the complex between the fluorescently labeled KDR or VEGF/KDR complex binding heteromultimer and KDR or VEGF/KDR complex target can be detected and quantified by measuring the increased fluorescence polarization arising from the KDR or VEGF/KDR complex-bound heteromultimer relative to that of the free heteromultimer.
  • Heteromultimers comprising cMet binding moieties may be used similarly.
  • a sandwich-type "ELISA" assay may be used, wherein a heteromultimeric construct is immobilized on a solid support such as a plastic tube or well, then the solution suspected of containing the target is contacted with the immobilized heteromultimeric construct, non-binding materials are washed away, and complexed target is detected using a suitable detection reagent, such as a monoclonal antibody recognizing the target.
  • a suitable detection reagent such as a monoclonal antibody recognizing the target.
  • the monoclonal antibody is detectable by conventional means known in the art, including being detectably labeled, e.g., radiolabeled, conjugated with an enzyme such as horseradish peroxidase, or fluorescently labeled.
  • heteromultimers of the invention can be immobilized on a solid substrate such as a chromatographic support or other matrix material, then the immobilized heteromultimer can be loaded or contacted with the solution under conditions suitable for formation of a heteromultimer:target complex.
  • the non-binding portion of the solution can be removed and the complex may be detected, e.g., using an antibody against the target, such as an anti-binding polypeptide antibody (e.g., anti-KDR, anti-VEGF/KDR complex, anti-cMet, or anti-cMet/HGF complex antibody), or the heteromultimer:target complex may be released from the binding moiety at appropriate elution conditions.
  • an anti-binding polypeptide antibody e.g., anti-KDR, anti-VEGF/KDR complex, anti-cMet, or anti-cMet/HGF complex antibody
  • heteromultimeric constructs of the present invention may be used in in vivo diagnostic applications to image specific tissues or cellular disorders.
  • a particularly preferred use for the heteromultimeric constructs according to the present invention is for creating visually readable images of target expressing or containing tissue.
  • the heteromultimers of the invention are conjugated with a label appropriate for diagnostic detection, optionally via a linker Suitable linkers can be substituted or unsubstituted alkyl chains, amino acid chains (e.g., polyglycine), polyethylene glycols, polyamides, and other simple polymeric linkers known in the art.
  • heteromultimers of the invention may be conjugated with or without a linker to a paramagnetic chelate suitable for magnetic resonance imaging (MRI), with a radiolabel suitable for x-ray, PET or scintigrapic imaging (including if necessary a chelator, such as those described herein, for a radioactive metal) with an ultrasound contrast agent (e.g. a stabilized microbubble, a microballoon, a microsphere or what has been referred to as a gas filled "liposome”) suitable for ultrasound detection, or with an optical imaging dye.
  • MRI magnetic resonance imaging
  • KDR or VEGF/KDR complex binding heteromultimeric constructs of the invention or cMet or HGF complex binding heteromultimeric constructs of the invention may be used to image neoplastic tumors, which require angiogenesis for survival and metastasis, or other sites of angiogenic activity.
  • heteromultimeric constructs including KDR and VEGF/KDR complex binding polypeptides or cMet or HGF/cMet complex binding polypeptides are converted to imaging reagents by conjugation with a label appropriate for diagnostic detection, optionally via a linker, as described herein.
  • the technique of using a detectably labeled heteromultimeric construct is based on the premise that the label generates a signal that is detectable outside the patient's body.
  • a detectably labeled heteromultimer of the invention when administered to the patient in which angiogenesis, e.g., due to a tumor, is occurring, the high affinity of the KDR or VEGF/KDR complex binding moieties included in the heteromultimeric constructs for KDR or VEGF/KDR complex causes the heteromultimeric construct to bind to the site of angiogenesis and accumulate label at the site of angiogenesis. Sufficient time is allowed for the labeled heteromultimeric construct to localize at the site of angiogenesis.
  • the signal generated by the labeled peptide is detected by a scanning device which will vary according to the type of label used, and the signal is then converted to an image of the site of angiogenesis.
  • heteromultimers of the invention can be conjugated with for example, avidin, biotin, or an antibody or antibody fragment that will bind the detectable label or radiotherapeutic.
  • heteromultimers can be conjugated to streptavidin or avidin for in vivo binding to target-containing or expressing cells. After the unbound heteromultimer has cleared from the body, a biotinylated detectable label or radiotherapeutic construct (e.g. a chelate molecule complexed with a radioactive metal) can be infused which will rapidly concentrate at the site where the targeting construct is bound.
  • a biotinylated detectable label or radiotherapeutic construct e.g. a chelate molecule complexed with a radioactive metal
  • This approach in some situations can reduce the time required after administering the detectable label until imaging can take place. It can also increase signal to noise ratio in the target site, and decrease the dose of the detectable label or radiotherapeutic construct required. This is particularly useful when a radioactive label or radiotherapeutic is used as the dose of radiation that is delivered to normal but radiation-sensitive sites in the body, such as bone-marrow, kidneys, and liver is decreased.
  • This approach sometimes referred to as pre-targeting or two-step, or three-step approaches was reviewed by S.F. Rosebrough (Q. J. Nucl. Med. 40:234-251; 1996 ).
  • heteromultimeric constructs including KDR or VEGF/KDR binding moieties are used.
  • heteromultimeric constructs including cMet or HGF/cMet binding moieties are used.
  • the heteromultimers of the present invention may advantageously be conjugated with one or more paramagnetic metal chelates in order to form a contrast agent for use in MRI.
  • Preferred paramagnetic metal ions have atomic numbers 21-29, 42, 44, or 57-83. This includes ions of the transition metal or lanthanide series which have one, and more preferably five or more, unpaired electrons and a magnetic moment of at least 1.7 Bohr magneton.
  • Preferred paramagnetic metals include, chromium (III), manganese (II), manganese (III), iron (II), iron (III), cobalt (II), nickel (II), copper (II), praseodymium (III), neodymium (III), samarium (III), gadolinium (III), terbium (III), dysprosium (III), holmium (III), erbium (III), europium (III) and ytterbium (III). Additionally, heteromultimers of the present invention may also be conjugated with one or more superparamagnetic particles.
  • Gd(III) is particularly preferred for MRI due to its high relaxivity and low toxicity, and the availability of only one biologically accessible oxidation state. Gd(III) chelates have been used for clinical and radiologic MR applications since 1988, and approximately 30% of MR exams currently employ a gadolinium-based contrast agent.
  • a metal according to dose required to detect target containing tisssue and considering other factors such as toxicity of the metal to the subject. See, Tweedle et al., Magnetic Resonance Imaging (2nd ed.), vol. 1, Partain et al., eds. (W.B. Saunders Co. 1988), pp. 796-7 .
  • the desired dose for an individual metal will be proportional to its relaxivity, modified by the biodistribution, pharmacokinetics and metabolism of the metal.
  • the trivalent cation, Gd 3+ is particularly preferred for MRI contrast agents, due to its high relaxivity and low toxicity, with the further advantage that it exists in only one biologically accessible oxidation state, which minimizes undesired metabolization of the metal by a patient.
  • Another useful metal is Cr 3+ , which is relatively inexpensive.
  • the paramagnetic metal chelator is a molecule having one or more polar groups that act as a ligand for, and complex with, a paramagnetic metal.
  • Suitable chelators are known in the art and include acids with methylene phosphonic acid groups, methylene carbohydroxamine acid groups, carboxyethylidene groups, or carboxymethylene groups.
  • chelators include, diethylenetriamine pentaacetic acid (DTPA), 1,4,7,10-tetraazacyclotetradeeane-1,4,7,10-tetraacetic acid (DOTA), 1-substituted 1,4,7,-tricarboxymethyl 1,4,7,10 teraazacyclododecane triacetic acid (DO3A), ethylenediaminetetraacetic acid (EDTA), and 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA).
  • DTPA diethylenetriamine pentaacetic acid
  • DOTA 1,4,7,10-tetraazacyclotetradeeane-1,4,7,10-tetraacetic acid
  • DO3A 1-substituted 1,4,7,-tricarboxymethyl 1,4,7,10 teraazacyclododecane triacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • Additional chelating ligands are ethylenebis-(2-hydroxy-phenylglycine) (EHPG), and derivatives thereof, including 5-Cl-EHPG, 5Br-EHPG, 5-Me-EHPG, 5t-Bu-EHPG, and 5sec-Bu-EHPG; benzodiethylenetriamine pentaacetic acid (benzo-DTPA) and derivatives thereof, including dibenzo-DTPA, phenyl-DTPA, diphenyl-DTPA, benzyl-DTPA, and dibenzyl DTPA; bis-2 (hydroxybenzyl)-ethylene-diaminediacetic acid (HBED) and derivatives thereof; the class of macrocyclic compounds which contain at least 3 carbon atoms, more preferably at least 6, and at least two heteroatoms (O and/or N), which macrocyclic compounds can consist of one ring, or two or three rings joined together at the hetero ring elements, e.g., benzo-DOTA, dibenzo-DOTA,
  • a preferred chelator for use in the present invention is DTPA.
  • Examples of representative chelators and chelating groups contemplated by the present invention are described in WO 98/18496 , WO 86/06605 , WO 91/03200 , WO 95/28179 , WO 96/23526 , WO 97/36619 , PCT/US98/01473 , PCT/US98/20182 , and U.S. 4,899,755 , U.S. 5,474,756 , U.S. 5,846,519 and U.S. 6,143,274 .
  • Use of the chelate DO3A is particularly preferred.
  • the chelator(s) of the MRI contrast agent is coupled to a heteromultimer, such as, for example one comprised of KDR or VEGF/KDR complex binding polypeptides or cMet or HGF/cMet complex binding polypeptides.
  • a heteromultimer such as, for example one comprised of KDR or VEGF/KDR complex binding polypeptides or cMet or HGF/cMet complex binding polypeptides.
  • the positioning of the chelate(s) should be selected so as not to interfere with the binding affinity or specificity of the heteromultimeric construct.
  • the chelate(s) will be appended either to the N-terminus or the C-terminus, however the chelate(s) may also be attached anywhere within the sequence.
  • a chelator having a free central carboxylic acid group makes it easy to attach at the N-terminus of a binding peptide by formation of an amide bond.
  • the chelate(s) could also be attached at the C-terminus with the aid of a linker.
  • isothiocyanate conjugation chemistry could be employed as a way of linking the appropriate isothiocyante group bearing DTPA to a free amino group anywhere within the peptide sequence.
  • the heteromultimer can be bound directly or covalently to the metal chelator(s) (or other detectable label), or it may be coupled or conjugated to the metal chelator(s) using a linker, which may be, amide, urea, acetal, ketal, double ester, carbonyl, carbamate, thiourea, sulfone, thioester, ester, ether, disulfide, lactone, imine, phosphoryl, or phosphodiester linkages; substituted or unsubstituted saturated or unsaturated alkyl chains; linear, branched, or cyclic amino acid chains of a single amino acid or different amino acids ( e.g., extensions of the N- or C- terminus of the binding moieties); derivatized or underivatized polyethylene glycol, polyoxyethylene, or polyvinylpyridine chains; substituted or unsubstituted polyamide chains; derivatized or underivatized polyamine, polyester, polyeth
  • the molecular weight of the linker can be tightly controlled.
  • the molecular weights can range in size from less than 100 to greater than 1000.
  • the molecular weight of the linker is less than 100.
  • biodegradable functionalities can include ester, double ester, amide, phosphoester, ether, acetal, and ketal functionalities.
  • a heteromultimer can be linked through the N- or C-terminus of a component binding moiety via an amide bond, for example, to a metal coordinating backbone nitrogen of a metal chelate or to an acetate arm of the metal chelate itself.
  • the present invention contemplates linking of the chelate(s) on any position, provided the metal chelate retains the ability to bind the metal tightly in order to minimize toxicity.
  • a component binding moiety of a heteromultimer may be modified or elongated in order to generate a locus for attachment to a metal chelate, provided such modification or elongation does not eliminate its ability to bind the target.
  • MRI contrast reagents prepared according to the disclosures herein may be used in the same manner as conventional MRI contrast reagents.
  • certain MR techniques and pulse sequences may be preferred to enhance the contrast of the site to the background blood and tissues.
  • These techniques include, for example, black blood angiography sequences that seek to make blood dark, such as fast spin echo sequences (see, e.g., Alexander et al., Magnetic Resonance in Medicine, 40(2): 298-310 (1998 )) and flow-spoiled gradient echo sequences (see, e.g., Edelman et al., Radiology, 177(1): 45-50 (1990 )).
  • the labeled reagent is administered to the patient in the form of an injectable composition.
  • the method of administering the MRI contrast agent is preferably parenterally, meaning intravenously, intraarterially, intrathecally, interstitially, or intracavitarilly.
  • intravenous or intraarterial administration is preferred.
  • the subject will receive a dosage of contrast agent sufficient to enhance the MR signal at the target (e.g. a site of angiogenesis) at least 10%.
  • the target e.g. a site of angiogenesis
  • the patient is scanned in the MRI machine to determine the location of any sites containing the target.
  • a cytotoxic or therapeutic agent can be immediately administered, if necessary, and the patient can be subsequently scanned to visualize the therapeutic effect.
  • heteromultimers including KDR or VEGF/KDR complex binding moieties are conjugated to one or more paramagnetic metal chelates or one or more superparamagnetic particles, optionally via a linker.
  • heteromultimeric constructs including cMet or HGF/cMet complex binding moieties are used. Such heteromultimeric constructs are complexed with one or more paramagnetic metal and adminitered in a dose sufficient to enhance the MR signal at the site of angiogenesis at least 10%. After injection, the patient is scanned to determine the location of any sites of angiogenesis (e.g. angiogenic tumors, etc.) or hyperproliferative tissue.
  • an anti-angiogenic or tumoricidal agent such as, for example, an inhibitor of VEGF (or VEGF activation of KDR) may be administered. If necessary, the patient may be scanned again to visualize/track the tumor regression, arrest of angiogenesis, etc.
  • Ultrasound contrast agents are intense sound wave reflectors because of the acoustic differences between the agent and the surrounding tissue.
  • Gas containing or gas generating ultrasound contrast agents are particularly useful because of the acoustic difference between liquid (e.g., blood) and the gas-containing or gas generating ultrasound contrast agent.
  • ultrasound contrast agents comprising microbubbles, microballoons, may remain for a longer time in the blood stream after injection than other detectable moieties; thus a targeted ultrasound agent may demonsrate superior imaging of tissue expressing or containing the target.
  • the heteromultimeric constructs may include a material that is useful for ultrasound imaging.
  • heteromultimers of the invention may be linked to materials employed to form vesicles (e.g., microbubbles, microballoons, microspheres, etc.), or emulsions containing a liquid or gas which functions as the detectable label (e.g., an echogenic gas or material capable of generating an echogenic gas).
  • Materials for the preparation of such vesicles include surfactants, lipids, sphingolipids, oligolipids, phospholipids, proteins, polypeptides, carbohydrates, and synthetic or natural polymeric materials. See e.g. WO 98/53857 , WO 98/18498 , WO 98/18495 , WO 98/18497 , WO 98/18496 , and WO 98/18501 .
  • phospholipids for contrast agents comprising suspensions of stabilized microbubbles (a preferred embodiment), phospholipids, and particularly saturated phospholipids are preferred.
  • the preferred gas-filled microbubbles can be prepared by means known in the art, such as, for example, by a method described in any one of the following patents: EP 554213 , US 5,413,774 , US 5,578,292 , EP 744962 , EP 682530 , US 5,556,610 , US 5,846,518 , US 6,183,725 , EP 474833 , US 5,271,928 , US 5,380,519 , US 5,531,980 , US 5,567,414 , US 5,658,551 , US 5,643,553 , US 5,911,972 , US 6,110,443 , US 6,136,293 , EP 619743 , US 5,445,813 , US 5,597,549 , US 5,686,060 , US 6,187,288
  • Suitable phospholipids include esters of glycerol with one or two molecules of fatty acids (the same or different)and phosphoric acid, wherein the phosphoric acid residue is in turn bonded to a hydrophilic group, such as choline, serine, inositol, glycerol, ethanolamine.
  • Fatty acids present in the phospholipids are in general long chain aliphatic acids, typically containing from 12 to 24 carbon atoms, preferably from 14 to 22, that may be saturated or may contain one or more unsaturations.
  • Suitable fatty acids are lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, oleic acid, linoleic acid, and linolenic acid.
  • Mono esters of phospholipid are also known in the art as the "lyso" forms of the phospholipids.
  • phospholipids are phosphatidic acids, i.e. the diesters of glycerol-phosphoric acid with fatty acids, sphingomyelins, i.e. those phosphatidylcholine analogs where the residue of glycerol diester with fatty acids is replaced by a ceramide chain, cardiolipins, i.e. the esters of 1,3-diphosphatidylglycerol with a fatty acid, gangliosides, cerebrosides, etc.
  • phospholipids includes either naturally occurring, semisynthetic or synthetically prepared products that can be employed either singularly or as mixtures.
  • phospholipids examples include natural lecithins (phosphatidylcholine (PC) derivatives) such as, typically, soya bean or egg yolk lecithins.
  • PC phosphatidylcholine
  • semisynthetic phospholipids are the partially or fully hydrogenated derivatives of the naturally occurring lecithins.
  • Examples of synthetic phospholipids are e.g., dilauryloyl-phosphatidylcholine ("DLPC”), dimyristoylphosphatidylcholine (“DMPC”), dipalmitoyl-phosphatidylcholine (“DPPC”), diarachidoylphosphatidylcholine (“DAPC”), distearoyl-phosphatidylcholine (“DSPC”), 1-myristoyl-2-palmitoylphosphatidylcholine (“MPPC”), 1-palmitoyl-2-myristoylphosphatidylcholine (“PMPC”), 1-palmitoyl-2-stearoylphosphatid-ylcholine (“PSPC”), 1-stearoyl-2-palmitoyl-phosphatidylcholine (“SPPC”), dioleoylphosphatidylycholine (“DOPC”), 1,2 Distearoyl-sn-glycero-3-Ethylphosphocholine (Ethyl-
  • compositions may also contain PEG-4000 and/or palmitic acid. Any of the gases disclosed herein or known to the skilled artisan may be employed; however, inert gases, such as SF 6 , or fluorocarbons, such as CF 4 , C 3 F 8 and C 4 F 10 , are preferred.
  • the preferred microbubble suspensions may be prepared from phospholipids using known processes such as a freeze-drying or spray-drying solutions of the crude phospholipids in a suitable solvent or using the processes set forth in EP 554213 , US 5,413,774 , US 5,578,292 , EP 744962 , EP 682530 , US 5,556,610 , US 5,846,518 , US 6,183,725 , EP 474833 , US 5,271,928 , US 5,380,519 , US 5,531,980 , US 5,567,414 , US 5,658,551 , US 5,643,553 , US 5,911,972 , US 6,110,443 , US 6,136,293 , EP 619743 , US 5,445,813 , US 5,597,549 , US 5,686,060 , US 6,187,288 , and US 5,908,610 .
  • the phospholipids are dissolved in an organic solvent and the solution is dried without going through a liposome formation stage.
  • This can be done by dissolving the phospholipids in a suitable organic solvent together with a hydrophilic stabilizer substance or a compound soluble both in the organic solvent and water and freeze-drying or spray-drying the solution.
  • the criteria used for selection of the hydrophilic stabilizer is its solubility in the organic solvent of choice.
  • hydrophilic stabilizer compounds soluble in water and the organic solvent are e.g. a polymer, like polyvinyl pyrrolidone (PVP), polyvinyl alcohol (PVA), polyethylene glycol (PEG), etc., malic acid, glycolic acid, maltol and the like.
  • Such hydrophilic compounds also aid in homogenizing the microbubbles size distribution and enhance stability under storage.
  • Any suitable organic solvent may be used as long as its boiling point is sufficiently low and its melting point is sufficiently high to facilitate subsequent drying.
  • Typical organic solvents include, for example, dioxane, cyclohexanol, tertiary butanol, tetrachlorodifluoro ethylene (C 2 Cl 4 F 2 ) or 2-methyl-2-butanol however, 2-methyl-2-butanol and C 2 Cl 4 F 2 are preferred.
  • the freeze-dried or spray-dried phospholipid powders Prior to formation of the suspension of microbubbles by dispersion in an aqueous carrier, the freeze-dried or spray-dried phospholipid powders are contacted with air or another gas. When contacted with the aqueous carrier the powdered phospholipids whose structure has been disrupted will form lamellarized or laminarized segments that will stabilize the microbubbles of the gas dispersed therein.
  • This method permits production of suspensions of microbubbles that are stable even when stored for prolonged periods and are obtained by simple dissolution of the dried laminarized phospholipids (which have been stored under a desired gas) without shaking or any violent agitation.
  • microbubbles can be prepared by suspending a gas into an aqueous solution at high agitation speed, as disclosed e.g. in WO 97/29783 .
  • a further process for preparing microbubbles is disclosed in co-pending European patent application no. 03002373 , which comprises preparing an emulsion of an organic solvent in an aqueous medium in the presence of a phospholipid and subsequently lyophilizing said emulsion, after optional washing and/or filtration steps.
  • non-film forming surfactants including polyoxypropylene glycol and polyoxyethylene glycol and similar compounds, as well as various copolymers thereof; fatty acids such as myristic acid, palmitic acid, stearic acid, arachidic acid or their derivatives, ergosterol, phytosterol, sitosterol, lanosterol, tocopherol, propyl gallate, ascorbyl palmitate and butylated hydroxytoluene may be added.
  • the amount of these non-film forming surfactants is usually up to 50% by weight of the total amount of surfactants but preferably between 0 and 30% by weight.
  • gas containing suspensions include those disclosed in, for example, US 5,798,091 and WO 97/29783 . These agents may be prepared as described in US 5,798,091 or WO97/29783 .
  • microballoon refers to gas filled bodies with a material boundary or envelope. More on microballoon formulations and methods of preparation may be found in EP-A-0 324 938 US 4,844,882 ; US 5,711,933 ; US 5,840,275 ; US 5,863,520 ; US 6,123,922 ; US 6,200,548 ; US 4,900,540 ; US 5,123,414 ; US 5,230,882 ; 5,469,854 ; 5,585,112 ; US 4,718,433 ; US 4774,958 ; WO 9501187 ; US 5,529,766 ; US 5,536,490 and US 5,990,263 .
  • the preferred microballoons have an envelope including a biodegradable physiologically compatible polymer or, a biodegradable solid lipid.
  • the polymers useful for the preparation of the microballoons of the present invention can be selected from the biodegradable physiologically compatible polymers, such as any of those described in any of the following patents: EP 458745 , US 5,711,933 , US 5,840,275 , EP 554213 , US 5,413,774 and US 5,578,292 .
  • the polymer can be selected from biodegradable physiologically compatible polymers, such as polysaccharides of low water solubility, polylactides and polyglycolides and their copolymers, copolymers of lactides and lactones such as ⁇ -caprolactone, ⁇ -valerolactone and polypeptides.
  • biodegradable physiologically compatible polymers such as polysaccharides of low water solubility, polylactides and polyglycolides and their copolymers, copolymers of lactides and lactones such as ⁇ -caprolactone, ⁇ -valerolactone and polypeptides.
  • suitable polymers include poly(ortho)esters (see e.g ., US 4,093,709 ; US 4,131,648 ; US 4,138,344 ; US 4,180,646 ); polylactic and polyglycolic acid and their copolymers, for instance DEXON (see J.
  • microballoons of the present invention can also be prepared according to the methods of WO-A-96/15815 , where the microballoons are made from a biodegradable membrane comprising biodegradable lipids, preferably selected from mono- di-, tri-glycerides, fatty acids, sterols, waxes and mixtures thereof.
  • biodegradable lipids preferably selected from mono- di-, tri-glycerides, fatty acids, sterols, waxes and mixtures thereof.
  • Preferred lipids are di- or tri-glycerides, e.g. di- or tri-myristin, - palmityn or -stearin, in particular tripalmitin or tristearin.
  • microballoons may employ any of the gases disclosed herein or known to the skilled artisan; however, inert gases such as fluorinated gases are preferred.
  • the microballoons may be suspended in a pharmaceutically acceptable liquid carrier with optional additives known to those of ordinary skill in the art and stabilizers.
  • gas-containing contrast agent formulations include microparticles (especially aggregates of microparticles) having gas contained therein or otherwise associated therewith (for example being adsorbed on the surface thereof and/or contained within voids, cavities or pores therein).
  • Methods for the preparation of these agents are as described in EP 0122624 , EP 0123235 , EP 0365467 , US 5,558,857 , US 5,607,661 , US 5,637,289 , US 5,558,856 , US 5,137,928 , WO 9521631 and WO 9313809 .
  • any of these ultrasound compositions should also be, as far as possible, isotonic with blood.
  • small amounts of isotonic agents may be added to any of above ultrasound contrast agent suspensions.
  • the isotonic agents are physiological solutions commonly used in medicine and they comprise aqueous saline solution (0.9% NaCl), 2.6% glycerol solution, 5% dextrose solution, etc.
  • the ultrasound compositions may include standard pharmaceutically acceptable additives, including, for example, emulsifying agents, viscosity modifiers, cryoprotectants, lyoprotectants, bulking agents etc.
  • gas includes any substances (including mixtures) substantially in gaseous form at the normal human body temperature.
  • the gas may thus include, for example, air; nitrogen; oxygen; CO 2 ; argon; xenon or krypton, fluorinated gases (including for example, perfluorocarbons, SF 6 , SeF 6 ) a low molecular weight hydrocarbon (e.g.
  • Fluorinated gases include materials which contain at least one fluorine atom such as SF 6 , freons (organic compounds containing one or more carbon atoms and fluorine, i.e.
  • perfluorocarbon refers to compounds containing only carbon and fluorine atoms and includes, in particular, saturated, unsaturated, and cyclic perfluorocarbons.
  • the saturated perfluorocarbons which are usually preferred, have the formula C n F n+2 , where n is from 1 to 12, preferably from 2 to 10, most preferably from 3 to 8 and even more preferably from 3 to 6.
  • Suitable perfluorocarbons include, for example, CF 4 , C 2 F 6 , C 3 F 8 , C 4 F 8 , C 4 F 10 , C 5 F 12 , C 6 F 12 , C 7 F 14 , C 8 F 18 , and C 9 F 20 .
  • the gas or gas mixture comprises SF 6 or a perfluorocarbon selected from the group consisting of C 3 F 8 C 4 F 8 , C 4 F 10 , C 5 F 12 , C 6 F 12 , C 7 F 14 , C 8 F 18 , with C 4 F 10 being particularly preferred.
  • a precursor to a gaseous substance e.g. a material that is capable of being converted to a gas in vivo, often referred to as a "gas precursor"
  • gas precursor e.g. a material that is capable of being converted to a gas in vivo
  • the gas precursor and the gas it produces are physiologically acceptable.
  • the gas precursor may be pH-activated, photo-activated, temperature activated, etc.
  • certain perfluorocarbons may be used as temperature activated gas precursors. These perfluorocarbons, such as perfluoropentane, have a liquid/gas phase transition temperature above room temperature (or the temperature at which the agents are produced and/or stored) but below body temperature; thus, they undergo a phase shift and are converted to a gas within the human body.
  • the gas can include a mixture of gases.
  • the following combinations are particularly preferred gas mixtures: a mixture of gases (A) and (B) in which, at least one of the gases (B), present in an amount of between 0.5 - 41% by vol., has a molecular weight greater than 80 daltons and is a fluorinated gas and (A) is selected from the group consisting of air, oxygen, nitrogen, carbon dioxide and mixtures thereof, the balance of the mixture being gas A.
  • ultrasound vesicles may be larger than the other detectable labels described herein, they may be linked or conjugated to a plurality of heteromultimeric constructs in order to increase the targeting efficiency of the agent.
  • Attachment to the ultrasound contrast agents described above may be via direct covalent bond between a binding polypeptide and the material used to make the vesicle or via a linker, as described previously.
  • WO 98/53857 generally for a description of the attachment of a peptide to a bifunctional PEG linker, which is then reacted with a liposome composition. See also, Lanza et al., Ultrasound in Med. & Bio., 23(6): 863-870 (1997 ).
  • a number of methods may be used to prepare suspensions of microbubbles conjugated to heteromultimers. For example, one may prepare maleimide-derivatized microbubbles by incorporating 5 % (w/w) of N-MPB-PE (1, 2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-4-(p-maleimido-phenyl butyramide), (Avanti Polar-Lipids, Inc) in the phospholipid formulation.
  • N-MPB-PE 1-, 2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-4-(p-maleimido-phenyl butyramide), (Avanti Polar-Lipids, Inc)
  • solutions of mercaptoacetylated heteromultimers (10 mg/mL in DMF), which have been incubated in deacetylation solution (50 mM sodium phosphate, 25 mM EDTA, 0.5 M hydroxylamine HCl, pH 7.5) are added to the maleimide-activated microbubble suspension. After incubation in the dark, under gentle agitation, the heteromultimer conjugated microbubbles may be purified by centrifugation.
  • Compounds that can be used for derivatization of microbubbles typically include the following components: (a) a hydrophobic portion, compatible with the material forming the envelope of the microbubble or of the microballoon, in order to allow an effective incorporation of the compound in the envelope of the vesicel; said portion is represented typically by a lipid moiety (dipalmitin, distearoyl); and (b) a spacer (typically PEGs of different molecular weights), which may be optional in some cases (microbubbles may for instance present difficulties to be freeze dried if the spacer is too long e.g) or preferred in some others (e.g.
  • peptides may be less active when conjugated to a microballoon with short spacers); and (c) a reactive group capable of reacting with a corresponding reacting moiety on the peptide to be conjugated (e.g. maleimido with the -SH group of cysteine).
  • a reactive group capable of reacting with a corresponding reacting moiety on the peptide to be conjugated e.g. maleimido with the -SH group of cysteine
  • heteromultimers conjugated to microbubbles may be prepared using biotin/avidin.
  • biotin/avidin for example, avidin-conjugated microbubbles may be prepared using a maleimide-activated phospholipid microbubble suspension, prepared as described above, which is added to mercaptoacetylated-avidin (which has been incubated with deacetylation solution). Biotinylated heteromultimers (prepared as described herein), are then added to the suspension of avidin-conjugated microbubbles, yielding a suspension of microbubbles conjugated to the heteromultimers.
  • the lyophilized residue may be stored and transported without need of temperature control of its environment and in particular it may be supplied to hospitals and physicians for on site formulation into a ready-to-use administrable suspension without requiring such users to have special storage facilities.
  • it can be supplied in the form of a two-component kit, which can include two separate containers or a dual-chamber container.
  • the container is a conventional septum-sealed vial, wherein the vial containing the lyophilized residue of step b) is sealed with a septum through which the carrier liquid may be injected using an optionally prefilled syringe.
  • the syringe used as the container of the second component is also used then for injecting the contrast agent.
  • the dual-chamber container is a dual-chamber syringe and once the lyophilizate has been reconstituted and then suitably mixed or gently shaken, the container can be used directly for injecting the contrast agent.
  • the size of the gas microbubbles is substantially independent of the amount of agitation energy applied to the reconstituted dried product. Accordingly, no more than gentle hand shaking is generally required to give reproducible products with consistent microbubble size.
  • aqueous phase can be interposed between the water-insoluble gas and the environment, to increase shelf life of the product.
  • a material necessary for forming the contrast agent is not already present in the container (e.g. a targeting ligand to be linked to the phospholipid during reconstitution)
  • it can be packaged with the other components of the kit, preferably in a form or container adapted to facilitate ready combination with the other components of the kit.
  • the present invention may use conventional containers, vials and adapters.
  • the only requirement is a good seal between the stopper and the container.
  • the quality of the seal therefore, becomes a matter of primary concern; any degradation of seal integrity could allow undesirable substances to enter the vial.
  • vacuum retention is essential for products stoppered at ambient or reduced pressures to assure safe and proper reconstitution.
  • the stopper it may be a compound or multicomponent formulation based on an elastomer, such as poly(isobutylene) or butyl rubber.
  • Ultrasound imaging techniques which may be used in accordance with the present invention include known techniques, such as color Doppler, power Doppler, Doppler amplitude, stimulated acoustic imaging, and two- or three-dimensional imaging techniques. Imaging may be done in harmonic (resonant frequency) or fundamental modes, with the second harmonic preferred.
  • the contrast agents formed by phospholipid stabilized microbubbles may, for example, be administered in doses such that the amount of phospholipid injected is in the range 0.1 to 200 ⁇ g/kg body weight, preferably from about 0.1 to 30 ⁇ g/kg.
  • Microballoons-containing contrast agents are typically administered in doses such that the amount of wall-forming polymer or lipid is from about 10 ⁇ g/kg to about 20 mg/kg of body weight.
  • the ultrasound contrast agents described herein are conjugated to one or more heteromultimers comprised of KDR or VEGF/KDR complex binding moieties, and target tissue expressing KDR. These targeted ultrasound contrast agents will localize at sites of angiogenesis and other tissue expressing KDR and may demonstrate superior imaging of angiogenic tissue.
  • the ultrasound contrast agents described herein are conjugated to one or more heteromultimers comprised of or cMet or HGF/cMet complex binding moieties, and target tissue expressing cMet. These targeted ultrasound contrast agents will localize at sites of hyperproliferation or angiogenesis (including tumors) and other tissue expressing cMet and may demonstrate superior imaging of such tissue.
  • a number of optical parameters may be employed to determine the location of a target, such as a KDR, VEGF/KDR complex, cMet or HGF/cMet complex, with in vivo light imaging after injection of the subject with an optically-labeled heteromultimeric construct.
  • Optical parameters to be detected in the preparation of an image may include transmitted radiation, absorption, fluorescent or phosphorescent emission, light reflection, changes in absorbance amplitude or maxima, and elastically scattered radiation.
  • biological tissue is relatively translucent to light in the near infrared (NIR) wavelength range of 650-1000 nm.
  • heteromultimeric constructs comprised of KDR, VEGF/KDR complex, cMet, or HGF/cMet binding polypeptides may be used for optical imaging of KDR, VEGF/KDR complex, cMet, or HGF/cMet complex in vivo.
  • the heteromultimeric constructs of the invention may be conjugated with photolabels, such as optical dyes, including organic chromophores or fluorophores, having extensive delocalized ring systems and having absorption or emission maxima in the range of 400-1500 nm.
  • the compounds of the invention may alternatively be derivatized with a bioluminescent molecule.
  • the preferred range of absorption maxima for photolabels is between 600 and 1000 nm to minimize interference with the signal from hemoglobin.
  • photoabsorption labels have large molar absorptivities, e.g . > 10 5 cm -1 M -1 , while fluorescent optical dyes will have high quantum yields.
  • optical dyes examples include, those described in WO 98/18497 , WO 98/18496 , WO 98/18495 , WO 98/18498 , WO 98/53857 , WO 96/17628 , WO 97/18841 , WO 96/23524 , WO 98/47538 , and references cited therein.
  • the photolabels may be covalently linked directly to heteromultimers of the invention, such as, for example, heteromultimers comprised of KDR or VEGF/KDR complex binding peptides or linked to such a heteromultimers via a linker, as described previously.
  • the patient is scanned with one or more light sources (e.g., a laser) in the wavelength range appropriate for the photolabel employed in the agent.
  • the light used may be monochromatic or polychromatic and continuous or pulsed. Transmitted, scattered, or reflected light is detected via a photodetector tuned to one or multiple wavelengths to determine the location of target-containing tissue(, e.g., tissue containing KDR, VEGF/KDR complex, cMet, or HGF/cMet complex) in the subject. Changes in the optical parameter may be monitored over time to detect accumulation of the optically-labeled reagent at the target site (e.g. the site of angiogenesis). Standard image processing and detecting devices may be used in conjunction with the optical imaging reagents of the present invention.
  • optical imaging reagents described above may also be used for acousto-optical or sonoluminescent imaging performed with optically-labeled imaging agents (see, U.S. 5,171,298 , WO 98/57666 , and references therein).
  • acousto-optical imaging ultrasound radiation is applied to the subject and affects the optical parameters of the transmitted, emitted, or reflected light.
  • sonoluminescent imaging the applied ultrasound actually generates the light detected. Suitable imaging methods using such techniques are described in WO 98/57666 .
  • Heteromultimers of the invention may be conjugated with a radionuclide reporter appropriate for scintigraphy, SPECT or PET imaging or with a radionuclide appropriate for radiotherapy. Constructs in which the heteromultimers of the invention are conjugated with both a chelator for a radionuclide useful for diagnostic imaging and a chelator for a radionuclide useful for radiotherapy are within the scope of the invention.
  • a heteromultimer may be complexed with one of the various positron emitting metal ions, such as 51 Mn, 52 Fe, 60 Cu, 68 Ga, 72 As, 94m Tc, or 110 In.
  • the heteromultimeric constructs can also be labeled by halogenation using radionuclides, such as 18 F, 124 I, 125 I, 131 I, 123 I, 77 Br, and 76 Br.
  • Preferred metal radionuclides for scintigraphy or radiotherapy include 99m Tc, 51 Cr, 67 Ga, 68 Ga, 47 Sc, 51 Cr, 167 Tm, 141 Ce, 111 In, 168 Yb, 175 Yb, 140 La, 90 Y, 88 Y, 153 Sm, 166 Ho, 165 Dy, 166 Dy, 62 Cu, 64 Cu, 67 Cu, 97 Ru, 103 Ru, 186 Re, 188 Re, 203 Pb, 211 Bi, 212 Bi, 213 Bi, 214 Bi, 105 Rh, 109 Pd, 117 Sn, 149 Pm, 161 Tb, 177 Lu, 198 Au and 199 Au.
  • the preferred radionuclides include 64 Cu, 67 Ga, 68 Ga, 99m Tc, and 111 In.
  • the preferred radionuclides include 64 Cu, 90 Y, 105 Rh, 111 In, 117m Sn, 149 Pm, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 175 Yb, 177 Lu, 186/188 Re, and 199 Au.
  • 99m Tc is particularly preferred for diagnostic applications because of its low cost, availability, imaging properties, and high specific activity.
  • the nuclear and radioactive properties of Tc-99m make this isotope an ideal scintigraphic imaging agent. This isotope has a single photon energy of 140 keV and a radioactive half-life of about 6 hours, and is readily available from a 99 Mo- 99m Tc generator.
  • the metal radionuclides may be chelated by, for example, linear, macrocyclic, terpyridine, and N 3 S, N 2 S 2 , or N 4 chelants (see also, U.S. 5,367,080 , U.S. 5,364,613 , U.S. 5,021,556 , U.S. 5,075,099 , U.S. 5,886,142 ), and other chelators known in the art including, HYNIC, DTPA, EDTA, DOTA, TETA, and bisamino bisthiol (BAT) chelators (see also U.S. 5,720,934 ).
  • N 4 chelators are described in U.S. Patent Nos.
  • N 3 S chelators are described in PCT/CA94/00395 , PCT/CA94/00479 , PCT/CA95/00249 and in U.S. Patent Nos. 5,662,885 ; 5,976,495 ; and 5,780,006 .
  • the chelator may also include derivatives of the chelating ligand mercapto-acetyl-acetyl-glycyl-glycine (MAG3), which contains an N 3 S, and N 2 S 2 systems such as MAMA (monoamidemonoaminedithiols), DADS (N 2 S diaminedithiols), CODADS.
  • MAG3 chelating ligand mercapto-acetyl-acetyl-glycyl-glycine
  • MAMA monoamidemonoaminedithiols
  • DADS N 2 S diaminedithiols
  • CODADS CODADS
  • the chelator may also include complexes containing ligand atoms that are not donated to the metal in a tetradentate array. These include the boronic acid adducts of technetium and rhenium dioximes, such as are described in U.S. Patent Nos. 5,183,653 ; 5,387,409 ; and 5,118,797 .
  • disulfide bonds of a binding polypeptide of the invention are used as two ligands for chelation of a radionuclide such as 99m Tc.
  • a radionuclide such as 99m Tc.
  • Tc peptide-S-S-peptide changed to peptide-S-Tc-S-peptide.
  • the other chelating groups for Tc can be supplied by amide nitrogens of the backbone, another cystine amino acid or other modifications of amino acids.
  • Particularly preferred metal chelators include those of Formula 20, 21, and 22 (for 111 In and lanthanides such as paramagnetic Gd 3+ and radioactive lanthanides, such as, for example 177 Lu, 90 Y, 153 Sm, and 166 Ho) and those of Formula 23,24, and 25 (for radioactive 99m Tc, 186 Re, and 188 Re) set forth below.
  • These and other metal chelating groups are described in U.S. Patent Nos. 6,093,382 and 5,608,110 .
  • the chelating group of formula 22 is described in, for example, U.S. Patent No. 6,143,274 ;
  • the chelating group of formula 24 is described in, for example, U.S. Patent Nos. 5,627,286 and 6,093,382
  • the chelating group of formula 25 is described in, for example, U.S. Patent Nos. 5,662,885 ; 5,780,006 ; and 5,976,495 .
  • R is alkyl, preferably methyl.
  • X is either CH 2 or O
  • Y is either C 1 -C 10 branched or unbranched alkyl
  • Y is aryl, aryloxy, arylamino, arylaminoacyl
  • Y is arylkyl - where the alkyl group or groups attached to the aryl group are C 1 -C 10 branched or unbranched alkyl groups, C 1 -C 10 branched or unbranched hydroxy or polyhydroxyalkyl groups or polyalkoxyalkyl or polyhydroxy-polyalkoxyalkyl groups
  • the chelators may be covalently linked directly to the heteromultimers or linked to heteromultimers via a linker, as described previously, and then directly labeled with the radioactive metal of choice ( see, WO 98/52618 , U.S. 5,879,658 , and U.S. 5,849,261 ).
  • Radioactive technetium are particularly useful for diagnostic imaging and complexes of radioactive rhenium are particularly useful for radiotherapy.
  • the technetium complex preferably a salt of Tc-99m pertechnetate
  • the reagents of this invention is reacted with the reagent in the presence of a reducing agent.
  • Preferred reducing agents are dithionite, stannous and ferrous ions; the most preferred reducing agent is stannous chloride.
  • Means for preparing such complexes are conveniently provided in a kit form comprising a sealed vial containing a predetermined quantity of a reagent of the invention to be labeled and a sufficient amount of reducing agent to label the reagent with Tc-99m.
  • the complex may be formed by reacting a heteromultimer of this invention conjugated with an appropriate chelator with a pre-formed labile complex of technetium and another compound known as a transfer ligand. This process is known as ligand exchange and is well known to those skilled in the art.
  • the labile complex may be formed using such transfer ligands as tartrate, citrate, gluconate or mannitol, for example.
  • the alkali metal salts such as the sodium salt, or ammonium salts or lower alkyl ammonium salts.
  • Preparation of the complexes of the present invention where the metal is radioactive rhenium may be accomplished using rhenium starting materials in the +5 or +7 oxidation state. Examples of compounds in which rhenium is in the Re(VII) state are NH 4 ReO 4 or KReO 4 .
  • Re(V) is available as, for example, (ReOCl 4 ](NBu 4 ), [ReOCl 4 ](AsPh 4 ), ReOCl 3 (PPh 3 ) 2 and as ReO 2 (pyridine) 4 + .
  • (Ph is phenyl; Bu is n-butyl).
  • Other rhenium reagents capable of forming a rhenium complex may also be used.
  • Radioactively-labeled scintigraphic imaging agents provided by the present invention are provided having a suitable amount of radioactivity.
  • the unit dose to be administered has a radioactivity of about 0.01 mCi to about 100 mCi, preferably 1 mCi to 20 mCi.
  • the solution to be injected at unit dosage is from about 0.01 mL to about 10 mL.
  • Typical doses of a radionuclide-labeled heteromultimeric construct imaging agent of the invention provide 10-50 mCi.
  • a PET camera or a gamma camera calibrated for the gamma ray energy of the nuclide incorporated in the imaging agent is used to image areas of uptake of the agent and quantify the amount of radioactivity present in the site.
  • Imaging of the site in vivo can take place in a matter of a few minutes. However, imaging can take place, if desired, in hours or even longer, after the radiolabeled peptide is injected into a patient. In most instances, a sufficient amount of the administered dose will accumulate in the area to be imaged within about 0.1 of an hour to permit the taking of scintiphotos.
  • Radiotherapeutic compounds of the present invention are known to those skilled in the art.
  • the compounds can be administered using many methods which include, but are not limited to, a single or multiple IV or IP injections, using a quantity of radioactivity that is sufficient to cause damage or ablation of the targeted tissue, but not so much that substantive damage is caused to non-target (normal tissue).
  • the quantity and dose required is different for different constructs, depending on the energy and half-life of the isotope used, the degree of uptake and clearance of the agent from the body and the mass of the tumor.
  • doses can range from a single dose of about 30-50 mCi to a cumulative dose of up to about 3 Curies.
  • the radiotherapeutic compositions of the invention can include physiologically acceptable buffers, and can require radiation stabilizers to prevent radiolytic damage to the compound prior to injection.
  • Radiation stabilizers are known to those skilled in the art, and may include, for example, para-aminobenzoic acid, ascorbic acid, gentistic acid and the like.
  • a single, or multi-vial kit that contains all of the components needed to prepare the radiopharmaceuticals of this invention, other than the radionuclide, is an integral part of this invention.
  • a single-vial kit preferably contains a chelating ligand (if a metal radionuclide is used), a source of stannous salt (if reduction is required, e.g., when using technetium), or other pharmaceutically acceptable reducing agent, and is appropriately buffered with pharmaceutically acceptable acid or base to adjust the pH to a value of about 3 to about 9.
  • a chelating ligand if a metal radionuclide is used
  • stannous salt if reduction is required, e.g., when using technetium
  • other pharmaceutically acceptable reducing agent if the quantity and type of reducing agent used would depend highly on the nature of the exchange complex to be formed. The proper conditions are well known to those that are skilled in the art. It is preferred that the kit contents be in lyophilized form.
  • Such a single vial kit may optionally contain labile or exchange ligands such as glucoheptonate, gluconate, mannitol, malate, citric or tartaric acid and can also contain reaction modifiers such as diethylenetriamine-pentaacetic acid (DPTA), ethylenediamine tetraacetic acid (EDTA), or ⁇ , ⁇ , or ⁇ cyclodextrin that serve to improve the radiochemical purity and stability of the final product.
  • the kit may also contain stabilizers, bulking agents such as mannitol, that are designed to aid in the freeze-drying process, and other additives known to those skilled in the art.
  • a multi-vial kit preferably contains the same general components but employs more than one vial in reconstituting the radiopharmaceutical.
  • one vial may contain all of the ingredients that are required to form a labile Tc(V) complex on addition of pertechnetate (e.g. the stannous source or other reducing agent).
  • pertechnetate e.g. the stannous source or other reducing agent.
  • Pertechnetate is added to this vial, and after waiting an appropriate period of time, the contents of this vial are added to a second vial that contains the ligand, as well as buffers appropriate to adjust the pH to its optimal value. After a reaction time of about 5 to 60 minutes, the complexes of the present invention are formed. It is advantageous that the contents of both vials of this multi-vial kit be lyophilized.
  • reaction modifiers, exchange ligands, stabilizers, bulking agents, etc. may be present in either or both vials.
  • heteromultimeric constructs of the present invention can be used to improve the activity and/or efficacy of therapeutic agents by, for example, improving their affinity for or residence time at the target.
  • heteromultimers are conjugated with the therapeutic agent.
  • a liposome or bubble containing a therapeutic agent may be conjugated to heteromultimers of the invention.
  • the therapeutic agent may be a radiotherapeutic, discussed above, a drug, chemotherapeutic or tumorcidal agent, genetic material, or a gene delivery vehicle, etc.
  • the heteromultimer portion of the conjugate causes the therapeutic to "home" to the sites of target expression/localization and to improve the affinity of the conjugate for these sites, so that the therapeutic activity of the conjugate is more localized and concentrated at the target sites.
  • heteromultimers including KDR or VEGF/KDR complex binding polypeptides can be used to improve the activity of therapeutic agents (such as anti-angiogenic or tumorcidal agents) against undesired angiogenesis such as occurs in neoplastic tumors, by providing or improving their affinity for KDR or the VEGF/KDR complex and their residence time at a KDR or VEGF/KDR complex on endothelium undergoing angiogenesis.
  • therapeutic agents such as anti-angiogenic or tumorcidal agents
  • hybrid agents are provided by conjugating KDR or VEGF/KDR complex binding heteromultimers with a therapeutic agent.
  • Such heteromultimeric constructs will be useful in treating angiogenesis associated diseases, especially neoplastic tumor growth and metastasis, in mammals, including humans.
  • the method of treatment comprises administering to a mammal in need thereof an effective amount of a heteromultimeric construct comprising KDR or VEGF/KDR complex binding polypeptides conjugated with a therapeutic agent.
  • the invention also provides the use of such conjugates in the manufacture of a medicament for the treatment of angiogenesis associated diseases in mammals, including humans.
  • Heteromultimeric constructs of the invention comprising cMet or HGF/cMet complex binding moieties may be used similarly to treat disease associated with hyperproliferation or angiogenesis.
  • Suitable therapeutic agents for use in this aspect of the invention include, but are not limited to: antineoplastic agents, such as platinum compounds (e.g., spiroplatin, cisplatin, and carboplatin), methotrexate, adriamycin, mitomycin, ansamitocin, bleomycin, cytosine, arabinoside, arabinosyl adenine, mercaptopolylysine, vincristine, busulfan, chlorambucil, melphalan (e.g., PAM, a,L-PAM or phenylalanine mustard), mercaptopurine, mitotane, procarbazine hydrochloride, dactinomycin (actinomycin D), daunorubcin, hydrochloride, doxorubicin hydrochloride, taxol, mitomycin, plicamycin (mithramycin), aminoglutethimide, estramustine phosphate sodium, flutamide
  • heteromultimeric constructs target other tissue and are useful in treating other disease states the skilled artisan may substitute an appropriate therapeutic agent.
  • the heteromultimeric constructs of the present invention may also be used to target genetic material to specific cells.
  • the heteromultimeric constructs of the present invention may be used to localize genetic material to cells or tissue containing the desired target.
  • the genetic material may include nucleic acids, such as RNA or DNA, of either natural or synthetic origin, including recombinant RNA and DNA and antisense RNA and DNA.
  • Types of genetic material that may be used include, for example, genes carried on expression vectors such as plasmids, phagemids, cosmids, yeast artificial chromosomes (YACs) and defective or "helper" viruses, antigene nucleic acids, both single and double stranded RNA and DNA and analogs thereof, such as phosphorothioate and phosphorodithioate oligodeoxynucleotides. Additionally, the genetic material may be combined, for example, with lipids, proteins or other polymers.
  • Delivery vehicles for genetic material may include, for example, a virus particle, a retroviral or other gene therapy vector, a liposome, a complex of lipids (especially cationic lipids) and genetic material, a complex of dextran derivatives and genetic material, etc.
  • heteromultimeric constructs of the invention are utilized in gene therapy for treatment of diseases associated with angiogenesis.
  • genetic material, or one or more delivery vehicles containing genetic material, e.g., useful in treating an angiogenesis-related disease may be conjugated to one or more KDR or VEGF/KDR complex binding heteromultimers or cMet or HGF/cMET complex binding heteromultimers of the invention and administered to a patient.
  • Constructs including genetic material and the KDR binding heteromultimers of the invention may be used, in particular, to selectively introduce genes into angiogenic endothelial cells, which may be useful not only to treat cancer, but also after angioplasty, where inhibition of angiogenesis may inhibit restenosis.
  • Therapeutic agents and heteromultimers of the invention can be linked or fused in known ways, using the same type of linkers discussed herein.
  • Preferred linkers will be substituted or unsubstituted alkyl chains, amino acid chains, polyethylene glycol chains, and other simple polymeric linkers known in the art. More preferably, if the therapeutic agent is itself a protein, for which the encoding DNA sequence is known, the therapeutic protein and a binding polypeptide of the invention may be coexpressed from the same synthetic gene, created using recombinant DNA techniques, as described above.
  • the coding sequence for a binding polypeptide may be fused in frame with that of the therapeutic protein, such that the peptide is expressed at the amino- or carboxy-terminus of the therapeutic protein, or at a place between the termini, if it is determined that such placement would not destroy the required biological function of either the therapeutic protein or the binding polypeptide.
  • a particular advantage of this general approach is that concatamerization of multiple, tandemly arranged binding polypeptides is possible, thereby increasing the number and concentration of binding sites associated with each therapeutic protein. In this manner binding peptide avidity is increased which would be expected to improve the efficacy of the recombinant therapeutic fusion protein.
  • Similar recombinant proteins containing one or more coding sequences for a binding polypeptide may be useful in imaging or therapeutic applications.
  • the coding sequence for a KDR, VEGF/KDR complex, cMet, or HGF/cMet binding peptide may be fused in frame to a sequence encoding an antibody (or an antibody fragment or recombinant DNA construct including an antibody, etc.) which, for example, binds to a chelator for a radionuclide (or another detectable label).
  • the antibody expressing the KDR, VEGF/KDR complex, cMet, or HGF/cMet binding polypeptide is then administered to a patient and allowed to localize and bind to KDR- or cMet-expressing tissue.
  • the chelator-radionuclide complex or other detectable label
  • the coding sequence for a binding peptide may be fused in frame to a sequence encoding, for example, serum proteins or other proteins that produce biological effects (such as apoptosis, coagulation, internalization, differentiation, cellular stasis, immune system stimulation or suppression, or combinations thereof).
  • the resulting recombinant proteins are useful in imaging, radiotherapy, and therapies directed against cancer and other diseases that involve angiogenesis or diseases associated with the pathogens discussed herein.
  • heteromultimers of the present invention may themselves be used as therapeutics to treat a number of diseases.
  • a protein or other molecule e.g. a growth factor, hormone etc.
  • heteromultimers including such binding moieties may be useful as therapeutics.
  • binding of a binding moiety itself inhibits a disease process heteromultimers containing such binding moieties may also be useful as therapeutics.
  • heteromultimers including KDR or VEGF/KDR complex binding polypeptides that inhibit the binding or inhibit VEGF to KDR (or otherwise inhibit activation of KDR) may be used as anti-angiogenic agents.
  • Certain heteromultimers of the invention that inhibit activation of KDR are discussed in the Examples.
  • a particularly preferred heteromultimer is the heterodimer-containing construct D1 (structure shown below in Example 9).
  • Other preferred heterodimer constructs include D4, D5, and D6 (structures provided in Examples 9 and 15 below).
  • heteromultimers may be useful in the treatment of cancer or other diseases associated with inappropriate or excessive angiogenesis, such as, for example arthritis and atherosclerotic plaques, trachoma, corneal graft neovascularization, psoriasis, sleroderma, hemangioma and hypertrophic scarring, vascular adhesions, angiofibroma, and ocular diseases, such as diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rebeosis, Osler-Webber Syndrome, myocardial angiogenesis, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma and wound granulation.
  • angiogenesis such as, for example arthritis and atherosclerotic plaques, trachoma, corneal graft neovascularization, psorias
  • tumors and related disorders include, for example, melanoma, central nervous system tumors, neuroendocrine tumors, sarcoma, multiple myeloma as wells as cancer of the breast, lung, prostate, colon, head & neck, and ovaries. Additional tumors and related disorders are listed in Table I of U.S. Patent No. 6,025,331, issued February 15, 2000 to Moses, et al. Benign tumors include, for example, hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas.
  • heteromultimers of the present invention can be used to reduce or prevent uterine neovascularization required for embryo implantation, for example, as a birth control agent.
  • Heteromultimers of this invention can also be useful for treating vascular permeability events that can result when VEGF binds KDR.
  • vascular permeability events that can result when VEGF binds KDR.
  • anti-VEGF antibodies can reverse damage and in a similar way the compounds of the invention can reverse renal permeability pathogenesis in, for example, diabetes.
  • the heteromultimers include cMet or HGF/cMet complex binding polypeptides that inbhit the binding of cMet to HGF (or otherwise inhibit the activation of cMet) may be used to treat tumors and other hyperproliferative disorders.
  • Particular heteromultimers that inhibit cMet are discussed in the Examples.
  • a preferred heteromultimer is D28 (structure shown below in Example 9).
  • heteromultimers of the present invention may be useful in treating diseases associated with certain pathogens, including, for example, malaria, HIV, SIV, Simian hemorrhagic fever virus, etc.
  • Sequence homology searches of KDR-binding peptides identified by phage display using the BLAST program at NCBI has identified a number of homologous proteins known or expected to be present on the surface of pathogenic organisms. Homologies were noted between KDR and VEGF/KDR complex binding polypeptides and proteins from various malaria strains, HIV, SIV, simian hemorrhagic fever virus, and an enterohemorrhagic E. coli strain.
  • homologous proteins such as PfEMP1 and EBL-1
  • hypermutable adhesion proteins known to play roles in virulence. These proteins possess multiple binding sites that are capable of binding to more than one target molecule on the host's surface. Their high mutation and recombination rates allow them to quickly develop new binding sites to promote survival and/or invasion.
  • proteins such as gp120 of HIV which also has homology to some of the KDR-binding peptides disclosed herein
  • heteromultimeric constructs including the KDR-binding peptide sequences disclosed herein may have usefulness in blocking infection with the pathogen species that possesses the homology. Indeed, a strategy is being employed to block HIV infection by trying to prevent virus envelope proteins from binding to their known cellular surface targets such as CD4. Howie SE, et al., FASEB J 1998 Aug; 12(11):991-8, "Synthetic peptides representing discontinuous CD4 binding epitopes of HIV-1 gp120 that induce T cell apoptosis and block cell death induced by gp120. " Thus, KDR may represent a previously unknown target for a number of pathogens and the heteromultimeric constructs including KDR or VEGF/KDR complex binding peptides may be useful in treating the diseases associated with these pathogens.
  • the compounds may be administered by any convenient route customary for therapeutic agents, for example parenterally, enterally or intranasaly, and preferably by infusion or bolus injection, or by depot or slow release formulation.
  • the composition may be formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • compositions include, sterile water, saline solution, buffered saline (including buffers like phosphate or acetate), alcohol, vegetable oils, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, paraffin, etc.
  • the composition may also include a solubilizing agent and a local anaesthetic such as lidocaine to ease pain at the site of the injection, preservatives, stabilizers, wetting agents, emulsifiers, salts, lubricants, etc. as long as they do not react deleteriously with the active compounds.
  • the composition may comprise conventional excipients, i.e.
  • the ingredients will be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent in activity units.
  • a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent in activity units.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade "water for injection" or saline.
  • an ampoule of sterile water for injection or saline may be provided so that the ingredients may be mixed prior to administration.
  • the quantity of material administered will depend on the seriousness of the condition. For example, for treatment of anangiogenic condition, e.g ., in the case of neoplastic tumor growth, the position and size of the tumor will affect the quantity of material to be administered.
  • the precise dose to be employed and mode of administration must per force in view of the nature of the complaint be decided according to the circumstances by the physician supervising treatment.
  • dosages of the heteromultimer/therapeutic agent conjugate will follow the dosages that are routine for the therapeutic agent alone, although the improved affinity of a heteromultimer of the invention for its target may allow a decrease in the standard dosage.
  • Such conjugate pharmaceutical compositions are preferably formulated for parenteral administration, and most preferably for intravenous or intra-arterial administration.
  • pharmaceutical compositions may be given as a bolus, as two or more doses separated in time, or as a constant or non-linear flow infusion.
  • the hetermultimers can be administered to an individual over a suitable time course depending on the nature of the condition and the desired outcome.
  • the heteromultimeric constructs can be administered prophylactically, e.g ., before the condition is diagnosed or to an individual predisposed to a condition.
  • the heteromultimers of the invention can be administered while the individual exhibits symptoms of the condition or after the symptoms have passed or otherwise been relieved (such as after removal of a tumor).
  • the heteromultimers of the present invention can be administered a part of a maintenance regimen, for example to prevent or lessen the recurrence or the symptoms or condition.
  • the heteromultimers of the present invention can be administered systemically or locally.
  • the term "therapeutic" includes at least partial alleviation of symptoms of a given condition.
  • the heteromultimeric constructs of the present invention do not have to produce a complete alleviation of symptoms to be useful.
  • treatment of an individual can result in a decrease in the size of a tumor or diseased area, or prevention of an increase in size of the tumor or diseased area or partial alleviation of other symptoms.
  • Treatment can result in reduction in the number of blood vessels in an area of interest or can prevent an increase in the number of blood vessels in an area of interest. Treatment can also prevent or lessen the number or size of metastic outgrowths of the main tumor(s).
  • symptoms that can be alleviated include physiological characteristics such as VEGF receptor activity and migration ability of endothelial cells.
  • the heteromultimers of the present invention can inhibit activity of VEGF receptors, including VEGF-2/KDR, VEGF-1/Flt-1 and VEGF-3/Flt-4. Such inhibition can also be detected, for example, by measuring the phosphorylation state of the receptor in the presence of or after treatment with the binding polypeptides or constructs thereof. Based on the teachings provided herein, one of ordinary skill in the art would know how and be able to administer a suitable dose of binding polypeptide or construct thereof as provided herein and measured before and after treatment.
  • the phosphorylation state of the relevant receptor, or the migration ability of endothelial in an area of interest can be measured in samples taken from the individual.
  • the VEGF receptors or endothelial cells can be isolated from the sample and used in assays described herein.
  • the dosage of the heteromultimers may depend on the age, sex, health, and weight of the individual, a well as the nature of the condition and overall treatment regimen.
  • the biological effects of the multimers are described herein. Therefore, based on the biological effects of the heteromultimers provided herein, and the desired outcome of treatment, the referred dosage is determinable by one of ordinary skill in the art through route optimization procedures.
  • the daily regiment is in the range of about 0.1 ⁇ g/kg to about 1 mg/kg.
  • heteromultimers provided herein can be administered as the sole active ingredient together with a pharmaceutically acceptable excipient, or can be administered together with other binding polypeptides and constructs thereof, other therapeutic agents, or combination thereof.
  • the heteromultimers can be conjugated to therapeutic agents, for example, to improve specificity, residence time in the body, or therapeutic effect.
  • therapeutic agents include, for example, other antiangiogenic compounds, and tumoricidal compounds.
  • the therapeutic agent can also include antibodies.
  • heteromultimers of the present invention can be used as an endothelial cell homing device. Therefore, the heteromultimeric constructs can be conjugated to nucleic acids encoding, for example, a therapeutic polypeptide, in order to target the nucleic acid to endothelial cells. Once exposed to the nucleic acid, thereby delivering the therapeutic peptide to the target cells.
  • the therapeutic agent can be associated with an ultrasound contrast agent composition, said ultrasound contrast agent including the KDR, VEGF/KDR complex, cMet, or HGF/cMet binding peptides of the invention linked to the material employed to form the vesicles (particularly microbubbles or microballoons) comprised in the contrast agent, as previously described.
  • said contrast agent/therapeutic agent association can be carried out as described in US 6,258,378 .
  • the pathogenic site can be irradiated with an energy beam (preferably ultrasonic, e.g. with a frequency of from 0.3 to 3 MHz), to cause the bursting of microvesicles, as disclosed for instance in the above cited U.S. Patent No. 6,258,378 .
  • an energy beam preferably ultrasonic, e.g. with a frequency of from 0.3 to 3 MHz
  • the therapeutic effect of the therapeutic agent can thus be advantageously enhanced by the energy released by the burst of the microvesicles, in particular causing an effective delivery of the therapeutic agent to the targeted pathogenic site.
  • the heteromultimers can be administered by any suitable route. Suitable routes of administration include, topical application, transdermal, parenteral, gastrointestinal, intravaginal, and transalvcolar. Compositions for the desired route of administration can be prepared by any of the methods well known in the pharmaceutical arts. Details concerning dosages, dosage forms, modes of administration, composition and the like are further discussed in a standard pharmaceutical text, such as Remington's Pharmaceutical Sciences, 18th ed., Alfonso R. Gennaro, ed. (Mack Publishing Co., Easton, PA 1990 ).
  • the heteromultimers can be suspended, for example, in a cream, gel or rinse which allows the polypeptides or constructs to penetrate the skin and enter the blood stream, for systemic delivery, or contact the are of interest, for localized delivery.
  • compositions suitable for topical application include any pharmaceutically acceptable base in which the polypeptides are at least minimally soluble.
  • the heteromultimers can be applied in pharmaceutically acceptable suspension together with a suitable transdermal device or "patch."
  • suitable transdermal devices for administration of the heteromultimers of the present invention are described, for example, in U.S. Patent No. 6,165,458, issued December 26, 2000 to Foldvari, et al. , and U.S. Patent No. 6,274,166B1, issued August 4, 2001 to Sintov, et al.
  • the heteromultimers can be suspended, for example, in a pharmaceutically acceptable sterile isotonic solution, such as saline and phosphate buffered saline.
  • a pharmaceutically acceptable sterile isotonic solution such as saline and phosphate buffered saline.
  • the constructs of the invention can then be injected intravenously, intramuscularly, intraperitoneally, or subcutaneously.
  • the heteromultimers can be incorporated into pharmaceutically acceptable powders, pills or liquids for ingestion, and suppositories for rectal or vaginal administration.
  • the heteromultimers can be suspended in a pharmaceutically acceptable excipient suitable for aerosolization and inhalation or as a mouthwash.
  • a pharmaceutically acceptable excipient suitable for aerosolization and inhalation or as a mouthwash such as atomizers and vaporizes can also be used.
  • Suitable formulations for aerosol delivery of polypeptides using buccal or pulmonary routes can be found, for example in U.S. Patent No. 6,312,665B1, issued November 6, 2001 to Pankaj Modi .
  • heteromultimers of the present invention can be administered nasally or ocularly, where the heteromultimers are suspended in a liquid pharmaceutically acceptable agent suitable for dropwise dosing.
  • the heteromultimers of the present invention can be administered such that the polypeptide is released in the individual over an extended period of time (sustained or controlled release).
  • the heteromultimers can be formulated into a composition such that a single administration provides delivery of the constructs of the invention for at least one week, or over the period of a year or more.
  • Controlled release systems include monolithic or reservoir-type microcapsules, depot implants, osmotic pumps, vesicles, micelles, liposomes, transdermal patches and iontophoretic devices.
  • the heteromultimers of the present invention are encapsulated or admixed in a slow degrading, non-toxic polymer. Additional formulations suitable for controlled release of constructs of the invention are described in U.S. Patent No. 4,391,797, issued July 5, 1983, to Folkman, et al.
  • Another suitable method for delivering the heteromultimers of the present invention to an individual is via in vivo production of the polypeptides.
  • Genes encoding the polypeptides can be administered to the individual such that the encoded polypeptides are expressed.
  • the genes can be transiently expressed.
  • the genes encoding the polypeptide are transfected into cells that have been obtained from the patient, a method referred to as ex vivo gene therapy. Cells expressing the polypeptides are then returned to the patient's body.
  • Methods of ex vivo gene therapy are well known in the art, and are described, for example, in U.S. Patent No. 4,391,797, issued March 21, 1998 to Anderson, et al.
  • Selected KDR or VEGF/KDR binding peptides corresponding to positive phage isolates were synthesized on solid phase using 9-fluorenylmethoxycarbonyl protocols and purified by reverse phase chromatography. Peptide masses were confirmed by electrospray mass spectrometry, and peptides were quantified by absorbance at 280 nm. For synthesis, two N-terminal and two C-terminal amino acids from the phage vector sequence from which the peptide was excised were retained and a -Gly-Gly-Gly-Lys-NH 2 linker was added to the C-terminus of each peptide.
  • Peptides with selected lysine residues were protected with 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-3-methybutyl (ivDde), which allows selective coupling to the C-terminal lysine, is not removed during peptide cleavage, and can be removed after coupling with 2% hydrazine in DMF or 0.5 M hydroxylamine, pH 8, in water.
  • ivDde 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)-3-methybutyl
  • Each peptide was labeled with fluorescein on the C-terminal lysine using Fluorescein (N-hydroxysuccinimide ester derivative) or Fluorescein Isothiocyanate (FITC) in DMF, 2% diisopropylethylamine (DIPEA). If the peptide contained an ivDde protected lysine, the reaction was quenched by the addition of 2% hydrazine, which reacts with all free NHS-fluorescein and removes the internal protecting group. For all other peptides, the reaction was quenched by the addition of an equal volume of 0.5 M hydroxylamine, pH 8.
  • the quenched reactions were then diluted with water to less than 10% DMF and then purified using C18 reverse phase chromatography.
  • the peptides were characterized for purity and correct mass on an LC-MS system (HP1100 HPLC with in-line SCIEX AP150 single quadrapole mass spectrometer).
  • Fluorescence anisotropy measurements were performed in 384-well microplates in a volume of 10 ⁇ L in binding buffer (PBS, 0.01% Tween-20, pH 7.5) using a Tecan Polarion fluorescence polarization plate reader. In some cases, heparin (0.5 ⁇ g/mL) or 10% human serum was added to the binding buffer. The concentration of fluorescein labeled peptide was held constant (20 nM) and the concentration of KDR-Fc (or similar target) was varied. Binding mixtures were equilibrated for 10 minutes in the microplate at 30 °C before measurement. The observed change in anisotropy was fit to Equation (1) below via nonlinear regression to obtain the apparent K D .
  • r obs is the observed anisotropy
  • r free is the anisotropy of the free peptide
  • r bound is the anisotropy of the bound peptide
  • K D is the apparent dissociation constant
  • KDR is the total KDR concentration
  • P is the total fluorescein-labeled peptide concentration.
  • the peptides were synthesized on NovaSyn TGR (Rink amide) resin (0.2 mmol/g) using the Advanced ChemTech ACT 357 or ACT 496 Synthesizers employing Fmoc peptide synthesis protocols, specifically using HOBt/DIC as the coupling reagents and NMP as the solvent.
  • the Fmoc was removed by treating the Nova-Syn TGR (Rink amide-available from NovaBiochem, San Diego, CA) resin-bound peptide with 25% piperidine in DMF twice (4 min and 10 min). All amino acids were dissolved in NMP (DMF was added when the amino acid was not soluble in pure NMP). The concentration of the amino acid was 0.25 M, and the concentration for both HOBt and DIC was 0.5 M.
  • a typical amino acid coupling cycle (not including wash steps) was to dispense piperidine solution (2.4 mL) to each well and mix for 4 min, then empty all wells. NMP (320 ⁇ L), HOBt solution (320 ⁇ L, 4eq), amino acid (640 ⁇ L, 4eq) and DIC (320 ⁇ L, 4eq) solutions were dispensed to each well. The coupling time was 3 h; then the resin was washed. The cycle was repeated for each amino acid. After the last amino acid coupling, the resin-bound peptide was treated with 25% piperidine to remove the Fmoc protecting group.
  • the resin bound peptide was capped with 1.0 M Ac 2 O (1.2 mL per well) and diisopropylethylamine in DMF, optionally including varying amounts of HOBt in the mixture for 30 min.
  • the resin was washed first with methanol and then with dichloromethane and dried. Cleavage of the peptides from the resin and side-chain deprotection was accomplished using Reagent B for 4.5h.
  • the cleavage solutions were collected and the resins were washing with an additional aliquot of Reagant B.
  • the combined solutions were concentrated to dryness.
  • Ether was added to the residue with swirling or stirring to precipitate the peptides.
  • the ether was decanted, and solid was collected.
  • the purified linear di-cysteine containing peptides were dissolved in water, mixtures of water-acetonitrile, or mixtures of water-DMSO at concentrations between 0.1 mg/mL and 2.0 mg/mL.
  • the choice of solvent was a function of the solubility of the crude peptide in the solvent.
  • the pH of the solution was adjusted to 7.5-8.5 with aqueous ammonia, aqueous ammonium carbonate or aqueous ammonium bicarbonate. The mixture was stirred vigorously in air for 24-48 h. In the case of non-DMSO containing solvent systems, the pH of the solution was adjusted to 2 with aqueous trifluoroacetic acid.
  • the mixture was lyophilized to provide the crude cyclic disulfide containing peptide.
  • the cyclic disulfide peptide was then dissolved to a volume of 1-2 mL in aqueous (0.1% TFA) containing a minimum of acetonitrile (0.1% TFA).
  • the resulting solution was loaded onto a reverse phase column and the desired compound obtained by a gradient elution of acetonitrile into water, employing a C 18, or C8 reverse phase semipreparative or preparative HPLC column.
  • the solution was diluted until the DMSO concentration was minimal without precipitation of the peptide.
  • the resulting mixture was quickly acidified to pH 2 with dilute trifluoroacetic acid and loaded onto the reverse phase HPLC system and purified as described. Fractions containing the desired materials were pooled and the peptides isolated by lyophilization.
  • the peptides were synthesized as in Method 1, with the following changes. HBTU/HOBt/DIEA were used as the coupling reagent and NMP as the solvent. A low load ( ⁇ 0.2 mmol/g) Fmoc-GGGK(Boc)-NovSyn-TGR-resin prepared from the above-described Nova-Syn TGR resin was employed for peptides synthesis on 0.01 mmol scale synthesis.
  • the crude ether-precipitated linear di-cysteine containing peptides were cyclized by dissolution in water, mixtures of aqueous acetonitrile (0.1% TFA), or aqueous DMSO and adjustment of the pH of the solution to 7.5 - 8.5 by addition of aqueous ammonia, aqueous ammonium carbonate, or aqueous ammonium bicarbonate solution.
  • the peptide concentration was between 0.1 and 2.0 mg/mL.
  • the mixture was stirred in air for 24-48 h, acidified to a pH of 2 with aqueous trifluoroacetic acid and then purified by preparative reverse phase HPLC employing a gradient of acetonitrile into water. Fractions containing the desired material were pooled and the peptides were isolated by lyophilization.
  • the peptides were synthesized using an Advanced ChemTech ACT 496 MOS Synthesizer as in Method 1.
  • the low load ( ⁇ 0.2 mmol/g) GGGK(Boc)-NovaSyn-TGR resin was employed for peptide synthesis.
  • the coupling solvent was NMP/DMSO 8:2.
  • the synthesis was performed at a 0.02 mmol scale using a coupling time of 3h.
  • the crude linear peptides were further processed as described above for Method 1.
  • the peptides were synthesized using method 3 on the ACT 496 with HBTU/DIEA as the coupling reagents, and NMP as the solvent. 2,4,6-collidine as a 1 M solution was used as the base. The low load Fmoc-GGGK(ivDde)-Novsyn-TGR resin ( ⁇ 0.2 mmol/g) was used for peptide synthesis. The coupling time was 30 minutes. The crude linear peptides were further processed as described above for Method 1.
  • Synthesis of peptides was carried out on a 0.25 mmol scale using the FastMoc protocol (Applied Biosystems Inc.) In each cycle of this protocol, 1.0 mmol of a dry protected amino acid in a cartridge was dissolved in a solution of 0.9 mmol of HBTU, 2 mmol of DIEA, and 0.9 mmol of HOBt in DMF with additional NMP added. The peptides were made using 0.1 mmol of NovaSyn TGR (Rink amide) resin (resin substitution 0.2 mmol/g). The coupling time in this protocol was 21 min. Fmoc deprotection was carried out with 20% piperidine in NMP.
  • the synthesized peptide was acetylated using acetic anhydride/DIEA/HOBt/NMP.
  • the peptide resin was washed and dried for further manipulations or cleaved from the resin (using reagent B). Generally, the cleaved peptides were cyclized, as in Method 1, above.
  • the peptides were prepared by Method 5.
  • the ivDde protecting group on the C-terminal lysine was selectively removed by treatment with 10% hydrazine in DMF.
  • the resin was then treated with a solution of Biotin-N-hydroxysuccinimidyl ester in DMF in the presence of DIEA. After washing, the resin was dried and cleavage was performed using Reagent B. The resin was filtered off and the filtrate concentrated to dryness.
  • the biotinylated peptide was dissolved in neat DMSO and treated with DIEA and stirred for 4-6 h to effect disulfide cyclization.
  • the crude mixture was purified by preparative HPLC.
  • the resin was filtered off, Reagent B was removed in vacuo and the peptide was precipitated by addition of anhydrous ether.
  • the solid formed was collected, washed with ether and dried.
  • the solid was dissolved in anhydrous DMSO and the mixture was adjusted to pH 7.5 with DIEA and stirred for 4-6 h to effect disulfide cyclization.
  • the disulfide cyclization reaction was monitored by analytical HPLC. After completion of the cyclization, the mixture solution was diluted with 25% acetonitrile in water and directly purified by HPLC on reverse phase C-18 column using a gradient of acetonitrile into water (both containing 0.1 % TFA). Fractions were analyzed by analytical HPLC and those containing the pure product were collected and lyophilized to obtain the required biotinylated peptide.
  • the purified peptide (10 mg, prepared by methods 1-5) containing a free amino group was dissolved in anhydrous DMF or DMSO (1 mL) and Biotin-NHS ester of (5 equivalents) and DIEA (5 equivalents) were added.
  • the reaction was monitored by HPLC and after the completion of the reaction (1-2 h), the crude reaction mixture was directly purified by preparative HPLC. Fractions were analyzed by analytical HPLC and those containing the pure product were collected and lyophilized to obtain the required biotinylated peptide.
  • the resin was washed with DMF (2 x 10 ml) and with DCM (1x 10 mL). The resin was then treated with 20% piperidine in DMF (2 x 15 mL) for 10 min each time. The resin was washed and the coupling with Fmoc-diaminodioxaoctanoic acid and removal of the Fmoc protecting group were repeated once more.
  • the resulting resin containing a peptide with a free amino group, was treated with a solution of Biotin-NHS ester (0.4 mmol, 5 equivalent) and DIEA (0.4 mmol, 5 equivalents) in DMF for 2 h.
  • the peptide-resin was washed and dried as described previously and then treated with reagent B (20 mL) for 4h. The mixture was filtered and the filtrate concentrated to dryness. The residue was stirred with ether to produce a solid that was collected, washed with ether, and dried. The solid was dissolved in anhydrous DMSO and the pH adjusted to pH 7.5 with DIEA. The mixture was stirred for 4-6 hr. to effect the disulfide cyclization reaction which was monitored by analytical HPLC. After the completion of the cyclization, the DMSO solution was diluted with 25% acetonitrile in water and applied directly to a reverse phase C-18 column.
  • the mixture was agitated for 12 h (fluorescein-containing compounds were protected from light).
  • the resin was then washed with DMF (3 x 10 mL) and twice with CH 2 Cl 2 (10 mL) and dried under nitrogen for 1h.
  • the peptide was cleaved from the resin using Reagent B for 4h and the solution collected by filtration. The volatiles were removed under reduced pressure and the residue was dried under vacuum.
  • the peptide was precipitated with ether, collected and the precipitate was dried under a stream of nitrogen.
  • the precipitate was added to water (1mg/mL) and the pH of the mixture was adjusted to 8 with 10% aqueous meglumine. Cyclization of the peptide was carried out for 48 h and the solution was freeze-dried.
  • the crude cyclic peptide was dissolved in water and purified by RP-HPLC on a C 18 column with linear gradient of acetonitrile into water (both phases contained 0.1%TFA). Fractions containing the pure product were collected and freeze dried. The peptides were characterized by ES-MS and the purity was determined by RP-HPLC (linear gradient of acetonitrile into water/0.1% TFA).
  • Peptides were synthesized starting with 0.1 mmol of NovaSyn -TGR resin (0.2 mmol/g substitution). Deprotected (ivDde) resin was then treated according to the protocol A for the incorporation of Fmoc (Gly)-OH, Fmoc-Cys(Acm)-OH and, Fmoc-Ser(tBu)-OH. Protocol A for manual coupling of single amino acid:
  • the Fmoc-protected peptide loaded resin was then treated with 20% piperidine in DMF (2 X 10 mL, 10 min) and washed with DMF (3 X 10 mL).
  • a solution of N,N-dimethylglycine (0.11 mmol), HATU (1 mmol), and DIEA (0.11 mmol) in DMF (10 mL) was then added to the peptide loaded resin and the manual coupling was continued for 5 h. After the reaction the resin was washed with DMF (3 x 10 mL) and CH 2 Cl 2 (3 x 10 mL) and dried under vacuum.
  • the purified peptide from Method 5 (having a free amino group, was coupled to AcSCH 2 -CO-(NH-CH 2 -CH 2 -O-CH 2 -CH 2 -O-CH 2 -CO) 2 -OH (30 eq.)/HOBt (30 eq.)/DIC (30 eq.) in NMP for 40 h at room temperature. The mixture was purified and the ivDde group was removed. A second purification gave the final product as a white lyophilizate.
  • Fmoc aminodioxaoctanoic acid was coupled twice successively to the peptide (produced by method 5) followed by Fmoc removal and coupling to S-acetylthioglycolic acid.
  • the required purified peptides were prepared by SPPS using Method 5. To prepare homodimers, half of the peptide needed to prepare the dimer was dissolved in DMF and treated with 10 equivalents of glutaric acid bis N-hydoxysuccinimidyl ester The progress of the reaction was monitored by HPLC analysis and mass spectroscopy. At completion of the reaction, the volatiles were removed in vacuo and the residue was washed with ethyl acetate to remove the unreacted bis-NHS ester. The residue was dried, re-dissolved in anhydrous DMF and treated with another half portion of the peptide in the presence of 2 equivalents of DIEA. The reaction was allowed to proceed for 24 hr. This mixture was applied directly to a Waters Associates C-18 XTerra RP-HPLC column and purified by elution with a linear gradient of acetonitrile into water (both containing 0.1% TFA).
  • one of the monomers was reacted with the bis NHS ester of glutaric acid and after washing off the excess of bis NHS ester, the second amine was added in the presence of DIEA. After the reaction, the mixture was purified by preparative HPLC.
  • the KDR and VEGF/KDR complex binding polypeptides in Table 1 were prepared.
  • the letter “J” in the peptide sequences refers to the spacer or linker group, 8-amino-3,6-dioxaoctanoyl.
  • C* refers to a cysteine residue that contributes to a disulfide bond. The ability of the biotinylated polypeptides to bind to KDR was assessed using the assay set described below.
  • Bead-binding assay to confirm ability of pertides identified by phage display to bind KDR-expressing cells
  • KDR-binding peptides P5-B and P5-XB and P6-B and P6-XB were conjugated to fluorescent beads and their ability to bind to KDR-expressing 293H cells was assessed.
  • the experiments show that both peptide sequences can be used to bind particles such as beads to KDR-expressing sites.
  • the P6 peptides exhibited better binding to the KDR expressing cells than P5.
  • the binding of both peptides improved with the addition of a spacer.
  • Anti-KDR from Sigma (V-9134), as ascites fluid, was biotinylated using a kit from Molecular Probes (F-6347) according to the manufacturer's instructions.
  • 293H cells were transfected using the protocol described in Example 6. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640). The cells in one half of the plate (48 wells) were mock-transfected (with no DNA) and those in the other half of the plate were transfected with KDR cDNA. The cells were 80-90% confluent at the time of transfection and completely confluent the next day, at the time of the assay; otherwise the assay was aborted.
  • Unconjugated Neutravidin beads were used as a negative control while beads conjugated with a biotinylated anti-KDR antibody were used as the positive control for the assay.
  • the positive control beads with anti-KDR attached clearly bound preferentially to the KDR-expressing cells while avidin beads with nothing attached did not bind to either cell type.
  • Biotinylated P5 beads did not bind to the KDR-transfected cells significantly more than to mock-transfected cells, but adding a hydrophilic spacer between the peptide moiety and the biotin group enhanced binding to KDR cells without increasing the binding to mock-transfected cells.
  • Biotinylated P6 beads showed greater binding to KDR-transfected cells.
  • adding a hydrophilic spacer between the peptide portion and the biotin of the molecule significantly improved the specific binding to KDR in the transfected cells.
  • the peptide sequences of both P5 and P6 can be used to bind particles such as beads to KDR expressing sites.
  • KDR-binding peptides assessed by transfected 293H cells. While KDR-binding polypeptide P4 did not compete significantly with 125 I-labeled VEGF, P5-XB, P6 and P12-XB competed very well with 125 I-labeled VEGF, inhibiting 96.29 ⁇ 2.97% and 104.48 ⁇ 2.07% of 125 I-labeled VEGF binding.
  • 293H cells were transfected using the protocol described in Example 6. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640). The cells in one half of the plate (48 wells) were mock-transfected (with no DNA) and those in the other half of the plate were transfected with KDR cDNA. The cells were 80-90% confluent at the time of transfection and completely confluent the next day, at the time of the assay; otherwise the assay was aborted.
  • M199 medium for the assay, one M199 medium packet (GIBCO, cat. # 31100-035), 20 mL of 1 mM HEPES (GIBCO, cat. #15630-080), and 2 g of DIFCO Gelatin (DIFCO, cat. # 0143-15-1) were added to 950 mL of double distilled (dd) H 2 O and the pH of the solution was adjusted to 7.4 by adding approximately 4 mL of 1N NaOH. After pH adjustment, the M199 medium was warmed to 37 °C in a water bath for 2 h to dissolve the gelatin, then filter sterilized using 0.2 ⁇ m filters (Coming, cat. # 43109), and stored at 4 °C to be used later in the assay.
  • lyophilized 125 I-Iabeled VEGF (Amersham, cat. # IM274) were reconstituted with 250 ⁇ L of ddH 2 O to create a stock solution, which was stored at -80 °C for later use.
  • a 300 pM solution of 125 I-labeled VEGF was made fresh by diluting the above stock solution in M199 medium.
  • the concentration of 125 I-labeled VEGF was calculated daily based on the specific activity of the material on that day.
  • Cells were used 24 h after transfection, and to prepare the cells for the assay, they were washed 3 times with room temperature M199 medium and placed in the refrigerator. After 15 minutes, the M199 medium was removed from the plate and replaced with 75 ⁇ L of 300 pM 125 I-labeled VEGF in M199 medium (prepared as above). Each dilution was added to three separate wells of mock and KDR transfected cells. After incubating at 4 °C for 2 h, the plates were washed 5 times with cold binding buffer, gently blotted dry and checked under a microscope for cell loss.
  • solubilizing solution 2% Triton X-100, 10% Glycerol, 0.1% BSA
  • solubilizing solution 100 ⁇ L was added to each well and the plates were incubated at room temperature for 30 minutes.
  • the solubilizing solution in each well was mixed by pipeting up and down, and transferred to 1.2 mL tubes.
  • Each well was washed twice with 100 ⁇ L of solubilizing solution and the washes were added to the corresponding 1.2 mL tube.
  • Each 1.2 mL tube was then transferred to a 15.7 mm X 10 cm tube to be counted in an LKB Gamma Counter ( 125 I window for 1 minute).
  • KDR-binding peptides P6, P4, P5-XB, and P12-XB were assessed in mock-transfected and KDR-transfected cells.
  • P4 was used in the assay as a negative control. It was selected because it exhibits only poor binding to KDR in FP assays, and thus would not be expected to displace or compete with VEGF.
  • To calculate the specific binding to KDR the binding of 125 I-labeled VEGF to mock-transfected cells was subtracted from KDR-transfected cells.
  • the binding of 125 I-labeled VEGF to sites other than KDR (which may or may not be present in 293H cells) is not included when calculating the inhibition of 125 I-labeled VEGF binding to 293H cells by KDR-binding peptides.
  • FIG. 2 shows the percentage inhibition of 125 I-labeled VEGF binding by peptides (P6 ,P4 , P5-XB , and P12-XB) at two different concentrations (30 ⁇ M and 0.3 ⁇ M) to KDR-transfected 293H cells. Percentage inhibition was calculated using formula [(Y1-Y2)x100/Y1], where Y1 is specific binding to KDR-transfected 293H cells in the absence of peptides, and Y2 is specific binding to KDR-transfected 293H cells in the presence of peptides or DMSO (vehicle).
  • P4 which, due to its relatively high Kd (>2 ⁇ M, measured by FP against KDR-Fc), was used as a negative control, did not compete significantly with 125 I-labeled VEGF, 12.69 ⁇ 7.18% at 30 ⁇ M and -5.45 ⁇ 9.37% at 0.3 ⁇ M ( FIG. 2 ).
  • P6, and P12-XB competed very well with 125 I-labeled VEGF, inhibiting 96.29 ⁇ 2.97% and 104.48 ⁇ 2.07% of 125 I-labeled VEGF binding at 30 ⁇ M and 52.27 ⁇ 3.78% and 80.96 ⁇ 3.8% at 0.3 ⁇ M, respectively.
  • the percentage inhibition with P5-X-B was 47.95 ⁇ 5.09% of 125 I-labeled VEGF binding at 30 ⁇ M and 24.41 ⁇ 8.43% at 0.3 ⁇ M ( FIG. 2 ).
  • This assay should also be useful for identifying peptides that bind tightly to KDR but do not compete with VEGF, a feature that may be useful for imaging KDR in tumors, where there is frequently a high local concentration of VEGF that would otherwise block the binding of KDR-targeting molecules.
  • KDR-binding peptides identified by phage display were assessed using the following assay.
  • a number of peptides of the invention were shown to inhibit activation of KDR in monomeric and/or tetrameric constructs, including P5-D, P6-D, P10-D and P11-D.
  • peptides that inhibit activation of KDR may be useful as anti-angiogenic agents.
  • Human umbilical vein endothelial cells (HUVECs) (Biowhittaker Cat No. CC-2519) were obtained frozen on dry ice and stored in liquid nitrogen until thawing. These cells were thawed, passaged, and maintained as described by the manufacturer in EGM-MV medium (Biowhittaker Cat No. CC-3125). Cells seeded into 100 mm dishes were allowed to become confluent, then cultured overnight in basal EBM medium lacking serum (Biowhittaker Cat No. CC-3121). The next morning, the medium in the dishes was replaced with 10 mL fresh EBM medium at 37 °C containing either no additive (negative control), 5 ng/mL VEGF (Calbiochem Cat No.
  • VEGF vascular endothelial growth factor
  • a neutralizing anti-KDR antibody Cat No. AF357, R&D Systems
  • the antibody was pre-incubated with the test cells for 30 min at 37 °C prior to the addition of fresh medium containing both VEGF and the antibody.
  • D-PBS Dulbecco's phosphate buffered saline
  • the first dish of a set was drained and 0.5 mL of Triton lysis buffer was added (20 mM Tris base pH 8.0,137 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA (ethylenediaminetetraacetic acid), 1 mM PMSF (phenylmethylsulfonylfluoride), 1 mM sodium orthovanadate, 100 mM NaF, 50 mM sodium pyrophosphate, 10 ⁇ g/mL leupeptin, 10 ⁇ g/mL aprotinin).
  • the cells were quickly scraped into the lysis buffer using a cell scraper (Falcon, Cat No.
  • the lysates either freshly prepared or frozen and thawed, were precleared by adding 20 ⁇ L of protein A-sepharose beads (Sigma 3391, preswollen in D-PBS), washed three times with a large excess of D-PBS, reconstituted with 6 mL D-PBS to generate a 50% slurry) and rocked at 4 °C for 30 min.
  • the beads were pelleted by centrifugation for 2 min in a Picofuge (Stratgene, Cat No. 400550) at 2000xg and the supernatants transferred to new 1.5 mL tubes.
  • 20 ⁇ g of anti-Flk-1 antibody (Santa Cruz Biotechnology, Cat No.
  • sc-504 was added to each tube, and the tubes were incubated overnight (16-18 h) at 4°C on a rotator to immunoprecipitate KDR. The next day 40 ⁇ L of protein A-sepharose beads were added to the tubes, which were then incubated at 4°C for 1 h on a rotator. The beads in each tube were subsequently washed three times by centrifuging for 2 min in a Picofuge, discarding the supernatant, and dispersing the beads in 1 mL freshly added TBST buffer (20 mM Tris base pH 7.5,137 mM NaCl, and 0.1% Tween 20).
  • Detection of phosphorylated KDR as well as total KDR in the immunoprecipitates was carried out by immunoblot analysis. Half (20 ⁇ L) of each immunoprecipitate was resolved on a 7.5% precast Ready Gel (Bio-Rad, Cat No. 161-1154) by SDS-PAGE according to the method of Laemmli ( U. K. Laemmli "Cleavage of structural proteins during assembly of the head of bacteriophage T4.” Nature (1970); 227, 680-685 ).
  • Blots were blocked at room temperature in 5% Blotto-TBS (Pierce Cat No. 37530) pre-warmed to 37°C for 2 h.
  • the blots were first probed with an anti-phosphotyrosine antibody (Transduction Labs, Cat No. P11120), diluted 1:200 in 5% Blotto-TBS with 0.1% Tween 20 added for 2 h at room temp.
  • the unbound antibody was removed by washing the blots four times with D-PBS containing 0.1% Tween 20 (D-PBST), 5 min per wash. Subsequently, blots were probed with an HRP-conjugated sheep anti-mouse antibody (Amersham Biosciences Cat No.
  • the blots were stripped by incubating for 30 min at 37 °C in TBST with its pH adjusted to 2.4 with HCl, blocked for 1 h at room temp with 5% Blotto-TBS with 0.1% Tween 20 (Blotto-TBST), and reprobed with an anti-Flk-1 polyclonal antibody (Cat No. sic-315 from Santa Cruz Biotech), 1:200 in 5% Blotto-TBST with 1% normal goat serum (Life Tech Cat No. 16210064) for 2 h at room temp. The unbound antibody was removed by washing the blots four times with D-PBST, 5 min per wash.
  • the blots were probed with an HRP-conjugated donkey anti-rabbit secondary antibody (Amersham Biosciences Cat No. NA934) diluted 1:10,000 in 5% Blotto-TBST for 1 h at room temperature, and washed four times with D-PBST. Finally, the blots were incubated with 2 mL of chemiluminescent substrate and exposed to X-ray film as described above.
  • the ability of the assay to detect agents capable of blocking the VEGF activation of KDR was assessed by adding a series of compounds to HUVECs in combination with VEGF and measuring KDR phosphorylation with the immunoblot assay described above. As negative and positive controls, immunoprecipitates from unstimulated HUVECs and from HUVECs stimulated with VEGF in the absence of any test compounds were also tested in every assay. When a neutralizing anti-KDR antibody (Cat No. AF-357 from R&D Systems) was combined with the VEGF, the extent of KDR phosphorylation was greatly reduced ( FIG. 4 , upper panel), indicating that the antibody was able to interfere with the ability of VEGF to bind to and activate KDR.
  • a neutralizing anti-KDR antibody Cat No. AF-357 from R&D Systems
  • P2 and P6 were the most potent compounds in the assay, producing at least a 50% inhibition of VEGF-induced KDR phosphorylation at 1 ⁇ M.
  • tetrameric complexes of biotinylated derivatives P6-XB or P12-XB produced at least a 50% inhibition of VEGF-induced KDR phosphorylation at 10 nM.
  • Tc-labeled P12-C the ability of Tc-labeled P12-C to bind KDR was assessed using KDR-transfected 293H cells.
  • the results show that Tc-labeled P12-C bound significantly better to KDR transfected 293H cells than to mock transfected 293H cells, and binding increased with concentration of the Tc-labeled polypeptide in a linear manner.
  • the resin was filtered and washed with DMF (3 x 80 mL), CH 2 Cl 2 (3 x 80 ml) and dried.
  • the resin was mixed with 80 mL of AcOH/CF 3 CH 2 OH/DCM (1/1/8, v/v/v) and shaken for 45 min.
  • the resin was filtered and the filtrate was evaporated to a paste. Purification of the crude material by silica gel chromatography using 25% MeOH/DCM afforded 2.0 g of the final product.
  • a stannous gluconate solution was prepared by adding 2 mL of a 20 ⁇ g/mL SnCl 2 2H 2 O solution in nitrogen-purged 1N HCl to 1.0 mL of nitrogen-purged water containing 13 mg of sodium glucoheptonate.
  • To a 4 mL autosampler vial was added 20-40 ⁇ L (20 - 40 ⁇ g) of P12-C ligand dissolved in 50/50 ethanol/H 2 O, 6-12 mCi of 99m TcO 4 - in saline and 100 ⁇ L of stannous glucoheptonate solution. The mixture was heated at 100 °C for 22 min.
  • the resulting radiochemical purity (RCP) was 10- 47% when analyzed using a Vydac C18 Peptide and Protein column that was eluted at a flow rate of 1 mL/min with 66% H 2 O (0.1% TFA)/34% ACN(0.085% TFA).
  • the reaction mixture was purified by HPLC on a Vydac C18 column (4.6 mm x 250 mm) at a flow rate of 1 mL/min, using 0.1% TFA in water as aqueous phase and 0.085% TFA in acetonitrile as the organic phase.
  • the following gradient was used; 29.5% org. for 35 min., ramp to 85% org. over 5 min, hold for 10 min.
  • the fraction containing 99m Tc-P12-C (which no longer contained the ACM protecting group) was collected into 500 ⁇ L of a stabilizing buffer containing 5 mg/mL ascorbic acid and 16 mg/mL hydroxypropyl- ⁇ -cyclodextrin in 50 mM phosphate buffer.
  • the mixture was concentrated using a speed vacuum apparatus to remove acetonitrile, and 200 ⁇ L of 0.1% HSA in 50 mM pH 5 citrate buffer was added.
  • the resulting product had an RCP of 100%.
  • the compound Prior to injection into animals, the compound was diluted to the desired radioconcentration with normal saline.
  • 293H cells were transfected using the protocol described in avidin HRP example. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640). The cells in one half of the plates (48 wells) were mock-transfected (with no DNA) and the cells in the other half of the plate were transfected with KDR cDNA. The cells were 80-90% confluent at the time of transfection and completely confluent the next day, at the time of the assay; otherwise the assay was aborted.
  • Opti-MEMI was obtained from Invitrogen (cat. # 11058-021) and human serum albumin (HSA) was obtained from Sigma (cat. # A-3782).
  • HSA human serum albumin
  • Tc-labeled P12-C (117 pCi/ml) was diluted 1:100, 1:50, 1:25 and 1:10 in opti-MEMI with 0.1% HSA to provide solutions with final concentration of 1.17,2.34,4.68 and 11.7 ⁇ Ci/mL of Tc-labeled P12-C
  • Cells were used 24 h after transfection, and to prepare the cells for the assay, they were washed 1X with 100 ⁇ L of room temperature opti-MEMI with 0.1% HSA. After washing, the opti-MEMI with 0.1% HSA was removed from the plate and replaced with 70 ⁇ L of 1.17, 2.34, 4.68 and 11.7 ⁇ Ci/mL of Tc-labeled P12-C (prepared as above). Each dilution was added to three separate wells of mock and KDR transfected cells.
  • Tc-labeled P12-C The ability of Tc-labeled P12-C to bind specifically to KDR was demonstrated using transiently transfected 293H cells. As shown in FIG. 6 , Tc-labeled P12-C bound significantly better to KDR transfected 293H cells, as compared to mock transfected 293H cells. To calculate specific binding to KDR, the binding of Tc-labeled P12-C to mock transfected cells was subtracted from the binding to KDR transfected cells. As shown in FIG. 7 , a linear increase in the specific binding of Tc-labeled P12-C to KDR was observed with increasing concentration of Tc-labeled P12-C.
  • tetrameric complexes of KDR-binding peptides P6-XB , P5-XB, P12-XB , and P13-XB and a control peptide, P1-XB were prepared and tested for their ability to bind 293H cells that were transiently-transfected with KDR. All four tetrameric complexes of KDR-binding peptides bound to the KDR-expressing cells; however, P13-XB exhibited the best Kd (1.81 nM). The tetrameric complexes of KDR-binding peptides P6-XB and P5-XB exhibited improved binding over monomers of the same peptides. Moreover, inclusion of a spacer (between the KDR-binding peptide and the biotin) in these constructs was shown to improve binding in Experiment B.
  • Experiment C demonstrates the use of this assay to assess the effect of serum on binding of peptides of the invention to KDR and VEGF/KDR complex.
  • the binding of P5-XB, P6-XB and P13-XB was not significantly affected by the presence of serum, while the binding of P12-XB was reduced more than 50% in the presence of serum.
  • Experiment D demonstrates that this assay is useful in evaluating distinct combinations of KDR and VEGF/KDR complex binding polypeptides for use in multimeric targeting constructs which contain more than one KDR and VEGF/KDR complex binding polypeptide.
  • Experiments D and E establish that heteromeric constructs, which have two or more KDR binding peptides that bind to different binding sites, exhibited superior binding to "homotetrameric" constructs of the targeting peptides alone.
  • HUVEC cells were grown to almost 80% confluence in 175 cm 2 tissue culture flasks (Becton Dickinson, Biocoat, cat # 6478) and then 10 ng/mL of bFGF (Oncogene, cat # PF003) was added for 24 h to induce expression of KDR.
  • MRNA was isolated using the micro-fast track 2.0 kit from Invitrogen (cat. # K1520-02). 12 ⁇ g of mRNA (measured by absorbance at 260 nM) was obtained from two flasks (about 30 million cells) following the kit instructions.
  • Reverse transcription to generate cDNA was performed with 2 ⁇ g of mRNA, oligo dT primer (5'-(T) 25 GC-3') and/or smart II oligo (5'AAGCAGTGGTAACAACGCAGAGTA CGCGGG-3') using Moloney Murine Leukemia Virus (MMLV) reverse transcriptase.
  • MMLV Moloney Murine Leukemia Virus
  • the reaction was performed in a total volume of 20 ⁇ L and the reaction mix contained 2 ⁇ L of RNA, 1 ⁇ L smart II oligo, 1 ⁇ L of oligo dT primer, 4 ⁇ L of 5x first-strand buffer (250 mM Tris HCl pH 8.3, 375 mM KCl, 30 mM MgCl 2 ) 1 ⁇ L DTT (20 mM, also supplied with reverse transcriptase), 1 ⁇ L dNTP mix (10 mM each of dATP, dCTP, dGTP, and dTTP in ddH 2 O, Stratagene, cat.
  • 5x first-strand buffer 250 mM Tris HCl pH 8.3, 375 mM KCl, 30 mM MgCl 2
  • DTT 20 mM, also supplied with reverse transcriptase
  • 1 dNTP mix 10 mM each of dATP, dCTP, dGTP, and dTTP in dd
  • a 5' oligo G ATG GAG AGC AAG GTG CTG CTG G
  • a 3' oligo C CAA GTT CGT CTT TTC CTG GGC A
  • the PCR reaction was done in total volume of 50 ⁇ L and the reaction mix contained 2 ⁇ L 5' RACE ready cDNA library, 1 ⁇ L 5' oligo (10 ⁇ M), 1 ⁇ L 3' oligo (10 ⁇ M), 5 ⁇ L 10X PCR buffer [PCR buffer (200 mM Tris-HCl pH 8.8, 20 mM MgSO 4 , 100 mM KCl, 100 mM (NH 4 ) 2 SO 4 ) supplied with pfu enzyme plus 1% DMSO and 8% glycerol], 1 ⁇ L dNTP mix (10 mM) and 40 ⁇ L ddH 2 O.
  • PCR buffer 200 mM Tris-HCl pH 8.8, 20 mM MgSO 4 , 100 mM KCl, 100 mM (NH 4 ) 2 SO 4
  • the PCR reaction was performed by using a program set for 40 cycles of 1 minute at 94 °C, 1 minute at 68 °C and 4 minutes at 72 °C.
  • the PCR product was purified by extraction with 1 volume of phenol, followed by extraction with 1 volume of chloroform and precipitated using 3 volume of ethanol and 1/10 volume of 3M sodium acetate.
  • the PCR product was resuspended in 17 ⁇ L of ddH 2 O, the 2 ⁇ L of 10X Taq polymerase buffer (100 mM Tris-HCl pH 8.8, 500 mM KCl, 15 mM MgCl 2 , 0.01% gelatin) and 1 ⁇ L of Taq polymerase (Stratagene, cat.
  • a 5' oligo (TCC CCC GGG ATC ATT ATT CTA GTA GGC ACG GCG GTG) and a 3' oligo (C AGG AGG AGA GCT CAG TGT GGT C) were used. These were designed to amplify the complete transmembrane and cytoplasmic domains of KDR ( ⁇ 1.8 kbps) from the 5' RACE ready cDNA library (described above) using polymerase chain reaction (PCR) with pfu polymerase. PCR reaction conditions and the program were exactly the same as described above for s-KDR. Just as with the s-KDR sequence, the PCR product was purified using phenol chloroform extraction, treated with Taq polymerase and cloned into TOPOII vector from invitrogen to give TOPO-CYTO.
  • PCR polymerase chain reaction
  • the extra-cellular domain and the cytoplasmic domain were amplified by PCR separately from TOPO-sKDR and TOPO-CYTO respectively and ligated later to create the full-length receptor.
  • An oligo with a Notl site at the 5' end of the extracellular domain (A TAA GAA TGC GGC CGC AGG ATG GAG AGC AAG GTG CTG CTG G) and an oligo complimentary to the 3' end of the extracellular domain (TTC CAA GTT CGT CTT TTC CTG GGC ACC) were used to amplify by PCR the extracellular domain from TOPO-sKDR.
  • the 5' oligo (ATC ATT ATT CTA GTA GGC ACG GCG GTG) and the 3' oligo, with a Notl site (A TAA GAA TGC GGC CGC AAC AGG AGG AGA GCT CAG TGT GGT C), were used to amplify by PCR the cytoplasmic domain of KDR (with transmembrane domain) from TOPO-CYTO. Both PCR products were digested with Notl and ligated together to create the full-length receptor. The cDNA encoding the full-length receptor was purified on an agarose gel and ligated into the Notl site of the pcDNA6/V5-HisC vector.
  • 293H cells were obtained from Invitrogen (cat. # 11631) and grown as monolayer cultures in their recommended media plus 1mL/L pen/strep (Invitrogen, cat. # 15140-148). All the cells were grown in presence of antibiotic for everyday culture but were split into antibiotic free media for 16-20 hour prior to transfection.
  • E. coli. bacteria DH5 ⁇ containing pf-KDR was streaked onto LB with 50 ⁇ g/mL ampicillin (LB agar from US biologicals, cat. # 75851 and ampicillin from Sigma, cat. #A2804) plates from a glycerol stock and plates were left in a 37 °C incubator to grow overnight. Next morning, a single colony was picked from the plate and grown in 3 mL of LB/ampicillin media (LB from US biologicals, cat. # US75852) at 37 °C. After 8 hours, 100 ⁇ L of bacterial culture from the 3 mL tube was transferred to 250 mL of LB/ampicillin media for overnight incubation at 37 °C.
  • Bacteria were grown up with circular agitation in a 500 mL bottle (Beckman, cat. # 355605) at 220 rpm in a Lab-Line incubator shaker. The next day, the bacterial culture was processed using maxi-prep kit (QIAGEN, cat. # 12163). Generally, about 1 mg of plasmid DNA (as quantitated by absorbance at 260 nm) was obtained from 250 mL of bacterial culture.
  • Transfection was done as recommended in the lipofectamine 2000 protocol (Invitrogen, cat# 11668-019) using a poly-D-lysine-coated 96 well plate. 320 ng of KDR DNA (pc-DNA6-fKDR)/per well in 0.1 mL was used for 96 well plate transfections. Transfection was done in serum-containing media, the transfection reagent mix was removed from cells after 6-8 hours and replaced with regular serum-containing medium. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640).
  • the cell in one half of the plate (48 wells) were mock-transfected (with no DNA) and the cells in the other half of the plate were transfected with KDR cDNA.
  • the cells were 80-90% confluent at the time of transfection and completely confluent next day, at the time of the assay, otherwise the assay was aborted.
  • M199 media was prepared as described above
  • SoftLink soft release avidin-sepharose was prepared by centrifuging the sepharose obtained from Promega (cat. # V2011) at 12,000 rpm for 2 minutes, washing twice with ice cold water (centrifuging in-between the washes) and resuspending the pellet in ice cold water to make a 50% slurry in ddH 2 O. A fresh 50% slurry of avidin-sepharose was prepared for each experiment.
  • Biotinylated peptides P6-XB, P5-XB, P12-XB, P13-XB and the biotinylated control peptide, P1-XB, (prepared as described above) were used to prepare 250 ⁇ M stock solutions in 50% DMSO and a 33 ⁇ M stock solution of Neutravidin HRP was prepared by dissolving 2 mg of Neutravidin HRP (Pierce, cat. # 31001) in 1 mL of ddH 2 O. Peptide stock solutions were stored at -20 °C, whereas the Neutravidin HRP stock solution was stored at -80 °C.
  • the structures of the biotinylated peptides are shown in Table 1.
  • peptide/neutravidin HRP complexes 10 ⁇ L of 250 ⁇ M biotinylated peptide stock solution and 10 ⁇ L of 33 ⁇ M Neutravidin HRP were added to 1 ml of M199 medium. This mixture was incubated on a rotator at 4 °C for 60 minutes, followed by addition of 50 ⁇ L of soft release avidin-sepharose (50% slurry in ddH 2 0) to remove excess peptides and another incubation for 30 minutes on a rotator at 4 °C.
  • peptide/neutravidin HRP complex 120 ⁇ L, 60 ⁇ L, 20 ⁇ L, 10 ⁇ L, 8 ⁇ L, 6 ⁇ L, 4 ⁇ L and 1 ⁇ L of peptide/neutravidin HRP complex were added to 1.2 ml aliquots of M199 medium to create dilutions with final concentrations of 33.33 nM, 16.65 nM, 5.55 nM, 2.78 nM, 1.67 nM, 1.11 nM and 0.28 nM complex, respectively.
  • Blocking solution was prepared by adding 20 mL of M199 medium to 10 mg of lyophilized unlabeled neutravidin (Pierce, cat. # 31000). Fresh blocking solution was used for each experiment.
  • each well of the 293H cells was washed 1X with 100 ⁇ L of M199 medium and incubated with 80 ⁇ L of blocking solution at 37 °C. After one hour, cells were washed 2X with 100 ⁇ L of M199 media and incubated with 70 ⁇ L of peptide/neutravidin HRP dilutions of P1-XB, P6-XB, P5-XB, P12-XB and P13-XB for two and half hours at room temperature. Each dilution was added to three separate wells of mock as well as KDR-transfected 293H cells (two plates were used for each saturation binding experiment).
  • complexes of P6-XB, P5-XB, P12-XB, P13-XB peptides, and the control peptide, P1-XB, with neutravidin HRP were prepared as described above and tested for their ability to bind 293H cells that were transiently-transfected with KDR.
  • neutravidin HRP a 7.5 fold excess of biotinylated peptides over neutravidin HRP was used to ensure that all four biotin binding sites on neutravidin were occupied.
  • binding constants are, as expected, lower than those measured by FP against the KDRFc construct for the related monodentate peptides P6 (69 nM) and P5 (280 nM) (fluoresceinated) but similar for the monodentate peptide P12 (3 nM). As expected, no saturation of binding for the control P1-X-B peptide/neutravidin HRP-complex was observed. As shown in FIG.
  • Experiment B was designed to look at the effect of a spacer (X) between the KDR binding sequence (P6 and P5) and biotin.
  • X spacer
  • Experiment C examined the serum effect on the binding of P6-XB, P5-XB, P12-XB, and P13-XB.
  • biotinylated peptide/avidin HRP complexes of P6-XB, P5-XB, P12-XB, and P13-XB were tested in M199 media (as described above in Experiment A) with and without 40% rat serum.
  • This experiment was performed as described for Experiment A, except that it was only done at single concentration of 6.66 nM for P6-XB and P5-XB, 3.33 nM for P12-XB and 2.22 nM for P13XB.
  • Experiment D was designed to evaluate the binding of tetrameric complexes of KDR and VEGF/KDR complex-binding polypeptides P6-XB and P5-XB, particularly where the constructs included at least two KDR binding polypeptides.
  • the KDR binding peptides and control binding peptide (P1-XB) were prepared as described above. This experiment was performed using the protocol set forth for Experiment A, except the procedures set forth below were unique to this experiment.
  • peptide/neutravidin HRP complexes To prepare peptide/neutravidin HRP complexes, a total 5.36 ⁇ L of 250 ⁇ M biotinylated peptide stock solution (or a mixture of peptide solutions, to give peptide molecules four times the number of avidin HRP molecules) and 10 ⁇ L of 33 ⁇ M Neutravidin HRP were added to 1 mL of M199 medium. This mixture was incubated on a rotator at 4 °C for 60 minutes, followed by addition of 50 ⁇ L of soft release avidin-sepharose (50% slurry in ddH 2 0) to remove excess peptides and another incubation for 30 minutes on a rotator at 4 °C.
  • soft release avidin-sepharose 50% slurry in ddH 2 0
  • P1-XB is a biotinylated derivative of P1, a control peptide that does not bind to KDR.
  • a tetrameric complex of P1-XB with avidin-HRP did not show enhanced binding to KDR-transfected cells.
  • tetrameric complexes of P6-XB or P5-XB bound to KDR-transfected cells significantly better than to mock-transfected cells.
  • P6-XB tetramers however, bound much better than P5-X tetramers.
  • the ratios of specific binding of tetramer to monomer, dimer and trimer were calculated by dividing the specific binding (obtained by subtracting the binding to mock transfected cells from KDR transfected cells) of tetramer, trimer & dimer with that of monomer. Results suggest that there is co-operative effect of multimerization of P5-XB, P6-XB and P13-XB on the binding to KDR transfected cells. Table 2. Enhanced binding of homomultimeric constructs over monomers Ref .
  • the ratios of specific binding of heterotetramer, heterotrimer and heterodimer to monomer were calculated by dividing the specific binding (obtained by subtracting the binding to mock transfected cells from KDR transfected cells) of tetramer, trimer and dimer with that of monomer. Monomer, which was used to calculate the ratios, for each set of heteromers is recorded at the end of each heteromer listing in the table and given the ratio of 1.
  • the enhanced binding ratios of the homodimers range from about 1-4 fold as seen in table 2 whereas the binding of the heterodimers ranges from 2-110 fold, demonstrating the synergistic effect on binding strength of complementary sequences (Table 3).
  • Experiment E was designed to confirm that P6-XB and P5-XB bind to distinct binding sites on KDR. If the peptides bind to the same site on KDR, they would likely compete with each other for binding to KDR, whereas if the peptides bind to different sites, there should be no competition between the peptides for binding to KDR.
  • This experiment was performed using a single concentration of P5-XB/avidin HRP (3.33 nM) solution in each well and adding a varying concentration (0-2.5 ⁇ M) of P1-XB, P5-XB and P6-XB, none of which were complexed with avidin.
  • two linear peptides (P9, P10) were linked together to form a heterodimer. As determined by VEGF competition assays, these two peptides bind different sites on KDR. It is possible, therefore, that both peptides in the heterodimer could bind a single protein molecule at the same time and as result, bind with a higher overall affinity for the receptor. Two forms of the heterodimer were synthesized in an effort to determine the optimal orientation for this bidentate binding event. The peptides were either linked together in a tail-to-tail orientation via their C-terminal lysine residues or in a head-to-head orientation via their N-terminal amino groups.
  • each individual peptide monomer was modified at either the C-terminal lysine (to make the tail-to-tail dimer) or N-terminal amino (to make the head-to-head dimer) with a monodispersed PEG-based amino acid linker (Fmoc-NH-PEG 4 -CO 2 H).
  • tail-to-tail and head-to-head heterodimers were formed in solution and purified to homogeneity by standard reverse phase protocols. A more detailed description of this linkage chemistry is found in K. Rose, et al. JACS, 1999, 121: 7034-7038 .
  • each heterodimer was assayed for binding using a surface plasmon resonance instrument (Biacore 3000).
  • Soluble KDR receptor was cross-linked to the dextran surface of a CM5 sensor chip by the standard amine coupling procedure.
  • a 0.5mg/mL solution was diluted 1:40 with 50mM acetate, pH 6.0 to immobilize a total R L of 12721.
  • Experiments were performed in PBST buffer (5.5mM phosphate, pH 7.65, 0.15M NaCl, 0.1 % Tween-20 (v/v)).
  • Peptide solutions quantified by extinction coefficient were diluted to produce 1000, 500, 250, 125, 62.5 and 31.3nM solutions.
  • peptides were injected at 20 ⁇ L/min for 2 minutes using the kinject program. Following a 3 minute dissociation, any remaining peptide was stripped from the KDR surface with a quicki nj ect of 50mM NaOH, 1M NaCl for 15s at 75 ( ⁇ L/min. Monomeric P9 and P10 were run as standards. Sensorgrams were analyzed by global analysis using BIAevaluation software 3.1.
  • the peptide dimers investigated in this study by BIAcore analysis bind KDR with significantly higher affinity than either of the constituent monomers.
  • the interaction of a dimeric peptide with KDR is expected to proceed through two kinetic steps.
  • an apparent K D was calculated for the dimer interaction using the rate describing the initial encounter (k a,1 ) and the predominant off-rate (k d,2 ). From this analysis, the apparent K D of the head-to-head dimer was 2.2 nM and that of the tail-to-tail dimer was 11 nM (Table 4).
  • Peptide synthesis was carried out on an ABI-433A Synthesizer (Applied Biosystems Inc., Foster City, CA) on a 0.25 mmol scale using the FastMoc protocol. In each cycle of this protocol preactivation was accomplished by dissolution of 1.0 mmol of the requisite dry N ⁇ -Fmoc side-chain protected amino acid in a cartridge with a solution of 0.9 mmol of HBTU, 2 mmol of DIEA, and 0.9 mmol of HOBt in a DMF-NMP mixture. The peptides were assembled on NovaSyn TGR (Rink amide) resin (substitution level 0.2 mmol/g). Coupling was conducted for 21 min.
  • Fmoc deprotection was carried out with 20% piperidine in NMP. At the end of the last cycle, the N-terminal Fmoc group was removed and the fully protected resin-bound peptide was acetylated using acetic anhydride / DIEA / HOBt / NMP.
  • the crude ether-precipitated linear di-cysteine containing peptides were cyclized by dissolution in water, mixtures of aqueous acetonitrile (0.1% TFA), aqueous DMSO or 100% DMSO and adjustment of the pH of the solution to 7.5 - 8.5 by addition of aqueous ammonia, aqueous ammonium carbonate, aqueous ammonium bicarbonate solution or DIEA.
  • the mixture was stirred in air for 16-48 h, acidified to pH 2 with aqueous trifluoroacetic acid and then purified by preparative reverse phase HPLC employing a gradient of acetonitrile into water. Fractions containing the desired material were pooled and the purified peptides were isolated by lyophilization.
  • the resin was washed with DMF (2 x 10 mL) and with DCM (1 x 10 mL). The resin was then treated with 20% piperidine in DMF (2 x 15 mL) for 10 min each time. The resin was washed and the coupling with Fmoc-8-amino-3,6-dioxaoctanoic acid and Fmoc protecting group removal were repeated once more.
  • the resin was washed with DMF (2 x 10 mL) and with DCM (1x 10 mL). The resin was then treated with 20% piperidine in DMF (2 x 15 mL) for 10 min each time. The resin was washed and the coupling with Fmoc-8-amino-3,6-dioxaoctanoic acid and removal of the Fmoc protecting group were repeated once more.
  • the resulting resin-bound peptide with a free amino group was treated with a solution of Biotin-NHS ester (0.4 mmol, 5 equiv.) and DIEA (0.4 mmol, 5 equiv.) in DMF for 2 h.
  • the resin was washed and dried as described previously and then treated with Reagent B (20 mL) for 4 h.
  • the mixture was filtered and the filtrate concentrated to dryness.
  • the residue was stirred with ether to produce a solid that was collected, washed with ether, and dried.
  • the solid was dissolved in anhydrous DMSO and the pH adjusted to 7.5 with DIEA. The mixture was stirred for 4-6 h to effect the disulfide cyclization which was monitored by HPLC.
  • reaction mixture Upon completion of the cyclization, the reaction mixture was diluted with 25% acetonitrile in water and applied directly to a reverse phase C-18 column. Purification was effected using a gradient of acetonitrile into water (both containing 0.1% TFA). Fractions were analyzed by HPLC and those containing the pure product were collected and lyophilized to provide the required biotinylated peptide.
  • the resin was washed with DMF (2 x 10 mL) and with DCM (1x 10 mL). The resin was then treated with 20% piperidine in DMF (2 x 15 mL) for 10 min each time. The resin was washed and the coupling with Fmoc-8-amino-3,6-dioxaoctanoic acid and removal of the Fmoc protecting group were repeated once.
  • the resulting resin-bound peptide with a free amino group was resuspended in DMF (10 mL) and treated with a solution of 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid,-1,4,7-tris-t-butyl ester (DOTA-tris-t-butyl ester, 0.4 mmol, 5 equiv.), HOBt (0.4 mmol), DIC (0.4 mmol) and DIEA (0.8 mmol) in DMF (10 mL) with mixing for 4 h.
  • DMF 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid,-1,4,7-tris-t-butyl ester
  • HOBt 0.4 mmol
  • DIC 0.4 mmol
  • DIEA 0.8 mmol
  • the resin was washed with DMF (2 x 10 mL) and with DCM (1 x 10 mL) and treated with Reagent B (20 mL) for 4 h. The mixture was filtered and the filtrate concentrated to dryness. The residue was stirred in ether to produce a solid that was collected, washed with ether, and dried. The solid was dissolved in anhydrous DMSO and the pH adjusted to 7.5 with DIEA. The mixture was stirred for 16 h to effect the disulfide cyclization, which was monitored by HPLC. Upon completion of the cyclization, the mixture was diluted with 25% acetonitrile in water and applied directly to a reverse phase C-18 HPLC column.
  • C* refers to a cysteine residue that contributes to a disulfide bond.
  • the monomeric peptides described herein are prepared as cyclic disulfide peptides and then linked together to form dimers. Consequently, even if a cysteine residue lacks the "C*" designation, the presence of a disulfide bond to the nearest cysteine in the monomer can generally be assumed.
  • the monomer components of the dimers will also generally contain such disulfide bonds, regardless of whether the cysteine residues contain the "C*" designation or not.
  • the dimers and other heteromultimers of the present invention could alternatively be prepared by performing the cyclization of Di-cysteine peptides after the monomers are linked to form dimers.
  • Example 8 The purified peptide monomers mentioned above in Example 8 were used in the preparation of various homodimeric and heterodimeric constructs.
  • one of the monomers was reacted with the bis-NHS ester of glutaric acid and after washing off the excess of bis-NHS ester (as described for the homodimeric compounds), the second monomer (“B”) was added in the presence of DIEA. After the reaction the mixture was purified by preparative HPLC. Typically, to a solution of glutaric acid bis N-hydoxysuccinimidyl ester (0.02 mmol, 10 eqivalents) in DMF (0.3 mL) was added a solution of peptide A and DIEA (2 equiv) in DMF (0.5mL) and the mixture was stirred for 2 h.
  • dimer D5 For the preparation of the dimer D5, after the coupling reaction of the individual peptides, 50 ⁇ l of hydrazine was added to the reaction mixture (to expose the lysine N ⁇ -amino group) and the solution was stirred for 2 min. The reaction mixture was diluted with water (1.0 mL) and the pH was adjusted to 2 with TFA. This was then purified by the method described above.
  • System K Column: Waters XTerra, 4.6 x 50 mm; Eluents:A: Water (0.1%TFA), B: Acetonitrile (0.1%TFA) : Elution: Initial condition, 5 % B, Linear Gradient 5-60 % B in 10 min; Flow rate: 3.0 mL/min; Detection: UV @ 220 nm.
  • the following experiment assessed the ability of KDR-binding polypeptides, homodimers and heterodimers of the invention to compete with 125 I-labeled VEGF for binding to KDR expressed by transfected 293H cells.
  • 293H cells were transfected with the KDR cDNA or mock-transfected by standard techniques described herein. The cells were incubated with 125 I-VEGF in the presence or absence of competing compounds (at 10 ⁇ M, 0.3 ⁇ M, and 0.03 ⁇ M). After washing the cells, the bound radioactivity was quantitated on a gamma counter. The percentage inhibition of VEGF binding was calculated using the formula [(Y1-Y2)x100/Y1], where Y1 is specific binding to KDR-transfected 293H cells in the absence peptides, and Y2 is specific binding to KDR-transfected 293H cells in the presence of peptide competitors. Specific binding to KDR-transfected 293H cells was calculated by subtracting the binding to mock-transfected 293H cells from the binding to KDR-transfected 293H cells.
  • KDR-binding multimeric constructs including heteromultimers of the invention, to inhibit VEGF induced activation (phosphorylation) of KDR was assessed using the following assay (see also Example 4 above).
  • D1 was able to completely block the VEGF-induced phosphorylation of KDR in HUVECs at 10 nM. More than half of the phosphorylation was inhibited by the compound at 1 nM.
  • the IC 50 for D1 in this assay varied between 0.5 and 1 nM.
  • the two KDR-binding moieties within D1 when tested as monomeric free peptides (P12-XB and P6-D) in the receptor activation assay had IC 50 s of 0.1 and 1 micromolar respectively, which is 100 to 1000-fold higher than the IC 50 for D1 in the assay and 14 to 30-fold higher than the K D s for the fluoresceinated derivatives of the monomeric peptides.
  • IC 50 s of 0.1 and 1 micromolar respectively, which is 100 to 1000-fold higher than the IC 50 for D1 in the assay and 14 to 30-fold higher than the K D s for the fluoresceinated derivatives of the monomeric peptides.
  • the following experiment assessed the ability of D1, a heteromultimer of the invention, to block the VEGF-induced migration of HUVECs in culture.
  • Serum-starved HUVECs were placed, 100,000 cells per well, into the upper chambers of BD Matrigel-coated FluoroBlok 24-well insert plates (#354141).
  • Basal medium containing either nothing or different attractants such as VEGF (10ng/mL) or serum (5% FBS) in the presence or absence of potential VEGF-blocking/inhibiting compounds, was added to the lower chamber of the wells.
  • quantitation of cell migration/invasion was achieved by post-labeling cells in the insert plates with a fluorescent dye and measuring the fluorescence of the invading/migrating cells in a fluorescent plate reader.
  • the VEGF-induced migration was calculated by subtracting the migration that occurred when only basal medium was placed in the lower chamber of the wells.
  • VEGF induced a large increase in endothelial cell migration in the assay, which was potently blocked by D1.
  • D1 the VEGF-stimulated endothelial cell migration was 84% blocked (see FIG. 16 ).
  • this migration was almost completely blocked.
  • a known KDR inhibitor, SU-1498 ((E)-3-(3,5-Diisopropyl-4-hydroxyphenyl)-2-[(3-phenyl-n-propyl)aminocarbonyl]acrylonitrile] was tested in the assay.
  • SU1498 at 3 micromolar did not block the VEGF-induced migration as well as D1 (47% blocked at 3 micromolar).
  • D7 (structure provided below), at 50 nM, also produced essentially complete inhibition of the migration stimulated by VEGF. Serum was a very powerful attractant in the assay when used in place of VEGF, but its effect was not significantly diminished by D1, indicating that D1 specifically inhibits endothelial migration induced by VEGF.
  • SnCl 2 2H 2 O (20 mg) was dissolved in 1 mL of 1 N HCl, and 10 ⁇ L of this solution was added to 1 mL of a DTPA solution that was prepared by dissolving 10 mg of Ca Na 2 DTPA 2.5 H 2 O (Fluka) in 1 mL of water.
  • the pH of the stannous DTPA solution was adjusted to pH 6-8 using 1N NaOH.
  • the product was purified on a Supelco Discovery C16 amide column (4 x 250 mm, 5 um pore size) eluted at a flow rate of 0.5 mL/min using an aqueous/organic gradient of 1 g/L ammonium acetate in water (A) and acetonitrile (B). The following gradient was used: 30.5% B to 35% B in 30 minutes, ramp up to 70% B in 10 min.
  • the compound, which eluted at a retention time of 21.2 minutes was collected into 500 ⁇ L of 50 mM citrate buffer (pH 5.2) containing 1% ascorbic acid and 0.1% HSA, and acetonitrile was removed using a Speed Vacuum (Savant). After purification, the compound had an RCP of >98%.
  • the 111 In-labeled compound was separated from unlabeled ligand using a Vydac C18 column (4.6 x 25 cm, 5 micron pore size) under the following conditions: aqueous phase, 1g/L ammonium acetate (pH 6.8); organic phase, acetonitrile. Gradient: 23% org. to 25% org. in 30 minutes, up to 30% org. in 2 minutes, hold for 10 minutes.
  • the compound, which eluted at a retention time of 20.8 min was collected into 200 ⁇ L of 50 mM citrate buffer (pH 5.2) containing 1% ascorbic acid and 0.1% HSA, and the acetonitrile was removed using a Speed Vacuum (Savant). After purification the compound had an RCP of >93%.
  • a histidine buffer was prepared by adjusting a 0.1M solution of histidine (Sigma) to pH 6.25 with concentrated ammonium hydroxide.
  • Ammonium acetate buffer was prepared by adjusting a 0.2 M solution of ammonium acetate (99.99%, Aldrich) to pH 5.5 using concentrated HCl (J. T. Baker, Ultra Pure).
  • High purity 111 InCl 3 (100 ⁇ L, 1.2 mCi, Mallinckrodt) was added to D4 (200 ⁇ g in 200 of 50% DMF, 10% DMSO, 20% acetonitrile and 20% water), followed by addition of 300 ⁇ L of histidine buffer. The final pH was 5.5. After incubation of the reaction mixture at 85°C for 45 minutes, the RCP was 20%.
  • 111 InCl 3 provided with a commercially available OctreoScanTM Kit (134 ⁇ L, 0.6 mCi, Mallinkrodt) was added to D4 (135 ⁇ g) in 162 ⁇ L of 0.2M ammonium acetate buffer. The final pH was 5.5. After incubation of the reaction mixture at 85°C for 45 min. the RCP was 20%.
  • Aqueous phase 0.1% TFA in water; organic phase: 0.085% TFA in acetonitrile.
  • Gradient 30% org. to 36% org. in 30 minutes, up to 60% org. in 5 minutes, hold for 5 minutes.
  • the compound was collected into 200 ⁇ L of 50 mM citrate buffer (pH 5.2) containing 1% ascorbic acid and 0.1% HSA. Acetonitrile was removed using a Speed Vacuum (Savant). The resulting compound had an RCP of 97%.
  • the product was purified on a Supelco Discovery C16 amide column (4 x 250 mm, 5 um pore size) eluted at a flow rate of 0.7 mL/min using an aqueous/organic gradient of 0.1% TFA in water (A) and 0.085% TFA in acetonitrile (B). The following gradient was used: 30% B to 42% B in 36 min, ramp up to 70% B in 10 min.
  • the compound, which eluted at a retention time of 37.1 min. was collected into 500 ⁇ L of 50 mM citrate buffer (pH 5.2) containing 0.2% HSA, and acetonitrile was removed using a Speed Vacuum (Savant). After purification, the compound had an RCP of >90%.
  • the product was purified on a Vydac peptide C18 column (4.6 x 250 mm) eluted at a flow rate of 1 mL/min using an aqueous/organic gradient of 0.1% TFA in water (A) and 0.085% TFA in acetonitrile (B). The following gradient was used: 30% B to 45% B in 40 min.
  • a peptide heterodimer (D6, shown below) was prepared as previously described in Example 9 using glutaric acid bis N-hydoxysuccinimidyl ester. The heterodimer was tested for binding to KDR-Fc using Biacore and an affinity contant was determined as follows.
  • the 11 ⁇ L should contain about 1.5 mCi.
  • No dose calibrator was in the room.
  • the sample was swirled and set in a lead pig to incubate for 6min with a swirl every 30 sec. After 6 min, the entire sample was transferred to the peptide that was in an Eppendorf tube. The sample was swirled and set to incubate for 8 min, with a swirl every 30 sec. After 8 min the reaction was quenched (terminated) with tyrosine (10mg/mL, a saturated solution), allowed to sit for 5 min, and then 2 ⁇ L was removed for a standard.
  • tyrosine 10mg/mL, a saturated solution
  • a 10 mL column of the D-salt polyacrylamide 1800 was used to separate the labeled peptide from labeled tyrosine.
  • the column was first washed with 10 mL saline, then 5 mL of 25 mM Tris, 0.4M NaCl, pH 7.5 containing 2.5% HSA to block non-specific sites. After the HSA buffer wash, the column was eluted with 60mL of the 25 mM Tris, 0.4 M NaCl buffer, and the column was stored overnight at 4°C.
  • the labeled sample contained 1.355 mCi, as determined by the dose calibrator.
  • the 2 ⁇ l sample that was removed as a standard contained 8.8 ⁇ Ci.
  • mice were injected with 100 ⁇ L 125 I-D6 and mice (in sets of 3) were sacrificed at the following time points: 0, 7, 15, 30, 90 minutes. Actual activity injected was about 6 ⁇ Ci. With 6 ⁇ Ci injected the corresponding peptide administered was ⁇ 0.5 ⁇ g per animal.
  • the counts were determined in a 50 ⁇ L plasma sample from each animal. For each set of three animals at each time point, the counts were averaged, converted to % injected dose/ml plasma (ID%/mL), and then plotted to assess the rate of clearance ( FIG. 19 ). Then this data was fit to either a 4 or 5 parameter equation to determine the biphasic half life of this molecule.
  • the 4 parameter fit resulted in a T 1/2 ⁇ of 2.55 minutes and a T 1/2 ⁇ of 64.66 minutes.
  • the 5 parameter fit resulted in a T 1/2 ⁇ of 2.13 minutes and a T 1/2 ⁇ of 23.26 minutes.
  • HUVECs were cultured in RPMI + 10% FCS +1% antibiotics + 1% 1-glutamin + 0.4% BBE (bovine brain extract) and seeded per well, 5000-10000/well in100 ⁇ L. The cells were allowed to recover for 24 h prior to use.
  • D6 completely inhibits HUVEC proliferation at 10 ⁇ g/mL in the presence of VEGF, similar to an anti-VEGF antibody (positive control).
  • PNC-1 Ac-AEGTGDLHCYFPWVCSLDPGPEGGGK-OH
  • P12-G one of the peptides that make up the heterodimer
  • P12-G does not inhibit proliferation this assay at the highest concentration tested (10 ⁇ g/mL).
  • the heterodimer clearly shows an enhanced ability to compete with VEGF in comparison with P12-G alone.
  • BIAcore determine the binding constants of peptide dimers D1 (a heterodimer of P12-G and a truncated form of P6-D) and D7 (a heterodimer of P5-D and P6-D) for murine KDR-Fc.
  • K D1 is a calculated K D based on kd 1 /ka 1
  • K D2 is a calculated K D based on kd 2 /ka 1 (i.e. avidity factor) *The chi2 value is a standard statistical measure of the closeness of the fit. For good fitting to ideal data, chi2 is of the same order of magnitude as the instrument noise in RU (typically ⁇ 2).
  • 293H cells were transfected with the KDR cDNA or mock-transfected by standard techniques described in Example 6. The cells were incubated with 125 I-VEGF in the presence or absence of PG-1 (Ac-ERVTTCWPGEYGGVECYSVAY-NH 2 ) (SEQ ID NO: 30) or D1 (at 300, 30, 3, and 0.3 nM). After washing the cells, the bound radioactivity was quantitated on a gamma counter.
  • PG-1 Ac-ERVTTCWPGEYGGVECYSVAY-NH 2
  • D1 at 300, 30, 3, and 0.3 nM
  • the percentage inhibition of VEGF binding was calculated using the formula [(Y1-Y2)x100/Y1], where Y1 is specific binding to KDR-transfected 293H cells in the absence peptides, and Y2 is specific binding to KDR-transfected 293H cells in the presence of peptide competitors. Specific binding to KDR-transfected 293H cells was calculated by subtracting the binding to mock-transfected 293H cells from the binding to KDR-transfected 293H cells.
  • Serum-starved HUVECs were placed, 100,000 cells per well, into the upper chambers of BD fibronectin-coated FluoroBlok 24-well insert plates.
  • Basal medium, with or without VEGF (10 ng/mL) in the presence or absence of increasing concentrations of PG-1 or D1 was added to the lower chamber of the wells.
  • quantitation of cell migration/invasion was achieved by post-labeling cells in the insert plates with a fluorescent dye and measuring the fluorescence of the invading/migrating cells in a fluorescent plate reader.
  • VEGF-stimulated migration was derived by subtracting the basal migration measured in the absence of VEGF.
  • PG-1 and D1 competed about equally well with 125 I-VEGF for binding to KDR-transfected cells, indicating that they possess comparable binding affinities as well as a comparable ability to inhibit VEGF from binding to KDR.
  • Tc-labeled D10 the ability of Tc-labeled D10 to bind KDR was assessed using KDR-transfected 293H cells.
  • the results show that Tc-labeled D10 bound significantly better to KDR transfected 293H cells than to mock transfected 293H cells, and good binding was maintained in the presence of 40% mouse serum.
  • a derivative of Tc-labeled D10 with its amino acid sequence scrambled, D18 was shown to possess no affinity for KDR-expressing cells, confirming the specificity of the D10 binding to those cells.
  • the product was purified on a Supelco Discovery C16 amide column (4 x 250 mm, 5 um pore size) eluted at a flow rate of 0.7 mL/min using an aqueous/organic gradient of 0.1% TFA in water (A) and 0.085% TFA in acetonitrile (B). The following gradient was used: 30% B to 42% B in 36 min, ramp up to 70% B in 10 min.
  • the compound, which eluted at a retention time of 32 min. was collected into 500 ⁇ L of 50 mM citrate buffer (pH 5.2) containing 0.2% HSA, and acetonitrile was removed using a Speed Vacuum (Savant). After purification, the compound had an RCP of >90%.
  • the entire reaction was injected on a Vydac 218TP54 C18 column (4.6 x 250 mm, 5 um silica) and eluted at a flow rate of 1.5 mL/min using an aqueous/organic gradient of 0.1 % TFA in water (A) and 0.085% TFA in acetonitrile (B).
  • the following gradient was used: 32% to 39% B in 30 minutes, ramp up to 80% B in 2 min.
  • the free ligand eluted at a retention time of 19 minutes.
  • the complex, which eluted at 24 minutes, was collected into 500 ⁇ L of 50 mM citrate buffer (pH 5.3) containing 0.1 % HSA and 1% Ascorbic Acid. Acetonitrile & excess TFA were removed using a Speed Vacuum (Savant) for 40 minutes. After purification, the compound had an RCP of 93%.
  • 293H cells were transfected using the protocol described in Example 6. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640). The cells in one half of the plate (48 wells) were mock-transfected (with no DNA) and the cells in the other half of the plate were transfected with KDR cDNA. The cells were 80-90% confluent at the time of transfection and completely confluent the next day, at the time of the assay; otherwise the assay was aborted.
  • Opti-MEMI was obtained from Invitrogen (cat. # 11058-021) and human serum albumin (HSA) was obtained from Sigma (cat. # A-3782).
  • HSA human serum albumin
  • Tc-labeled D10 and D18 were diluted in opti-MEMI with 0.1% HSA to provide solutions with final concentrations of 1.25, 2.5, 5.0, and 10 ⁇ Ci/mL of each Tc-labeled heterodimer.
  • a second set of dilutions was also prepared using a mixture of 40% mouse serum/60% opti-MEMI with 0.1% HSA as the diluent.
  • Cells were used 24 h after transfection, and to prepare the cells for the assay, they were washed 1X with 100 ⁇ L of room temperature opti-MEMI with 0.1% HSA. After washing, the opti-MEMI with 0.1% HSA was removed from the plate and replaced with 70 ⁇ L of 1.25, 2.5, 5.0, and 10 ⁇ Ci/mL of Tc-labeled D10 or D18 (prepared as above with both diluent solutions). Each dilution was added to three separate wells of mock and KDR-transfected cells. After incubating at room temperature for 1 h, the plates were washed 5 times with 100 ⁇ L of cold binding buffer (opti-MEMI with 0.1% HSA).
  • solubilizing solution 0.5 N NaOH
  • the solubilizing solution in each well was mixed by pipeting up and down, and transferred to 1.2 mL tubes. Each well was washed once with 100 ⁇ L of solubilizing solution and the washes were added to the corresponding 1.2 mL tube. Each 1.2 mL tube was then transferred to a 15.7 mm X 100 cm tube to be counted in an LKB Gamma Counter.
  • Tc-labeled D10 and D18 were assessed using transiently transfected 293H cells. As shown in FIG. 28A , Tc-labeled D10 bound significantly better to KDR transfected 293H cells, as compared to mock-transfected 293H cells in both the presence and absence of 40% mouse serum, although there was some inhibition in the presence of serum. The total specific binding of this Tc-labeled heterodimer to KDR-expressing cells was much greater than that observed previously with a Tc-labeled monomeric peptide (Example 5). Tc-labeled D18, on the other hand, displayed no affinity for either mock-transfected or KDR-transfected 293H cells, confirming the specificity of D10 binding.
  • D13 (306 ⁇ g) was added to a 2-mL autosampler vial with a ⁇ 450 ⁇ L conical insert and dissolved in 0.01N NH 4 OH (50 ⁇ L). To this was added 300 ⁇ L of 0.5M Ammonium Acetate containing stabilizers. A 6.8 ⁇ L aliquot of 177 LuCl 3 in 0.05N HCl (39.3 mCi) was added, the vial was crimp-sealed, warmed for 15 min at 37°C, cooled for ⁇ 5 minutes, and 10 ⁇ L of 1 % Na 2 EDTA.2H 2 O in H 2 O was added.
  • 293H cells were transfected using the protocol described in Example 6. Transfection was done in black/clear 96-well plates (Becton Dickinson, cat. # 354640). The cells in one half of the plate (48 wells) were mock-transfected (with no DNA) and the cells in the other half of the plate were transfected with KDR cDNA. The cells were 80-90% confluent at the time of transfection and completely confluent the next day, at the time of the assay; otherwise the assay was aborted.
  • Opti-MEMI media with 0.1% HAS was prepared as in Example 18.
  • a stock solution of Lu-labeled D13 was diluted in opti-MEMI with 0.1% HSA to provide solutions with final concentrations of 1.25, 2.5, 5.0, and 10 ⁇ Ci/mL of labeled heterodimer.
  • a second set of dilutions was also prepared using a mixture of 40% mouse serum/60% opti-MEMI with 0.1% HSA as the diluent.
  • Lu-labeled D13 The ability of Lu-labeled D13 to bind specifically to KDR was demonstrated using transiently-transfected 293H cells. As shown in FIG. 29 , Lu-labeled D13 bound significantly better to KDR transfected 293H cells, as compared to mock-transfected 293H cells in both the presence and absence of 40% mouse serum, although there was some binding inhibition in the presence of serum.
  • Biotinylated peptides P30-XB, P31-XB, P32-XB and biotinylated non-binding control peptide were used to prepare 1.25 ⁇ M stock solutions in 50% DMSO.
  • a 33.33 nM stock solution of 125 I-streptavidin was purchased from Amersham.
  • a stock solution of 13.33 nM I-125 streptavidin/100 nM VEGF was prepared by mixing 850 ml of I-125 streptavidin with 22 ⁇ l of 10 ⁇ M VEGF and 1275 ⁇ l of M199 media. Another stock solution was prepared in the same manner, but lacking VEGF.
  • nM peptide- 125 I-streptavidin complex solution ⁇ VEGF 500 ⁇ l of the 125 I-streptavidin (with & without VEGF) stock solutions (prepared in last step) were mixed with 24 ⁇ l of 1.25 ⁇ M peptide solution of P30-XB, P31-XB, P32-XB, or control peptide. The mixtures were incubated on a rotator at 4° C for 60 minutes, followed by addition of 50 ⁇ l of soft release avidin-sepharose (50% slurry in ddH 2 0) to remove excess peptides and another incubation for 30 minutes on a rotator at 4° C.
  • soft release avidin-sepharose 50% slurry in ddH 2 0
  • P30-XB was also the best KDR/VEGF complex binder among the peptides tested using fluorescence polarization and SPR (BiaCore) assays.
  • This example shows that peptide (P30-XB) can specifically bind to The KDR/VEGF complex present on the cell surface. Therefore, it may possibly be used in targeting the KDR/VEGF complex in vitro and in vivo for diagnostic or therapeutic purposes. Since the KDR/VEGF binding peptide only detects the functional and active KDR receptor and not all the KDR present on cell surface, it may be useful in detecting and/or treating active angiogenesis in tumors, metastasis, diabetic retinopathy, psoriasis, and arthropathies. Furthermore, these peptides, as well as other peptides which bind KDR/VEGF complex may advantageously be included in hetermultimers of the invention.
  • the following experiment assessed the ability of heterodimers D24 and D26 to block the VEGF-induced migration of HUVECs in culture and demonstrated that the added glycosylation and/or distinct spacer structure used in D26 enhanced its potency.
  • Serum-starved HUVECs were placed, 100,000 cells per well, into the upper chambers of BD fibronectin-coated FluoroBlok 24-well insert plates.
  • quantitation of cell migration/invasion was achieved by post-labeling cells in the insert plates with a fluorescent dye and measuring the fluorescence of the invading/migrating cells in a fluorescent plate reader.
  • the VEGF-induced migration was calculated for each experimental condition by subtracting the amount of migration that occurred when only basal medium was added to the lower chamber of the wells.
  • VEGF induced a large increase in endothelial cell migration in the assay, which was potently blocked by both D24 and D26 ( FIG. 32 ).
  • D26 was ten-fold more potent than D24 (IC 50 0.5 nM and 5 nM respectively), indicating that the glycosylation of D26 and/or its distinct spacer properties has enhanced its ability to bind KDR and block the effects of VEGF.
  • TK-1 structure provided below
  • a multimeric construct of the peptide TKPPR which binds to NP-1, a VEGF receptor which enhances the effects of VEGF mediated by KDR
  • Serum-starved HUVECs were placed, 100,000 cells per well, into the upper chambers of BD fibronectin-coated FluoroBlok 24-well insert plates.
  • Basal medium, with or without VEGF (10 ng/mL) in the presence or absence of varying concentrations of D6, or varying concentrations of D6 in combination with a constant 100 nM TK-1 (synthesized as described in WO 01/91805 A2 ) was added to the lower chamber of the wells.
  • quantitation of cell migration/invasion was achieved by post-labeling cells in the insert plates with a fluorescent dye and measuring the fluorescence of the invading/migrating cells in a fluorescent plate reader.
  • VEGF-induced migration was calculated for each experimental conditions by subtracting the amount of migration observed in the absence of VEGF.
  • VEGF induced a large increase in endothelial cell migration in the assay, which was potently blocked by D6 (IC 50 about 12.5 nM), but not by 100 nM TK-1 alone ( FIG. 33 ).
  • TK-1 was able to enhance the potency of D6 by about ten-fold when used in the assay simultaneously with D6 (IC 50 about 2.5 nM). This indicates that compounds containing the TKPPR sequence (or analogs) found in TK-1 can be used to enhance the potency of certain compounds such as D6 which compete with VEGF for binding to KDR.
  • 293H cells were transfected with the KDR cDNA or mock-transfected by standard techniques described in Example 6.
  • Streptavidin-HRP complexes containing P12-XB were prepared as in Example 6. Binding of the streptavidin-HRP complexes to the cells was carried out as in Example 6 with a complex concentration of 5.5 nM in the presence of 0 to 250 nM or 0 to 1000 nM of the following competing peptides: P13-XB, F1, F2, and F3. After determining the specific binding under each experimental condition, the IC 50 for each peptide was determined (where possible).
  • F1 composed of just the Asp-Trp-Tyr-Tyr binding motif that is also shared with PI2-XB along with the non-targeted Gly-Gly-Gly-Lys sequence that was added to most monomeric peptides synthesized based on phage display data, was the smallest fragment able to block P12-XB streptavidin-HRP complex binding with an IC 50 below one micromolar. Surprisingly, a larger fragment derived from P13-XB, F2, failed to significantly inhibit complex binding at one micromolar.
  • Heterodimers targeting two epitopes on a single target molecule results in superior binding to a homodimers that binds one of the two epitopes on the target molecule.
  • Serum-starved HUVECs were placed, 100,000 cells per well, into the upper chambers of BD fibronectin-coated FluoroBlok 24-well insert plates.
  • Basal medium containing either nothing or VEGF in the presence or absence of increasing concentrations of homodimeric D8 or heterodimeric D17, was added to the lower chamber of the wells.
  • quantitation of cell migration/invasion was achieved by post-labeling cells in the insert plates with a fluorescent dye and measuring the fluorescence of the invading/migrating cells in a fluorescent plate reader.
  • VEGF induced a large increase in endothelial cell migration in the assay, which was potently blocked by D17 but not D8 ( FIG. 34 ).
  • D17 blocked VEGF-induced migration with an IC 50 of about 250 nM while D8 had no significant effect on migration even at 800 nM. This is in spite of the fact that D8 used the full targeting sequence found inp13-XB while D17 contained a truncated version of the P13-XB sequence (as seen in F3) with a lower affinity for KDR (as demonstrated in Example 24).
  • a heterodimer with the capability of binding to two separate epitopes on the same target molecule can be more effective at blocking ligand binding to the target molecule than a homodimer containing the same or even more potent targeting sequences.
  • Disulfide bond substitution analogs of P12-G (P12 with non-target GGGK sequence) where the Cys residues at position 6 and 13 are replaced by a pair of amino acids, one with a carboxy-bearing side-chain (either Glu or Asp) and the other with an amino-bearing side chain [(Lys or Dpr (2,3-diaminopropanoic acid)] were prepared.
  • the cycle encompassing the same sequence positions as those included in p12-G (made by formation of the disulfide bond) was made by condensation of the side-chain amino and side-chain acid moieties, resulting in a lactam ring which bridges the residues 6-13 as does the disulfide bond of P12-G.
  • Table 10 10.
  • This treatment served to expose only the carboxy and amino groups of Glu6 and Lysl3 which are required for the lactam forming reaction.
  • the on-resin cyclization of 2 was carried out using HATU (114 mg, 0.3 mmol), NMM (66 ⁇ L, 0.6 mmol) and DMF (10 mL) for 3 h. The completion of the cyclization was monitored by Kaiser test.
  • the peptide was cleaved from the peptide resin 3 using reagent B for 4 h. The resin was filtered and the filtrate was evaporated to a paste. The crude peptide was precipitated in ether and washed twice with ether.
  • the cyclic peptide was purified by preparative reverse phase linear gradient HPLC using a Waters-YMC C-18 column (250 mm x 30 mm i.d.) with CH 3 CN into H 2 O (both with 0.1% TFA) as the eluent. Lyophilization of the product-containing fractions afforded 8 mg of (P33-L). P34-L, P35-L, P36-L and P37-L were prepared similarly.
  • 293H cells were transfected with the KDR cDNA or mock-transfected by standard techniques described in Example 6.
  • Streptavidin-HRP complexes containing P12-XB were prepared as in Example 6. Binding of the streptavidin-HRP complexes to the cells was carried out as in Example 6 with a complex concentration of 5.5 nM in the presence of 0 to 250 nM P12-G, or P34-L. After determining the specific binding under each experimental condition, the IC 50 for each peptide was determined.
  • P34-L containing a lactam disulfide bridge replacement, was still able to compete with P12-XB-streptavidin-HRP complexes for binding to KDR although some affinity was lost (IC 50 108 nM versus 13 nM for P12-G).
  • lactam peptides or similarly prepared lactam analogs of binding polypeptides disclosed herein may be utilized instead of the disulfide bridge-containing peptides in heteromultimers of the invention.
  • Table 11 P12-G and P34-L (disulfide bridge replacement analog) in a displacement assay competing with a complex composed of P12-XB and streptavidin-HRP for binding to KDR-expressing cells. Fragment (Ref Number) IC 50 , nM P12-G 13 P34-L 108
  • the binding constant was determined for the dimer D28 binding to immobilized cMet-Fc.
  • cMet-Fc Three densities of cMet-Fc (R&D Systems) were cross- linked to the dextran surface of a CM5 sensor chip by the standard amine coupling procedure (3 ⁇ M solution diluted 1:100, 1:50, or 1:20 with 50 mM acetate, pH 5.5). Flow cell 1 was activated and then blocked to serve as a reference subtraction. Final immobilization levels achieved:
  • Kd value of 0.79 nM was obtained for D28 (heterodimer of P26-A and P27-X), which was significantly better than KD value of either heterodimer alone.
  • Microvascular endothelial cells were used to assess the in vitro efficacy of D6 and related analogues for their ability to inhibit VEGF-stimulated proliferation.
  • MVECs (passage 2) were grown to 90% confluency, trypsinized and plated in gelatin-coated 96-well microtiter plates at a density of 4-8 x 10 3 cells/well. Sixteen to 24 hours after plating, the cells were washed one time (200 ⁇ L/well) with media devoid of fetal bovine serum but containing 0.1 % bovine serum albumin (BSA). Fresh BSA-containing media was added to each well and the cells were incubated for an additional 24 hours.
  • BSA bovine serum albumin
  • Conditions are described providing methods for determining efficacy of three (3) concentrations for a test compound (dimer D6) suspected of having anti-angiogenic activity on SW-480 human colon carcinoma cells using an in vivo xenograft tumor model.
  • Athymic nude mice are acceptable hosts for the growth of allogenic and heterogenic cells. Nude mice are required in Points to Consider in the Characterization of Cell Lines used to Produce Biologicals ( Points to Consider in the Characterization of Cell Lines used to Produce Biologicals, FDA 1993 ).
  • D6 is a synthetic heterodimeric peptide suspected of having anti-angiogenic activity. This peptide binds to the human VEGF receptor 2 (KDR) with high affinity and competes with VEGF binding. The following experiments confirms its anti-angiogenic activity.
  • KDR human VEGF receptor 2
  • Colon carcinoma, SW-480, cells were cultured in Dulbecco's Modified Eagles Medium (DMEM) supplemented with 4 mM L-glutamine, 0.1 mM non-essential amino acids, 50 mg/mL Gentamicin, 250 mg/mL Fungizone and 10% heat inactivated fetal bovine serum at 37°C in 95% air and 5% CO 2 .
  • DMEM Dulbecco's Modified Eagles Medium
  • HBSS Hanks Balanced Salt Solution
  • Sterile phosphate buffered saline (BioWhittaker) was manufactured in accordance with cGMP regulations and was cell culture tested to assure compatibility; having a pH of 7.3-7.7 and an osmolarity of 271-287 mOsm/kg.
  • PBS was the vehicle used to reconstitute Test Articles and for vehicle control injections.
  • Cisplatin (American Pharmaceutical Partners, Inc.; Los Angeles, CA) was prepared according to manufacture's specifications. Cisplatin was prepared in an aseptic fashion using a BL2 BioChem guard hood.
  • mice were uniquely numbered using an ear tag system. Additionally, cages were marked with cage cards minimally identifying group number, animal number, study number and IACUC protocol number.
  • mice were fed gamma-irradiated rodent chow ad libitum. Tap water was sterilized and supplied via bottle and sipper tube ad libitum.
  • mice were housed by groups in semi-rigid isolators. Mice were housed in flat bottom caging containing five to ten animals. Cages contained gamma-irradiated contact bedding. The number of mice in each cage may have been altered due to the behavior of the mice, changes were noted in the isolator inventory. The housing conforms to the recommendations set forth in the Guide for the Care and Use of Laboratory Animals, National Academy Press, Washington, D.C., 1996 and all subsequent revisions.
  • Environmental controls were set to maintain a temperature of 16-26°C (70 ⁇ 8°F) with a relative humidity of 30-70. A 12:12 hour light: dark cycle was maintained.
  • mice were allowed to acclimate to the laboratory environment for 24-hours prior to the study start. Mice were observed for signs of disease, unusual food and/or water consumption or other general signs of poor condition. At the time of animal receipt, animals were clinically observed and appeared to be healthy.
  • mice Female athymic nude mice (Crl:NU/NU-nuBR) at 6-8 weeks of age were used in this study. A total of 115 mice were injected subcutaneously into the right lateral thorax with 5 ⁇ 10 6 SW-480, human colon carcinoma cells. When tumors reached a target window size of approximately 150 ⁇ 75 mg, 90 tumor-bearing mice were randomly selected and distributed into one of nine groups. Test compound and vehicle were administered intraperitoneally (IP), Cisplatin was administered intravenously (IV). Tumor measurements were recorded twice weekly using hand-held calipers. Mice were monitored daily for signs of toxicity and morbidity. At study termination, animals were euthanized by carbon dioxide overdose and necropsied for tissue collection.
  • IP intraperitoneally
  • IV intravenously
  • Each group contained ten (10) tumor-bearing mice.
  • Groups 1 and 2 contained untreated and vehicle treated negative control mice, respectively.
  • Groups 3, 4, and 5 contained mice that received one of three different concentrations of the D6 heterodimer.
  • Groups 6, 7, and 8 contained mice that received one of three different concentrations of a different anti-angiogenic peptide.
  • Group 9 contained mice that received cisplatin, a standard chemotherapeutic compound as a positive control.
  • Dose levels for each group are provided in Table 12. Dosing began the same day that animals were randomly sorted into groups (Study Day 7). Each dose was removed from the dose vial using aseptic technique for each animal and the injection site was wiped with an alcohol swab prior to dose administration. Doses were administered with a 1.0 mL syringe and a 27-gauge x 1 ⁇ 2" needle for each mouse. Table 12. Study Treatment Groups Group Test Compound Concentration mg/kg Number of Animals 1 Untreated - 10 2 Vehicle 0 10 3 D6 0.05 10 4 D6 0.5 10 5 D6 5.0 10 9 Cisplatin 6.0 10
  • mice received daily intraperitoneal (IP) injections for 15 days. Cisplatin was administered every other workday for a total of five (5) doses via an intravenous route.
  • IP intraperitoneal
  • Morbidity included signs of illness such as, but not limited to, emaciation, dehydration, lethargy, hunched posture, unkempt appearance, dyspnea and urine or fecal staining.
  • tumor measurements were taken twice weekly throughout the study by measuring the length and width of tumors with calibrated calipers. Measurements occurred a minimum of 3-4 days apart, except when animals were euthanized and measurements were taken; this sometimes resulted in an interval of less than 3 days.
  • mice in groups 1, 2, 3, 4, and 5 were submitted for necropsy when tumors reached a group mean target size of ⁇ 1000 mg over two (2) consecutive measurements within a group.
  • Animals were submitted for necropsy to the Charles River Laboratories Health Monitoring Laboratory (HM), Wilmington, MA. All animals were euthanized on Study Day 22, short of received the full 28 day treatment regiment with Test Articles because mean tumor size was ⁇ 1000 mg in Test Article Treated Groups 3-8. All animals were humanely euthanized by carbon dioxide (CO 2 ) inhalation.
  • CO 2 carbon dioxide
  • Frozen blocks were made of tumors and kidneys for each animal. A representative section of the tissue (tumor, kidneys) was taken. Kidney sections included the cortex and medulla. Tissue sections were placed in the bottom of a labeled plastic-freezing mold. Tissue was embedded with OCT medium. Blocks were submerged into isopentane chilled with dry ice until frozen. Blocks were briefly examined for quality, and stored on dry ice.
  • Test Compound (D6) did not show any signs of toxicity at the doses used in this study.
  • mice were euthanized on Study Day 22. All mice, except Group 9 mice, were euthanized prior to completing Test compound administration, because mean tumor size was ⁇ 1000 mg in Groups 1-8. Group 9, Cisplatin-treated animals were euthanized on Study Day 22 when mean tumor weight was 995 mg. No animals died while on study.
  • mice Throughout the study palpable masses were detected in all mice, with tumors progressively growing for the duration of the study. As expected tumors in untreated and vehicle treated negative control mice (Groups 1 and 2) grew the fastest, reaching a mean tumor size of 1000 mg on or before Study Day 20. In addition, animals treated with Cisplatin (Group 9) developed tumors that grew the slowest reaching a mean tumor size of 995 mg at study termination (Day 22).
  • the following example describes the preparation of an ultrasound contrast agent conjugated to a KDR-binding heterodimer of the invention and the ability of the heterdimer conjugated contrast agent to localize to KDR-expressing cells in vitro and angiogenic tissue in vivo.
  • DSPC disearoylphosphatidylcholine
  • DPPG.Na disearoylphosphatidylglycerol sodium salt
  • N-MPB-PE N-MPB-PE
  • the air in the headspace was replaced with a mixture of C 4 F 10 /Air (50/50) and vials capped and crimped.
  • the lyophilized samples were reconstituted with 10 ml saline solution (0.9%-NaCl) per vial, yielding a suspension of phospholipids stabilized microbubbles.
  • D23 (a dimeric construct of P6- and P12-derived sequences) was conjugated with a preparation of microbubbles as above described, according to the following methodology.
  • the thioacetylated peptide (200 ⁇ g) was dissolved in 20 ⁇ l DMSO and then diluted in 1 ml of Phosphate Buffer Saline (PBS).
  • PBS Phosphate Buffer Saline
  • This solution was mixed to the N-MPB-functionalized microbubbles dispersed in 18 ml of PBS-EDTA 10 mM, pH 7.5 and 2 ml of deacetylation solution (50 mM sodium phosphate, 25 mM EDTA, 0.5 M hydroxylamine.HCl, pH 7.5) was added.
  • the headspace was filled with C 4 F 10 /Air (50/50) and the mixture was incubated for 2.5 hours at room temperature under gentle agitation (rotating wheel), in the dark. Conjugated bubbles were washed by centrifugation. Similarly, the monomer peptides making up D23 were separately conjugated to two different microbubble preparations according to the methodology described above.
  • 293H cells were transfected with KDR DNA as set forth in Example 6.
  • the transfected cells were incubated with a suspension of peptide-conjugated microbubbles prepared as described above.
  • a small plastic cap is filled with a suspension containing 1 to 3.10 8 peptide-conjugated microbubbles and the cap covered with an inverted Thermanox® coverslip is placed so that the transfected cells are in contact with the conjugated microbubbles. After about 20 min at RT, the coverslip is lifted with tweezers, rinsed three times in PBS and examined under a microscope to assess binding of the conjugated microbubbles.
  • Table 13 shows the results of the binding affinity (expressed as coverage % of the imaged surface) of targeted microvesicles of the invention to KDR transfected cells, as compared to the binding of the same targeted microvesicles to Mock-transfected cells.
  • a known model of angiogenic tissue (the rat Mat B III model) was used to examine the ability of phospholipid stabilized microbubbles conjugated to a heteromultimer of the invention to localize to and provide images of angiogenic tissue.
  • mice Female Fisher 344 rat (Charles River Laboratories, France) weighing 120 to 160g were used for the MATBIII tumor implantation. Male OFA rats (Charles River Laboratories, France) weighing 100 to 150g were used for Matrigel injection.
  • Rats were anesthetized with an intramuscular injection (1ml/kg) of Ketaminol® /xylazine (Veterinaria AG/Sigma) (50/10mg/ml) mixture before implantation of Matrigel or MatBIII cells.
  • Ketaminol® /xylazine Veterinaria AG/Sigma
  • animals were anesthetized with the same mixture, plus subcutaneous injection of 50% urethane (1g/kg).
  • a rat mammary adenocarcinoma designated 13762 Mat B III, was obtained from ATCC (CRL-1666) and grown in McCoy's 5a medium + 10% FCS. 1% glutamine and 1% pen/strep (Invitrogen cat# 15290-018). Cells in suspension were collected and washed in growth medium, counted, centrifuged and resuspended in PBS or growth medium at 1.10 7 cells per ml.
  • Tumor imaging was performed using an ultrasound imaging system ATL HDI 5000 apparatus equipped with a L7-4 linear probe.
  • an intravenous bolus of unconjugated microbubbles or microbubbles conjugated to non-specific peptide was injected.
  • the linear probe was fixed on the skin directly on line with the implanted tumors and accumulation of targeted bubbles was followed during thirty minutes.
  • a perfusion of SonoVue® was administrated before injecting the test bubble suspension. This allows to evaluate the vascularization status and the video intensity obtained after SonoVue® injection is taken as an internal reference.
  • a baseline frame was recorded and then insonation was stopped during the injection of the microbubbles. At various time points after injection (1, 2, 5, 10, 15, 20, 25,30 minutes) insonation was reactivated and 2 frames of one second were recorded on a videotape.
  • Video frames from tumor imaging experiments were captured and analysed with the video-capture and Image-Pro Plus 2.0 software respectively.
  • the same rectangular Area of Interest (AOI) including the whole sectional area of the tumor was selected on images at different time points (1, 2, 5, 10, 15, 20, 25, 30 minutes).
  • AOI Area of Interest
  • Results are expressed as the percentage of the signal obtained with SonoVue®, which is taken as 100%.
  • SonoVue® SonoVue®
  • FIG. 37 shows uptake and retention of bubble contrast in the tumor up to 30 minutes post injection for suspensions of phospholipid stabilized microbubbles conjugated to a heteromultimeric construct of the invention prepared as described above (D23).
  • the same bubbles showed only transient (no more than 10 minutes) visualization/bubble contrast in the AOI situated outside the tumor site.

Claims (15)

  1. Multivalente Verbindung umfassend zwei Polypeptide mit Spezifität für verschiedene Epitope auf einem Protein-Tyrosin-Kinase-Rezeptor ausgewählt aus der Gruppe bestehend aus KDR und cMet, wobei die Verbindung ausgewählt ist aus der Gruppe bestehend aus
    Figure imgb0100
    Figure imgb0101
    Figure imgb0102
    Figure imgb0103
    Figure imgb0104
    Figure imgb0105
    Figure imgb0106
    Figure imgb0107
    Figure imgb0108
    Figure imgb0109
    Figure imgb0110
    Figure imgb0111
    Figure imgb0112
    Figure imgb0113
    Figure imgb0114
  2. Verbindung nach Anspruch 1, wobei die Polypeptide Spezifität für verschiedene Epitope auf KDR haben und die Verbindung ausgewählt ist aus der Gruppe bestehend aus D1, D5, D6, D7, D9, D17, D19, D20, D22, D23, D24, D25, D26, D27, D31.
  3. Verbindung nach Anspruch 1, weiterhin umfassend wenigstens eine Marker-Gruppe, wobei die Marker-Gruppe vorzugsweise eine Gruppe umfasst, die durch Magnetresonanz-Bildgebung, Ultraschall-Bildgebung, optische Bildgebung, Sonolumineszenz-Bildgebung, photoakustische Bildgebung oder nukleare Bildgebung detektierbar ist oder ein Ultraschall-Kontrastmittel, einen Photomarker oder ein biolumineszentes Molekül
    oder
    ein therapeutisches Mittel, wobei das therapeutische Mittel vorzugsweise ein bioaktives Mittel, ein zytotoxisches Mittel, ein Medikament, ein chemotherapeutisches Mittel oder ein radiotherapeutisches Mittel umfasst.
  4. Verbindung nach Anspruch 3, wobei die Marker-Gruppe oder das therapeutische Mittel einen oder mehrere Chelator(en) umfasst, die mit einem paramagnetischen Metallion superparamagnetischen Partikeln komplexiert sind, ein Ultraschall-Kontrastmittel, einen oder mehrere Photomarker oder einen oder mehrere Chelator(en), die mit einem Radionuklid komplexiert sind.
  5. Verbindung nach Anspruch 4, wobei das Radionuklid 18F, 124I, 125 I, 131 I, 123 I, 77Br, 76Br, 99mTC, 51Cr, 67Ga, 68Ga, 47SC, 51Cr, 167Tm, 141Ce, 111In, 168Yb, 175Yb, 140La, 90Y, 88Y, 153Sm, 166Ho, 165Dy, 166Dy, 62Cu, 64Cu, 67Cu, 97Ru, 103Ru, 186Re, 188Re, 203Pb, 211Bi, 212Bi, 213Bi, 214Bi, 105Rh, 109Pd, 117mSn, 149Pm, 161Tb, 177Lu, 198Au oder 199Au ist.
  6. Verbindung nach Anspruch 3, wobei die Marker-Gruppe umfasst
    eine Gruppe, die durch optische Bildgebung detektierbar ist, und der detektierte optische Parameter ausgewählt ist aus der Gruppe bestehend aus transmittierter Strahlung, Absorption, Fluoreszenz- oder Phosphoreszenz-Emission, Lichtreflektion, Änderungen in der Absorbanz, Amplitude oder Maxima, und elastisch gestreute Strahlung,
    oder
    einen Photomarker, der einen optischen Farbstoff umfasst, optional ein organisches Chromophor oder Fluorophor.
  7. Verbindung nach Anspruch 3, weiterhin umfassend einen Linker zwischen der multivalenten Verbindung und der Marker-Gruppe oder dem therapeutisehen Mittel, wobei der Linker vorzugsweise eine substituierte Alkyl-Kette, eine unsubstituierte Alkyl-Kette, ein Polyethylenglykol-Derivat, einen Aminosäure-Spacer, einen Zucker, einen aliphatischen Spacer, einen aromatischen Spacer, ein Lipidmolekül oder eine Kombination davon umfasst.
  8. Verbindung nach Anspruch 5, wobei der Chelator ausgewählt ist aus der Gruppe bestehend aus:
    Figure imgb0115
    Figure imgb0116
     wobei X ist CH2 oder O;
    Y ist C1-C10 verzweigtes oder unverzweigtes Alkyl-, Aryl-, Aryloxy-, Arylamino-, Arylaminoacyl- oder Aralkyl- umfassend C1-C10 verzweigte oder unverzweigte Alkylgruppen, C1-C10 verzweigte oder unverzweigte Hydroxy- oder Polyhydroxyalkyl-Gruppen oder Polyalkoxyalkyl- oder Polyhydroxypolyalkoxyalkyl-Gruppen;
    J ist C(=O)-, OC(=O)-, SO2-, NC(=O)-, NC(=S)-, N(Y), NC(=NCH3)-, NC(=NH)-, N=N-, ein Homopolyamid oder ein Heteropolyamin aus synthetischen oder natürlich vorkommenden Aminosäuren;
    und n ist 1-100.
    und der Chelator ist optional mit 99mTc, 186Re, oder 188Re komplexiert
    oder
    der Chelator hat die folgende Struktur:
    Figure imgb0117
     und der Chelator ist optional mit 99mTc komplexiert
    oder
    der Chelator ist ausgewählt aus der Gruppe bestehend aus:
    Figure imgb0118
    Figure imgb0119
    Figure imgb0120
     wobei R eine Alkylgruppe ist
    und der Chelator ist optional mit 177Lu, 90Y, 153Sm, 111In, or 166Ho komplexiert.
  9. Verbindung nach Anspruch 8, konjugiert an einen Chelator, wobei die multivalente Verbindung, die an einen Chelator konjugiert ist, vorzugsweise ausgewählt ist aus der Gruppe bestehend aus D17, D26, D31.
  10. Verbindung nach Anspruch 1, wobei das besagte Dimer umfasst:
    Figure imgb0121
     optional weiterhin umfassend wenigstens eine Marker-Gruppe oder therapeutisches Mittel, wobei die Marker-Gruppe vorzugsweise eine Gruppe umfasst, die durch Ultraschall-Bildgebung detektierbar ist.
  11. Ultraschall-Kontrastmittel umfassend entweder
    ein Vesikel konjugiert an wenigstens eine multivalente Verbindung nach Anspruch 1 ausgewählt aus der Gruppe bestehend aus D1, D5, D6, D7, D9, D19, D20, D22, D23, 24, D25, D27, D31,
    oder
    ein Vesikel-bildendes Material, das verwendet wird, um ein Vesikel zu bilden, das an wenigstens eine multivalente Verbindung nach Anspruch 1 ausgewählt aus der Gruppe bestehend aus D1, D5, D6, D7, D9, D19, D20, D22, D23, D24, D25, D27, D31, konjugiert ist.
  12. Mittel nach Anspruch 11, wobei das Vesikel-bildende Material ausgewählt ist aus der Gruppe bestehend aus Tensiden, Lipiden, Sphingolipiden, Oligolipiden, Phospholipiden, Proteinen, Polypeptiden, Kohlenhydraten und synthetischen oder natürlichen polymeren Materialien.
  13. Mittel nach Anspruch 11, wobei
    entweder das Vesikel über einen Linker an die multivalente Verbindung konjugiert ist
    oder und das Vesikel-bildende Material umfasst ein oder mehrere Phospholipide und ist über einen Linker an die multivalente Verbindung konjugiert,
    wobei der Linker vorzugsweise ausgewählt ist aus der Gruppe bestehend aus einer substituierten Alkylkette, einer unsubstituierten Alkylkette, einem Polyethylenglykol-Derivat, einem Aminosäure-Spacer, einem Zucker, einem aliphatischen Spacer, einem aromatischen Spacer, einem Lipidmolekül oder einer Kombination davon.
  14. Multivalente Verbindung umfassend zwei Polypeptide mit Spezifität für verschiedene Epitope auf einem Protein-Tyrosin-Kinase-Rezeptor ausgewählt aus der Gruppe bestehend aus KDR und cMet, wobei die Verbindung ausgewählt ist aus der Gruppe bestehend aus
    Figure imgb0122
    Figure imgb0123
    Figure imgb0124
    Figure imgb0125
    Figure imgb0126
    Figure imgb0127
    Figure imgb0128
    Figure imgb0129
    Figure imgb0130
    Figure imgb0131
    Figure imgb0132
    Figure imgb0133
  15. Verbindung nach Anspruch 14, wobei die Polypeptide Spezifität für verschiedene Epitope auf KDR haben und die Verbindung ausgewählt ist aus der Gruppe bestehend aus D4, D10, D11, D12, D13, D14, D15, D16 und D21
    oder
    die Polypeptide haben Spezifität für verschiedene Epitope auf cMet und die Verbindung ist ausgewählt aus D28, D29, D30.
EP03726024.7A 2002-03-01 2003-03-03 Multivalente konstrukte für therapeutische und diagnostische anwendungen Expired - Lifetime EP1482987B1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
SI200332395T SI1482987T1 (sl) 2002-03-01 2003-03-03 Večvalentni konstrukti za terapevtske in diagnostične aplikacije

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US36082102P 2002-03-01 2002-03-01
US360821P 2002-03-01
US44020103P 2003-01-15 2003-01-15
US440201P 2003-01-15
PCT/US2003/006656 WO2003084574A1 (en) 2002-03-01 2003-03-03 Multivalent constructs for therapeutic and diagnostic applications

Publications (3)

Publication Number Publication Date
EP1482987A1 EP1482987A1 (de) 2004-12-08
EP1482987A4 EP1482987A4 (de) 2007-03-07
EP1482987B1 true EP1482987B1 (de) 2014-08-13

Family

ID=28794312

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03726024.7A Expired - Lifetime EP1482987B1 (de) 2002-03-01 2003-03-03 Multivalente konstrukte für therapeutische und diagnostische anwendungen

Country Status (8)

Country Link
EP (1) EP1482987B1 (de)
JP (1) JP2005519980A (de)
AU (1) AU2003228276B8 (de)
CA (1) CA2477935C (de)
ES (1) ES2523654T3 (de)
HK (1) HK1071999A1 (de)
SI (1) SI1482987T1 (de)
WO (1) WO2003084574A1 (de)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8623822B2 (en) 2002-03-01 2014-01-07 Bracco Suisse Sa KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy
US7794693B2 (en) 2002-03-01 2010-09-14 Bracco International B.V. Targeting vector-phospholipid conjugates
US7666979B2 (en) * 2002-03-01 2010-02-23 Bracco International B.V. Methods for preparing multivalent constructs for therapeutic and diagnostic applications and methods of preparing the same
US20050250700A1 (en) * 2002-03-01 2005-11-10 Sato Aaron K KDR and VEGF/KDR binding peptides
CA2513044A1 (en) 2002-03-01 2004-08-05 Dyax Corp. Kdr and vegf/kdr binding peptides and their use in diagnosis and therapy
US7261876B2 (en) 2002-03-01 2007-08-28 Bracco International Bv Multivalent constructs for therapeutic and diagnostic applications
US7211240B2 (en) 2002-03-01 2007-05-01 Bracco International B.V. Multivalent constructs for therapeutic and diagnostic applications
CN100374165C (zh) 2003-02-04 2008-03-12 伯拉考国际股份公司 超声造影剂及其制备方法
JP5513708B2 (ja) 2003-12-22 2014-06-04 ブラッコ・シュイス・ソシエテ・アノニム 造影イメージング用の気体封入マイクロベシクル・アセンブリー
DE602005010424D1 (de) 2004-06-03 2008-11-27 Bracco Research Sa Liposomale anordnung für die therapeutische und/oder diagnostische anwendung
WO2006018433A1 (en) 2004-08-18 2006-02-23 Bracco Research Sa Gas-filled microvesicles composition for contrast imaging
EP1714642A1 (de) 2005-04-18 2006-10-25 Bracco Research S.A. Pharmazeutische Formulierung mit gasgefüllten Mikrokapseln zur ultraschallgesteuerten Freisetzung
MX2008007321A (es) * 2005-12-09 2008-09-30 Bracco Int Bv Conjugados fosfolipido de vector dirigido.
JP5420410B2 (ja) 2006-09-05 2014-02-19 ブラッコ・シュイス・ソシエテ・アノニム ポリマー修飾脂質を含むガス封入微小胞
WO2008075192A2 (en) 2006-12-19 2008-06-26 Bracco International Bv Targeting and therapeutic compounds and gas-filled microvesicles comprising said com ounds
JP5491511B2 (ja) 2008-10-07 2014-05-14 ブラッコ・シュイス・ソシエテ・アノニム 抗ポリマー抗体およびそれと結合するリポソームまたは微小胞を含むターゲッティング構築物
WO2011080401A1 (en) * 2009-12-31 2011-07-07 Licentia Ltd Receptor tyrosine kinase-binding compositions
JP6231263B2 (ja) * 2012-07-17 2017-11-15 株式会社島津製作所 アフィニティ支持体及びそれを用いた物質の捕捉方法
EP2934740B1 (de) 2012-12-21 2019-12-11 Bracco Suisse SA Gasgefüllte mikrovesikel
WO2016097130A1 (en) 2014-12-18 2016-06-23 Bracco Suisse Sa Targeted gas-filled microvesicles formulation
US11717570B2 (en) 2019-05-15 2023-08-08 Bracco Suisse Sa Gas-filled microvesicles
US20200360289A1 (en) 2019-05-15 2020-11-19 Bracco Suisse Sa Freeze-dried product and gas-filled microvesicles suspension

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000063380A1 (en) * 1999-04-16 2000-10-26 Genentech, Inc. Vascular endothelial cell growth factor variants and uses thereof
WO2001052875A1 (en) * 2000-01-18 2001-07-26 Ludwig Institute For Cancer Research Vegf-d/vegf-c/vegf peptidomimetic inhibitor

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT1066380E (pt) * 1998-05-19 2002-05-31 Avidex Ltd Receptor de celula t soluvel
CA2477836A1 (en) * 2002-03-01 2003-09-12 Dyax Corp. Kdr and vegf/kdr binding peptides and their use in diagnosis and therapy
CA2513044A1 (en) * 2002-03-01 2004-08-05 Dyax Corp. Kdr and vegf/kdr binding peptides and their use in diagnosis and therapy
US7211240B2 (en) * 2002-03-01 2007-05-01 Bracco International B.V. Multivalent constructs for therapeutic and diagnostic applications

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000063380A1 (en) * 1999-04-16 2000-10-26 Genentech, Inc. Vascular endothelial cell growth factor variants and uses thereof
WO2001052875A1 (en) * 2000-01-18 2001-07-26 Ludwig Institute For Cancer Research Vegf-d/vegf-c/vegf peptidomimetic inhibitor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HERYNK MATTHEW H ET AL: "Down-regulation of c-Met inhibits growth in the liver of human colorectal carcinoma cells.", CANCER RESEARCH 1 JUN 2003 LNKD- PUBMED:12782608, vol. 63, no. 11, 1 June 2003 (2003-06-01), pages 2990 - 2996, ISSN: 0008-5472 *

Also Published As

Publication number Publication date
AU2003228276A1 (en) 2003-10-20
AU2003228276B8 (en) 2010-02-18
CA2477935C (en) 2015-01-06
AU2003228276B2 (en) 2009-09-03
WO2003084574A1 (en) 2003-10-16
CA2477935A1 (en) 2003-10-16
ES2523654T3 (es) 2014-11-28
SI1482987T1 (sl) 2014-12-31
EP1482987A1 (de) 2004-12-08
JP2005519980A (ja) 2005-07-07
HK1071999A1 (en) 2005-08-12
EP1482987A4 (de) 2007-03-07

Similar Documents

Publication Publication Date Title
US9056138B2 (en) Multivalent constructs for therapeutic and diagnostic applications
US7854919B2 (en) Multivalent constructs for therapeutic and diagnostic applications
US9629934B2 (en) KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy
EP1482987B1 (de) Multivalente konstrukte für therapeutische und diagnostische anwendungen
US7666979B2 (en) Methods for preparing multivalent constructs for therapeutic and diagnostic applications and methods of preparing the same
JP5039075B2 (ja) Ｋｄｒおよびｖｅｇｆ／ｋｄｒ結合ペプチドならびに診断および治療におけるその使用
US8623822B2 (en) KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy
US20050250700A1 (en) KDR and VEGF/KDR binding peptides
CA2779639A1 (en) Multivalent constructs for therapeutic and diagnostic applications

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041001

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SATO, AARON

Inventor name: RAMALINGAM, KONDAREDDIAR

Inventor name: POCHON, SIBYLLE

Inventor name: MARINELLI, EDMUND, R.

Inventor name: SONG, BO

Inventor name: NUNN, ADRIAN

Inventor name: FAN, HANG

Inventor name: WALKER, SHARON, MICHELE

Inventor name: DRANSFIELD, DANIEL, T.

Inventor name: ARBOGAST, CHRISTOPHE

Inventor name: LINDER, KAREN, E.

Inventor name: VON WRONSKI, MATHEW, A.

Inventor name: SHRIVASTAVA, AJAY

Inventor name: BUSSAT, PHILIPPE

Inventor name: NANJAPPAN, PALANIAPPA

Inventor name: SWENSON, ROLF, E.

Inventor name: PILLAI, RADHAKRISHNA

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1071999

Country of ref document: HK

A4 Supplementary search report drawn up and despatched

Effective date: 20070201

RIN1 Information on inventor provided before grant (corrected)

Inventor name: LINDER, KAREN, E.

Inventor name: MARINELLI, EDMUND, R.

Inventor name: SATO, AARON

Inventor name: POCHON, SIBYLLE

Inventor name: NUNN, ADRIAN

Inventor name: PILLAI, RADHAKRISHNA

Inventor name: SHRIVASTAVA, AJAY

Inventor name: WALKER, SHARON, MICHELE

Inventor name: BUSSAT, PHILIPPE

Inventor name: DRANSFIELD, DANIEL, T.

Inventor name: FAN, HANG

Inventor name: SONG, BO

Inventor name: RAMALINGAM, KONDAREDDIAR

Inventor name: NANJAPPAN, PALANIAPPA

Inventor name: VON WRONSKI, MATHEW, A.

Inventor name: ARBOGAST, CHRISTOPHE

Inventor name: SWENSON, ROLF, E.

17Q First examination report despatched

Effective date: 20080915

R17C First examination report despatched (corrected)

Effective date: 20081218

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SATO, AARON

Inventor name: SWENSON, ROLF, E.

Inventor name: WALKER, SHARON, MICHELE

Inventor name: RAMALINGAM, KONDAREDDIAR

Inventor name: SONG, BO

Inventor name: DRANSFIELD, DANIEL, T.

Inventor name: YAN, FENG

Inventor name: POCHON, SIBYLLE

Inventor name: VON WRONSKI, MATHEW, A.

Inventor name: PILLAI, RADHAKRISHNA

Inventor name: NUNN, ADRIAN

Inventor name: BUSSAT, PHILIPPE

Inventor name: ARBOGAST, CHRISTOPHE

Inventor name: SHRIVASTAVA, AJAY

Inventor name: FAN, HANG

Inventor name: MARINELLI, EDMUND, R.

Inventor name: LINDER, KAREN, E.

Inventor name: NANJAPPAN, PALANIAPPA

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DYAX CORP.

Owner name: BRACCO SUISSE SA

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 49/22 20060101ALI20130815BHEP

Ipc: A61M 36/14 20060101ALI20130815BHEP

Ipc: A61K 51/00 20060101AFI20130815BHEP

INTG Intention to grant announced

Effective date: 20130826

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DYAX CORP.

Owner name: BRACCO SUISSE SA

RIN1 Information on inventor provided before grant (corrected)

Inventor name: FAN, HONG

Inventor name: YAN, FENG

Inventor name: NUNN, ADRIAN D.

Inventor name: BUSSAT, PHILIPPE

Inventor name: SATO, AARON

Inventor name: DRANSFIELD, DANIEL, T.

Inventor name: MARINELLI, EDMUND, R.

Inventor name: WALKER, SHARON, MICHELE

Inventor name: LINDER, KAREN, E.

Inventor name: VON WRONSKI, MATHEW, A.

Inventor name: RAMALINGAM, KONDAREDDIAR

Inventor name: SWENSON, ROLF, E.

Inventor name: POCHON, SIBYLLE

Inventor name: PILLAI, RADHAKRISHNA K.

Inventor name: SHRIVASTAVA, AJAY

Inventor name: NANJAPPAN, PALANIAPPA

Inventor name: ARBOGAST, CHRISTOPHE

Inventor name: SONG, BO

INTG Intention to grant announced

Effective date: 20140214

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

Ref country code: AT

Ref legal event code: REF

Ref document number: 681784

Country of ref document: AT

Kind code of ref document: T

Effective date: 20140815

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 60346623

Country of ref document: DE

Effective date: 20140925

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2523654

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20141128

REG Reference to a national code

Ref country code: HK

Ref legal event code: GR

Ref document number: 1071999

Country of ref document: HK

REG Reference to a national code

Ref country code: NL

Ref legal event code: T3

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 681784

Country of ref document: AT

Kind code of ref document: T

Effective date: 20140813

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141215

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141114

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141113

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 60346623

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20150515

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

Ref country code: LU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20150303

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 14

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20030303

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20140813

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IE

Payment date: 20220328

Year of fee payment: 20

Ref country code: GB

Payment date: 20220328

Year of fee payment: 20

Ref country code: DE

Payment date: 20220329

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20220327

Year of fee payment: 20

Ref country code: IT

Payment date: 20220322

Year of fee payment: 20

Ref country code: FR

Payment date: 20220325

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SI

Payment date: 20220222

Year of fee payment: 20

Ref country code: NL

Payment date: 20220326

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20220401

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20220404

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60346623

Country of ref document: DE

REG Reference to a national code

Ref country code: NL

Ref legal event code: MK

Effective date: 20230302

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20230302

REG Reference to a national code

Ref country code: IE

Ref legal event code: MK9A

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20230426

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230303

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230304

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230302

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230304