CA2245956A1 - Monoclonal antibodies specific to endothelial cell cadherins and uses thereof - Google Patents

Abstract

A new VE-cadherin molecule is provided. Monoclonal antibodies that specifically bind to and neutralize an extracellular domain of a VE-cadherin molecule are provided. In vitro and in vivo methods of using these antibodies are also provided.

Description

MONOCLONAL ANTIBODIES Sl'tCl~lC TO ENDOTHELIAL CELL
CADHERINS AND USES THEREOF

CA 0224~9~6 1998-08-11 BACKGROUND OF THE INVENT~ON

Endothelial cells constitute an important i"Le- race lining the internal vascular surface and regulating the p~ss~ge of plasma proteins and circulating cells fromblood to tissues. (Caveda et al., J. Clin. Invest. 98~4): 886-893, August, 1~96).

Endothelial permeability is regulated by intercellular junctions. These junctions are complex structures formed by transl I ~embl ~ne adhesive molecules, such as cadherins, linked to a network of cytoplas~ic and cytoskeletal proteins.
Adhesive molecules regulate leukocyte extravasation, endothelial cell growth, and permeability. (Dejana, E. et al, Review: Endothelial Cell-to-Cell Jul 11tiOI IS, FAS~B J., 9:910-918 (1995). Cadherins are adhesive glycoproteins that mediate - homotypic cell-to-cell adhesion, are calcium-dependent, and protease-sensitive.
All cell types that form solid tissues express sorrle mernbers of the cadherin family and each member displays a hornophilic binding specificity. Members of the cadherin superfamily share a comrnon basic structure. The common structures of cadherins include an N-terminal extracellular domain that determines binding specihcity; a hydrophobic transmembrane dornain; and a C-terminal cytoplasmic domain. The C-terminal cytoplasmic domain, which is highly conserved among the superfarnily mernbers, interacts with the cytoskeleton through catenins and other ,~, ut~ s. Some cadherins, however, lack a cytoplasmic domain. The most il l~pOI lal1l biological role of cadherins is to support homotypic cell aggregation and segregation, which during embryogenesis promote the formation of defined tissues and organs. (Brevario, F., et al., Arterioscler. Thromb. Vasc. Biol. 15:1229-1239 (19~5)).

Despite their similar biochemical properties, each cadherin is characterized by a different spatiotemporal pattern of expression and cell binding specificity. For : W O 98/25946 PCT~US97/20006 example, in humans, E-cadherin, or uvomorulin, is essentially found in epitheliaand in subsets of neurons. N-cadherin is expressed in the nervous system and in skeletal and cardiac muscles, and P-cadherin exhibits a wides,uread distribution. (Takeichi, M., Annu. Rev. Biochem. 59:237-252 (1990)). Vascular endothelial cadherins (VE-cadherins) are endothelial-specific cadherins strictlylocalized at intercellular junctions of essentially all types of endothelium.
(Brevario, F., et al. 1995) VE-cadherins are so farthe only cadherins consistently organized at interendothelial adherence junctions. VE-cadherins areconstitutive components of all types of endothelia, have adhesive properties, restrict endothelial permeability, and mediate hornotypic cell adhesion. (Caveda~t ~ Th~3 amino acid se~uence of one such VE~cadherin, identified in this CA 0224~9~6 1998-08-11 WO 98125g46 PCT/US97/20~06 Unlike most endothelial markers, VE-cadherins are not found in blood cells or inhematopoietic precursors. The observation that VE-cadherins are constitutively expressed by the endothelium of most organs and tissues suggests that their biologic properties are required for the early assembly and integrity of blood vessels. (Breier, G. et al., Blood, 87(2)L630~41 (1996)).

Blood vessels are formed by v~-~cl 'ogenesis, a process during which a primary capillary plexus is formed that is remodeled either by fusion or regression, andangiogenesis (also called neovascularization), a process in which vasculature isformed by new vessels sprouting from preexisting vessels and invading the developing organ. (Breier et al. 1996) Angiogenesis is an important process in the menstrual cycle in the endometrium, in pregnancy, and during neonatal growth. Angiogenesis is also important in wound healing and in the pathogenesis of a large variety of ciinical diseases including tissue inflammation, arthritis, tumor growth, diabetic retinopathy, and macular degeneration by neovascula~ ion of the retina. These clinical manifestations ~CSoci~cd with angiogenesis are referred to as angiogenic diseases. (Folkman et al., Science1 235:442447 (1987). Ar Iyioyel ~esis is generally absent in healthy adult or mature tissues, although it does occur in wound healing and in the corpous luteum growth cycle. See, for example, Moses et al., Science, 248:1408-1410 (1990).

Angiogenesis is required for tumor proliferation because tumors need an adequate blood per~usion to obtain nutrients. Inhibition of angiogenesis by limiting vessel growth or selectively destroying proliferating endothelium wouldbe a useful therapy for restricting tumor growth. Various methods of inhibiting angiogenesis have been proposed: (1) inhibition of the release of "angiogenic molecules" such as basic-FGF (basicfibroblast growth factor); (2) neutralizationof angiogenic molecules, such as basic-FGF by the use of anti-basic -FGF
antibodies; and (3) il ll l,bilio~ 1 of ~ndoLhelial cell response to angiogenic stimuli.
This latter strategy has received attention, and Folkman et al., Cancer Biology,3:89-96 (1992), have described several endothelial cell response inhibitors, including coilagenase inhibitor, an yiOS~ iC steroids, fungal-derived angiogenesis CA 0224~9~6 1998-08-11 - inhibitors, platelet factor 4, thrombospondin, arthritis drugs such as ~-penicillamine and gold thiomalate, vitamin D3 analogs, alpha-interFeron, and others that might be used to inhibit angiogenesis. For additional proposed inhibitors of angiogenesis, see Blood et al., Bioch. Biophys. Acta., 1032:89-8 (1~90), Moses et al., Science 248:1408-1410 (1990~, Ingber et al., Lab. Invest.,5g:44-51 (1988~, and U.S. Patent Nos. 5,092,885; 5,112,946; 5,192,744; and ~,202,352. Other new inhibitors of angiogenesis include angiostatin and endostatin (O'Reilly et al., Cell, 88(2) 277-28~). None of the inhibitors of angiogenesis described in these references are targeted at inhibition of cadherins.

An object of this invention is to provide membrane markers of proliferating endothelial cells, i.e., VE-cadherins, which are useful in quanti~ying the degree of angiogenesis, and thus as diagnostic tools in evaluating the invasive state and other properties of a tumor. A further object of this invention is to provide antibodies against VE-cadherins, which participate in angiogenesis. Another object of this invention is to use such antibodies against VE-cadherins to inhibit angiogenesis to treat or prevent angiogenic dise~ses, such as tumor angiogenesis, rheumatoid a, lhl ilis, diabetic retinopathy and psoriasis. Such antibodies against VE-cadherins can also be useful as diagnostic tools to evaluate the invasive state and properties of a tumor.

SUMMARY OF THE INVENTION

The present invention provides a glycosylated or unglycosylated protein comprising an amino-acid sequence shown in SEQ ID NO:1 or a homologous sequence having at least 70% homology to the sequence shown in SEQ ID
NO:1.

The present invention provides monoclonal antibodies which specifically bind to VE-cadherin molecules and modify their activity.

CA 0224~9~6 1998-08-11 Further, the invention provides a method of modifying VE-cadherin activity in endothelial cells co"~prisil Ig contacting the cells with a monoclonal antibody of the invention.

The invention also provides a method of i~ IhiLJilil Ig angiogenesis in a mammalcomprising administering an effective amount of any one of the antibodies of theinvention to the mammal. In addition, the invention provides a method of ir Ihibilil Ig tumor growth in a 1 ~ lal "" ~al comprising administering an effective amount of any one of the antibodies of the invention to the mammal.

The invention also provides a pharmaceutical composition comprising any one of the antibodies of the invention and a pharmaceutically acceptable carrier.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides new transrnembrane cadherin proteins located at cell-to-cell junctions in endothelial cells. In this specification, these cadherin proteins, found on vascular endothelial cells, are called VE-cadherins. One such VE-cadherin protein is VE-cadherin-1 (also known as cadherin-~, as well as VE-cadherin), whose amino acid sequence is presented in Lampugnani, M. et al., J.Cell Biol. 118:1511-1522 (1992). A second VE-cadherin provided by this invention is called in this specification protocadherin-4 (pcdh-4); alternatively, pcdh-4 is called VE-cadherin-2. The VE-cadherins of the invention promote cell-to-cell hornotypic adhesion and its expression is upregulated in proliferating endothelial cells in comparison to resting cells. The VE-cadherin proteins of this invention are preferably of human origin, but may also be found in other animals such as mice, rats, pigs, monkeys, sheep and goats.

The present invention provides a pcdh~ protein in glycosylated or unglycosylated form comprising an amino-acid sequence selected from the CA 0224~9~6 1998-08-11 WO 9812~946 PCT/US97/20006 - sequence SEQ ID NO: 1 and homologous sequences having at least 70%
homology to the sequence S~Q ID NO: 1. The percentage of homology may for instance be at least 75%, 80% or as high as 85%, or even higher such as 90% or 95~~0, especially if the homologous sequence originates from a transmembrane protein of the same or closely related species. However, it is anticipated that proteins which have at least 70 % homology to the amino-acid sequence SEQ ID NO: 1 will share both diagnostic and medical properties to such a high degree that they can be used for the various applications of the present invention. Among such proteins may be included both naturally occurring analogs and variants of the same protein from the same or from different species as well as synthetic or recombinant equivalents of these proteins.

The synthetically or recombinantly produced proteins of the invention function as competitors in cell-cell adhesion processes at cell-to-cell junctions.

The DNA of the invention can be any DNA that encodes the protein of the invention. Such DNA can be genomic or synthetic.

Another aspect of the invention is directed to a cDNA sequence coding for a protein of the present invention. A specific embodiment of this aspect of the invention is the cDNA sequence of SEQ ID NO: 2 coding for the protein having the amino-acid sequence of SEQ ID N0: 1. The cDNA molecules of the invention may be used in gene therapy. For example, they may be used as oncosuppressors by transfection in carcinoma cells lacking this molecule.

A further aspect of the invention is directed to a structural gene coding for a protein of the present invention or a peptide derived from the protein. The structural gene may be used in the production of a protein or peptide of the in~lention. The flanking regions, such as promoter or leader sequences, are preferably chosen with regard to the expression system to be used to promote good production. Further, the codons used in the structural gene CA 0224~9~6 1998-08-11 may be selected with regard to the codons most frequently used by the selected expression host, in order to optimize the expression yield. For instance, if yeast is selected as the expression host, the codons may be optimized for yeast. The specific example of a structural gene of the invention is the protein coding region of a cDNA of the invention, namely the structural gene having the nucleotide sequence SEQ ID NO: 3 coding for the protein having the amino-acid sequence SEQ ID NO: 1.

The present invention is also directed to a recombinant protein or peptide expressed by a structural gene or a fragment of a gene provided by the invention.

The invention is further directed to a modifier of the homophilic binding of VE-cadherins at cell-to-cell junctions. The term "modifier" is to be interpreted broadly and comprises both inhibitors and activators of the binding of the VE-cadherins. In one embodiment, the modifiers of the invention either prevent or promote binding of pcdh-4 molecules at cell-to-cell junctions. In other embodiments, the modifiers of the invention either prevent or promote binding of VE-cadherin-1 (cadherin-~;) or pcdh4 ~VE-cadherin-2~ molecules at cell-to-cell junctions.

A modifier of the invention rnay be any ligand to the protein of the invention, or any ligand, which binds to the protein and has the ability to prevent or promotethe homophilic binding of VE-cadherin proteins. For example, the modifier of the invention may have a structure which is complementary to a VE-cadherin protein of the invention or a part of the protein. Such a modifier of the invention may bind to a VE-cadherin protein of the invention. In a preferred embodiment of this aspect of the invention the modifier is selected from the group consisting of antibodies specifically binding to the protein according to the invention and inhibiting or inducing or promoting the homophilic binding of said protein, and homophilic-binding-inhibiting or -inducing proteins, peptides,peptidomimetics and organic molecule-ligands derived from the amino-acid CA 0224~9S6 1998-08-11 - W O 98/2~946 PCT~US97/20006 sequence of the protein according to the invention. The invention also inciudes antisense oligonucleotides based on the cDNA sequence encoding the proteins of the invention, which may be used in cancer therapy as modifiers of angiogenesis.

The present invention provides antibodies that bind specifically to a VE-cadherin protein molecule of the invention or to a part of the VE-cadherin. The antibodies of the invention may be polyclonal, but ~rt3r~,~bly are monoclonal and prere~ably bind to the extracellular domain of a VE-ca-ll ,e, i" molecule. The VE-cadherin molecule may be any cadherin molecule that is an endothelial-specific cadherin localized at intercellular junctions of essentially all types of endothelium, and that has adhesive properties, restrict endothelial perrneability, and mediate homotypic cell adhesion. In one embodiment of the invention, the VE-cadherin molecule is called VE-cadherin-1, previously described as cadherin-5 or VE-cadherin, whose amino acid se~uence is presented in Lampugnani, M. et al., J.Cell Biol.
118:1~1 1-1522 (1992)). In another embodiment of the invention, the VE-cadherin is pcdh~, which is altematively named VE-cadherin-2.

The antibodies of the invention modify the activity of a VE-cadherin molecule.
One way of modifying such activity is by inter~ering with or preventing cell-to-cell binding of the VE-cadherin's extracellular binding domain. Another way of modifying such activity is by inducing or pr~"l.,lirlg such cell-to-cell binding. In one embodiment of this invention, the antibodies of the invention will either prevent or promote homophilic binding of VE-cadherin molecules at cell-to-cell Junctions. Accordil l~ly, modification of VE-cadherin activity encompasses both inhibition of and activation of VE-cadherin activity.

- UTILITY

A. Modifying VE-cadherin activity WO 98/~946 PCT/US97/20006 - In vivo:

Modification of VE-cadherin activity in a sample of endothelial cells may be performed in vivo. Such modification occurs when a modiher of the invention, preferabiy an antibody, is contacted with a VE-cadherin upon administering the modifier to a mammal.

Additional modifiers of the invention include, but are not limited to, peptides,peptidometics, and srnail molecules.

Methods of administration to a mammal include, for example, oral, intravenous, intraperitoneal, subcutaneous, or intramuscular adrninistration.

This in vivo method is useful for inl liiJiliny a. ~y:o~Jellesis in a mammal. The in vivo neutralization method is a useful therapeutic rnethod such as for preventing or inhibiting angiogenesis associated with pathologicdl conditions such as tumor growth in a mammal. Accordingly, the modifiers, and more specifically, the antibodies, of the invention are anti-angiogenic immunotherapeutic agents.

The methods of il lhibilil lg angiogenesis and of inhibiting pathological conditions such as tumor growth in a mammal co",,~r~ies adnninistering an effective amount of any one of the invention's antibodies to a rnamrnal or directly to a tumor within the "~" ,n ,al. The mamrnal is preferably human. This method is effective for treating subjects with carcinomas or SdlCOIll~S, preferably highly vascuiar tumors such as Kaposi's sarcoma, CNS neoplasrns ~capillary heman~i~ bl~tomas, meningiomas and cereb~ al metastases), melanornas, gastrointestinal and renal s~,.;ol"as, rhabdomyosarcoma, glioiJld:,loll,a, preferably glioblastoma multiforma, and leiomyosa, cor"a.

A cocktail of at least two monoclonal antibodies of the invention provides an especially efficient treatment for il 1l liiJiLi~ Iy angio~enesis and thus the growth of tumor cells Any number of antibodies that is effective may be used, the upper --tO--~ --. = = .
CA 0224~9~6 1998-08-11 Iimit is d~:le~ ed by cost; preferably 10, more preferably 6, and most preferably not higher than 4.

The combined treatrrlent of one or more of the antibodies of the invention with an anti-neoplastic or anti-chemotherapeutic drug such as doxorubicin, cisplatin or taxol provides an efficient treatment for inhibiting the growth of tumor cells. In one embodiment, the pharmz~cel Itic~l composition comprises the antibody and carrier with an anti-chemotherapeutic drug attached thereto.

Preventing or inhibiting angiogenesis is also useful to treat non-neoplastic angiogenic pathologic conditions such as neovascular glaucoma, proliferative retinopathy including proliferative diabetic retinopathy, macular degeneration, hemangiomas, angiuribrol"as, and psoriasis.

In addition to prevention or inhibition of angiogenesis, other applications of the modifiers of the invention include the prevention or inhibition of leukocyte infiltration, tumor cell metastasis, or endothelial permeability. r-urther applications include using the modifiers as vaccines and for making endothelial junctions more permeable to antigens, thus indicating use of the modifiers for treatment or prevention of acute and chronic inflammatory diseases, organ transplantation, myocardial ischemia, atherosclerosis, cancer, diabetic retinopathy, psoriasis, rheumatoid arthritis, and intestinal infection.

A further application of the invention is that the antibodies of the invention may be labeled and used for detecting early endothelial cell damage in vivo.
Additionally, the labeled antibodies can be used to detect and/or isolate cells that express the VE-cadherin molecules both in vivo and in vitro. Standard methods for labeling and using labeled antibodies are know in the art, such as standard blot and ELlSA formats. These ro""~Ls are normaily based on incubating an antibody with a sample suspected of conlai~ g the protein and detecting the presence of a complex between the antibody and the protein. The antibody is labeled either before, during, or after the incubation step. The protein is preferably immobilized prior to detection. Immobili~Lion may be accomplished by directly binding the protein to a solid surface, such as a microtiter well, or by binding the protein to immobilized anli~oc;;es. (R.H. Kenneth, "Enzyme-Linked Antibody Assay with Cells Attached to Polyvinyl Chloride Plates" in Kenneth et al, Monoclonal Antibodies, Plenum Press, N.Y., page 376 (1981).) In Vitro:

The invention provides a method of modifying VE-cadherin activity in a sample ofendothelial cells comprising contacting the sample with an antibody of the invention before, simultaneously with, or after, adding VE-cadherin to the cell sample.

BA Using the Antiboclies of the Invention to Isolate and Purify the VE-Cadherins and VE-Ca~ll,~,i,~ E~ ssir~ Cells The antibodies of the present invention may be used to isolate and purify VE-cadherins, and cells exp~essing VE-cadherins, using conventional methods such as affinity chromatography (Dean, P. D.G et al., Affinity C~ " on ,aLography: A
Practical Approach, IRL Press, Arlington, VA (1985)). Other methods well known in the art include magnetic separation with an~ibody-coated magnetic beads, "panning" with an antibody attached to a solid matrix, and flow cytometry.

The source of VE-cadherins is typically vascular endothelial cells, which express VE-cadherins. Suitable sources of vascular endothelial cells are blood vessels.
The VE-cadherins may be used as starting material to produce other materials, such as DNA encoding the cadherins, or as antigen for making additional monoclonal and polyclonal antibodies that recognize and bind to the VE-cadherin or other related antigens on endothelial cells.

Modifiers of VE-cadherin-1, particularly rronoclonal antibodies made against VE-cadherin-1, can bind to the extracellular domain of the protein. In some WO 98/2~;946 PCT/US97/20006 cases the antibodies bind between amino acid residues 343 and 351. These antibodies block angiogenesis. The specific amino acid sequence to which these antibodies bind is TIDLRYMSP.

C. Monitoring Levels of VE-Ca.ll ,~ In Vifro or In Vivo The antibodies of the invention rnay be used to monitor levels of VE-cadherin invitro or in vivo in biological samples using standard assays and methods known in the art. Some examples of biological samples include solid tissues, such as vascular tissue. Standard assays involve, for exarnple, labeling the antibodies and conducting standard immunoassays, such as enzyme linked immunosorbent assays (ELISA) and radioimrnunoassays, as is well known in the art. A pre~erred embodiment of the invention is a diagnostic kit comprising as a diagnostic reagent an antibody according to the invention or a modifier according to the invention. The actual diagnostic method, such as ELISA, to be used will determine any additional components in the kit.

The invention also provides transgenic anirnals or cells overexpressing or lacking a VE-cadherin protein. Transgenic animals carrying null mutation of pcdh-4 created by standard techniques, such as the knock-in and knock-out methods. Some examples of transgenic anirnals are those described by Hogan, B., et. al., 1994. These transgenic anirnals may be used as in vivo models for screening replacing, activating rnolecules for VE-cadherins such as pcdh-4, and for providing the therapeutic potential of such cadherins in gene therapy in medicine. Transgenic animals ~ay be engineered to overexpress by using promoters selected from NSE, Thy 1, PDGFB, VE cadherin, Willebrand factor, and transomodulin. Such transgenic anirnals can be used for screening in vivo for the therapeutic use of modifiers of VE-cadherin hornophilic binding.Transgenic VE-cadherin cells may be used for in vit~o testing purposes.

PREPARATION OF ANTIBODIES

CA 0224~9~6 1998-08-11 The polyclonal and monoclonal antibodies of the invention that specifically bindto the VE-cadherins may be produced by methods known in the art. These methods include the immunological rnethod described by Kohler and Milstein in Nature 256l 495~97 ~1975) and Campbell in "Monoclonal Antibody Technology, The Production and Characterization of Rodent and Human Hybridomas" in Burdon et al., Eds., Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13, ElsevierScience Publishers, A~sler~am (1985); aswell as by the recombinant DNA method described by Huse et al in Science 246, 1275-1281 (1989).

Such antibody techniques include imrnunizing an animal, preferably a mouse, with an amount of a VE-cadherin molecule to cause an immune response. The spleen of an immunized animal, which demonstrates a proper antibody titre, is removed and a fused with an immortal cell line such as a myeloma cell line. The resultant hybridoma line is then screened for antibody producing cells; said cells are then clonally isolated.

The antibody may be prepared in any mammal, including mice, rats, rabbits, goats and humans. The antibody may be a mernber of one of the following immunoglobulin classes: IgG, IgM, I~A, IgD, or IgE, and the sl Ihcl~ses thereof,and preferably is an IgG antibody.

Functional Equivalents of Antibodies The invention also includes functional equivalents of the antibodies described in this specification. Functional equivalents have binding characteristics comparable to those of the antibodies, and include, for example, chimerized, humanized and single chain antibodies as well as fragments thereof. Diabodies may also be functional equivalents of the antibodies of this invention. Methods of producing sucn functional equivalents are disclosed in PCT Application No. WO

-CA 0224~9~6 1998-08-11 - WO 9812!;946 PCT/US97/20006 93/21319, European Patent Application No. EPO 239,400; PCT Application Wo 89/09622; European Patent Application No. 338,745; and European Patent Application EPO 332,4~4.

Functional equivalents include polypeptides with amino acid sequences substantially the same as the amino acid sequence of the variable or hypervariable regions of the antibodies of the invention. "Substantially the same"
amino acid sequence is defined herein as a sequence with at least 70% percent homology to an amino acid sequence of an antibody of the invention, as determined by the FASTA search method in accordance with Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85, 2444-2448 (1988).

Chimerized antibodies preferably have constant regions derived substantially or exclusively from human antibody constant regions and variable regions derived substantially or exclusively from the sequence of the variable region ~rom a mammal other than a human.

~umanized antibodies are commonly created by transplanting the antigen binding segments, known as complementarity determining regions (CDRs), from rodent antibodies into human antibodies. (Carter and Merchant, Current Opinions in Biotechnology (8):449-454, 1997.) Humanized antibodies pl~fel~Lly have co, ~ n~ regions and variable regions other than the hypervariable region derived substantially or exclusively from the corresponding human antibody regions and complementarity deterrnining regions (CDRs) derived substantially or exclusively from a mammal other than a human. The extent to which an antibody is subs~nLially or exclusively modified can be deler,l,ined by standardmethods for optimizing the humanization methodology.

Suitable mammals other than a human include any mammal from which monoclonal antibodies may be made, such as a rabbit, rat, mouse, horse, goat, or primate.

CA 0224~9~6 1998-08-11 WO 9812~i946 PCT/US97/20006 Single chain antibodies or Fv fragments (scFv) are polypeptides which consist ofthe variable (V) region of the heavy chain of the antibody linked to the variable (V~ region of the light chain with or without an i, ILe, connecting linker. Thiscomprises the entire antibody combining site, and is the rninimal antibody binding site. These chains may be produced in bacteria.

Functional equivalents further include fragments o~ antibodies that have the samé or binding characteristics comparable to those of the whole antibody. Such r, ~yl 1 ~ may contain one or both Fab r, a~" ~el ll~ or the F(ab')2 fragment.
~, ~rer~bly the antibody ~ragments contain all six complementarity determining regions of the whole antibody, although r,~y, ne~ containing fewer than ail of such regions, such as three, four or five CDRs, may also be functional.

Diabodies are examples of additional functional equivalents. A diabody is an antibody fragment which has two antigen binding sites and can be a bivalent or bispecific ~ragment. Bispecific diabodies are l~elerodimers of two 'crossover' scFv fragments in which the variable light and variable heavy domains of the twoantibodies are present on dirr3renl polypeptide chains. (Carter and Merchant, Current Opinions in Biotechnology ~8):449~54, 1997.) Further, the functional equivalents rnay be or may combine members of any one of the following immunoglobulin classes: IgG, IgM, IgA, IgD, or IgE, and the subclasses thereof.

intracellularly expressed antibodies, referred to as "intrabodies" an be designed to bind and inactivate target molecules inside cells. Thegenes encoding can be expressed intracellularly. The specific and high-affinity binding properties of antibodies, combined with their ability to be stably expressed in precise intracellular locations inside mammalian cells, provides a molecules for gene therapy applications. (Marasco, W., Gene Ther (4) 1, p1 1-5, 1997).

dlion of VE-Cadherin Immunoqens CA 0224~9~6 1998-08-11 WO 98nsg46 PCT/US97/20006 The VE-cadherins of the invention may be used as immunogens against which an antibody can be raised, particularly the antibodies of the invention.
Alternatively, antibodies can be generated using as immunogens both synthetic peptides and VE-cadherin fragments. Such fragments and synthetic peptides are provided by the VE-cadherin amino acid sequences provided herein and by, for example, Lampugnani, M. et al., J.Cell Biol. 1 18:151 1-1522 (1992)).

As a further alternative, DNA encoding a VE-cadherin, such as a cDNA or a fragment thereof1 may be cloned and expressed and the resulting polypeptide recovered and used as an immunogen to raise an antibody of the invention. In order to prepare the VE-cadherins against which the antibodies are made, nucleic acid molecules that encode the VE-cadherins of the invention, or portions thereof, especially the extracellular portions thereof, may be inserted into known vectors for expression in host cells using standard recombinant DNA techniques.
Standard recombinant DNA techniques are described in Sambrook et al., - "Molecular Cloning," Second Edition, Cold Spring Harbor Laboratory Press (1987) and by Ausubel et al. (Eds) "Current Protocols in Molecular Biology,"
Green Publishing Associates/Wiley-lnterscience, NewYork (1990).

A suitable source of cells containing nucleic acid molecules that express the VE-cadherin includes vascular endothelial cells.

Total RNA or mRNA is prepared by standard procedures from endothelial tissue, or alternatively, from isolated endothelial cells. Standard methods may be used for Isolation of endothelial cells.

The total RNA or mRNA is used to direct cDNA synthesis. Standard methods for isolating RNA and synthesizing cDNA are provided in slal ~dard manuals of molecular biology such as, for example, in Sambrook et al., "Molecular Cloning,"Second Edition, Cold Spring Harbor Laboratory Press (1987) and in ~usubel et CA 0224~9~6 1998-08-11 - WO g8/25946 PCT/US97/20006 al., (Eds), "Current Protocols in Molecular Biology," Greene AssociateslWiley Interscience, New York (1990).

The cDNA of the VE-cadherin may be amplified by known methods. For example, the cDNA may be used as a template for arnplification by polymerase chain reaction (PCR); see Saiki et al., Science, 239, 487 (1988~ or Mullis et al., U.S.
patent 4,683,195. The sequences of the oligonucleotide primers for the PCR
amplification are derived from the sequences of mouse and human VE-cadherin respectively. The oligonucleotides are synthesized by methods known in the art.
Suitable methods include those described by Caruthers in Science 230, 281-285 (~985).

In order to isolate the entire protein-coding regions for the VE-cadherins, the upstream PCR oligonucleotide prirner is complementary to the sequence at the 5' end, preferably encompassing the ATG start codon and at least ~-10 nucleotides upstream of the start codon. The downstream PCR oligonucleotide primer is complementary to the sequence at the 3' end of the desired DNA sequence. The desired DNA sequence pl~r~rably encodes the entire extracellular portion of the VE-cadherin, and optionally encodes all or part of the transmembrane region, andlor all or part of the intracellular region, including the stop codon. A mixture of upstream and downstream oligonucleotides are used in the PCR amplification.
The conditions are optimized for each particular primer pair according to standard procedures. The PCR product is analyzed by ele~;L~ ~pt)oresis for cDNA having the correct size, cor~ esponding to the sequence between the tJI ;mel ~.

Alternatively, the coding region may be amplified in two or more ove, la~pi, Ig fragments. The overlapping fragments are designed to include a restriction site perrnitting the assembly of the intact cDNA from the fragments.

W 098/25946 PCT~US97/20006 The DNA encoding the VE-cadherins may also be replicated in a wide variety of cloning vectors in a wide variety of host cells. The host cell may be prokaryotic or eukaryotic.

The vector into which the DNA is spliced rnay c;ol ",, ise segments ofchromosomal, non-chromosomal and synthetic DNA sequences. Some suitable prokaryotic cloning vectors include plasmids from E. coli, such as colE1, PcR
pE3R322, pMB9, pUC, pKSM, and RP4. Prokaryotic vectors also include derivatives of phage DNA such as M13 and otherfilamentous single-stranded DNA phages.

C~c~.l ession and Isolation of VE-Cadherin Immunoqens DNA encoding the VE-cadherins of the invention are inserted into a suitable expression vector and expressed in a suitable prokaryotic or eucaryotic host.
The DNA inserted into a host rnay encode the entire extracellular portion o~ theVE-cadherin, or a soluble ~ragment of the extracellular portion of the VE-cadherin. The extracellular portion of the VE-cadherin encoded by the DNA is optionally attached at eitherl or both, the 5' end or the 3' end to additional amino acid sequences. The additional amino acid sequence may be attached to the VE-cadherin extracellular region in nature, such as the leader sequence, the transmembrane region and/or the intracellular region of the VE-cadherin. The additional amino acid sequences may also be sequences not attached to the VE-cadherin in nature. Prerel~bly, such additional amino acid sequences serve a particular purpose, such as to irnprove expression levels, secretion, solubility, or immunogenicity.

Vectors for expressing proteins in bacteria, especially E coli, are known. Such vectors include the PATH vectors described by Dieckmann and Tzagoloff in J.
Biol. Chem. 260, 1513-1520 (1985). These vectors contain DNA sequences that encode anthranilate synthetase (TrpE) followed by a polylinker at the carboxy terminus. Other expression vector systems are based on beta-gal~c~oskl~se _19_ CA 0224~9~6 1998-08-11 WO 98/25g46 PCT/US97/20006 (pEX); lambda PL; maltose binding protein (pMAL~; and glutathione S-transferase (pGST) -see Gene 67, 31 (1988) and Peptide Research 3, 167 (1990).

Vectors useful in yeast are available. A suitable example is the 2,u plasmid.

Suitable vectors for use in mammalian cells are also known. Such vectors include well-known derivatives of SV-40, adenovirus, retrovirus-derived DNA
sequences and shuttle vectors derived from combination of functional Irlarlllilalian vectors, such as those described above, and functional plasmids and phage DNA.

Further eukaryotic expression vectors are known in the art (e.g., P.J. Southern and P. Berg, J. Moi. Appl. Genet.1, 327-341 (1982); S. Subramani et al, Mol.
Cell. Biol. 1, 854-864 (1981); R.J. Kaufmann and P.A. Sharp, "Amplification And Expression Of Sequences Cotransfected with A Modular Dihydrofolate Reductase Complementary DNA Gene," J. Mol. Biol.159, 601 ~21 (1982); R.J.
Kaufmann and P.A. Sharp, Mol. Cell. Biol.159, 601-664 (1982); S.l. Scahill et al, "Expression And Characterization Of The Product Of A Human Immune Interferon DNA Gene In Chinese Hamster Ovary Cells," Proc. Natl. Acad. Sci.
USA 80, 4654-4659 (1983); G. Urlaub and L.A. Chasin, Proc. Natl. Acad. Sci.
USA77, 42164220, (1980).

The expression vectors useful in the present invention contain at least one expression control sequence that is operatively linked to the DNA sequence or fragment to be expressed. The control sequence is inserted in the vector in order to control and to regulate the expression of the cloned DNA sequence.
Examples of useful expression control sequences are the lac system, the trp system, the tac system, the trc system, maior operator and promoter regions of phage lambda, the control region of fd coat protein, the glycolytic promoters ofyeast, e.g., the ,uro" ,o~er for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, e.g., Pho5, the ,ulullloters of the yeast alpha-mating factors, and promoters derived from polyoma, adenovirus, retrovirus, and simian virus, e.g., the early and late promoters or SV40, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells and their viruses or combinations thereof.

Vectors containing the receptor-encoding DNA and control signals are inserted ~ into a host cell for expression of the r~ceplor. Some useful expression host cells include well-known prokaryotic and eukaryotic cells. Sorne suitable prokaryotic hosts include, for example, E. col!, such as E. coli SG-936, E coli HS 101, E. coli W3110, E. coli X1776, E. coli X2282, E. coli Dtll, and E. coli MRCI, Pseudomonas. Bacillus. such as Bacillus subtilis, and st,~Ptc)l~ ces. Suitable eukaryotic cells include yeast and other fungi, insect, animal cells, such as COS
cells and CHO cells, human cells and plant cells in tissue culture.

~ollowing expression in a host cell maintained in a suitable medium, the VE-cadherins may be isolated from the medium, and purified by methods known in the art. If the VE-cadherins are not secreted into the culture rnedium, the hostcells are Iysed prior to isolation and purification.

The antibodies of the invention rnay also be prepared frorn VE-cadherins expressed by endothelial cells, or altematively a cell into which the DNA
encoding a VE-cadherin has been 1, a~ l~r~-:led, such as 3T3 cells.

_ CA 0224~9~6 1998-08-11 EXAMPLES

The Examples which follow are set forth to aid in understanding the invention but are not intended tO1 and should not be construed to, limit its scope in any way.The Examples do not include detailed descriptions of conventionai methods employed in the construction of vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids or the introduction of plasmids into hosts. Such methods are well known to those of ordinary skill in the art and are described in numerous publications including Sarrlbrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press.

Identification of the cDNA of pcdh-4 Librarv Screenin~, DNA sequencinq.

A Igt10 library from P4-P8 postnatal mouse brain capillary was screened as previously described (Breviario et al. 1992) using a 130 bp cDNA probe obtained by means of RT-PCR. RT-PCR was carried out using, as primers, degenerated oligonucleotides (Sano et al. 1993) and a cDNA preparation from endothelioma 1 15V cells (Garlanda et al. 1991). Plaques showing a strong positive hybridization signal were screened three times to obtain a single clone. Phage inserts were rescued in pBluescript vector and sequenced by use of the dideoxynucleotide chain termination method.

Generation of recombinant f.d~ ,e~ and Production of polyclonal antibodies Recombinant fragments and polyclonal antibodies were produced in the laboratory using Qiaexpressionist Kit, Qiagen. The cDNA corresponding to EC1 (aa 74)-EC3 (recombinant fragment Extra 1 ) and to EC1 -EC4 (recombinant fragment Extra 2) of pcdh-4 were prepared by PCR and subcloned into the BamHI-Hindlll site of the expression vector pQE30 in the CA 0224S9~6 1998-08-11 : W 098/25946 PCT~US~7/20006 correct reading frame. The plasmid DNAs were then introduced into M15 (pREP4) cells by a single-step transformation method. The fusion proteins were induced by the addition of IPTG and were purified from the extract by Ni-NTA resin affinity chromatography, as described by the manufacturer (Qiaexpressionist Kit, Qiagen).
Polyclonal antibodies against pcdh-4 were produced in rabbits by injecting 0.5 mg of the fusion protein in Freund's complete adjuvant at three subcutaneous sites. Subsequent injections were in Freund's incomplete adjuvant with 0.~ mg of the fusion protein. The resultant antibodies were purified with a protein A column.

Constructs and Trans~ections Constructs: Preparation and transfection procedure were performed according to Breviario et al. 1995. Briefly, the mouse pcdh4 cDNA cloned in pBluescript vector was cut with EcoRI, and the insert was subcloned into the pECE eucaryotic expression vector to give the pECE-pcdh-4 construct. The construct was checked for correct orientation by sequence analysis.
CH0 cells were plated at 3-4x1 o6 cells per 100 mm petri dish in DMEM with 10% FCS. After 24 hrs cells were transfected by calcium phosphate precipitation with 20 ,ug pECE-pcdh-4 and 2 ~g pSV2neo plasmid. Medium was replaced by fresh medium 24 hours later and maintained for further 48 hrs. Then cells were detached and plated at 1X106 per 100 mm petri dish and cultured in selective medium with 600 ,ug/ml G418 (Geneticin, GIBC0).
Resistant colonies were isolated and tested for pcdh-4 antigen expression by immunofluorescence staining and immunoprecipitation analysis. Positive cells were cloned by limiting dilution and expanded for further studies.

Localization of Pcdh-4 at intercellular iunctiions Immunofluorescence microscopv CA 0224~9~6 1998-08-11 ~ells were seeded on glass coverslips and grown to confluence in D-MEM
medium containing 1C~% fetal calf serum before immunofluorescence staining.
Cells were fixed with MeOH for 4 min. and processed for indirect immunofluorescence microscopy as previously described in detail by Lampugnani et al. (1992~. Briefly, incubation with the primary antibody (Extra1 or Extra 2 and others) was followed by rhodamine-conjugated secondary antibody (Dakopatts) with several washes with 0.1% BSA in PBS
between the various steps. Coverslips were then mounted in Mowiol 4-88 (Calbiochem). A Zeiss Axiophot microscope was used for observation and image recording on Kodak TMax P3200 films.

Results Pcdh-4 distributes selectively at cell-cell contacts in cultured mouse endothelial cells and in transfectant cells.

Localization of pcdlh-4 in endothelial cells Immunohistochemistry Immunohistochemistry was performed according to Lampugnani et al. 1992.Tissue fragments were embedded in OCT compound (Ames Division), snap frozen in liquid nitrogen and stored at -80~C until sectioning. Cryostat sections were fixed in acetone for 10 min. at RT and were immunostained with the polyclonal antibodies Extra 1 or Extra 2 using avidin-biotin peroxidase complex technique. Sections were preincubated with horse serum to prevent non-specific binding, and then incubated with an optimal dilution of the primary antibody (1/50) for 30 min. The slides were sequentially incubated with biotin-conjugated horse anti-rabbit lg antibodies followed by avidin-biotin peroxidase complex. Each incubation step lasted 30 min. with 5 min. TBS washes between each step. The sections were finally incubated with 0.03% H202 and 0.06% 3,3' DAB for 3-5 min. Slides were then washed for 5 min. in running water, counterstained with hematoxilin for 5 min., and mounted in Canada balsam.

CA 0224~9~6 1998-08-11 WO 98/2!;946 PCT/US97/20006 Results Staining of different tissues indicate that pcdh4 antibodies stain endothelial cells of the microvasculature, with higher staining intensity in proliferating vessels of tumors. Extra 1 also cross reacts with human tissues.

The Polvclonal Ab Extra ~ can be used to detect Pcdh-4 in ELISA assay ELISA assav Microtiter wells of confluent cells were washed three times with DMEM+2.5%
horse serum +0.01% sodium azide and incubated for 1 h at 37~C with 100 ~I/well of rabbit anti-pcdh-4 serum, diluted 1/100 in PBS+2.5% horse serum.
After incubation, cells were washed three times with PBS+2.5% horse serum (washing bufler). Then, cells were fixed with glutaraldehyde 0.025% in washing buffer for 5 min., washed two times and incubated for 1 h with washing buffer. Fixation was required to prevent cells detaching from the culture wells during the following washes. After rinsing in washing buffer, cells were incubated with peroxidase conjugated anti-rabbit IgG (diluted 1/500 SIGMA) for 1h at RT. After incubation and three washes, 100 ~l chromogen substrate was added. Absorbance values were read at 490 nm.
In each experiment, the binding of peroxidase conjugated anti-rabbit IgG to the cells in the presence of non-immune serum was evaluated. This value, considered as background was subtracted from each measurement.

Results In ELISA the Ab Extra 1 was able to detect pcdh-4 protein in endothelial cells (such as H5V from heart microvasculature; bEnd from brain microvasculature) and pcdh-4 transfectant cells, while it gave negative values using cells which do not express pcdh-4 such as CH0 parental and L929 fibroblast.
The results are presented in Table 1.

WO 98/2!;946 PCT/US97120006 Table 1. Detection of pcdh-4 on endothelial cells and transfectants in ELISA

Cell types OD x 1000 H5V 305.3 + 12*
bEnd 300.2 i 18*
CHO-pcdh-4 380.5 + 10*
CHO-parental 118.6 i 6 L929 148.4 + 5 Non-immune serum was used as dilution 1/100. Absorbance values are means ~ SD of five replicates of a typical experiment out of four performed.
~Pc0.01 in comparison to CHO-parental by analysis of variance and Duncan's test.

The ab i~xtra 1 can be used to detect proliferatinq endothelial cells ELISA assay was used to detect pcdh-4 in subconfluent proliferating endothelial celis 1.2x104 cellslcm2 in comparison to non-proliferating confluent cells 1.2 x105 cells/cm2.

Results Pcdh-4 expression is higher in endothelial cells in growth than in cells at confluence.
Results are presented in Table 2.

: WO 98/259'16 PCT/US97/20006 -Table 2. Modulation of the expression of pcdh-4 at different stages of growth H5V growth stage OD x 1000 Subconfluents (1.2x104 cells/cm2) 389.3 + 2*
Confluents (1.2 x 1Q5 cellslcm2) 243.2 + 4 Values are means + SD of five replicates of a typical experiment out of four performed. *P<0.01 by Student's test.

Protocadherin 4 mediates hornotvpiic adhesion between cells Cell A~re~ation The procedure to measure cell aggregation is extensively described in Breviario et al. (1995). Briefly, confluent control cells, CHO transfected with the empty pECE and pSV2neo plasmids, and confluent pcdh-4-transfectants were washed several times with Ca~ and Mg~ -PBS. Then, 0.01% trypsin in Hank's balanced salt solution (HBSS) with 25rnM HEPI~S, 10 mM Ca~+
and 5 mM Mg++ was added and rnaintained on the cells for the shortest time interval before the appearance of intercellular retraction. Cells were completely detached by vigorous shaking of the flasks. Trypsin was neutralized by adding DMEM with 10% FCS and 0.1% soybean trypsin inhibitor. The cell suspensions were centrifuged and resuspended in HBSS
without Ca+~ and Mg~+ and then centrifuged and resuspended in 1% BSA in HBSS Ca++ and Mg~ free at a concentration of 4x105 ml. Cell suspensions (0.5 ml per well) were seeded in a 24-well plate previously coated with 1%
BSA to prevent cell adhesion, and treaLIllel lls. 5 mM CaCI2, 5mM ~GTA, 50 ~Lglml rabbit pcdh-4 purified antiserum (Extra 1), rabbit non-immune serum, were added to start aggregation. Controls without calciurn addition wer always run in parallel. Incubation was for 90 min. at 37~C on a rotating plafform (80 rpm). The reaction was stopped with 5% glutaraldehyde. The initial number of particles (NtO) and the nunlber of particles at 90 min. (Nt90) -were counted using a ZM Couiter Counter. Aggregation was quantified by use of the formula (NtO-Nt90)/NtO x 100.
For those experiments where anactin cytoskeleton disrupting agent was used, cytochalasin D was added at 1 llg/ml after the first centrifugation, and the cells were incubated at 37~C for 30 min. and processed as described.

Results Only pcdh4 transfectants showed siylliric~lll calcium-dependent aggregation.
The aggregation capacity was lost when EGTA was added to the CHO-pcdh-4 suspension. The rabbit purified antiserum, generated using the recombinant fragment Extra 1, was able to neutralize the aggregation capacity of CHO-pcdh-4 cells. Cytochalasin D did not affect aggregation indicating that the formation of aggregates does not require an intact actin cytoskeleton.
The results are presented in Table 3.

Table 3. Effect of pcdh~ transfection on cell aggregation capacity.

Transfectant cells % Aggregation CHO-parental 10 ~ 2.0 CHO-pcdh4 12 ~ 4.0 CHO-pcdh-4+Ca 5mM 50 ~: 8.2*
CHO-pcdh4-Ca 5mM+EGTA 5 mM 15 ~ 5.4 CHO-pcdh4+Ca 5mM+Ab (Extra1 ) 22 + 7.0 CHO-pcdh-4-Ca 5mM+non-immune serum 42 + 6.5 CHO-pcdh-4+Ca 5mM+Cyt D 55 + 4.1~

Values are means + SD from triplicates of a typical experirnent out of three perFormed. *P<0.01 by analysis of variance and Duncan s test in comparison to CHO parental.

CA 0224~?9~?6 1 998 - 08 - I I

Pcdh4 bindin~ was homoPhilic Aggregation assays were performed after mixing parental CHO cells and pcdh-4 transfectants. To distin~uish the two cell types, parental cells were ~ ~ labeled with 5 ?llg/ml of the fluorescent dye calcein in HBSS for 10 min. at 37~C, immediately after the first centrifugation and processed as described above. Aggregates were examined by fluorescence microscopy. The results showed that aggregation is essentially homophilic: only pcdh-4 transfectants were present in the aggregates whereas control cells remained mostly single.

Pcdh-4 promote homotvpic cell adhesion Cell Adhesion Cells in monolayers were obtained by culturing control cells and CHO-pcdh-4 transfectants (5x1 031well at the seeding) in 96-well plates for 4 - 5 days to confluence. Cells to be used in suspension were labeled 1h with 51Cr (1 ,~LCi/10~ cells). Detachment was as described above for the cell aggregation assay. Labeled cell suspensions (4x104 cells in 100 ,ul DMEM with 10% FCS
for each well) were added on the top of adherent cells (from which culture medium had been removed with no rinsing). Incubation was for 30 min. at 37~C. Non-adherent cells were removed by three washes with Ca++ and Mg++-PBS containin~ 10% FCS. The well content was then solubilized with 1 M NaOH/0.1% SDS (50 ?11) and counted for radioactivity.

Results CHO-pcdh-4 significantly adhered to homologous pcdh-4 transfectant monolayer? whereas parental cells adhered poorly to the transfectants.
The results are presented in Table 4.

Table 4. Effect on pcdh-4 transfection on cell adhesion Cell layer Cell suspension Number of adhered cells CH0-parental CH0-pcdh4 4770 + 950*
CH0-pcdh-4 CH0-pcdh4 14800 i 1800 Values are means + SD of five replicates of a typical experiment out of two performed. *P<0.01 by Student's test.

- .

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:
(A) NAME: Tamas Bartfai Konsulting AB
(B) STREET: Brinken 3 (C) CITY: Stocksund (E) COUNTRY: Sweden (F) POSTAL CODE (ZIP): 182 74 (ii) TITLE OF INVENTION: A component of intercellular junctions in the endothelium.

(iii) NUMBER OF SEQUENCES: 3 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTFM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version ~1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1180 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: both (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: NO

(xi) SEQUENCE DFSCRIPTION: SEQ ID NO: 1:

Met Met Leu Leu Leu Pro Phe Leu Leu Gly Leu Leu Giy Pro Gly Ser CA 0224~9~6 1998-08-11 Tyr Leu Phe lle Ser Gly Asp Cys Gln Glu Val Ala Thr Val Met Val Lys Phe Gln Val Thr Glu Glu Val Pro Ser Gly Thr Val lle Gly Lys Leu Ser Gln Glu Leu Arg Val Glu Glu Arg Arg Gly Lys Ala Gly Asp ~5 60 Ala Phe Gln lle Leu Gln Leu Pro Gln Ala Leu Pro Val Gln Met Asn Ser Glu Asp Gly Leu Leu Ser Thr Ser Ser Arg Leu Asp Arg Glu Lys Leu Cys Arg Gln Glu Asp Pro Cys Leu Val Ser Phe Asp Val Leu Ala Thr Gly Ala Ser Ala Leu lle His Val Glu lle Gln Val Leu Asp lle Asn Asp His Gln Pro Gln Phe Pro Lys Asp Glu Gln Glu Leu Glu lle Ser Glu Ser Ala Ser Leu His Thr Arg lle Pro Leu Asp Arg Ala Leu Asp Gln Asp Thr Gly Pro Asn Ser Leu Tyr Ser ryr Ser Leu Ser Pro Ser Glu His Phe Ala Leu Asp Val lle Val Gly Pro Asp Glu Thr Lys His Ala Glu Leu Val Val Val Lys Glu Leu Asp Arg Glu Leu His Ser Tyr Phe Asp Leu Val Leu Thr Ala Tyr Asp Asn Gly Asn Pro Pro Lys CA 0224~9~6 l998-08-ll Ser Gly lle Ser Val Val Lys Val Asn Val Leu Asp Ser Asn Asp Asn Ser Pro Val Phe Ala Glu Ser Ser Leu Ala Leu Glu lle Pro Glu Asp Thr Val Pro Gly Thr Leu Leu lle Asn Leu Thr Ala Thr Asp Pro Asp Gln Gly Pro Asn Gly Glu Val Glu Phe Phe Phe Gly Lys His Val Ser Pro Glu Val Met Asn Thr Phe Gly lle Asp Ala Lys Thr Gly Gln lle lle Leu Arg Gln Ala Leu Asp Tyr Glu Lys Asn Pro Ala Tyr Glu Val Asp Val Gln Ala Arg Asp Leu Gly Pro Asn Ser lle Pro Gly His Cys Lys Val Leu lle Lys Val Leu Asp Val Asn Asp Asn Ala Pro Ser lle Leu lle Thr Trp Ala Ser Gln Thr Ser Leu Val Ser Glu Asp Leu Pro Arg Asp Ser Phe lle Ala Leu Val Ser Ala Asn Asp Leu Asp Ser Gly Asn Asn Gly Leu Val His Cys Trp Leu Asn Gln Glu Leu Gly His Phe Arg Leu Lys Arg Thr Asn Gly Asn Thr Tyr Met Leu Leu Thr Asn Ala 405 410 41 ~
.

Thr Leu Asp Arg Glu Gln Trp Pro lle Tyr Thr Leu Thr Val Phe Ala Gln Asp Gln Gly Pro Gln Pro Leu Ser Ala Glu Lys Glu Leu Gln lle CA 0224~9~6 l998-08-ll : WO 98/25946 PCT~US97/2~006 Gln Val Ser Asp Val Asn Asp Asn Ala Pro Val Phe Glu Lys Ser Arg Tyr Glu Val Ser Thr Trp Glu Asn Asn Pro Pro Ser Leu His Leu lle Thr Leu Lys Ala His Asp Ala Asp Leu Gly Ser Asn Gly Lys Val Ser Tyr Arg lle Lys Asp Ser Pro Val Ser His Leu Val lle lle Asp Phe Glu Thr Gly Glu Val Thr Ala Gln Arg Ser Leu Asp Tyr Glu Gln Met Ala Gly Phe Glu Phe Gln Val lle Ala Glu Asp Arg Gly Gln Pro Gln Leu Ala Ser Ser lle Ser Val Trp Val Ser Leu Leu Asp Ala Asn Asp Asn Ala Pro Glu Val lle Gln Pro Val Leu Ser Glu Gly Lys Ala Thr Leu Ser Val Leu Val Asn Ala Ser Thr Gly His Leu Leu Leu Pro lle Glu Asn Pro Ser Gly Met Asp Pro Ala Gly Thr Gly lle Pro Pro Lys Ala Thr His Ser Pro Trp Ser Phe Leu Leu Leu Thr lle Val Ala Arg Asp Ala Asp Ser Gly Ala Asn Gly Glu Leu Phe Tyr Ser lle Gln Ser Gly Asn Asp Ala His Leu Phe Phe Leu Ser Pro Ser Leu Gly Gln Leu CA 0224~9~6 1998-08-11 .
Phe lle Asn Val Thr Asn Ala Ser Ser Leu lle Gly Ser Gln Trp Asp Leu Gly lle Val Val Glu Asp Gln Gly Ser Pro Ser Leu Gln Thr Gln Val Ser Leu Lys Val Val Phe Val Thr Ser Val Asp His Leu Arg Asp Ser Ala His Glu Pro Giy Val Leu Ser Thr Pro Ala Leu Ala Leu lle Cys Leu Ala Val Leu Leu Ala lle Phe Gly Leu Leu Leu Ala Leu Phe Val Ser lle Cys Arg Thr Glu Arg Lys Asp Asn Arg Ala Tyr Asn Cys Arg Glu Ala Glu Ser Ser Tyr Arg His Gln Pro Lys Arg Pro Gln Lys His lle Gln Lys Ala Asp lle His Leu Val Pro Val Leu Arg Ala His Glu Asn Glu Thr Asp Glu Val Arg Pro Ser His Lys Asp Thr Ser Lys Glu Thr Leu Met Glu Ala Gly Trp Asp Ser Cys Leu Glu Ala Pro Phe His Leu Thr Pro Thr Leu Tyr Arg Thr Leu Arg Asn Gln Gly Asn Gln Gly Glu Leu Ala Glu Ser Gln Glu Val Leu Gln Asp Thr Phe Asn Phe Leu Phe Asn His Pro Arg Gln Arg Asn Ala Ser Arg Glu Asn Leu Asn CA 0224~9~6 l998-08-ll - Leu Pro Glu Ser Pro Pro Ala Val Arg Gln Pro Leu Leu Arg Pro Leu Lys Val Pro Gly Ser Pro lle Ala Arg Ala Thr Gly Asp Gln Asp Lys Glu Glu Ala Pro Gln Ser Pro Pro Ala Ser Ser Ala Thr Leu Arg Arg Gln Arg Asn Phe Asn Gly Lys Val Ser Pro Arg Gly Glu Ser Gly Pro His Gln lle Leu Arg Ser Leu Val Arg Leu Ser Val Ala Ala Phe Ala Glu Arg Asn Pro Val Glu Glu Pro Ala Gly Asp Ser Pro Pro Val Gln Gln lle Ser Gln Leu Leu Ser Leu Leu His Gln Gly Gln Phe Gln Pro Lys Pro Asn His Arg Gly Asn Lys Tyr Leu Ala Lys Pro Gly Gly Ser Ser Arg Gly Thr lle Pro Asp Thr Glu Gly Leu Val Gly Leu Lys Pro Ser Gly Gln Ala Glu Pro Asp Leu Glu Glu Gly Pro Pro Ser Pro Glu Glu Asp Leu Ser Val Lys Arg Leu Leu Glu Glu Glu Leu Ser Ser Leu Leu Asp Pro Asn Thr Gly Leu Ala Leu Asp Lys Leu Ser Pro Pro Asp Pro Ala Trp Met Ala Arg Leu Ser Leu Pro Leu Thr Thr Asn Tyr Arg Asp Asn Leu Ser Ser Pro Asp Ala Thr Thr Ser Glu Glu Pro Arg Thr CA 0224~9~6 l998-08-ll : W0 98/25946 PCT~US97/20006 Phe Gln Thr Phe Gly Lys Thr Val Gly Pro Gly Pro Glu Leu Ser Pro 1090 10~5 1100 .
Thr Gly Thr Arg Leu Ala Ser Thr Phe Val Ser Glu Met Ser Ser Leu Leu Glu Met Leu Leu Gly Gln His Thr Val Pro Val Glu Ala Ala Ser Ala Ala Leu Arg Ar~ Leu Ser Val Cys Gly Arg Thr Leu Ser Leu Asp Leu Ala Thr Ser Gly Ala Ser Ala Ser Glu Ala Gln Gly Arg Lys Lys Ala Ala Glu Ser Arg Leu Gly Cys Gly Arg Asn Leu (2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3868 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: Z:

TGGTGCTGTG GCGGAGCAGG AA~ ll~CAGCAATTTATCTGTTCTGGG ACCTCTCACT 120 CA 0224~9~6 l998-08-ll - WO 98/2~;946 PCT/US97120006 CTGGCACGGT GATAGGGAAA CTGTCCCAAG AACTAAGAGT GGAGGAGAGG CGTGGGAAGG

AGGACGGCCT GCTCAGCACT TCCAGCCGGC TGGATCGGGA GAAGCTATGT CGGCAGGAAG

AGATTCAGGT GCTAGACATC AATGACCACC AGCCACAGTT rCCCAAAGAC GAGCAGGAAC 720 TGGACAGGGA ACTCCACTCA TA l l l l GATC TGGTGCTGAC CGCCTATGAC AATGGGAATC 960 CAGTG l l I GC TGAGAGTTCA CTAGCACTAG AAATCCCAGA AGACACTGTT CCTGGTACTC 1080 TCCAGGCAAG GGA l l l GGGT CCCAATTCCA TCCCAGGCCA TTGCAAAGTT CTTATCAAAG 1320 CA 022459~6 1998-08-11 W 098/25946 PCT~US97/20006 AGTGGCCCAT ATATACTCTC ACTGTGmG CCCAAGACCA AGGACCCCAG CCCTTATCAG 1620 CTGAGAAGGA GCTCCAAATT CAGGTTAGTG ATGTCMTGA CAATGCCCCT c ~ l l I GAGA 1680 CCCCCGmC TCACTTAGTC ATTATTGACT TTGAAACAGG AGAAGTCACT GCTCAGAGGT 1860 CACTGGACTA TGAACAGATG GCAGGCmG AGTTCCAGGT GATAGCAGAG GACAGAGGGC 1920 CCCCAGAAGT GATTCAGCCT GTGCTCAGTG AAGGCAAAGC CACCCmCG GTGCTTGTAA 2040 GTACTGGTAT ACCACCAAAG GCTACCCACA GCCCCTGGTC TTTCCTTTTG TrAACAATCG 2160 ATGCCAGCAG CCTCATCGGG AGTCAGTGGG ACCTGGGGAT AGTGGTAGAG GACCAGGGCA

TGGCTGTACT GCTGGCCATC TTTGGATTGC TCTrAGCCCT GTTCGTGTCC ATCTGCAGGA 2520 AGCCCAAGAG GCCCCAGAAA CAcATTcAGA AGGCAGATAT CCACCTGGTG CCTGTGCTTA 2640 .

CA 0224~9~6 l998-08-ll TATACAGGAC CCTGCGTAAC CAAGGCAACC AGGGAGAACT GGCAGAGAGC CAGGAGGTAC

TGCAGGACAC CTTCAACTTT CTCTTl AACC ATCCCAGGCA GAGGAATGCC TCCCGGGAGA 2880 TGCCTGGTAG CCCCATAGCG AGGGCGACTG GAGACCAAGA CAAGGAGGAG GCCCCACAGA

GAAATAAATA CTTGGCCAAG CCCGGCGGCA GCAGCAGGGG TACCATCCCA GACACAGAGG

GCCTTGTAGG CCTCAAGCCT AGTGGCCAAG CAGAACCTGA CCTGGAAGAA GGGCCCCCGA

AAATGTTGTT GGGGCAGCAC ACGGTACCAG TGGAAGCTGC GTCCGCGGCT TTGCGGAGGC

CA 0224S9~6 1998-08-11 W098/25946 PCT~US97t20006 (2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3540 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CCGTCTGGCA CGGTGATAGG GAAACTGTCC CAAGAACTAA GAGTGGAGGA GAGGCGTGGG

CA 0224~9~6 l998-08-ll WO 98/25g46 PCT/US97/20006 I 11; l l C; I I I G GCAAGCATGT GTCCCCAGAG GTGATGAACA CC I I I GGCAT AGATGCCAAG 900 GAGCAGTGGC CCATATATAC TCTCACTGTG l l l GCCCAAG ACCAAGGACC CCAGCCCTTA 1320 TCAGCTGAGA AGGAGCTCCA AATTCAGGTT AGTGATGTCA ATGACAATGC CCCTGTGl i 1 1380 GACTCCCCCG l l l CTCACTT AGTCATTATT GAC l l l GAAA CAGGAGAAGT CACTGCTCAG 1560 AGGTCACTGG ACTATGAACA GATGGCAGGC l l l GAGTTCC AGGTGATAGC AGAGGACAGA 1620 GTAAATGCCT CCACGGGCCA CCT I c; I ~ CCCATTGAGA ATCCCAGTGG CATGGATCCA 1800 GCAGGTACTG GTATACCACC AAAGGCTACC CACAGCCCCT G(i I ~; l l I ~;CT I I I GTTAACA 1860 ACCAATGCCA GCAGCCTCAT CGGGAGTCAG TGGGACCTGG GGATAGTGGT AGAGGACCAG

GGCGCCCCTC CTTGCAGACC CAAG l l l CAT TGAAGGTCGT GTTTGTCACC AGTGTGGACC 2100 CA 0224~9~6 l998-08-ll - WO 98/25946 PCT/USg7/20006 ACCTMGGGA TTCTGCTCAT GAGCCCGGAG TTCTGAGCAC ACCAGCACTG GC l l l GATCT 2160 CCTATACAGG ACCCTGCGTA ACCAAGGCAA CCAGGGAGAA CTGGCAGAGA GCCAGGAGGT

GTGCCTGGTA GCCCCATAGC GAGGGCGACT GGAGACCAAG ACAAGGAGGA GGCCCCACAG

GC l l l TGCGG AACGGAACCC GGTGGAGGAG CCTGCTGGGG ACTCTCCTCC TGTCCAGCAA

GGAAATAAAT ACTTGGCCAA GCCCGGCGGC AGCAGCAGGG GTACCATCCC AGACACAGAG

GGCCTTGTAG GCCTCAAGCC TAGTGGCCAA GCAGAACCTG ACCTGGAAGA AGGGCCCCCG

CA 0224~9~6 1998-08-11 CTGAGCCCAA CAGGCACGCG CCTGGCCAGC AC I I I CGTCT CGGAGATGAG (; I C I C; I GCTG 3360 GAAGCACAGG GTAGAAAGAA GGCAGCTGAG AGCAGACTTG GCTGTGGCAG GAATCTATGA

-- q4 ---

Claims (45)

What is claimed is:

1. A glycosylated or unglycosylated protein comprising an amino-acid sequence shown in SEQ ID NO:1 or a homologous sequence having at least 70% homology to the sequence shown in SEQ ID NO:1.

2. A cDNA sequence coding for a protein of claim 1.

3. A cDNA sequence of claim 2 having the nucleotide sequence shown in SEQ ID NO: 2.

4. A structural gene coding for a protein of claim 1 or a peptide derived from the protein.

5. A structural gene according to claim 4 having the nucleotide sequence shown in SEQ ID NO:3.

6. A recombinant protein or peptide expressed by a structural gene or a fragment of the gene of claim 4 or claim 5.

7. An antibody binding specifically to a protein according to claim 1 or a part of the protein.

8. A modifier of the binding of a protein of claim 1.

9. A modifier of claim 8 which inhibits or induces homophilic binding of the protein of claim 1 selected from the group consisting of antibodies which specifically bind to the protein of claim 1, and proteins, peptides, peptidomimetics and organic molecule-ligands derived from the amino-acid sequence of the protein of claim 1.

10. A diagnostic kit comprising as a diagnostic reagent an antibody of claim 7 or a modifier of claim 8 or claim 9.

11. A vaccine adjuvant comprising a modifier according to claim 8 or claim 9.

12. A medicament comprising as an active ingredient a modifier according to claim 8 or claim 9.

13. A transgenic animal or cell overexpressing or lacking a protein of claim 1.

14. Antisense oligonucleotide based on the cDNA sequence according to claim 2 or claim 3.

15. A monoclonal antibody which specifically binds to a VE-cadherin and modifies angiogenesis.

16. An antibody of claim 15, wherein the VE-cadherin is mammalian.

17. An antibody of claim 15, wherein the VE-cadherin is human.

18. A hybridoma cell line producing a monoclonal antibody of claim 15.

19. A polypeptide which comprises an amino acid sequence which is substantially the same as the amino acid sequence of the variable region of the monoclonal antibody of claim 15.

20. A nucleic acid that encodes the polypeptide of claim 19.

21. A chimeric antibody or a fragment thereof comprising the polypeptide of claim 20.

22. A chimeric antibody of claim 21 comprising an amino acid sequence of a human antibody constant region and an amino acid sequence of a non-human antibody variable region.

23. A chimeric antibody of claim 22 wherein the non-human variable region is murine.

24. A polypeptide which comprises an amino acid sequence which is substantially the same as the amino acid sequence of the hypervariable region of the monoclonal antibody of claim 15.

25. A nucleic acid that encodes the polypeptide of claim 24.

26. A humanized antibody or a fragment thereof comprising the polypeptide of claim 24.

27. The humanized antibody of claim 26 comprising amino acid sequences of framework and constant regions from a human antibody, and an amino acid sequence of a non-human antibody hypervariable region.

28. The humanized antibody of claim 27, wherein the amino acid sequence of the hypervariable region is murine.

29. A method of modifying VE-cadherin activity in cells comprising contacting the cells with the antibody of any of claims 15, 21 and 26.

30. A method of claim 29, wherein the cells are endothelial cells.

31. A method of inhibiting angiogenesis in a mammal comprising administering an effective amount of any one of the antibodies of claims 15,21 and 26 to the mammal.

32. A method of claim 31, wherein the mammal is a human.

33. A method of inhibiting tumor growth in a mammal comprising administering an effective amount of any one of the antibodies of claims 15,21 and 26 to the mammal.

34. A method of claim 33, wherein the mammal is a human.

35. A method of inhibiting tumor growth in a mammal comprising administering an effective amount of any one of the antibodies of claims 15,21 and 26 and a chemotherapeutic agent.

36. A method of claim 35, wherein the chemotherapeutic agent is selected from the group consisting of doxorubicin, cisplatin and taxol.

37. A pharmaceutical composition comprising any one of the antibodies of claims 15,21 and 26 and a pharmaceutically acceptable carrier.

38. A pharmaceutical composition of claim 37 further comprising a chemotherapeutic agent.

39. Modifiers that specifically bind to the amino acid sequence TIDLRYMSP.

40. A modifier of claim 39 that is a monoclonal antibody.

41. A synthetic peptide comprising the amino acid sequence TIDLRYMSP
and is capable of affecting angiogenesis.

42. A synthetic peptide of claim 41 that is capable of inhibiting angiogenesis.

43. A synthetic peptide of claim 41 that is capable of inducing or promoting angiogenesis.

44. A method of inhibiting angiogeneis in a mammal comprising administering to the mammal a effect amount of a modifier of claim 39.

45. A method of inducing or promoting angiogeneis in a mammal comprising administering to the mammal a effect amount of a modifier of claim 39.