EP1429801A1 - Neuropilin as a novel therapeutic target for modulation of immune reponses - Google Patents

Abstract

The invention relates to methods that enable the identification of modulators of immune responses mediated by immune effective cells, especially of the initiation of primary immune responses, and to methods for treating and / or preventing diseases or pathologic conditions associated with or controlled by said immunes responses. More specifically, it concerns methods for identifying compounds that modulate the selective interaction between cells implicated in the immune responses and/or that induce or inhibit the recruitment of semaphorin by neuropilin receptor and that are useful for modulating the immune responses mediated by immune effective cells.

Description

Neuropilin as a novel therapeutic target for modulation of immune reponses.

The invention relates to methods that enable the identification of modulators of immune responses, preferably those mediated by immune effective cells, especially of the initiation of primary immune responses, and to methods for treating and / or preventing diseases or pathologic conditions associated with or controlled by said immunes responses. More specifically, it concerns methods for identifying compounds that modulate the selective interaction between cells implicated in the immune responses and/or that induce or inhibit the recruitment of semaphorin by neuropilin receptor and that are useful for modulating the immune responses mediated by immune effective cells. The following description is provided to aid in understanding the invention but is not admitted to be prior art to the invention. The immune system is capable of producing two types of antigen-specific responses to foreign antigens. Cell-mediated immunity is the term used to refer to effective functions of the immune system mediated mainly by T lymphocytes. Humoral immunity is the term used to refer to production of antigen-specific antibodies by B lymphocytes. Both immune responses is stimulated in response to threats against health. In animals, defence against infectious agents, particularly rapidly growing viruses and bacteria or undesired cells or agents, requires an immediate response to limit growth and dissemination, and then stimulation of a more prolonged, specific immunity to prevent re-infection. The process by which animals meet the dual needs of an immediate response to danger and initiation of long-term protection is, at least partially, initiated by professional antigen presenting cells (APCs). Besides, the immune system can present aberrant regulation of cellular or humoral mediated immunity that is associated with abnormal or enhanced T cell, B cell and/or macrophage functions directed towards self antigens leading to autoimmune diseases occurrence. Other examples of disorders or conditions associated with abnormal or enhanced immune responses are inflammatory conditions, acute or chronic organ or tissue transplant rejection. Dendritic cells (DC) are professional antigen-presenting cells (APCs) that have the capacities to efficiently uptake, process and present antigen (innate immunity) and also to trigger lymphocyte primary activation. Distinct DC subsets in humans are described. Human skin contains two distinct subsets: Langherans cells within the epidermis and intersticial (dermal) DC. Two subsets of DC were identified in the blood as belonging to the myeloid (myeloid DC) or to the lymphoid lineage (plasmocytoid DC). Furthermore, another subset is represented by follicular dendritic cells that have been identified in secondary lymphoid organs but which origin is still unknown. T lymphocytes (T cells) mediated immune responses are initiated in secondary lymphoid organs, where naϊve T cells encounter antigen-carrying dendritic cells (DC). It has been shown that an interaction between T lymphocytes and DC occurs creating a specific physical site, termed the "immunological synapse". Said synapse is the target of specific ligands and costimulatory molecules initiating and sustaining T cell activation (Banchereau J. & Steinman R.M.; 1998). Said rapid and transient multisteps process, starting with the interaction of DC to T cells, results in T cells activation and in T cells priming or T cells tolerance. Actually, after the interaction with DC in the immunogical synapse the activated T cells can proliferate, differentiate and exercise their immune function as immune effector cells for cellular, humoral and tolerance immunity.

However, despite intensive investigations, little is known about the molecular events controlling and/or directing the initiation of the cellular interaction between DC and T cells. It has been shown that said initial interaction requires interaction between proteins such as DC-SIGN and ICAM-3 (Geijtenbeek T.B.H. et al., 2000 a), LFA-3 and CD2 or LFA-1 and ICAM-1 or ICAM-2, followed by a DC and T cell actin cytoskeletal rearrangement (Al-Alwan M.M. et al., 2001).

Similarly, nothing is known about the molecules that are involved in the ending of the DC/T cell interaction and thus stop the synapse.

It has been recently proposed that the immune synapses and . neuronal synapses could be organised via the same basic principles as the extracellular proteoglycan agrin is expressed both in the neuronal synaptic cleft and by T lymphocytes (Khan A.A. et al., 2001 ). Nevertheless, the participation of agrin to the T cells clustering at the immunological synapse has not been demonstrated (Trautmann A. & Vivier E., 2001 ).

The semaphorins are a family of proteins defined by the presence of a 500 amino acids long signature domain, called the "sema" domain, at their amino terminal end. Semaphorins have been categorized, depending of the arrangement of additional domains, into eight classes : classes I and II are invertebrate semaphorins, classes III to VII are found in vertebrates, and one final class encoded by viruses. In vertebrates, class IV to VI semaphorins are transmembrane proteins whereas class III semaphorins are secreted proteins and class VII semaphorins are tethered to the cell surface through a phosphatidylinositol anchorage (Raper J.A., 2000).

The functional characterisation of several of these proteins indicated a role in axonal guidance within the developing nervous system of invertebrates (classes I and II) or vertebrates (class III). Semaphorins have been further implicated in cardiac and skeletal development, in the regulation of angiogenesis and in tumor growth and metastasis. CD100, a class IV semaphorin, is the only semaphorin found to be physiologically expressed within the immune system, in lymphocytes, where it would be implicated in B and T cell activation (Shi W. et al., 2000). Actually, the in vivo biological functions of the majority of semaphorins remain to be determined.

Neuropilin-1 and NeuropiIin-2 (NP-1 and NP-2) are transmembrane proteins identified as receptors for the axonal chemorepellent class III semaphorins (He Z. & Tessier-Lavigne M., 1997). Currently, together with VEGF, class III semaphorins (Sema 3) are the only identified neuropilin ligands (Tamagnone L. et al., 1999). None of NP-1 nor NP-2 bind to the above cited class IV semaphorin CD100. Sema3A binds NP-1 whereas Sema3B, Sema3C, and Sema3F bind both NP-1 and NP-2. Additionally, Chen et al. have shown in a cellular model of COS transfected cells that the neuropilins can form homo or heterodimers at the cell surface in the absence of ligands (Chen H. et al., 1998). This result is regarded as a possible Sema3C signalling in sympathetic axons through neuropilin hetero- or homo-oligomeric receptors. While it has been recently shown that NP-1 is implicated in angiogenesis via its ligand VEGF (Miao et al., 1999)or is expressed by bone marrow stromal cells (Tordjman R. et al., 1999), so far, the biological role of neuropilins has essentially been studied in the developing nervous system, within the context of neuropilin-class III semaphorin interaction.

Besides, it is known that signal transduction pathway triggered by transmembrane, secreted or GPI anchored semaphorins requires plexins (Tamagnone L. et al., 1999) which are a family of large transmembrane proteins containing a "sema" domain. In neuronal cells, it has been shown that neuropilins form a multipartite complex with plexins and other coreceptors such as L1CAM (Castellani, 2000). In said complex, neuropilins serve as specific ligand binding subunits for semaphorin Sema3A whereas plexins and other coreceptors function as signal transducers to propagate the signal across the plasma membrane (Raper J.A. et al., 2000).

L1-CAM is further known as a cell adhesion molecule of the immunoglobulin superfamily that was shown to associate with NP-1 (He Z., 2000). So far, in vivo functional interactions involving NP and plexins have been only shown within the nervous system between NP-1 , in combination with Sema3A, and plexin-A1 and -

A2 (Takahashi, T. et al., 1999).

The inventors have now surprinsingly shown that neuropilin-1 is expressed by antigen-presenting cells (APCs), and more specifically by dendritic cells (DCs), by NKT cells and by T cells, both in vitro and in vivo and that NP-1 mediates molecular interactions that are crucial for the formation and functioning of the immunological synapse.

More precisely, they have shown that NP-1 acts at the very beginning of the immune response, through endocytosis of antigens by antigen-presenting cells and formation and functioning of the immunological synapse. The receptor NP-1 is further involved in turning off the synapse and thus of the immune response, especially of the cell-mediated immune response. Actually, upon interaction of Sema3A and NP-1 , dendritic cells retract, the number of clusters between T cells and DC diminishes and the proliferation of T cells slows down. NP-1 , whose expression is also induced when T cells are activated, thus plays a central role in clustering proliferated T cells and in effector functions of activated T cells. The present invention thus provides a novel therapeutic target for modulating the immune responses, more specifically the cell-mediated immune responses, for example within the context of prevention or treatment of diseases or pathologic conditions associated with or controlled by said immunes responses such as, for example, infections, particularly infections by rapidly growing viruses or bacteria, cancers, allergies, autoimmune diseases, inflammatory conditions, acute or chronic organ or tissue transplant rejections.

Therefore, the invention relates to methods that enable the identification of modulators of immune responses, preferably of the cell-mediated immune responses. According to a special embodiment, it concerns methods that enable the identification of modulators of the initiation of primary immune responses. More specifically, it concerns methods for identifying compounds that modulate the selective interaction between cells implicated in the immune responses and/or that induce or inhibit the recruitment of semaphorin by neuropilin receptor and that are useful for modulating the immune responses, preferably of the cell-mediated immune responses.

The invention furthermore relates to the use of an agent that modulates expression or activity of a neuropilin for the production of medicament intended for the treatment and/or prevention of diseases or pathologic conditions associated with or controlled by said immunes responses such as, for example, infections, particularly infections by rapidly growing viruses or bacteria, cancers, allergies, autoimmune diseases, inflammatory conditions, acute or chronic organ or tissue transplant rejection.

General definitions

In the context of the present invention, the term "neuropilin", or "NP", refers to a native Neuropilin-1 or Neuropilin-2 (NP-1 and NP-2), as above described. More specifically, its relates to a transmembrane receptor. This term encompasses the transmembrane protein as well as the endogenous soluble NP proteins, e.g.. soluble NP-1 (S11 and S12) and soluble NP-2 (S9),-as described in Rossignol et al, 2000, (S11 GENBANK access .number: AAG41406;S9 GENBANK access number:AAG41405), as well as synthetic proteins or proteins obtained genetically. The term includes the human form (NP-1 GENBANK Access numbeπXP 165547; NP-2 GENBANK Access number: NP 003863), or any equivalent, any variant, or variant of other species, including rodents (mouse NP-1 GENBANK Access number XP 125111 ; mouse NP-2 GENBANK access numbeπXP 129720) , dogs, cats, monkeys, etc. According to a specific embodiment an NP-1 equivalent is a mutant or a variant of NP-1 as far as the changes introduced into the amino acid sequence are minor in the sense that the NP-1 protein still presents the properties developed herein regarding its interaction with Sema3 and/or NP-1 itself, and optionally with plexins and/or other coreceptors such as L1CAM and /or NP-2. For example, the equivalent of NP-1 designates for a sequence having at least 75 %, 80% or 90% identity with the sequences as set forth in the GENBANK data base (see above the access numbers ; the sequences available in GENBANK are incorporated herein by reference).

According to the present invention, "percent identity" means the percentage of identical amino acids or nucleotides between two sequences when compared according to the best alignments, this percentage being statistical and the differences between the two sequences being at random and on the total length of the sequences. Optimal alignments of sequences can be achieved by means of the algorithm of Smith Waterman (1981), with the algorithm for local homology described in Neddleman and Wunsch (1970), with the similarity search method described by Lipman (1988), with softwares using GAP, BESTFIT, FASTA and TFASTA algorithms available in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl and DNASISNersion 2.5 for Windows; Hitachi Software Engineering Co., Ltd, South San Francisco, CA, by using the standard parameters described in the manufacturer brochure. Another possibility is to use the BLAST or FASTDB programs available at WWW.ncbi.nlm.nih.gov with the following parameters "Mismatch penalty 1.00; Gap Penalty 1.00; Gap Size Penalty 0.33; joining penalty 30.0. These algorithms are displayed in Current Methods in Sequencing and synthesis Methods and Applications, pages 127-149, 1988, Ala R. Liss, Inc". "Modulators of the neuropilin" or "neuropilin modulators" include activators, inhibitors, agonists, antagonists, partial antagonists and/or partial agonists of the neuropilin. The "biological activity" of the neuropilin refers generally to the action of neuropilin in the immunological synapse, or in modulation of cell migration, of axon outgrowth (neuropilin is required for both repulsion and attraction of growth cones), of neuron regeneration of cell differentiation. The biological activity of the neuropilin also refers to the interaction of the protein with downstream effectors, or induction thereof. Such effectors include the neuropilin-interacting protein called NIP, MICAL, Cas-L, c-fyn, or Rho-related G proteins and GTPases such as Rnd1 and RHoD GTPases (Zanata, 2002). The neuropilin activity further refers to a modification of the cytoskeleton. All these embodiments are described in greater details below. According to the invention, an immune cell whose interaction is mediated by a neuropilin is a cell chosen from the group consisting of dendritic cell (e.g. of langherans, dermal, follicular, and myeloid or plasmacytoid origin), T lymphocyte, B lymphocyte, γδ T cells, NK cell, NKT cell, macrophage, plasmocyte and mastocyte and other hematopoietic cells involved in an immune response. The "neuropilin-mediated interaction with a immune cell" can involve an interaction between two immune cells but also an interaction between an immune cell and a cell of another type such as a cancer cell, an infected cell, an hematopoietic cell, an osteoclast, a myoepithelial cell, a vascular smooth cell or an endothelial cell.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., (1989) ; B.D. Hames & S.J. Higgins-, (1984) ; R.I. Freshney,

(1986) ; Perbal, (1984) ; F.M. Ausubel et al. (1994).

The nucleic acid used in the context of the present invention can be a single or double strand deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Among

DNAs, possible alternatives include a complementary DNA (cDNA), a genomic DNA (gDNA), a hybrid sequence or a synthetic or semi-synthetic sequence. A further possibility is a nucleic acid modified chemically, for example, for the purpose of increasing its resistance to nucleases, its cell penetration or cell targeting, its therapeutic efficacy, and the like. These nucleic acids can be of human, animal, plant, bacterial, viral, synthetic and the like, origin. They may be obtained by any technique known to a person skilled in the art, and in particular by screening of libraries, by chemical synthesis or alternatively by mixed methods including the chemical or enzymatic modification of sequences obtained by screening of libraries. As mentioned later, they can be naked and/or be incorporated in vectors such as plasmid, viral or chemical vectors.

A "coding sequence" or a sequence "encoding" an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme. A coding sequence for a protein may include a start codon (usually ATG) and a stop codon.

The term "gene", also called a "structural gene" means a DNA sequence that codes for or corresponds to a particular sequence of amino acids, which comprises all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription. A coding sequence is "under the control of or "operatively associated with" expression (i.e. transcription and/or translation) control sequences in a cell when RNA polymerase transcribes the coding sequence into RNA, particularly mRNA, which is then trans-RNA spliced (if it contains introns) and translated into the protein encoded by the coding sequence. A "promoter" or "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The promoter sequence is generally bounded at its 3' terminus by the transcription initiation site and extends upstream (5¹ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence are found a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. The promoter may be operatively associated with other expression control sequences, including enhancer and repressor sequences.

Promoters which may be used to control gene expression include, but are not limited to, cytomegalovirus (CMV) promoter (Patents No. 5,385,839 and No. 5,168,062), the SV40 early promoter region (Benoist et al. (1981 ), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980)), the herpes thymidine kinase promoter (Wagner et al. (1981 )), the regulatory sequences of the metallothionein gene (Brinster et al. (1982)) ; prokaryotic expression vectors such as the beta-lactamase promoter (Villa- Komaroff et al. (1978)), or the tac promoter (DeBoer et al. (1983) and (1980) "Useful proteins from recombinant bacteria" in Scientific American) ; promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; and transcriptional control regions that exhibit hematopoietic tissue specificity, in particular: beta-globin gene control region which is active in myeloid cells (Mogram et al. (1985) ; Kollias et al. (1986)), hematopoietic stem cell differentiation factor promoters, erythropoietin receptor promoter (Maouche et al. (1991 )), etc. The terms "mutant" and "mutation" mean any detectable change in genetic material, e.g. DNA, or any process, mechanism, or result of such a change. This includes gene mutations, in which the structure (e.g. DNA sequence) of a gene is altered, any gene or DNA arising from any mutation process, and any expression product (e.g. protein or enzyme) expressed by a modified gene or DNA sequence. The term "variant" may also be used to indicate a modified or altered gene, DNA sequence, enzyme, cell, etc., i.e., any kind of mutant. For a protein, the term Variant" is intended for amino acid deletions, amino acid substitutions such as conservative or non conservative replacement by other amino acids or by isosteres (modified amino acids that bear close structural and spatial similarity to protein amino acids), amino acid additions or isostere additions, as long as the amino acid sequence of the variant protein shows at least 70% of homology, preferably 90% of homology with the corresponding native protein, as described below.

"Sequence-conservative variants" of a polynucleotide sequence are those in which a change of one or more nucleotides in a given codon position results in no alteration in the amino acid encoded at that position.

"Function-conservative variants" are those in which a given amino acid residue in a protein or enzyme has been changed without altering the overall conformation and function of the polypeptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like). Amino acids with similar properties are well known in the art. For example, arginine, histidine and lysine are hydrophilic-basic amino acids and may be interchangeable. Similarly, isoleucine, a hydrophobic amino acid, may be replaced with leucine, methionine or valine. Such changes are expected to have little or no effect on the apparent molecular weight or isoelectric point of the protein or polypeptide. Amino acids other than those indicated as conserved may differ in a protein or enzyme so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and may be, for example, from 70 % to 99 % as determined according to an alignment scheme such as by the Cluster Method, wherein similarity is based on the MEGALIGN algorithm. A "function-conservative variant" also includes a polypeptide or enzyme which has at least 60 % amino acid identity as determined by BLAST or FASTA algorithms, preferably at least 75 %, most preferably at least 85%, and even more preferably at least 90 %, and which has the same or substantially similar properties or functions as the native or parent protein or enzyme to which it is compared. As used herein, the term "homologous" in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a "common evolutionary origin," including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al., (1987)). Such proteins (and their encoding genes) have sequence homology, as reflected by their sequence similarity, whether in terms of percent similarity or the presence of specific residues or motifs at conserved positions.

Accordingly, the term "sequence similarity" in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., supra). However, in common usage and in the instant application, the term "homologous," when modified with an adverb such as "highly," may refer to sequence similarity and may or may not relate to a common evolutionary origin.

In a specific embodiment, two DNA sequences are "substantially homologous" or "substantially similar" when at least about 80 %, and most preferably at least about 90 or 95 %, of the nucleotides match over the defined length of the DNA sequences, as determined by sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, etc. An example of such a sequence is an allelic or species variant of the specific genes of the invention. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.

Similarly, in a particular embodiment, two amino acid sequences are "substantially homologous" or "substantially similar" when greater than 80 % of the amino acids are identical, or greater than about 90 % are similar (functionally identical). Preferably, the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of the programs described above (BLAST, FASTA, etc.). A "sequence capable of specifically hybridizing with a nucleic acid sequence" is understood as meaning a sequence which hybridizes with the nucleic acid sequence to which it refers under the conditions of high stringency (Sambrook et al, 1989). These conditions are determined from the melting temperature Tm and the high ionic strength. Preferably, the most advantageous sequences are those which hybridize in the temperature range (Tm - 5°C) to (Tm - 30°C), and more preferably (Tm - 5°C) to (Tm - 10°C). A ionic strength of 6xSSC is more preferred. For instance, high stringency hybridization conditions correspond to the highest Tm, e.g., 50 % formamide, 5x or 6x SCC. SCC is a 0.15 M NaCl, 0.015 M Na-citrate. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51 ). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). A minimum length for a hybridizable nucleic acid is at least about 10 nucleotides ; preferably at least about 15 nucleotides ; and more preferably the length is at least about 20 nucleotides.

The terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include plasmids, phages, viruses, etc.; they are discussed in greater detail below.

Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA is inserted. A common way to insert one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. A "cassette" refers to a DNA coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the proper reading frame. Generally, foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA. A segment or sequence of DNA having inserted or added DNA, such as an expression vector, can also be called a "DNA construct." A common type of vector is a "plasmid", which generally is a self- contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can be readily introduced into a suitable host cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that encodes a particular amino acid sequence for a particular protein or enzyme. Promoter DNA is a DNA sequence which initiates, regulates, or otherwise mediates or controls the expression of the coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. A large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids (Clontech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, Wl), pRSET or pREP plasmids (Invitrogen, San Diego, CA), or pMAL plasmids (New England Biolabs, Beverly, MA), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes. The terms "express" and "expression" mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an "expression product" such as a protein. The expression product itself, e.g. the resulting protein, may also be said to be "expressed" by the cell. An expression product can be characterized as intracellular, extracellular or secreted. The term "intracellular" means something that is inside a cell. The term "extracellular" means something that is outside a cell. A substance is "secreted" by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell.

The term "transfection" means the introduction of a foreign nucleic acid into a cell. The term "transformation" means the introduction of a "foreign" (i.e. extrinsic or extracellular) gene, DNA or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce a desired substance, typically a protein or enzyme coded by the introduced gene or sequence. The introduced gene or sequence may also be called a "cloned" or "foreign" gene or sequence, may include regulatory or control sequences, such as start, stop, promoter, signal, secretion, or other sequences used by a cell's genetic machinery. The gene or sequence may include nonfunctional sequences or sequences with no known function. A host cell that receives and expresses introduced DNA or RNA bas been "transformed" and is a "transformant" or a "clone." The DNA or RNA introduced into a host cell can come from any source, including cells of the same genus or species as the host cell, or cells of a different genus or species.

The term "host cell" means any cell of any organism that is selected, modified, transformed, grown, or used or manipulated in any way, for the production of a substance by the cell, for example the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. Host cells can further be used for screening or other assays, as described infra.

The term "expression system" means a host cell and compatible vector under suitable conditions, e.g. for the expression of a protein coded for by foreign RNA or DNA carried by the vector and introduced to the host cell. Common expression systems include E. coli host cells and plasmid vectors, insect host cells and Baculovirus vectors, and mammalian host cells and vectors. In a specific, embodiment, the protein of interest is expressed in COS-1 or C2C12 cells. Other suitable cells include CHO cells, HeLa cells, 293T (human kidney cells), mouse primary myoblasts, and NIH 3T3 cells.

Screening methods

According to an embodiment, the Applicant proposes a method that allows identification of compounds that are able to induce or inhibit the recruitment of a given ligand to a particular receptor, thereby allowing a very fine tuned regulation of the immunological synapse formation and functioning. Thus, the present invention concerns a method of screening for compounds that modulate the interaction of the NP-1 receptor expressed on DCs with all or part of at least one semaphorin, the method comprising:

(i) incubating a reaction mixture comprising :

- all or part of the NP-1 receptor, equivalents or chimeric proteins thereof,

- at least one potential binding modulator to be tested and,

- at least one semaphorin, fragments thereof, equivalents or chimeric proteins thereof, and

(ii) determining whether the binding to said NP-1 receptor of said semaphorin, of said fragment or of said chimeric protein, is increased or decreased in comparison to an assay which lacks the potential binding modulator.

According to a preferred embodiment, "NP-1 receptor" is the human form of NP-1 GENBANK Access numbeπXP 165547. According to a preferred embodiment, "semaphorin" means the Sema3A

(GENBANK Access number:NP_006071 ).

According to the present invention, the substances tested can be of any type, including natural or synthetic compounds or mixtures of compounds. The substance may be structurally defined or of unknown structure, e.g. in the form of a biological extract.

According to another embodiment, the present invention concerns a method of screening for compounds that modulate the interaction of the NP-1 receptor expressed on DCs with all or part of the Sema3A semaphorin, the method comprising:

(i) incubating a reaction mixture comprising :

-all or part of the NP-1 receptor, equivalents or chimeric proteins thereof,

-at least one potential binding modulator to be tested and, -all or part of the semaphorin Sema3A, fragments thereof, equivalents or chimeric proteins thereof, and

(ii) determining whether the binding to said NP-1 of said Sema3A, of said fragment or of said chimeric protein of Sema3A, is increased or decreased in comparison to an assay which lacks the potential binding modulator.

In special embodiment, the reaction mixture comprises all or part of said NP-1 receptor. More specifically, said reaction mixture comprises at least one fragment of said NP-1 receptor. In preferred embodiments, said fragment will be selected in the full length NP-1 receptor sequence and will retain the recognizing and binding properties of the parental full length NP-1 receptor regarding other specific molecules such as ligands such as Sema3A, or regarding cells expressing protein(s) able to interact with NP-1 , such as DCs and /or T cells. In one embodiment, said fragment of NP-1 includes the ligand binding domain (i.e. LBD) ; these terms are widely used in literature and are fully understandable by the one skilled in the art. According to one embodiment, the reaction mixture comprises a fragment of the NP-1 receptor including the domain of said receptor encompassing the domain which is able to react with the Sema3A semaphorin (Koppel AM, 2001 ).

The NP-1 receptor and the semaphorins used according to the invention are polypeptides. Said polypeptides are preferably recombinant polypeptides. The terms "recombinant polypeptides" relate to any molecule having a polypeptidic chain that can be produced by genetic engineering, through transcription and translation, of a corresponding DNA sequence under the control of appropriate gene regulatory elements within an efficient cellular host (the nucleic acid sequences encoding NP-1 and the requested Semaphorin are available on GenBank). For detailed information, please refer to the Material and Methods section. It should be noticed that the man skilled in the art, based on the amino acid sequence of polypeptides and genetic code, can easily determine nucleic acid sequence encoding the corresponding amino acid chain. The expression "recombinant polypeptides" such as those used herein does not exclude the possibility for the polypeptides to comprise of other groups, such as glycosylated groups. The term "recombinant" indeed means that the polypeptide has been produced by genetic engineering, particularly because it results from the expression in a cellular host of the corresponding nucleic acid sequences which have previously been introduced into an expression vector used in said host. Nevertheless, it must be understood that the polypeptides implemented according to the invention can be produced by a different process, for instance by classical chemical synthesis according to methods used in the protein synthesis or by proteolytic cleavage of larger molecules, including natural molecules. According to specific applications of the invention, it would be desirable to modify or label the polypeptide (e.g. NP-1 , Sema3A) implemented in the methods in order to allow their detection or in order to visualize their interaction with other compounds (e.g. heterologous proteins). Methods for modifications/labeling polypeptides are well known by those skilled in the art. As an example, please refer to Chapter 18 of Sambrook and Russell (Molecular Cloning ; Third Edition, 2001 , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). The polypeptide may be attached to a detectable label.

The invention also relates to methods implementing amino acid sequences constituted by all or part of the above mentioned polypeptides and by a protein or an heterologous sequence with respect to said polypeptide, said protein or heterologous sequence comprising for instance from about 1 to about 1100 amino acids. These "mixed" amino acid sequences are called "fusion proteins" or "chimeric proteins". Particularly, the amine or carboxyl functions of both terminal amino acids can be themselves involved in the bond with other amino acids. Examples of these "protein or an heterologous sequences" are: (i) epitopes (see Chapter 17, pages 17.90-17.94 of Sambrook and Russell (Molecular Cloning ; Third Edition, 2001 , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), and more preferably His-6 epitope recognized by monoclonal antibodies Mabs 6-His, δxHis and HIS-1 1 , or an epitope selected from the group consisting of substance P, Human c-Myc protein, colicin A protein, influenza virus hemagglutining, SV40 T antigen, Alkaline Phosphatase, FLAG sequence, T7-Tag, AU epitopes, HPOL, Btag, 3b3, IRS, or polypeptide sequences derived there from ; (ii) glutathione-S-transferase or GST protein (Smith and Johnson, 1988). Thus it is possible to design fusion proteins including all or part of NP-1 , or all or part of Sema3A, with an heterologous labelling or identifiable amino acid sequence as those disclosed above. Said fusion proteins are widely used in the art as tools for visualising receptor/ligand interactions.

Furthermore, any peptidic sequences resulting from the modification by substitution and/or by addition and/or by deletion of one or several amino acids of the polypeptides according to the invention are part of the invention in so far as this modification does not alter the properties and characteristics of said polypeptides.

According to a specific embodiment, the invention concerns the use of a chimeric protein comprising all or part of a polypeptide (NP-1 or Sema3A) as described above fused to a heterologous polypeptide, and more specifically to glutathione-S-transferase (GST) or His-6 epitope. Methods and conditions for screening compounds able to interact with receptors (e.g. ligands) are widely disclosed in the art : for example, Glickman et al., 2002; Le Douarin et al.;2001 ) have disclosed an in vitro screening test using the yeast two-hybrid system that is based on the ligand-dependent interaction of two proteins, a hormone receptor and a coactivator ; Zhou et al., (2001 ) have disclosed a homogeneous time-resolved fluorescence (HTRF) energy transfer technology which is sensitive, homogeneous, and nonradioactive ; Beaudet et al, (2001 ) have disclosed the AlphaScreen™ technology (Packard BioScience) which allows the development of high-throughput homogeneous proximity assays. The full content of these papers is incorporated herein by reference. Specific examples of said standard procedures available in the art are the

Fluorescence Resonance Energy Transfer (FRET), the CoActivator-dependent Receptor Ligand Assay (CARLA) and the GST-pull down assays or two-hybrid assays (see Experimental Section).

The effect of modulating the interaction is defined by reference to the natural situation, i.e. the natural interaction observed when the tested Semaphorin, or related chimeric protein, is contacted with the tested NP-1 receptor and/or when the tested NP-1 is contacted with the tested NP-1 receptor. Modulation refers to an increase or a decrease of said interaction when the "potential interaction modulator" is present in the reaction mixture. Generally, an increase of said interaction is assimilated to an enhancement and relates to compounds named activators, agonists or partial agonists. On the contrary, a decrease of said interaction is assimilated to an inhibition and relates to compounds named inhibitors or antagonists. These terms are not limited by any specific grade.

According to the invention, "inhibition" means that the measured interaction

{i.e. between said NP-1 receptor, or fragment thereof or chimeric derivate with said semaphorin, or fragment thereof or chimeric derivate) is decreased in comparison to assays which lack the tested modulator. "Inhibition" is not limited to any specific grade ; it might be total or partial.

According to the invention, "enhancement" means that the measured interaction (i.e. between said NP-1 receptor, or fragment thereof or chimeric derivate with said semaphorin, or fragment thereof or chimeric derivate) is increased in comparison to assays which lack the tested modulator.

"Enhancement" is not limited to any specific grade ; it might be total or partial.

Alternatively, the Applicant proposes biological methods that allows identification of compounds that are able to induce or inhibit the recruitment of Sema3A to the NP-1 receptor, thereby allowing a very fine tuned regulation of the immunological synapse formation and functioning. Accordingly, the present invention further concerns a method of screening for compounds that modulate the. interaction of the NP-1 receptor expressed on DCs with all or part of Sema3A.

A way to assess the modulation of NP-1 activity comprises determining a modification, e.g. a retraction, of the cytoskeleton, e.g. DC retraction upon interaction of Sema3A with NP-1. This can be achieved by monitoring the cytoskeleton shape by microscopy (for instance by confocal microscopy associated with F-actin or phalloidin fluorescence). Since this modification of cytosqueleton is mediated by Rho-related G proteins (Liu and Strittmatter, 2001 ), one can also assess the modulation of neuropilin activity through determining the interaction of plexins or neuropilins with Rho-related G proteins. The screening methods may comprise at least one of the following tests:

1/ test for measuring the retraction of Dendritic Cells (DCs): Retraction of DCs is one stop signal of the interaction of DCs with an other immune cell such as T cells : the Applicant has shown that Semaphorin 3A (Sema3A) interacts with NP-1 expressed by APCs, particularly DCs, and hereby induces the DC retraction by cytoskeleton movements. This retraction can be analyzed by the size changes by FACS or microscopy and the F-actin or phalloidin expression by immunochemistry. These techniques are widely used by the one skilled in the art. DCs or more generally Antigen Presenting Cells can be primary cells or cell lines. For the preparation of said cells, please refer to the Experiments section or to cells available in cell banks such as ECACC (T cell line such as Jurkat, Suzuki T, 2002) (DC cell lines, D1 such as Winzler C, 1997). Sema3A can be a natural or synthetic protein, a variant or an equivalent, produced by purification, genetically engineered or chemically produced. Said test comprises the following steps : (i) incubating a reaction mixture comprising :

-DCs or more generally Antigen Presenting Cells which can be primary cells or cell lines,

-at least one potential binding modulator to be tested and, -all or part of the semaphorin Sema3A, fragments thereof, equivalents or chimeric proteins thereof, and

(ii) determining whether the retraction of said cells is increased or decreased in comparison to an assay which lacks the potential binding modulator.

Similarly, step(ii) can be adapted to the below tests, optionally in combination :

2/ Antigen uptake by DC DCs or more generally Antigen Presenting Cells can be primary cells or cell lines are preincubated with Sema3A binding NP-1 show a reduced dextran (or other antigens) internalisation capacity which indicates a decreased pinocytose function of these cells, a process necessary for antigen presentation. Dextran (or other antigens) is FITC conjugated and thus the analysis is made by FACS. This test is performed in presence and in absence of the tested compound in order to identify modulators of interest.

3/ DC induced T cell proliferation DC is able to induce T cell proliferation. The T cell proliferation is measured by the H3 thymidine incorporation into T cell proliferated. According to said test, it is measured if theT cell proliferation is or is not influenced by the presence of the compound to be tested.

4/ DC-T cell clustering

DCs cluster with T cells . Said clustering is measured by FACS or microscopy.

5/ Adhesion of soluble neuropilin-1 to DC and T cells Binding of soluble NP-1 to DC or T cells is studied by measuring the percentage of DC or Tcells bound to fluorescent soluble NP-1 ectodomain-Fc fusion protein (Fc-NP-1 ). This binding is measured in presence and in absence of the tested compound.

6/ Heterotypic T cells clustering with neuropilin-expressing cells

T cells are able to form clusters around the NP-1 -expressing COS-7 cells in a NP-1 dependent manner. The heterotypic cell clustering between T cells expressing NP-1 and COS-7 cells expressing NP-1 is measured by flow cytometry and inhibited by blocking NP antibody or soluble NP-1 . This test is performed in presence and in absence of the tested compound in order to identify modulators of interest.

According to a another embodiment, the Applicant proposes a method that allows identification of compounds that are able to induce or inhibit the interaction between DCs and T cells, thereby allowing a very fine tuned regulation of the immunological synapse formation and functioning. Said method comprises the following steps :

(i) incubating a reaction mixture comprising : -DCs or more generally Antigen Presenting Cells which can be primary cells or cell lines, at least one potential binding modulator to be tested and, T cells , and

(ii) determining whether the interaction between APC and T cells is increased or decreased in comparison to an assay which lacks the potential binding modulator.

This method may be performed in the presence or absence of soluble neuropilin or blocking anti-neuropilin antibodies.

Biological tests above described (3/ DC induced T cell proliferation and 4/ DC-T cell clustering) are applicable for these interactions between DC and T cells.

According to a another embodiment, the Applicant proposes a method that allows identification of compounds that are able to induce or inhibit the interaction between exogenous NP-1 and T cells or DC, thereby allowing a very fine tuned regulation of the immunological synapse formation and functioning. Said method comprises the following steps :

(i) incubating a reaction mixture comprising :

-DCs or more generally Antigen Presenting Cells, or T cells which can be primary cells or cell lines, at least one potential binding modulator to be tested and, - exogenous NP-1 such as soluble NP-1 or NP-1 expressing cells , and

(ii) determining whether the interaction between NP-1- and T cells or and DC is increased or decreased in comparison to an assay which lacks the potential binding modulator. Biological tests above described (5/ Adhesion of soluble neuropilin-1 to DC and T cells and 6/ Heterotypic T cells clustering with neuropilin-expressing cells) are applicable for these interactions between DC and T cells.

The above proposed methods allow to identify compounds that are able to influence the immunogical synapse formation and/or maintenance. More specifically, a compound which is able to prevent or inhibit the recruitment of Sema3A by NP-1 receptor, present especially on APCs (e.g. DCs), i.e. an antagonist or an inhibitor, supports the immunological synapse formation and functioning and therefore preserves the T cell proliferation and thus immune response pathway. On the contrary, a compound which is able to stabilize or to enhance the recruitment of Sema3A by NP-1 receptor, present especially on APCs (e.g. DCs), i.e. an agonist or an activator, disrupts the immunological synapse formation and functioning and therefore inhibits the T cell proliferation and thus immune response pathway.

The above proposed methods further allow to identify compounds that are able to influence the immunogical synapse formation and/or maintenance by preventing or inhibiting the interaction between APCs (e.g. DCs) and T cells, i.e. an antagonist or an inhibitor; or alternatively, compounds which are able to stabilize or to enhance the interaction between APCs (e.g. DCs) and T cells, i.e. an agonist or an activator.

It has further been shown by the Inventors that NP-1 is expressed by the NKT. Interaction between DCs and NKT cells has been previously disclosed without mentioning the molecular basis of said interaction. It is only recognized that the DCs / NKT interaction is implicated in the stimulation of cytokine production during the immune response (Fernandez, 1999, Kitamura H, 1999). Accordingly, the Invention further concerns a method that allows identification of compounds that are able to induce or inhibit the interaction between DCs and NKT cells, thereby allowing to regulate cytokine production during the immune responses. Said method comprises the following steps :

(i) incubating a reaction mixture comprising : DCs or more generally Antigen Presenting Cells which can be primary cells or cell lines, at least one potential binding modulator to be tested and, NKT cells, and (ii) determining whether the interaction of APCs, e.g. DCs, with NKT cells is increased or decreased in comparison to an assay which lacks the potential binding modulator.

This method may be performed in the presence or absence of soluble neuropilin or blocking anti-neuropilin antibodies. The one skilled in the art will easily appreciate that the invention allows a very fine tuned regulation of the immunological synapse formation and functioning, and thus of the immune responses, and more preferably of the cell-mediated immune responses.

Accordingly, the present invention further concerns modulators of immunological synapse formation and functioning and of the immune responses, preferably of the cell-mediated immune responses, which are identifiable by the screening method of the Invention. It further concerns pharmaceutical compositions comprising said modulators and uses of said modulators and/or pharmaceutical compositions for therapeutic methods.

The therapeutic methods of the invention are useful for any subject or patient. The subject or patient is a vertebrate, preferably a mammal, and even more preferably is a human.

The therapeutic methods of the invention refer to the prevention, i.e. prophylactic treatment and/ or to the therapeutic or curative treatment of diseases or pathologic conditions associated with or controlled by said immunes responses such as, for example, infections, particularly infections by rapidly growing viruses or bacteria, cancers, allergies, autoimmune diseases, inflammatory conditions, acute or chronic organ or tissue transplant rejections. Naturally it is being understood that the therapeutic approach that is proposed herein is not exclusive of the use of other therapeutics. The therapeutic approach of the invention may be useful alone, or in combination with other approaches. In the case of cancers, it may particularly advantageous to combine the therapeutic approach of the invention with standard chemotherapy, or surgery.

Diseases or pathologic conditions associated with or controlled by immunes responses

According to the present invention, the diseases or pathologic conditions associated with or controlled by said immunes responses are diseases or condition which provoke or are provoked by, at least partially, an immune response, and preferably a cell-mediated immune response. These terms also encompass immune disorders, and immune cell mediated diseases, as well as diseases involving aberrant immune regulation that relates for instance to an inappropriate immune response to an exogenous or endogenous antigen. The cell mediated immune responses are associated to specific cells, the immune cells.

Said immune cells may be a dendritic cell, a T lymphocyte, a B lymphocyte, a NK cell, a γδ T cell, a macrophage, a plasmocyte, a monocyte, a mastocyte or a NKT cell.

In a preferred embodiment, the diseases or conditions according to the present invention are involving dendritic cells and/or T cells.

The diseases or pathologic conditions of the invention include allergy, such as food intolerance, allergy to grass, pollens, hymenopteres, or metals, e.g. nickel.

Infections are also encompassed. Infections include acute and chronic infections, viral infections, for instance with HIV or HTLV-1 , -2, hepatitis virus such as HBV, HCV as well as bacterial, fungal, for instance candidiosis or aspergillus or parasitic infections. A biological function of DC is indeed to capture endogenous or exogenous antigens, such as microorganisms within cutaneous or mucosal tissues or antigens at the surface of tumor cells, and then to migrate to secondary lymphoid organs, where they present these in antigenic form to T cells and consequently initiate adaptive immune responses.

This T cell activation is notably mediated by the DC-specific type II membrane protein, DC-SIGN, which interacts with the T cell expressed ICAM-3

(Geijtenbeek T.B.H. et al., 2000 a). However, it was further shown that the same

DC-SIGN protein could bind the HIV-1 envelope glycoprotein gp120. DC-SIGN does not act as a receptor for viral entry in DC but rather promotes efficient trans infection of T cells (Geijtenbeek T.B.H. et al., 2000 b).

Diseases or pathologic conditions of the invention further comprise neuro- immune diseases such as prion diseases. Follicular dendritic cells (FDC) are currently thought to be responsible for the propagation and spread in secondary lymphoid organs of the abnormal isoform of the prion protein, PrP^sc, the hallmark of the neurodegenerative prion diseases (Sy MS. & Gambetti P., 1999).

DCs are therefore regarded as a putative reservoir and vehicle of infectious agents. Diseases or pathologic conditions of the invention also include cancer. All forms of cancers are contemplated, i.e. solid tumors or tumors of the hematopoietic system, e.g. lymphoma, myeloma or leukemia.

Diseases or pathologic conditions of the invention also include inflammatory diseases such as Crohn disease, ulcerative colitis, hepatitis. Immunodeficiency such as common invariable deficiency is also contemplated.

Graft rejection and graft versus host diseases is also contemplated.

Diseases of DC, such as histiocytosis, are also part of the present invention.

Autoimmune diseases, e.g. multiple sclerosis, psoriasis, rheumatoid arthritis, sclerodermia, lupus, behcet disease or type I diabetes, are also encompassed.

Neuropilin modulation

In a first aspect of the invention it is provided a method for preventing or treating diseases or pathologic conditions associated with or controlled by said immunes responses (see above) , which method comprises modulating neuropilin receptor activity, e.g. by administering to a patient in need of such treatment a therapeutically active amount of a modulator compound of the invention.

In another aspect, the invention relates to the use of a modulator of the invention, for the preparation of a medicament for the prevention or treatment of an immune cell mediated disease. According to the invention the agent that modulates the activity or expression of a neuropilin is capable of controlling the cell-mediated immune response initiation and/or the innate immunity.

Gene therapy According to another embodiment of the present invention, the modulation of neuropilin activity may further be achieved by augmenting (increasing) the amount of neuropilin protein in the cells of a patient.

This may be performed by transfecting the cells with an isolated DNA sequence encoding said neuropilin, namely a neuropilin expressing vector, e.g. in the form of a naked DNA or as vector (viral or non viral, i.e. synthetic vector).

The insertion of a nucleic acid sequence capable of modulating the expression of a neuropilin in an immune cell can be achieved in vitro or in vivo using a expression vector, such as a plasmid or a viral derived vector, e.g. a retroviral or an adenoviral vector, and the transformation of host cells with the expression vector, by any of the methods available to the skilled person, like for instance transfection or infection.

Such expression vectors generally contain a promoter sequence, signals for initiation and termination of translation, as well as appropriate regions for regulation of translation. Their insertion into the host cell may be transient or stable. Said vector may also contain specific signals for secretion of the translated protein. These various control signals are selected according to the host cell and may be inserted into vectors which self-replicate in the selected host cell, or into vectors which integrate the genome of said host. Preferably, host cells belongs to the haematopoietic lineage. More preferably, host cells are immune cells chosen from the group consisting of dendritic cell, T lymphocyte, B lymphocyte, γδ T cells, NK cell, macrophage, plasmocyte, monocyte, mastocyte or NKT cell.

These embodiments are described in greater details hereafter.

Preferably, the neuropilin nucleic acid forms part of a vector. Such vector is a nucleic acid comprising a neuropilin coding sequence operatively associated with sequences that control expression of neuropilin in a cell transfected with the vector. The use of such a vector indeed makes it possible to improve the administration of the nucleic acid into the cells to be treated, and also to increase its stability in the said cells, which makes it possible to obtain a durable therapeutic effect. Furthermore, it is possible to introduce several nucleic acid sequences into the same vector, which also increases the efficacy of the treatment.

Successful gene therapy depends on the efficient delivery to and expression of genetic information within the cells of a living organism. Most delivery mechanisms used to date involve viral vectors, especially adeno- and retroviral vectors. Viruses have developed diverse and highly sophisticated mechanisms to achieve this goal including crossing of the cellular membrane, escape from lysosomal degradation, delivery of their genome to the nucleus and, consequently, have been used in many gene delivery applications in vaccination or gene therapy applied to humans. In a preferred embodiment of the invention, a viral vector is used which can be chosen from adenoviruses, retroviruses, adeno- associated viruses (AAV), lentivirus, herpes virus, cytomegalovirus (CMV), vaccinia virus and the like. Vectors derived from adenoviruses, retroviruses or AAVs, HIV-derived retroviral vectors, incorporating heterologous nucleic acid sequences have been described in the literature (Akli et al., (1993); Stratford- Perricaudet et al. (1990) ; EP 185 573, Levrero et al. (1991 ) ; Le Gal la Salle et al. (1993) ; Roemer et al. (1992) ; Dobson et al. (1990) ; Chiocca et al. (1990) ; Miyanohara et al. (1992) ; WO 91/18088). Among the various adenovirus serotypes, the use of the AD5/F35 chimeric adenovirus vector (Yontda and Onishi, 2001) is preferred.

The present invention therefore also relates to any recombinant virus comprising, inserted into its genome, a neuropilin sequence.

Advantageously, the recombinant virus according to the invention is a defective virus. The term "defective virus" designates a virus incapable of replicating in the target cell. Preferably, the defective virus nevertheless conserves the sequences of its genome which are necessary for the encapsulation of the viral particles.

The defective recombinant viruses of the invention can be prepared by homologous recombination between a defective virus and a plasmid carrying, inter alia, the neuropilin encoding sequence (Levrero et al. (1991 ) ; Graham, (1984)). The homologous recombination is produced after co-transfection of the said viruses and plasmid into an appropriate cell line. The cell line used should preferably (i) be transformable by the said elements, and (ii), contain sequences capable of complementing the part of the genome of the defective virus, preferably in integrated form so as to avoid the risks of recombination. As example of a line which can be used for the preparation of defective recombinant adenoviruses, there may be mentioned the human embryonic kidney line 293 (Graham et al. (1977)) which contains especially, integrated into its genome, the left part of the genome of an Ad5 adenovirus (12%). As example of a line which can be used for the preparation of defective recombinant retroviruses, there may be mentioned the CRIP line (Danos et al. (1988)). Alternative vectors, such as shuttle vectors, can also be used that permit the cloning of the desired gene in the vector backbone.

Besides, non-viral delivery systems have been developed which are based on receptor-mediated mechanisms (Perales et al., 1994; Wagner et al., 1994), on polymer-mediated transfection such as polyamidoamine (Haensler and Szoka, (1993)), dendritic polymer (WO 95/24221 ), polyethylene imine or polypropylene imine (WO 96/02655), polylysine (US-A-5 595 897 or FR 2 719 316) or on lipid- mediated transfection (Feigner et al., (1989)) such as DOTMA (Feigner et al., (1987), DOGS or Transfecta MTM (Behr et al., (1989)), DMRIE or DORIE (Feigner et al., 1993), DC-CHOL (Gao and Huang, (1991), DOTAPTM (McLachlan et al., (1995)) or Lipofectamine TM. These systems present potential advantages with respect to large-scale production, safety, targeting of transfectable cells, low immunogenicity and the capacity to deliver large fragments of DNA. Finally, in 1990, Wolff et al. (1990) have shown that injection of naked RNA or DNA, i.e. without a special delivery system, directly into mouse skeletal muscle results in expression of reporter genes within the muscle cells. This technique for transfecting cells offers the advantage of simplicity and experiments have been conducted that support the usefulness of this system for the delivery to the lung (Tsan et al., Am. J. Physiol. 268 (1995), L1052-L1056; Meyer et al., Gene Therapy 2 (1995), 450-460), brain (Schwartz et al., Gene Therapy 3 (1996), 405-41 1 ), joints (Evans and Roddins, Gene therapy for arthritis; In Wolff (ed) Gene therapeutics: Methods and Applications of direct Gene Transfer. Birkhaiser. Boston (1990), 320-343), thyroid (Sikes et al., Human Gen. Ther. 5 (1994), 837- 844), skin (Raz et al., Proc. Nati. Acad. Sci. USA 91 (1994), 9519-9523) and liver (Hickman et al., Hum. Gene Ther. 5 (1994), 1477-1483). It is also possible to introduce the vector in vivo as a naked DNA plasmid. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wilson et al., (1992) ; Wu et al. (1988)). Targeted gene delivery is described in International Pat. Publication WO

95/28494, published October 1995.

Alternatively, the vector can be introduced in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Information regarding liposome is provided in the "pharmaceutical composition" section of the present application as well. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al. (1987). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner et al. (1989). The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting. Targeted peptides, e.g. hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.

Alternatively, one can make use of any isolated DNA that encodes a neuropilin interacting protein, or any nucleic acid containing molecule, capable of specifically hybridizing with a nucleic acid sequence encoding said neuropilin or neuropilin interacting protein. All gene disruption methods known by the skilled in the art are within the scope of the invention. The available techniques for gene therapy are the same as above described.

Peptide therapy

In another embodiment, the augmentation of the amount of neuropilin protein or neuropilin activity in the cells of a patient may be achieved by administering a neuropilin protein or a neuropilin derived peptide to the cell or the patient.

Alternatively, it may be desired to diminish the level of neuropilin activity, by administering a peptide that shows an agonist or antagonist activity against neuropilin, ot the cell or the patient.

For that purpose, the neuropilin protein or a neuropilin peptide may be chemically or enzymatically modified to improve stability or bioavailability.

Other Modulating agents

In another embodiment, modulating, i.e. augmenting or lowering the amount or activity of a neuropilin protein in a cell is achieved by stimulating or inhibiting the neuropilin endogenous expression or activity in the cell. Preferably the targeted cell is an immune cell, such as DC or T cells.

Peptidomimetics and non peptidic mimetics (Rubin-Carrez, 2000), such as small organic molecules may be useful as NP modulators. One skilled in the art knows how to develop or select useful modulators.

Modulating agents can be identified by screening methods, including biochemical and cellular in vitro assays.

Of particular interest is a process for screening substances for their ability to modulate, i.e. inhibit or activate, neuropilin expression or activity, comprising the steps of providing a cell that expresses neuropilin and testing the ability of the substances to modulate, i.e. inhibit or activate, neuropilin expression or activity, e.g. by blocking the interaction between neuropilin and one of its binding partners. The enhancement of level of expression or activity of neuropilin in comparison with neuropilin expressing cell that was not subjected to this agent, is indicative of an agent that shows a stimulating property toward the neuropilin. The modulation of the neuropilin activity may be assessed by various ways.

One is by determining the interaction of neuropilin with one of its downstream effectors, or the induction thereof. Among these effectors, one can cite the neuropilin-interacting protein called NIP, that is involved in membrane trafficking machinery (Cai and Reed, 1999).

Another effector is MICAL, a member of the monooxygenase protein family, that interact with the plexin A proteins in neurons. This interaction is dependent on the neuropilin-1/plexin A interaction (Terman J, 2002). In T lymphocytes, MICAL can interact with Cas-L, a protein involved in T lymphocytes migration and homing (Suzuki et al, 2002). The biological activities of Mical proteins may be susceptible to small inhibitors that affet their ability to oxidize their substrate. Some gallic acid derivatives including epigallate (EGCG) and epicatechin are potent and selective inhibitors of flavoprotein monoxygenases, such as MICAL and are thus potent modulators of NP- 1 / S3A activity (Terman J, 2002). Another effector is c-fyn. It has been recently shown (Sasaki et al, 2002) that the plexin A proteins can directly interact with c-fyn and that this association is dependent on the neuropilin/plexin A interaction. C-fyn is a member of the src tyrosine kinase family and is involved, in T lymphocytes, in the TCR signalling.

Thus modulation of the neuropilin-1 /Plexin A interaction can be useful to regulate the T cell mediated immune response and the T lymphocytes migration and homing.

Preferred modulators encompass any agent that enhances or triggers neuropilin activity through direct interaction with the neuropilin protein. Other useful modulators encompass any agent that activates neuropilin activity by interfering in the binding of the neuropilin protein with one of its binding partners.

Suitable neuropilin modulators encompass inhibitory forms of neuropilin, which can be modified forms of neuropilin molecules, fragments of neuropilin molecules, or modified fragments that retain binding capacity to Sema3A.

• In a particular embodiment, neuropilin molecules or fragments thereof be mutated, such as by site directed mutagenesis for obtaining a form of neuropilin or fragment thereof that retains binding capacity but fails to deliver a neuropilin- associated signal. Other useful modulators comprise or consist in an extracellular fragment of neuropilin. Such soluble neuropilin refers to a truncated form of a neuropilin lacking any transmembrane domain. Such soluble neuropilin could be used as the extracellular domain of NP (a1 , a2, b1 , b2, and MAM domain) fused to a human Fc.

Fragments that comprise the Semaphorin binding domain, (Koppel AM, Rapper 1997) and in particular peptide (amino-acid 360-380) NYQWVPYQGRVPYPRPGTC and peptide PQPRPL (Giordano, 2001), are preferred. Other useful neuropilin modulators encompass neuropilin binding partners, namely neuropilin interacting proteins, themselves, or variants thereof. Such neuropilin interacting proteins include semaphorins such as class III secreted semaphorins, plexins such as A1 , A2, A3, A4, B, C, soluble plexins, L1-CAM, soluble L1-CAM, neuropilin themselves such as NP-1 , NP-2 and their soluble forms, and heparans sulfate A particular way to modulate cluster induced by NP-1 is to modulate heparan sulfate / NP-1 interactions (Mamluk R, 2002).

In another aspect of the invention, the modulating or active agent acts indirectly through modulation of GMPc. The intracellular level of GMPc influences the interaction of neuropilin with Sema3A (Song et al, 1998), and as a result, influences the activity of neuropilin pathway. 8-bromo-cGMP or Sp-cGMPS, a membrane-permeable agonist of endogeous cGMP signalling, or Guanine and guanosine like or a guanylate cyclase activator such as Protoporphyrin-9 can influence the neuropilin pathway. Nitric oxide (NO) donor, S-nitroso-N- acetylpenicillamine that may activate soluble guanylate cyclase by releasing NO, abolishes the repulsive turning response of Sema3A/NP-1. Therefore nitric oxyde donor can influence neuropilin pathway. (Song et al, 1998). Similarly, as it is known that sema3A induction requires 12/15lipoxygenase (Mikule et al, 2002), it may also be useful to use an agent that modulates such lipooxygenase as indirect neuropilin modulation. Examples of such agents include 12(S)- hydroxyeicosatetraenoic acid (HETE).

In still another aspect of the invention, the modulating or active agent is capable of interfering with the homophilic interaction of a neuropilin at the surface of an immune cell. Homophilic interaction is intented for a homo or hetero- oligomerisation, cis or trans, of either NP-1 , or NP-2 or both. A cis oligomerisation is the interaction between proteins at the surface of a same cell, whereas a trans oligomerisation is the interaction between proteins expressed on two different cells. A trans homophilic interaction would be an interaction mediating cell aggregation and/or activation involving an immune cell and non-immune cell, such as a cell from the nervous system, a neuron for instance. In a preferred embodiment, the homophilic interaction is an NP-1/NP-1 mediated interaction, in particular between a DC and a resting or activated T cell. According to the invention, said modulating or active agent is capable of regulating, either activating or inhibiting, an immune response. More particularly, said agent controls the innate immunity response and/ or the cell-mediated immune response initiation. Innate immune response requires interactions between DC and pathologic cells such as infected or cancer cells, DC and other immune cells such as NK, γδ l cells or NKT cells. Innate immunity provides host defense also using NK, γδ T cells or NKT cells. Initiation of the cell-mediated immune response requires the formation of the immunological synapse which implies an initial interaction between DC and T cells.

Activation of the immune response can be achieved by any agent capable of promoting an interaction with a neuropilin at the surface of an immune cell and/or a neuropilin/neuropilin interaction, in particular NP-1/NP-1 , or NP-1/NP-2, between immune cells. Conversely, inhibition of the immune response can be achieved by any agent likely to block the interaction with a neuropilin at the surface of an immune cell and/or a neuropilin/neuropilin interaction between immune cells.

Proteases that cut or inactivate neuropilin may also be useful.

Preferred neuropilin modulators include inhibitory anti- neuropilin antibodies.

. Other modulating agents are described throughout the present specification.

Inhibitory antibodies In another aspect, the neuropilin modulating or active agents are monoclonal or polyclonal antibodies, or fragments thereof, or chimeric or immunoconjugate antibobies, which are capable of specifically recognizing a neuropilin or a neuropilin interacting protein. The antibodies of the present invention can be single chain or double chain, chimeric antibodies, humanized antibodies, or portions of an immunoglobulin molecule, including those portions known in the art as antigen binding fragments Fab, Fab', F(ab')2 and F(v). They can also be immunoconjugated ,e.g. with a toxine, or labelled antibodies.

Antibodies that inhibit the interaction of neuropilin with one of its binding partners are more particularly useful.

Whereas polyclonal antibodies may be used, monoclonal antibodies are preferred for they are more reproducible in the long run.

Procedures for raising polyclonal antibodies are also well known. Polyclonal antibodies can be obtained from serum of an animal immunized against neuropilin or a neuropilin interacting protein, which can be produced by genetic engineering for example according to standard methods well-known by one skilled in the art. Typically, such antibodies can be raised by administering the protein or polypeptide of the present invention subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum. The antigens can be injected at a total volume of 100 μ! per site at six different sites. Each injected material will contain adjuvants with or without pulverized acrylamide gel containing the protein or polypeptide after SDS-polyacrylamide gel electrophoresis. The rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A sample of serum is then collected 10 days after each boost. Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed in E. Harlow, et. al., editors, Antibodies: A Laboratory Manual (1988), which is hereby incorporated by reference.

A "monoclonal antibody" in its various grammatical forms refers to a population of antibody molecules that contain only one species of antibody combining site capable of immunoreacting with a particular epitope. A monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g. a bispecific monoclonal antibody. Although historically a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.

Laboratory methods for preparing monoclonal antibodies are well known in the art (see, for example, Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, (1988)). Monoclonal antibodies (Mabs) may be prepared by immunizing purified NP protein isolated from any of a variety of mammalian species into a mammal, e.g. a mouse, rat, rabbit, goat, camelides, human and the like mammal. The antibody-producing cells in the immunized mammal are isolated and fused with myeloma or heteromyeloma cells to produce hybrid cells (hybridoma). The hybridoma cells producing the monoclonal antibodies are utilized as a source of the desired monoclonal antibody. This standard method of hybridoma culture is described in Kohler and Milstein, 1975.

While Mabs can be produced by hybridoma culture, the invention is not to be so limited. Also contemplated is the use of Mabs produced by an expressing nucleic acid cloned from a hybridoma of this invention. That is, the nucleic acid expressing the molecules secreted by a hybridoma of this invention can be transferred into another cell line to produce a transformant. The transformant is genotypically distinct from the original hybridoma but is also capable of producing antibody molecules of this invention, including immunologically active fragments of whole antibody molecules, corresponding to those secreted by the hybridoma. See, for example, U.S. Pat. No. 4,642,334 to Reading; PCT Publication No. WO 890099 to Robinson et al.; European Patent Publications No. 0239400 to Winter et al. and No. 0125023 to Cabilly et al.

Antibody generation techniques not involving immunisation are also contemplated such as for example using phage display technology to examine naive libraries (from non-immunised animals); see Barbas et al (1992), and Waterhouse et al (1993). Several antibodies are already on the market. Anti-plexin-B1 antibodies can be purchased from Santa Cruz Biotech (Ca, USA). Anti-neuropilin antibodies can be purchased from Oncogene, Zymed, Santa cruz, R&D system.

Inhibition of neuropilin gene expression

According to one embodiment of the invention, inhibition of neuropilin activity is achieved by inhibiting the transcription of neuropilin.

One skilled in the art can select various strategies therefor.

For instance, antisense nucleic acids, including ribozymes, may be used to inhibit expression of a neuropilin protein.

When transfected into a cell via a viral vector antisense nucleic acids can be stably integrated and provide a long-term inhibition. Alternatively, antisense oligonucleotides can be directed administered and provides a transient inhibition.

An "antisense nucleic acid" is a single stranded nucleic acid molecule which, on hybridizing under cytoplasmic conditions with complementary bases in an RNA or DNA molecule, inhibits the latter's role. If the RNA is a messenger RNA transcript, the antisense nucleic acid is a countertranscript or mRNA-interfering complementary nucleic acid. As presently used, "antisense" broadly includes RNA- RNA interactions, RNA-DNA interactions, ribozymes and RNase-H mediated arrest. Antisense nucleic acid molecules can be encoded by a recombinant gene for expression in a cell (e.g., U.S. Patent No. 5,814,500 ; U.S. Patent No. 5,811 ,234), or alternatively they can be prepared synthetically (e.g., U.S. Patent No. 5,780,607).

"Neuropilin antisense" nucleic acids are preferably designed to be specifically hybridizable with a neuropilin encoding sequence, e.g. the human sequence, especially NP-1 or NP-2.

Naked nucleic acids may be used as antisense. Antisense therapy can also make use of a vector (e.g. a plasmid) that carries the antisense sequence.

The use of such a vector indeed makes it possible to improve the administration of the nucleic acid into the cells to be treated, and also to increase its stability in the said cells, which makes it possible to obtain a durable therapeutic effect. Furthermore, it is possible to introduce several nucleic acid sequences into the same vector, which also increases the efficacy of the treatment.

Vectors and methods for administering the same may be selected from the vectors and methods described for gene therapy, or may be adapted therefrom.

Antisense oligonucleotides can also be used to provide a transient neuropilin inhibition. For that purpose antisense oligonucleotides, that are not part of a viral vector, can be administered to the cell by any means as described above. As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of at least 10, preferably at least 15, and more preferably at least 20 nucleotides, preferably no more than 100 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule, or a mRNA molecule encoding a gene, mRNA, cDNA, or other nucleic acid of interest. Oligonucleotides can be labelled, e.g., with 32P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc. Reversible short inhibition of transcription may also be useful as described above. Such inhibition can be achieved by specific inhibitors of neuropilin transcription.

Aptamers (oligonucleotide sequences that are high affinity and specificity ligands) may also be of interest (Jayasena S.D., 1999). In another embodiment of the invention, one can make use of siRNAs .

RNAinterference (RNAi) technology prevents the expression of genes by using small RNA molecules such as « small interfering RNAs" (siRNAs). This technology in turn takes advantage of the fact that RNAi is a natural biological mechanism for silencing genes in most cells of many living organisms, from plants to insects to mammals (Sharp, 2001 ). RNAi would prevent a gene from producing a functional protein by ensuring that the molecule intermediate, the messenger RNA copy of the gene is destroyed. siRNAs could be used in a naked form and incorporated in a vector, as described above.

Synergy with DC-SIGN The coactivation of both DC-SIGN and NP-1 for the initiation of the immune response indicates a possible link between these two components. DC- SIGN is a protein that was shown to be a "carrier" on DC of infectious agents, such as HIV, and to be involved in the contact between DC and resting T cells (Geijtenbeek T.B.H. et al., 2000). Alternatively, as a DC expressed cell surface receptor, NP-1 could act directly as a "carrier" for said infectious agents in DC, or more generally in treating or preventing diseases or pathological conditions associated with or controlled by immune responses.

In a particular therapeutic approach, it may thus be advantageous to target both neuropilin and DC-SIGN. It was shown that a modulation of neuropilin could potentiate a modulation of DC-SIGN in term on expression or localization. In particular it may be of great interest to simultaneously inhibit a neuropilin, such as NP-1 , and DC-SIGN. This synergic inhibition can be achieved by any means available to the skilled person, according to the methods described above, e.g. by using an anti-NP antibody and an anti-DC-SIGN antibody, or a soluble NP and soluble DC-SIGN. This co- inhibition is synergic in term of inhibition of the formation and function of the immunological synapse and of inhibition of the immune response.

Alternatively, it may be useful to simultaneously activate a neuropilin and DC-SIGN and thus synergize the activation of the immune response. Accordingly another aspect of the invention relates to a method for preventing or treating disease or pathological conditions associated with or controlled by immune responses, which method comprises simultaneously modulating neuropilin, e.g. by administering to a patient in need of such treatment a therapeutically active amount of a neuropilin modulating agent, and modulating DC-SIGN, e.g. by administering to a patient in need of such treatment a therapeutically active amount of a DC-SIGN modulating agent. In another aspect, the invention relates to the use of an agent that modulates the activity or expression of a neuropilin, for the preparation of a medicament for the treatment of disease or pathological conditions associated with or controlled by immune responses , wherein the agent that modulates the activity or expression of a neuropilin is associated with an agent that modulates the activity or expression of DC-SIGN.

The DC-SIGN modulating agent may be of any type, and may selected by means of any method adapted from the methods described above.

Pharmaceutical compositions

The pharmaceutical compositions of the invention, including further the active material a convenient vehicle, may be administered to a mammal, preferably to a human, in need of a such treatment, according to a dosage which may vary widely as a function of the age, weight and state of health of the patient, the nature and severity of the complaint and the route of administration. The appropriate unit forms of administration comprise oral forms such as tablets, gelatin capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, topical, parenteral, subcutaneous, transcutaneous, transungal, intramuscular (e.g. by injection or by electroporation), intravenous, intranasal or intraoccular administration forms and rectal administration forms.

Preferably, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected, optionally directly into a tumor site in tumor therapy or into articulation in arthritis therapey, for instance.

The suitable pharmaceutical compositions may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. To prepare pharmaceutical compositions for peptide or antibody therapy, an effective amount of the protein may be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.

Examples of pharmaceutical formulations are provided hereafter. Pharmaceutical compositions comprise an effective amount of a neuropilin modulating agent in a pharmaceutically acceptable carrier or aqueous medium.

"Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. As used herein, a "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions ; formulations including sesame oil, peanut oil or aqueous propylene glycol ; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

In terms of using peptide therapeutics as active ingredients, U.S. patents 4,608,251 ; 4,601 ,903 ; 4,599,231 ; 4,599,230 ; 4,596,792 and 4,572,770 provide useful information.

The preparation of more, or highly concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area.

Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

The neuropilin modulators may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered.

In addition to the compounds formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration ; liposomal formulations ; time release capsules ; and any other form currently used, including creams.

Other routes of administration are contemplated, including nasal solutions or sprays, aerosols or inhalants, or vaginal or rectal suppositories and pessaries.

In certain embodiments, the use of liposomes and/or nanoparticles is contemplated for the introduction of inhibitory antibodies or other agents, especially protein or peptide agents, as well as nucleic acid vectors into host cells.

The formation and use of liposomes is generally known to those of skill in the art, and is also described below.

Nanocapsules can generally entrap compounds in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 μm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention, and such particles may be are easily made.

Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs)). MLVs generally have diameters of from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core.

The following information may also be utilized in generating liposomal formulations. Phospholipids can form a variety of structures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios the liposome is the preferred structure. The physical characteristics of liposomes depend on pH, ionic strength and the presence of divalent cations. Liposomes can show low permeability to ionic and polar substances, but at elevated temperatures undergo a phase transition which markedly alters their permeability. The phase transition involves a change from a closely packed, ordered structure, known as the gel state, to a loosely packed, less-ordered structure, known as the fluid state. This occurs as a characteristic phase-transition temperature and results in an increase in permeability to ions, sugars and drugs. Liposomes interact with cells via four different mechanisms: endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and neutrophils ; adsorption to the cell surface, either by non-specific weak hydrophobic or electrostatic forces, or by specific interactions with cell-surface components ; fusion with the plasma cell membrane by insertion of the lipid bilayer of the liposome into the plasma membrane, with simultaneous release of liposomal contents into the cytoplasm ; and by transfer of liposomal lipids to cellular or subcellular membrane, or vice versa, without any association of the liposome contents. Varying the liposome formulation can alter which mechanism is operative, although more than one may operate at the same time.

Cell sorting The inventors have identified Neuropilin, especially NP-1 , as a marker of DC and T cells. This makes it possible to sort these cells in a sample, e.g. by means of antibodies that recognize the neuropilin on the cell surface.

The antibodies may be immobilized on a solid surface, e.g. such as magnetic beads or a plane surface, so that the cells of interest are immobilized on the surface via antigen-antibody binding. The cells so sorted may be useful in cell therapy, e.g. against cancer, or immunotherapy. For that purpose these cells may be advantageously modified or transformed so as to express proteins of interest.

All publications, sequence references and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

The invention has been described in an illustrative manner, and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation. Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practised otherwise than as specifically described. Accordingly, those. skilled in the art will recognize, or able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described specifically herein. Such equivalents are intended to be encompassed in the scope of the following claims.

These and other embodiments are disclosed or are obvious from and encompassed by the description and examples of the present invention. Further literature concerning any one of the methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries, using for example electronic devices. For example the public database "Medline" may be utilized which is available on Internet, e.g. under http://www.ncbi.nlm.nih.gov/PubMed/medline.html. Further databases and addresses, such as http://www.ncbi.nlm.nih.gov/, http://www.infobiogen.fr/, http://www.fmi.ch/biology/research_tools.html, http://www.tigr.org/, are known to the person skilled in the art and can also be identified/located using, e.g., http://www.lycos.com. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness are given in Berks, TIBTECH 12 (1994), 352-364.

Figures:

Figure 1 represents the analysis of NP-1 expression on in vitro human monocyte-derived dendritic cells (DC). NP-1 expression increases during DC differentiation in vitro. Immature DC were obtained from monocytes after culture in the presence of GM-CSF and IL-4. At different time points, the developing DC were analyzed by flow cytometry for expression of the monocyte marker CD14, the dendritic cells markers CD1a and DC-SIGN, and NP-1. One representative experiment out of four is shown.

Figure 2 illustrates mRNA NP-1 expression in resting T cells. RT-PCR were performed using total RNA from resting T cells, human marrow adherent cells (positive control) and monocytes (negative control). The expected NP-1 PCR product is 450 bp.

Figures 3A and 3B show adhesion of soluble neuropiIin-1 to DCs and T cells. Binding of soluble NP-1 to DC or resting T cells was studied by measuring the percentage of DC or T cells bound to fluorescent soluble NP-1 ectodomain-Fc fusion protein (Fc-NP-1 ) by flow cytometry using an FITC-anti-human Fc antibody. Binding of Fc-NP-1 to DC was inhibited when DC or resting T cells were pre- incubated with blocking anti-NP-1 antibodies (DC + 28. II and T cells + 28. II) and was not inhibited when a non blocking anti-NP-1 antibody (DC + H286 and T cells + H286) was used. In each assay, DC and T cells were first pre-incubated with human IgG to block the Fc receptors on DC. Figure 3A shows a histogram representing the mean ± SE of three independent experiments and, Figure 3B shows one of the FACS analysis obtained after binding of Fc NP-1 to DC (46: percentage of DC bound to Fc NP-1 and 194: mean of fluorescence).

Figures 4A and 4B shows heterotypic T cells clustering with neuropilin-1- expressing COS-7 cells. Figure 4A COS-7 cells were transfected with a vector that allowed a high level of NP-1 expression (45%) showed by flow cytometry. Figure 4B: COS-7 cells and NP-1 expressing COS-7 cells, COS-7-NP-1 , were incubated with T cells labeled with the fluorescent dye hydroethidine at 37°C and the heterotypic cell clustering was measured by flow cytometry. The specificity of the binding was studied by T cells pre-incubation with blocking NP-1 antibodies (T cells + 28. II) or with NP-1 antibodies without a blocking function (T cells + H286). The results are. expressed as the mean + SE of three independent experiments.

Figure 5 shows that the NP-1 -mediates DC-T clustering and DC-induced T cell proliferation.

A NP-1 is required for clustering of DC with resting T cells. DC and T cells were first pre-incubated with human IgG to block the Fc receptors on DC. DC were then pre-incubated with blocking NP-1 antibody (DC + 28. II) or rabbit polyclonal IgG purified antibody (DC + IgG) and mixed with labeled allogenic resting T cells. In separate experiments, labeled allogenic resting T cells were pre-incubated with blocking NP-1 antibody (T cells + 28. II) or rabbit polyclonal IgG purified antibody (T cells + IgG) and then mixed with DC. The clustering was determined by measuring percentage of DC that had bound fluorescent T cells by flow cytometry. The results are expressed as the mean ± SE percent of three independent experiments.

B NP-1 is required for DC-induced allogenic T cell proliferation. DC and resting T cells were first pre-incubated with human IgG to block Fc receptors on DC. DC were then pre-incubated with non blocking NP-1 antibody (H286), blocking NP-1 antibody (28. II), blocking CD58 antibody (CD58) or a combination of blocking CD58 and NP-1 antibodies (CD58 + 28.ll). The allogenic resting J cells were then added to these pre-treated DC. In separate experiments, the allogenic resting T cells were pre-incubated with non blocking NP-1 antibody (H286) or blocking NP-1 antibody (28. II) and then co-cultured with DC. The control represented DC and T cells without any antibody pre-incubation. DC and allogenic resting T lymphocytes were co-cultured for 4 days. T cells were then pulsed for 16hr with ³H thymidine, and T cell proliferation was measured by thymidine incorporation. The results are expressed as the mean ± SE of CPM from triplicate wells.

Figure 6 shows the expression of intracytoplasmic Sema3A during PHA and IL-2 induced human T cell activation. T cells were collected at the indicated time, fixed, permeabilized and stained with anti-Sema3A antibody. The mean fluorescence intensity obtained as a function of time is shown.

Figure 7 shows NP-1 expression by immature and activated DC (upper panels), Sema3A binding to immature and activated DC together with Sema3A binding inhibition by VEGF165 (lower panels). The table shows the mean fluorescences obtained in different experiments.

Figure 8A is a graph showing human T cell proliferation in the presence of immature allogenic DC and the regulation of this proliferation by Sema3A. Figure 8B is a graph showing human T cell proliferation in the. presence of activated allogenic DC and the regulation of this proliferation by Sema3A. Figure 8C is a graph showing T cell clustering to immature allogenic DC and the regulation of this clustering by Sema3A. Also shown is the inhibition of T cell clustering to immature allogenic DC when T lymphocytes are preincubated with Sema3A (LT + S3A). Figure 8D is a graph showing T cell clustering to activated allogenic DC in the presence of Sema3A. The inhibition of T cell clustering to immature allogenic DC when T lymphocytes are preincubated with Sema3A is also shown (LT + S3A).

Figure 9 is a graph showing T cell induced proliferation by activated allogenic DC in the presence of a peptide (pS3a) that interfere with Sema3A binding to NP-1 , or in the presence of an anti-Sema3A antibody (34.28).

Material and methods 1) Isolation and cell culture

Human monocytes and resting T cells were isolated from peripheral blood mononuclear cells of healthy volunteers by means of a monocyte and a pan T cells isolation kits (Miltenyi Biotec, Bergisch Gladbach, Germany) as described in Geissmann, F. et al. (1998). The purity of monocytes, evaluated by CD14 staining, and of resting T cells, evaluated by CD5 and CD19 staining, was always greater than 95%o. Immature DC were obtained from monocytes as described in Geissmann, F. et al. (1998). Culture of human marrow adherent cells was performed as described in Tordjman R. et al. (1999).

2) Fluorescence microscopy.

Cells were fixed in 4% paraformaldehyde, quenched with 0,1 M glycine, plated on poly-L-lysine (Sigma, St.Louis, MO)-coated slides and were permeabilised with 0,01 % saponin; Slides were examined with a confocal laser microscope system (LSM 510 Carl Zeiss, Germany) for NP-1 and DC-SIGN antigens. Expression of Sema3A by activated T cells was examined by intracellular staining using permeabilized T cells. Primary antibodies used were rabbit anti-intracytoplasmic NP-1 antibody (provided by M. Tessier-Lavigne, San Francisco, US) goat polyclonal anti-Sema3A antibody (Santa Cruz, N-15) and mouse anti-DC-SIGN antibody (provided by Dr A. Amara, Paris, France), and the secondary antibodies used were goat anti-rabbit whole IgG, rabbit anti-goat whole IgG and goat anti-mouse whole IgG CY-3 respectively (Jackson ImmunoResearch). Controls included the omission of the primary antibody. Clustering between DC with allogenic resting T cells (1 :3) was asseyed as previously described (Al-Alwan M.M. et al., 2001 ).

3) Immunohistochemistry

Dendritic and T cells from five dermatopathic lymphadenopathy biopsy samples were studied. Lymphadenopathy specimens were fixed in formol's fixative and then paraffin-embedded. Paraffin-embedded sections were evaluated for NP- 1 and CD1a antigens by means, of the alkaline phosphatase anti-alkaline phosphatase (APAAP) method (Cordell, J. L. et al., 1984) as described in Tordjman, R. et al. (2001). NP-1 antibody was the same as used in fluorescence microscopy and the anti-CD1 a was from Immunotech. Controls included the omission of the primary antibody and the use of an irrelevant anti-thyroglobuline polyclonal antibody (Dako).

4) Reverse Transcrition-Polymerase Chain Reaction (RT-PCR) analysis

RT-PCR analysis were performed as described in Tordjman R. et al. (1999).

Primer sequences of human NP-1 , NP-2, the soluble NP-1 isoforms S1 1 and S12 and the soluble NP-2 isoform S9 are the following: forward primers 5' ACG ATG

AAT GTG GCG ATA CT 3' (NP-1 and S11 and S12), 5' TCCGCCTCTTCCACCCA 3' (NP-2 and S9), and reverse primer 5' AGT GCA TTC AAG GCT GTT GG 3' (NP-1 ), 5' TGGTTGTGGCTATTAAGAACAA 3' (S11), 5'

CTGTCTATGACCGTGGGCT 3' (S12), 5' GAGTCTGTCCAGTCACAG 3' (NP-2) and 5' GCCTCCAAGAACAGCCT 3' (S9). Primer sequences of human plexin A1 , A2, A3, B1 and L1 CAM are the following: forward primers 5' CATGTGGGCTGAGGCAGG 3' (A1 ), 5' GGGGACTAAGAGTGGCAAG 3' (A2), 5' CATGCCCTCTGTCTGCCTC 3' (A3), 5' GCAGCACCTGTGCACCCACAAGGC 3' (B1 ) and 5' GTTGTCCAGCTGCCAGCCA 3' (L1 CAM); reverse primers 5' CTGGACAGGTAGTGCTCCT 3' (A1), 5' GGAGCATCACTCACTACCAG 3' (A2), 5'ATGCCCTGCCAGATGCTGC 3' (A3), 5' TGCAGGCTGGACGGGAGGATGAGG 3' (B1) and 5' GTGTCATTGGCCTGGAGGT 3' (L1CAM). Primer sequences of human Sema3A, SemalV, SemaV and SemaE are the following: forward primers 5' ACTCACTGTTCAGACTTA 3' (Sema3A), 5' GCGCATGAAGTTGATCAC 3' (SemalV), 5' CAACTGGGCAGGGAAGGACAT 3' (SemaV) and 5' GCAAAATGGCTGGCAAAGATCC 3' (SemaE); reverse primers 5' GAGCTGCATGAAGTCTCT 3' (Sema3A), 5' ACCAGTGGATGCCCTTCT 3¹ (SemalV), 5' CGTCTGGGTTCTCGCTCTCCG 3' (SemaV) and 5' CCCATGAAATCTATATACATTCC 3' (SemaE).

5) Antibodies and pS3A peptide The following antibodies were used in flow cytometry: 3F2 (anti-DC-SIGN),

28.11 (anti-NP-1 ; He Z. & Tessier-Lavigne M., 1997), anti-CD14-PE (Becton

Dickinson, le pont de claix, France), anti-CD1 a (Cliniscience, Montrouge, France), anti-Sema3A (Santa Cruz, N-15). The sequence of the pS3A peptide is the following: NH2-NYQWVPYQGRVPYPRPGTC-COOH and the anticorps antiS3A 34.28 is the against the peptide pS3A.

6) Neuropilin-1 Ectodomain-Fc Binding Assay DC were first blocked with human IgG (10mg/ml). Rat NP-1 extracellular domain fused to human lgG1 Fc (Fc-NP-1) (50μg/ml; 566-NNS-025, R&D Systems; Abingdon, United Kingdom) was pre-incubated with FITC-F(ab')2 fragment goat anti-human IgG, Fc (gamma) fragment specific (FITC-anti-human Fc)(Jackson ImmunoResearch) for 1 hr at 37°C. DC pre-incubated with/without the anti-NP-1 blocking rabbit antibody IgG (1 :100) (He Z. & Tessier-Lavigne M., 1997), were then incubated with the immune complexes FITC-anti-human Fc / Fc-NP-1 for 30 min at room temperature. The binding assay was evaluated by flow cytometry analysis. Controls included the binding of FITC-anti-human Fc without Fc-NP-1 to DC preincubated with/without anti-NP-1 antibody.

7) Sema3A and VEGF165 containing supernatants

Sema3A and VEGF165 supernatants were obtained by transient transfection of COS cells with the Sema3A (He Z.& Tessier-Lavigne M, Cell 1997) and VEGF165 (Tordjman et al, 1999) cDNAs containing plasmids. The supernatants were collected 24 hours after the transfection. Control supernatant was obtained from COS cells transfected with the empty expression vector pSEC.

8) Heterotypic Cell Clustering and DC-Induced T cell Proliferation. Clustering of resting T cells were assayed with COS7 cells or with NP-1-

COS7 cells transfectants. The NP-1 cDNA was cloned into the expression vector pMT21 (a kind gift from Dr Tessier-Lavigne, San Francisco) (He Z.& Tessier- Lavigne M, Cell 1997) and transiently transfected into COS7 cells using Lipofectamine (GIBCO-BRL). Clustering between DC with allogenic resting T cells was assayed as previously described (Geijtenbeek T.B.H. et al., 2000 a). T cells were labeled with hydroethidium (40μg/ml; Molecular Probes) for 1 hr at 37°C before mixing with DC (100:5). The clustering was determined by measuring percentage of fluorescent T cells that had bound DC by flow cytometry.

DC-induced resting allogenic T lymphocyte proliferation was evaluated as previously described (Geijtenbeek T.B.H. et al., 2000 a). Briefly, immature DC (4 x

10³) and allogenic resting responder T lymphocytes (100 x 10³) were mixed, cultured for 4 days and pulsed for 16 hr with [³H] thymidine and thymidine incorporation was quantified.

In these assays, DC or resting T cells were first blocked with human IgG (10mg/ml) and preincubated with/without the anti-NP-1 blocking rabbit antibody IgG purified (10μg/ml) (Geijtenbeek T.B.H. et al., 2000 a) for 30 min at 4°C. For functional blocking test of NP-1 , the blocking NP-1 antibody 28. II (against amino acids 265 to 857) was used as previously described at 10μg/ml and the control used was a non blocking NP-1 antibody, H286 (against amino-acids 570 to 855) (Santacruz). These two antibodies recognized extracellular epitopes.

Example 1 : Immunofluorescence analysis of NP-1 expression in immune cells and tissues

1.1. NP-1 Expression by DC:

Immature or activated DC were plated on poly(L)lysine coated slides and expression was assessed by immunofluorescence. Immunofluorescence analysis indicated that NP-1 is expressed on cytoplasmic expansion of both immature and mature human DC. Interestingly, no staining could be detected on monocytes, one of the DC precursors. As differentiation of monocytes into immature DC could be obtained in vitro in the presence of GM-CSF and IL-4, NP-1 protein expression was followed during this process.

No NP-1 expression could be detected on purified monocytes that expressed a high level of CD14 (Fig.1 , dO). Differentiation of monocytes into DC was followed by the decreased expression of CD 14, and an accompanying increased expression level of CD1a and DC-SIGN. Here, NP-1 expression is shown to be also increased during DC differentiation in vitro and followed a time course of appearance similar to the DC-SIGN or CD1a ones (Fig1 , d2, 4 and 7). Further maturation of DC in the presence of cytokines (TNFα, IL-1 ) did not significantly enhance NP-1 expression. NP-1 protein is also detected in langherans cells obtained in vitro as immature DC obtained with GM-CSF and IL-4 but plus TGFbeta (Geissmann, J Exp Med, 187:961-966, 1998), and in langherans in vivo on paraffin embedded skins by immunohistochemistry.

So NP-1 is expressed by several DC types: langherans cells, myeloid origin (DC derived from monocytes, see above) and also by plasmacytoid origin (cells were obtained from human peripheral blood and immunostained double positive by anti-CD1c (BDCA-2 from CLB) and anti-NP-1).

NP-1 is also interestingly expressed by other immune cells such as NKT cells (double positive immunostained by anti-CD56 dim and anti-NP-1 by Facs on human peripheral blood) , involved in the innate immunity.

1.2 NP-1 Expression by T cells and T cell-DC interaction induces NP-1 polarization.

To study NP-1 expression on resting T lymphocytes, these cells were purified from adult peripheral blood and NP-1 expression was searched for at the mRNA and protein levels. NP-1 protein was detected in resting T cells by immunocytochemistry.

Polarization of localization of NP-1 on fixed allogenic DC-T cell conjugates was found in T cell but not DC at the contact zone. Bipolar polarization of NP-1 on T cells was also found in a few DC-T cell conjugates. NP-1 and CD3 were detected on allogenic DC-T cell conjugates. Polarization and co-localization of NP-

1 and CD3 were further shown.

The level of NP-1 expression (ARN and protein) is low in resting T cells and increases by activated T cells after contacting DC and consequent proliferation. This increased expression makes it possible for the formation of homoclusters during T cell proliferation by NP-NP interaction. This NP-1 expression strongly induced on T cells during the activation of T cells could be involved in the effector immune function of T lymphocytes. 1 .3. NP-1 Expression in human lymphoid tissues

To determine if NP-1 expression in vitro coincides with expression in vivo, sections of lymph nodes were stained with anti-NP-1 antibodies.

Analysis of NP-1 expression in reactive dermatopathic lymphadenopathy which are known to contain a high number of DC in the interfollicular areas was done by immunohistochemistry (APAAP technique, naphtol fast red) and by immunofluorescence. NP-1 -expressing cells were found in lymph nodes T cell areas. Cytoplasmic NP-1 staining of cells with the DC morphology was observed in interfollicular areas, whereas the mantle cells of follicules (M) were negative. Surrounded lymphocytes in the interfollicular areas were also positive. Same serial sections stained with anti-CD1 a antibody, showed strong staining of DC whereas lymphoid cells were negative Expression of NP-1 and CD1 a was shown by immunofluorescence in human reactive dermatopathic lympadenopathy. Coexpression of NP-1 and CD1 a in dendritic cells is shown by double immunofluorescence.

Careful analysis of the staining of lymph nodes with anti-NP-1 antibodies indicated that, in addition to DC, T lymphocytes in the interfollicular areas also expressed this receptor NP-1.

The same method of immunohistochemistry applied on paraffin-embedded human skin show that langherans cells and dermal cells expressed NP-1 in vivo.

Example 2 : NP-1 roles in DC - T cell interaction and T cells clustering 2.1 . Adhesion of soluble neuropilin-1 to DCs and T cells

Using a Fc-NP-1 adhesion assay (Chen H, Neuron, 19, 547-559, 1997), Fc NP-1 was able to bind to DC (figure 3B) and this binding was inhibited in the presence of blocking anti-NP-1 antibodies whereas antibodies against NP-1 without blocking activity had no effect (figure 3A). A similar result was obtained with Fc-NP-1 and resting T cells. These results showed that the adhesion of DC or T cells to Fc-NP-1 is mediated by NP-1 and that the interaction between DC and resting T cells might involve homophilic NP-1 /NP-1 interactions (Figures 3A and 3B). 2.2. Heterotypic T cells clustering with neuropilin-1 -expressing COS-7 cells.

NP-1 can mediate resting T cells clusters when expressed in heterologous cells. The heterotypic cell clustering was measured by flow cytometry. COS7 cells were transfected with a NP-1 expression vector and 45% of COS7 cells expressed

NP-1 (Fig.4A). Resting T cells could form clusters with these COS7-NP-1 cells in a

NP-1 -dependent manner because blocking NP-1 antibodies inhibited the interaction whereas antibodies against NP-1 without blocking function had no effect (Fig.4B). The NP-1 independent clustering of T cells to untransfected COS7 cells might be explained by the expression of adhesion molecules by COS7 cells such as LFA-3 which can interact with CD2 on T cells or by the low level of NP-1 expression (less than 6%) in untransfected COS7 cells. However, as the blocking

NP-1 antibody had no effect on the NP-1 independent clustering of T cells on COS-7 cells, the former hypothesis were favored.

2.3. NP-1 effects on DC induced T cell clustering and proliferation

NP-1 is required on both DC and T cells for DC-T cell binding and T cell activation. DC clustering with allogenic resting T cells was partially inhibited when DC or T cells were pre-incubated with blocking anti-NP-1 antibodies (Fig.5A). The relative inhibitions (respectively 50% and 40% for pre-incubated DCs and T cells) indicate that the DC-T cell clustering is not totally dependent of the NP-1 activity and may reflect the numerous adhesion molecules involved in the stabilisation of the DC-T cell contact. Finally, to determine whether NP-1 mediated interactions are required for the initiation of the primary immune response, the effect of the NP- 1 antibodies on the DC-induced proliferation of resting T cells was studied. As shown in figure 5B, the DC-induced proliferation of resting T cells was 60%o inhibited when DC were pre-incubated with the blocking anti-NP-1 antibodies and 50% inhibited when T cells were pre-incubated with the same antibodies. These inhibitions were in the range of the values obtained when antibodies against LFA-3 (CD58) were used in the same assay (Fig.δB). The involvement of NP-1 mostly in the initial DC-T cell contact was further shown as NP-1 antibodies could not inhibit T cell proliferation of activated T cells. Example 3 : The role of NP-1 on the interaction between DC and NKT

NKT are involved in the innate immunity (mediating immunity such as anti- tumor and anti-viral immunity) and interact with DC. In this interaction, DC directly trigger NK cell function such as IFN-gamma production by NKT (Fernandez NC, Nat Med, 1999, 5:405-411 ). NKT and DC expressed NP-1 protein. When DC and NKT are incubated with blocking NP-1 antibody, the IFN-gamma production by NKT is down regulated.

Example 4 : The role of NP-1 on the expression and localization of DC- SIGN, protein expressed by DC and involved in the initiation of immunological synapse

DC pre-incubated with Sema3A binding NP-1 show a decreased DC-SIGN expression, a transmembrane protein which has been previously implicated in the immune response initiation.

Immunofluorescence studies demonstrated that DC-SIGN and NP-1 are coexpressed in DC and colocalize at the immunological synapse. The interaction of the soluble Fc-NP-1 with DC indeed induces the clustering of the DC-SIGN expressed by DC, necessary for the immunological synapse formation. It appears that NP-1 modulates DC-SIGN localization and induces DC-SIGN to concentrate at the site of the forming immune synapse to favour the DC-SIGN / ICAM-3 interaction.

Example 5 : The immunosuppressive role of Semaphorin3A

As already above mentioned, Sema3A mRNA expression could only be detected at a very low level in resting T cells. However, the cytoplasmic expression of the Sema3A protein is increased with activation and proliferation of

PHA and IL-2 (Figure 6), PMA-lono or CD3-CD28 activated T cells, and then further decreased with the stop of T cell proliferation.

Sema3A was shown to bind to DC competitively with another NP-1 ligand, VEGF165. Sema3A binds to DC by interacting with NP-1 (Figure 7). Immature DC pre-incubated with Sema3A show a reduced dextran internalisation capacity which indicates a decreased pinocytose function of these cells (Sallusto et al., 1995), a process necessary for antigen presentation and implicated in the primary steps of the immune response, before DC / T cell interaction.

DC pre-incubated with Sema3A binding NP-1 show a decreased DC-SIGN expression, a transmembrane protein which has been previously implicated in the immune response initiation.

Finally, pre-incubation of DC (immature and activated) or resting T cells with Sema3A inhibits DC / T cell clustering and T cell proliferation (Figures 8A-8D).

T cell proliferation induced by activated DC increases when DC and T cells are incubated with peptide that is an antagonist of Sema3A, or with an anti- Sema3A antibody (figure 9).

Furthermore incubation of DC with Sema3A induced cytoskeleton retraction of the DC measured by the size changes detected by Facs and by microscopy.

Altogether, these data indicate an immunosuppressive role of Sema3A, both before (antigen uptake by DC) and during Tcell/DC interaction on both side T cells and DC.

Example 6: NP-1 ligands and coreceptors in the immune system

The role of NP-1 ligands and coreceptors in the immune response is emphasized by detection of expression by RT-PCR or by immunochemistry. By RT-PCR, are expressed by DC: the isoform S1 1 and S12 of the soluble NP-1 , NP-2, the isoform S9 of the soluble NP-2, plexins A1 , A2, A3, B1 , L1CAM. Semaphorin IV, E and V are also detected in DC. Neuropilin-2, Semaphorin IV, plexins A1 , A2, A3, L1 CAM is also expressed by T cells. The proteins plexin B1 and NP-2 are present in the DC.

The present invention thus shows that NP-1 is involved in the formation of the immunological synapse essential for T cell activation. Moreover, the present data demonstrate that NP-1 acts in trans at the synapse between T lymphocytes and DC which might contribute to aggregation and hence activation of this receptor. Thus, NP-1 / NP-1 interactions appears to participate to DC / T cells aggregation and clustering necessary to the immunological synapse formation and function.

NP-1 is also involved in the innate immunity because of its expression on DC and NKT cells and by NP-1 role on this interaction modulating the cytokine secretion necessary for this immune response.

NP-1 ligands or coreceptors such as semaphorins, plexins and L1-CAM could contribute to regulate the immune response by triggering or extinguishing the contact between T lymphocytes and DC. In particular, Sema3A acts as an immunosupressor, by inhibiting the antigen uptake by DC and by inhibiting the immunological synapse function. This type of regulation could give rise to distinct functional outputs such as effector and memory T cell generation or T cell tolerance.

REFERENCES

Akli et al. (1993) Nature Genetics 3:224

Al-Alwan M.M. et al. (2001 ). Cutting edge: the dendritic cell cytoskeleton is critical for the formation of the immunological synapse. The Journal of Immunology, 166(3): 1452-1456.

Ausubel et al. eds (1994) Current Protocols in Molecular Biology, John Wiley and Sons, inc.

Barbas et al (1992) PNAS USA, 89: 4457-4461 Beaudet et al, (2001 ), Genome Res, 1 1 , 600-8

Behr et al., (1989), Proc. Nati. Acad. Sci. USA 86, 6982-6986

Benoist et al. (1981 ) Nature,290:304-310

Blanchereau J. & Steinman R.M. (1998). Dendritic cells and the control of immunity. Nature, vol 392, 245-252. Brinster et al. (1982) Nature, 296:39-42

Cai et al., (1999) J. Neurosci. Vol. 19(15), 6519-27 Castellani, (2000) Neuron, 27:191-3 Chen H, (1997) Neuron, 19:547-559

Chen et al. (1998). Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins. Nauron, vol 21 , 1283-1290.

Chiocca et al. (1990) New Biol. 2:739

Cordell, J. L. et al. (1984). Immunoenzymatic labeling of monoclonal antibodies using immune complexes of alkaline phosphatase and monoclonal anti- alkaline phosphatase (APAAP complexes). Journal of Histochemistry and Cytochemistry, vol 32, 219-229.

Danos et al. (1988) PNAS 85:6460

DeBoer et al. (1980) "Useful proteins from recombinant bacteria" in Scientific American, 242:74-94

DeBoer et al. (Ϊ 983) Proc. Natl. Acad. Sci. USA, 80:21-25 Dobson et al. (1990) Neuron 5:353 Feigner, et. al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417 Feigner et al. (1989) Nature 337:387-388

Feigner et al., (1993), Methods 5, 67- 75)

Fernandez NC, (1999) Nat Med 5:405-1 1 Freshney eds (1986) Animal Cell Culture

Gao and Huang, (1991 ), BBRC 179, 280-285)

Geijtenbeek T.B.H. et al. (2000 a). Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune response. Cell, vol 100, 575-585. Geijtenbeek T.B.H. et al. (2000 b). DC-SIGN, a dendritic cell-specific HIV-1- binding protein that enhances trans-infection of T cells. Cell, vol 100, 587-597.

Geissmann, F. et al. (1998). Transforming growth factor betal , in the presence of granulocyte/macrophage colony-stimulating factor and interieukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells. Journal of Experimental Medicine, vol 187, 961-966

Giordano RJ, Arap W, (2001 ) Nature medecine,7: 1249-1252

Glickman et al., (2002), J. Biomolecular Screening, 7, 3-10 ; .

Graham et al. (1977) J. Gen. Virol. 36: 59

Graham (1984) EMBO J. 12, 2917-22 Haensler and Szoka, (1993), Bioconjugate Chem. 4, 372-379

Hames et al. (1984) Transcription and Translation

E. Harlow, et. al., (1988) editors, Antibodies: A Laboratory Manual He Z. & Tessier-Lavigne M. (1997). Neuropilin is a receptor for the axonal chemorepellent semaphorin III. Cell, vol 90:, 739-751 . He Z. (2000). Crossed wires : L1 and neuropilin interactions. Neuron, vol

27, 191-196.

Jayasena S.D. (1999). Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clinical Chemistry, vol 45(9):, 1628-1650. Khan A.A. et al. (2001 ). Science, vol 292:, 565-594. Kitamura H, (1999) J Exp Med, 189:1121-8 Klein M.A. & Aguzzi A. (2000). The neuroimmune interface in prion diseases. News in Physiological Sciences, vol 15:, 250-254. Kδhler et Milstein (1975). Nature, vol. 256, 495-497

Kollias et al. (^"1986) Cell, 46: 89-94 Koppel AM, Rapper J.A. (1997) Neuron, 19:531-537

Koppel AM (2001) Neuron, 7:1249-53, Le Douarin et al., (2001 ), Methods Mol Biol, 176, 227-48 Le Gal la Salle et al. (1993) Science, 259:988

Levrero et al. (1991 ) Gene, 101 :195

Lipman (1988) J. Mol. Biol. 48 : 443

Liu et al. (2001 ) Cell Biol. Vol. 13(5):619-26 McLachlan et al., ( 995), Gene Therapy 2 674-622)

Maouche et al. (1991) Blood, 15:2557

Mamluk R, (2002) JBC, 277:24818-25 Miao et al. (1999). Journal of Cell Biology.

Mikule et al. (2002) J. neurosci vol. 22(12) :41

Miyanohara et al. (1992) New Biol. 4:238

Mogram et al. (Ϊ985) Nature, 315:338-340

Neddleman and Wunsch (1970) J. Mol. Biol. 48 : 443

Perales et al., (1994), Eur. J. Biochem. 226 (), 255266

Perbal, (1984) A Practical Guide To Molecular Cloning Raper J.A. (2000). Semaphorins and their receptors in vertebrates and invertebrates. Current Opinion in Neurobiology, vol 10, 88-94.

Reeck et al. (1987) Cell 50:667

Roemer et al. (1992) Eur. J. Biochem., 208, 211

Rossignol M, (2000) Genomics, 70:211-22

Rubin-Carrez C. (2000). Les mimes peptidiques. Le technoscope, Biofutur, vol 199. Sallusto et al. (1995). Journal of Experimental Medicine, vol 182:, 389-400.

Sambrook J. et al. (1989). In Molecular cloning: a laboratory manual, (Cold spring Harbor Laboratory Press).

Sasaki et al, (2002) Neuron, 35:907-920 Sharp, (2001 ) Genes Dev, 15:485-490

Shi W. et al. (2000). The class IV semaphorin CD100 plays nonredundant roles in the immune system : defective B and T cell activation in CD100-deficient mice. Immunity, vol 13, 633-642

Smith and Johnson (1988) Gene, 67, 31-40 Smith Waterman (1981 )Ad. App. Math. 2 : 482

Song et al. (1998) Science, vol. 281 (5382) :1465-6

Stratford-Perricaudet et al. (1990) Human Gene Therapy 1 :241

Suzuki et al. (2002) J.B.C., 277(7): 14933-14941

Sy MS. & Gambetti P. (1999). Prion replication - once again blaming the dendritic cell. Nature Medicine, vol 5:, 1235-1237.

Takahashi, T. et al. (1999). Plexin-neuropilin- complexes form functional semaphorin-3A receptors. Cell, vol 99:, 59-69.

Tamagnone L. et al. (1999). Plexins are a large family of receptors for transmembrane, secreted, and GPI-achored semaphorins in vertebrates. Cell, vol 99:, 71 -80.

Terman J, Mao T, (2002) Cell, 109 :887-900

Tordjman R. et al. (1999). Neuropilin-1 is expressed on bone marrow stromal cells: a novel interaction with hematopoietic cells? Blood, vol 94:, 2301- 2309. Tordjman, R. et al. (2001 ). Erythroblasts are a source of angiogenic factors.

Blood.

Trautmann A. & Vivier E. (2001). Agrin- a bridge between the nervous and immune systems. Science, vol 292 :, 1667-1668.

Villa-Komaroff et al. (1978) Proc. Natl. Acad. Sci. USA,75:3727-3731 Wagner et al. (/1981 ) Proc. Natl. Acad. Sci. USA, 78: 1441-1445

Wagner et al., (1994), Advanced Drug Delivery Reviews 14, 113-135, Waterhouse et al. (1993) Nucleic Acids Research, 21 :2265-2266 Winzler C, (1997)J Exp Med, 185:317-328 Wu et al. (1988) J. Biol. Chem. 263:14621-14624 Wilson et al. (1992) J. Biol. Chem. 267:963-967 Wolff et al. (1990) Science 247, 1465-1468)

Yamamoto et al. (1980) Cell, 22:787-797

Yotnda P., Onishi H., et al. (2001) Gene therapy, 8(12) :930-937 Zanata, (2002) J. neurosci, 22: 471-7 Zhou et al., (2001), Methods, 25, 54-61

Claims

1. Use of an agent that modulates the activity or expression of a neuropilin, for the preparation of a medicament for the prevention or treatment of diseases or pathologic conditions associated with or controlled by immunes responses.

2. The use according to claim 1 , wherein the disease is selected from cancer, infection, auto-immune disease, graft rejection, graft versus host diseases, allergy, inflammatory disease, dendritic cell disease, and neuroimmune disease.

3.The use according to claim 2, wherein the disease is HIV infection.

4. The use according to claim 2, wherein the disease is a prion disease.

5. The use according to any of claims 1 to 4, wherein said neuropilin is neuropilin-1.

6. The use according to any of claims 1 to 5, wherein said agent is a neuropilin protein, a soluble neuropilin protein or a variant of neuropilin that shows the same biological activity as neuropilin and retains the capacity to bind a semaphorin.

7.The use according to any of claims 1 to 5, wherein said agent is a neuropilin encoding nucleic acid.

8. The use according to any of claims 1 to 5, wherein said agent is an antisense nucleic acid that blocks the expression of neuropilin.

9. The use according to any of claims 1 to 5, wherein said agent is an anti- neuropilin antibody.

10. The use according to any of claims 1 to 5, wherein said agent is capable of interfering with the homophilic interaction of a neuropilin.

11. The use according to claim 6, wherein said homophilic interaction is a neuropilin-1 / neuropilin-1 interaction.

12. The use according to any of claims 1 to 5, wherein said agent is capable of interfering with a dendritic cell/T-cell interaction.

13. The use according to any of claims 1 to 5, wherein said agent is a neuropilin interacting protein or variant thereof that retains the capacity to interact with neuropilin.

14. The use according to any of claim 13, wherein said agent is selected from the group consisting of a semaphorin, a plexin, and L1-CAM.

15. The use according to any of claims 1 to 14, wherein said agent is capable of modulating the expression of a neuropilin by a cell of the haematopoietic lineage.