EP1409523A2 - Acides nucleiques et polypeptides pancam - Google Patents

Acides nucleiques et polypeptides pancam

Info

Publication number
EP1409523A2
EP1409523A2 EP02756316A EP02756316A EP1409523A2 EP 1409523 A2 EP1409523 A2 EP 1409523A2 EP 02756316 A EP02756316 A EP 02756316A EP 02756316 A EP02756316 A EP 02756316A EP 1409523 A2 EP1409523 A2 EP 1409523A2
Authority
EP
European Patent Office
Prior art keywords
protein
seq
pancam
nucleic acid
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02756316A
Other languages
German (de)
English (en)
Other versions
EP1409523A4 (fr
Inventor
Chao Sun
John P. Carulli
Alexander V. Lukashin
Daniel R. Kilburn
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogen MA Inc
Original Assignee
Biogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2001/019904 external-priority patent/WO2001098360A2/fr
Application filed by Biogen Inc filed Critical Biogen Inc
Publication of EP1409523A2 publication Critical patent/EP1409523A2/fr
Publication of EP1409523A4 publication Critical patent/EP1409523A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/06—Antimigraine agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/06—Drugs for disorders of the endocrine system of the anterior pituitary hormones, e.g. TSH, ACTH, FSH, LH, PRL, GH
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/10—Drugs for disorders of the endocrine system of the posterior pituitary hormones, e.g. oxytocin, ADH
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates generally to the field of molecular biology. More particularly, this invention relates to members of the immunoglobulin superfamily.
  • Ig superfamily members are integral plasma membrane proteins with Ig domains in the extracellular portions and widely divergent cytoplasmic tails, usually with no intrinsic enzymatic activity.
  • One recurrent characteristic of the Ig superfamily members is that interactions between Ig domains on different polypeptide chains (of the same or different amino acid sequences) are essential for the biological activities of the molecules. Heterophilic interactions can also occur between Ig domains on entirely distinct molecules expressed on the surfaces of different cells. Such interactions provide adhesive forces that stabilize cell-cell binding.
  • Many members of the Ig superfamily are cell surface or soluble molecules that mediate cell recognition, adhesion and binding functions in the vertebrate immune system. Two prominent cell types that produce Ig superfamily molecules are B and T lymphocytes.
  • Ig superfamily member proteins of importance in the immune system include antibodies, T cell receptors, Class I and II major histo-compatibility complex (MHC) molecules, CD2, CD3, CD4, CD5, CD8, CD28, CD20 (Bl), CD32 (FcgRII), CD44, CD54 (ICAM-1), CD80 (B7-1), CD86 (B7-2), CD90 (Thy-1), CD102 (ICAM-2), CD106 (VCAM-1), CD121 (IL-1R), CD152 (CTLA-4), p-IgR, NCAM, and CD140 (PDGFR) (Abbas et al., supra).
  • MHC major histo-compatibility complex
  • GP354 is an integral membrane protein predominantly expressed in the pancreas. This protein is also named PanCAM, for pancreas cell adhesion molecule. In the pancreas, GP354 (i.e., PanCAM) expression is localized to ⁇ cells. GP354 is also detected in low levels in the central nervous system (CNS), such as the brain. GP354 has a predicted single membrane spanning domain and five extracellular Ig domains. Human GP354 shares about 44% identity to a 494 amino acid fragment of human NEPH1 and 47% amino acid identity with a 368 amino acid fragment of mouse NEPH1. Both fragments are in the extracellular portion of NEPH1. GP354 is likely to play a role in cell-cell interactions (e.g., adhesion) in the pancreas and the CNS, affecting these organs' structures and functions.
  • cell-cell interactions e.g., adhesion
  • the invention provides isolated polynucleotides comprising nucleotide sequences encoding the above-described isolated polypeptides.
  • Exemplary isolated polynucleotides are those comprising part (e.g., nucleotides 202-1782) or all of SEQ ID NO:l l; part (e.g., nucleotides 196-2319) or all of SEQ ID NO:7; and part or all of SEQ ID NOs:l, 3, 5, 6, 9, 25, 27, and 32.
  • the polynucleotides further comprise a transcription regulatory sequence operatively linked to said nucleotide sequence.
  • the invention also features a method of isolating beta cells from a dispersed pancreatic cell population (e.g., a bovine or swine pancreatic cell population).
  • This method comprises the steps of providing an antibody specific for a PanCAM protein; contacting the dispersed pancreatic cell population with the antibody under conditions that allow beta cells in the population to bind to the antibody; and separating cells unbound by the antibody from beta cells bound to the antibody, thereby isolating beta cells.
  • the invention also provides a polynucleotide which encodes a naturally occurring, allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, wherein the nucleic acid hybridizes to SEQ ID NO:l or SEQ ID NO:l 1 under stringent conditions.
  • the invention also provides a polynucleotide which encodes a naturally occurring, allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:4, 8, 10 or 12, wherein the nucleic acid hybridizes to SEQ ED NO:l or 11 under stringent conditions.
  • the invention provides gp354 polynucleotides that specifically detect gp354 nucleic acids relative to nucleic acids encoding other members of the Ig superfamily.
  • the invention also provides a nucleic acid construct, e.g., a recombinant vector (e.g., a cloning, targeting or expression vector), comprising a gp354 polynucleotide of the invention.
  • a diagnostic assay for identifying the presence or absence of a gp354-related genetic lesion or mutation, characterized by at least one of the following: (i) aberrant modification or mutation of a gene encoding a GP354 protein; (ii) mis-regulation (e.g., transcription, splicing or translation) of a gene encoding a GP354 protein; and (iii) aberrant post-translational modification or localization of a GP354 protein; wherein the wild-type form of the gene encodes a protein with a GP354 biological activity.
  • the invention provides a non-human animal (e.g., a mammal such as a mouse, rat, guinea pig, sheep, goat, horse or cow) at least some cells of which comprise an isolated polynucleotide of this invention.
  • a non-human animal e.g., a mammal such as a mouse, rat, guinea pig, sheep, goat, horse or cow
  • Such an animal can be chimeric where only some of its somatic and/or germ cells carry the polynucleotide.
  • Such an animal can alternatively be transgenic where all of its somatic and germ cells carry the polynucleotide.
  • the invention provides a computer readable means of storing the nucleic acid and amino acid sequences of the instant invention.
  • the records of the computer readable means can be accessed for reading and display of sequences and for comparison, alignment and ordering of the sequences of the invention to other sequences.
  • FIG. 1 The coding (SEQ ID NO:l) and deduced amino acid sequences
  • FIG. 2 The alignment of the human GP354 amino acid sequence shown in
  • FIG. 1 SEQ ID NO:2 with sequences of Drosophila irregular chiasm (ICCR) (SEQ ID NO: 13) and human nephrin (SEQ ID NO: 14) proteins. Dashes indicate gaps in any of the sequences. Asterisks denote amino acids that are identical in the three sequences.
  • FIG. 3 Sequence of the RT-PCR fragment obtained using primers GX 1-218
  • FIG. 16 A human genomic gp354 sequence (SEQ ID NO:5). Exons are underlined.
  • FIG. 5 The cDNA (SEQ ID NO: 7) and derived amino acid sequences (SEQ ID NO:
  • SEQ ID NO:8 of a human PanCAM.
  • SEQ ID NO:7 is generated based on SEQ ID NO:
  • PanCAM- 1 an insert of plasmid CS0067-1, which was deposited at ATCC on June 11, 2002 (SEQ ID NO:25)
  • PanCAM-2 an insert of plasmid CS0067-3, which was deposited at ATCC on
  • FIG. 6 The nucleotide (SEQ ID NO: 11) and deduced amino acid sequences
  • FIG. 7 The nucleotide sequence (SEQ ID NO:25; an insert of plasmid
  • FIG. 9 A Alignment of proteins encoded by alternatively spliced transcripts of PanCAM: PanCAM-1 (SEQ ID NO:26), PanCAM-2 (SEQ ID NO:28), PanCAM
  • FIG. 9B A diagram of the PanCAM locus and alternatively spliced mRNAs.
  • Exons are numbered 1-15 and shown as filled boxes, and exons with cryptic splicing sites are marked with asterisks.
  • the shaded area in the PanCAM locus represents a cryptic intron, which is a portion of an exon spliced out in PanCAM- 1 and PanCAM-2 transcripts.
  • FIG. 10A Nucleotide (SEQ ID NO:32) and deduced amino acid (SEQ ID NO:32).
  • FIG. 10B Alignment of a partial protein sequence of human PanCAM (SEQ ID NO:30) with a partial protein sequence of murine PanCAM (SEQ ID NO:31). Immunoglobulin domains are underlined. The mouse sequence is at the bottom.
  • the present invention is based, at least in part, on the discovery of a novel human gene encoding a heretofore unknown protein, GP354 (i.e., PanCAM).
  • GP354 i.e., PanCAM
  • This gene, gp354 was identified by computational analysis of ("mining") the published nucleic acid sequences of the human genome.
  • the gp354 gene contains at least 14 exons and normally resides on human chromosome 19.
  • An mRNA transcribed from this gene has an open reading frame of 1779 base pairs (including the stop codon) and encodes a protein predicted to be 592 amino acid residues.
  • the novel GP354 protein is specifically expressed in the pancreas and the brain.
  • nucleic acid includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA).
  • RNA molecules e.g., mRNA
  • the term also is intended to include analogs of DNA or RNA containing non-natural nucleotide analogs, non-native internucleoside bonds, or both.
  • the nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or in a padlocked conformation. See, e.g., Baner et al, Curr. Opin.
  • an “isolated nucleic acid” is one which is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid. Specifically excluded are isolated, non-recombinant native chromosomes and fragments thereof that are larger than 500 kilobases.
  • an “isolated” nucleic acid is substantially free of sequences that naturally flank that nucleic acid in the genome of the organism from which the nucleic acid is derived.
  • a preferred isolated g ⁇ 354 nucleic acid is flanked by less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the isolated nucleic acid is derived.
  • the isolated polynucleotides are no more than 5000 base pairs, often no more than 1000 base pairs, 500 base pairs, 100 base pairs or 50 base pairs.
  • isolated does not necessarily require that the nucleic acid or polynucleotide so described has itself been physically removed from its native environment.
  • an endogenous nucleic acid sequence in the genome of an organism is deemed “isolated” herein if a heterologous sequence (i.e., a sequence that is not naturally adjacent to this endogenous nucleic acid sequence) is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered.
  • a non-native promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gp354 gene in the genome of a human cell, such that this gene has an altered expression pattern. This gene would now become “isolated” because it is separated from at least some of the sequences that naturally flank it.
  • a nucleic acid is also considered “isolated” if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome.
  • an endogenous gp354-coding sequence is considered “isolated” if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention.
  • An "isolated nucleic acid” also includes a nucleic acid integrated into a host cell chromosome at a heterologous site, a nucleic acid construct present as an episome and a nucleic acid construct integrated into a host cell chromosome.
  • an "isolated nucleic acid” can be substantially free of other cellular material, or substantially free of culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • a polynucleotide of the invention is considered “full-length” if it is able to encode a full-length GP354 protein.
  • the phrase "degenerate variant" of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence.
  • microarray includes all the devices so called or similarly called in Schena (ed.), DNA Microarrays: A Practical Approach (Practical Approach Series ' ). Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl):l-60 (1999); and Schena (ed.), Microarray Biochip: Tools and Technology. Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376); Brenner et al, Proc. Natl. Acad. Sci. USA 97(4):1665-1670 (2000). The disclosures of all of these references are incorporated herein by reference in their entireties.
  • probe refers to an isolated nucleic acid of known sequence that is, or is intended to be, detectably labeled.
  • probe refers to the isolated nucleic acid that is, or is intended to be, bound to the substrate.
  • target refers to a nucleic acid intended to be bound to a probe by sequence complementarity. Unless otherwise indicated, a "nucleic acid comprising SEQ ID NO: 1
  • nucleic acid refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO:X, or (ii) a sequence complementary to SEQ ID NO:X.
  • the choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.
  • high stringency conditions are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6X SSC (where 20X SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65°C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65°C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing.
  • standard "high stringency conditions” are defined as hybridization in 50% formamide, 5X SSC, 0.2 ⁇ g/ ⁇ l poly(dA), 0.2 ⁇ g/ ⁇ l human cotl DNA, and 0.5% SDS, in a humid oven at 42°C overnight, followed by successive washes of the microarray in IX SSC, 0.2% SDS at 55°C for 5 minutes, and then 0.1X SSC, 0.2% SDS, at 55°C for 20 minutes.
  • “moderate stringency conditions” suitable for cross-hybridization to mRNA encoding structurally- and functionally-related proteins, are defined to be the same as those for high stringency conditions but with reduction in temperature for hybridization and washing to room temperature (approximately 25°C).
  • protein As used herein, the terms “protein,” “polypeptide,” and “peptide” are used interchangeably to refer to a naturally-occurring or synthetic polymer of amino acids, irrespective of length, where amino acids here include naturally- occurring amino acids, naturally-occurring amino acid structural variants, and synthetic non-naturally occurring analogs that are capable of participating in peptide bonds.
  • the terms “protein”, “polypeptide”, and “peptide” explicitly permit post-translational and post-synthetic modifications, such as N- or C-terminal amino acid cleavage reactions and glycosylation.
  • oligopeptide herein denotes a protein, polypeptide, or peptide having 25 or fewer amino acid residues.
  • homologs encompasses “orthologs” and "paralogs.”
  • “Orthologs” are separate occurrences of the same gene in different species of organisms. The separate occurrences have similar or identical amino acid sequences, where the degree of sequence similarity depends in part on the evolutionary distance of the species from a common ancestor having the same gene.
  • "Paralogs” indicates separate occurrences of a gene in one species of organism. The separate occurrences have similar or identical amino acid sequences, where the degree of sequence similarity depends in part on the evolutionary distance of these separate occurrences from the gene duplication event giving rise to the occurrences.
  • homologous amino acid sequences include those amino acid sequences which contain conservative amino acid substitutions and which polypeptides have substantially the same binding and/or activity.
  • a homologous amino acid sequence does not, however, include the amino acid sequence encoding other known Ig superfamily members. Homology (percent identity) can be determined by, for example, the GAP program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison WI), using the default settings, which uses the algorithm of Smith and Waterman (Adv. Appl Math., 2:482-489 (1981), which is incorporated herein by reference in its entirety).
  • antibody refers to a full antibody
  • fragments consisting of two heavy chains and two light chains
  • fragments include, but are not limited to, those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation, and those produced recombinantly, so long as the fragment remains capable of specific binding to an antigen.
  • fragments include Fab, Fab', F(ab') 2 , and single chain Fv (scFv) fragments.
  • antibody Within the scope of the term "antibody” are also antibodies that have been modified in sequence, but remain capable of specific binding to an antigen.
  • modified antibodies are interspecies chimeric and humanized antibodies; antibody fusions; and heteromeric antibody complexes, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies (see, e.g. , Marasco (ed.), Intracellular Antibodies: Research and Disease Applications.
  • Specific binding refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment. Typically, “specific binding” discriminates over adventitious binding in a reaction by at least two-fold, more typically by at least 10-fold, often at least 100-fold.
  • the affinity or avidity of a specific binding reaction is at least about
  • region is meant a physically contiguous portion of the primary structure of a biomolecule.
  • a region is defined by a contiguous portion of the amino acid sequence of that protein.
  • domain refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be co-extensive with regions or portions thereof; domains may also include distinct, non-contiguous regions of a biomolecule. Examples of GP354 protein domains include, but are not limited to, an extracellular Ig domain (i.e., N- terminal), a transmembrane domain, and a cytoplasmic domain (i.e., C-terminal).
  • the term "compound” means any molecule, including, but not limited to, small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.
  • the gp354 gene was identified in contig 38 of a BAC clone with the GenBank accession number AC022315, which was deposited on February 10,
  • That deposit has the human genomic sequence of gp354 (Fig. 4 and SEQ ID NO:5), including 5' upstream (positions 1-6278) and 3' downstream (16490-20050) non-transcribed genomic sequences.
  • the invention provides an isolated polynucleotide comprising part or all of (i) the nucleotide sequence of SEQ ID NO:l, 3, 5, 6, 7, 9, 11, 25, 27, or 32; (ii) a degenerate variant of thereof; or (iii) the complement of (i) or (ii).
  • the invention provides an isolated polynucleotide comprising (i) a nucleotide sequence that encodes a polypeptide with the amino acid sequence of SEQ ID NO:2, 4, 8, 10, 12, 26, 28 or 31; or (ii) the complement of a nucleotide sequence that encodes the above polypeptide.
  • SEQ ID NOs:2, 4, 8, 10, 12, 26, 28 and 31 present the GP354 amino acid sequences encoded by SEQ ID NOs:l, 3, 7, 9, 11, 25, 27 and 32, respectively. See, e.g., Figs. 1-10.
  • the invention provides an isolated polynucleotide having a nucleotide sequence that (i) encodes a polypeptide having the sequence of SEQ ID NO:2, 8 or 12, (ii) encodes a polypeptide having the sequence of SEQ ID NO:2 , 8 or 12 with conservative amino acid substitutions, or (iii) that is the complement of (i) or (ii), where SEQ ID NO:2 presents the amino acid sequence of GP354 encoded by the cDNA of SEQ ID NO:l; SEQ ID NO:8 presents the amino acid sequence of GP354 encoded by sequences derived from SEQ ID NOs:5 and 11; and SEQ ID NO: 12 presents the amino acid sequence of GP354 encoded by the pancreatic cDNA of SEQ ID NO: 11.
  • the invention also provides isolated polynucleotides that encode select portions of GP354. As will be further discussed herein below, these "nucleic acid molecules" can be used, for example, to express specific portions of the GP354, either alone or as elements of a fusion protein. A nucleic acid fragment may also be used as a region-specific nucleic acid probe.
  • the isolated polynucleotide encodes, or the complement of which encodes, a polypeptide having, in at least one and preferably two, three, four or five of the Ig domains characteristic of the N-terminal extracellular portion of GP354.
  • the five extracellular lg domains are encoded by nucleotides 103-306, 406-609, 715-870, 967-1122 and 1228-1445, respectively, of the gp354 cDNA sequence of SEQ ED NO:l (see Fig.
  • the isolated polynucleotide encodes at least two, preferably three, more preferably four and most preferably all five domains in at least one copy.
  • the nucleic acid fragments comprise sequences which encode a signal secretion sequence that will mediate transport of the encoded polypeptides through a membrane.
  • signal sequence is typically cleaved from the polypeptides as transport through the membrane occurs.
  • the GP354 signal secretion sequence is encoded by nucleotides 1-54 of the gp354 cDNA sequence of SEQ ED NO:l (see Fig. 1) and by nucleotides 1-57 of the gp354 cDNA of SEQ ED NO:8 (see Fig. 5). More preferably, the signal secretion sequence of the isolated polynucleotide of the invention is from gp354.
  • the mature GP354 polypeptide sequence has an N- terminal proline residue encoded by nucleotides 55-57 of SEQ ED NO:l (see Fig. 1) and by nucleotides 259-261 of the gp354 cDNA of SEQ ED NO:8 (see Fig. 5).
  • Other preferred embodiments of the polynucleotides of the invention are those that encode, or the complements of which encode, a polypeptide having the transmembrane domain of GP354.
  • the above preferred isolated polynucleotides may optionally encode a transmembrane domain, if insertion of the encoded polypeptides into a membrane is so-desired.
  • the transmembrane domain may be encoded by gp354 sequences or may be encoded by a heterologous gene encoding a transmembrane domain of a heterologous membrane-associated protein.
  • the gp354 transmembrane domain is encoded by nucleotides 1522-1590 of the gp354 cDNA sequence of SEQ ED NO:l (see Fig. 1) and by nucleotides 1726-1794 of the gp354 cDNA of SEQ ED NO:8 (see Fig. 5).
  • the isolated polynucleotides of the invention may comprise sequences which encode (or their complements encode) an intracellular C-terminal domain, e.g., if specific signaling reactions are desired in response to GP354 binding interactions.
  • the intracellular domain may be encoded by g ⁇ 354 (see below) or may be encoded by a heterologous gene encoding an intracellular domain of a heterologous membrane-associated protein.
  • Preferred polynucleotides of the invention are those that encode, or the complements of which encode, a polypeptide having a (C-terminal) intracellular domain of GP354.
  • one intracellular domain of GP354 is encoded by nucleotides 1591-1776 of the gp354 cDNA sequence of SEQ ED NO:l (see Fig. 1).
  • a longer form of an intracellular domain of GP354 is encoded by nucleotides 1795-2319 of the gp354 cDNA sequence of SEQ ED NO:8 (see Fig. 5).
  • Fig. 3 One preferred isolated polynucleotide of the invention is shown in Fig. 3 (see SEQ ED NO:3) and comprises nucleotides 139-923 of the gp354 cDNA sequence of SEQ ED NO:l (see Fig. 1). It comprises the sequence of an RT-PCR fragment amplified from pancreatic RNA using primers GX1-218 (SEQ ED NO: 16) and GXl-219 (SEQ ED NO: 17). See Example 2.
  • This preferred isolated polynucleotide encodes amino acids 47-307 of SEQ ED NO:2, i.e., it encodes amino acids 13-68 of the first N-terminal Ig domain (i.e., it is missing the first 12 N-terminal amino acids of the Ig domain), and encodes the second and third Ig domains of GP354.
  • the invention provides isolated polynucleotides that hybridize to various of the gp354 nucleic acids of the present invention.
  • These "cross-hybridizing nucleic acids” can be used, inter alia, as probes for, and to drive expression of, proteins that are related to gp354 of the present invention as further isoforms, homologs, paralogs, or orthologs.
  • nucleic acids particularly preferred among the above-described nucleic acids are those that are expressed, or the complements of which are expressed, in pancreatic or neural tissues. Also particularly preferred among the above-described nucleic acids are those that encode, or the complements of which encode, a polypeptide having a gp354 biological activity, as described supra.
  • nucleic acid sequences specifically given herein are set forth as sequences of deoxyribonucleotides. It is intended, however, that the given sequences be interpreted as would be appropriate to the polynucleotide composition: for example, if the isolated nucleic acid is composed of RNA, the given sequence intends ribonucleotides, with uridine substituted for thymidine.
  • the invention provides homologs (e.g., paralogs and orthologs) of gp354 that are at least about 65% identical in sequence to SEQ ED NOs:l, 3, 5, 6, 7, 9 and 11, or to a portion of any one of those sequences that encodes at least one Ig domain, typically at least about 70%, 75%, 80%, 85%, or 90% identical in sequence, usefully at least about 91%, 92%, 93%, 94%, or 95% identical in sequence, more usefully at least about 96%, 97%, 98%, or 99% identical in sequence, and, most conservatively, at least about 99.5%, 99.6%, 99.1%, 99.8%) and 99.9% identical in sequence to those described with particularity herein.
  • homologs e.g., paralogs and orthologs
  • the present invention provides polynucleotides not only identical in sequence to those described with particularity herein, but also those that encode GP354 and portions thereof, having conservative amino acid substitutions or moderately conservative amino acid substitutions.
  • a “moderately conservative” replacement is any change having a nonnegative value in the PAM250 log-likelihood matrix reproduced herein above.
  • Such cross-hybridizing nucleic acids are useful, inter alia, as probes for, and to drive expression of, proteins related to the proteins of the present invention such as alternative splice variants and homologs (e.g., orthologs and paralogs).
  • orthologs are those from other primate species, such as chimpanzee, rhesus macaque monkey, baboon, orangutan, and gorilla; from rodents, such as rats, mice, guinea pigs; from lagomorphs, such as rabbits, and from domestic livestock, such as cow, pig, sheep, horse, goat.
  • nucleic acid samples of subgenomic complexity and/or by using plural fragments as short as 17 nucleotides in length collectively to prime amplification of nucleic acids, as, e.g., by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the nucleic acid primers of the present invention can also be used, for example, to prime single base extension (SBE) for SNP detection (see, e.g. , U.S. Pat. No. 6,004,744, the disclosure of which is incorporated herein by reference in its entirety).
  • SBE single base extension
  • Isothermal amplification approaches, such as rolling circle amplification are also now well-described. See, e.g., Schweitzer et al, Curr. Opin. Biotechnol. 12(l):21-7 (2001); U.S. Patent Nos. 5,854,033 and 5,714,320 and international patent publications WO 97/19193 and WO 00/15779, the disclosures of which are incorporated herein by reference in their entireties.
  • Rolling circle amplification can be combined with other techniques to facilitate SNP detection. See, e.g., Lizardi et al, Nature Genet. 19(3):225-32 (1998).
  • the nucleic acid fragment of the present invention is thus at least 17 nucleotides in length, typically at least 18 nucleotides in length, and often at least 24, 25, 30, 35, 40, or 45 nucleotides (nt) in length.
  • nt nucleotides
  • larger fragments having at least 50 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 450 nt, 500 nt or more are also useful, and at times preferred, as will be appreciated by the skilled worker.
  • An antisense nucleic acid of the invention may be a ribozyme.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes can be used to catalytically cleave gp354 mRNA transcripts to thereby inhibit translation of gp354 mRNA.
  • Oligonucleotide mimetics of gp354 can be used in therapeutic and diagnostic applications. See, e.g., Hyrup et al. Bioorg. Med. Chem. Lett. 4:5-23 (1996).
  • PNA compounds the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs of gp354 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases; or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; and Perry-O'Keefe, supra).
  • the isolated nucleic acids of the present invention can be used as probes to isolate genomic clones that include the nucleic acids of the present invention, which thereafter can be restriction mapped and sequenced to identify deletions, insertions, translocations, and substitutions (single nucleotide polymorphisms, SNPs) at the sequence level.
  • the isolated nucleic acids of the present invention can be also be used as probes to detect, characterize, and quantify gp354 nucleic acids in, and isolate gp354 nucleic acids from, transcript-derived nucleic acid samples.
  • the isolated nucleic acids of the present invention can be used as hybridization probes to detect, characterize by length, and quantify gp354 mRNA by northern blot of total or poly-A + - selected RNA samples.
  • the isolated nucleic acids of the present invention can also be used as hybridization probes to detect, characterize by location, and quantify gp354 message by in situ hybridization to tissue sections (see, e.g., Schwarchzacher et al, In Situ Hybridization, Springer- Verlag New York (2000) (ISBN: 0387915966), the disclosure of which is incorporated herein by reference in its entirety).
  • the nucleic acids of the present invention can also be used to detect and quantify gp354 nucleic acids in transcript-derived samples to measure expression of the gp354 gene.
  • Measurement of gp354 expression has particular utility in diagnostic assays for conditions, disorders and diseases associated with abnormal gp354 expression, either in pancreatic and neural tissues where and in a manner in which it is normally expressed, as well as in tissues where it may be mis-expressed, as further described in the Examples herein below.
  • WO 99/58720 incorporated herein by reference in its entirety, provides methods for quantifying the relatedness of a first and second gene expression profile and for ordering the relatedness of a plurality of gene expression profiles, without regard to the identity or function of the genes whose expression is used in the calculation.
  • genome-derived single exon probes and genome-derived single exon probe microarrays of the invention have the additional utility of permitting high-throughput detection of splice variants of the nucleic acids of the present invention.
  • Polynucleotides of the present invention inserted into nucleic acid constructs such as vectors which flank the polynucleotide insert with a promoter can be used to drive in vitro expression of RNA complementary to either strand of the nucleic acid of the present invention.
  • the RNA can be used as a single- stranded probe, in cDNA-mRNA subtraction, or for in vitro translation.
  • Those polynucleotides which encode GP354 protein or portions thereof can further be used to express the GP354 proteins or protein fragments, either alone, or as part of fusion proteins. Expression can be from genomic or transcript-derived polynucleotides of the present invention.
  • expression will typically be effected in eukaryotic, typically mammalian, cells capable of splicing introns from the initial RNA transcript.
  • Expression can be driven from episomal vectors or from genomic DNA integrated into a host cell chromosome.
  • expression can be effected in a wide variety of prokaryotic or eukaryotic cells.
  • viral vectors of the invention include vectors derived, e.g., from baculoviruses, adenoviruses, parvoviruses, herpesviruses, poxviruses, adeno-associated viruses, Semliki Forest viruses, vaccinia viruses, and retroviruses.
  • Genomic nucleic acids of the present invention can also be used to target homologous recombination to a gp354 locus in a subject. See, e.g., U.S. Patent Nos. 6,187,305; 6,204,061; 5,631,153; 5,627,059; 5,487,992; 5,464,764; 5,614,396; 5,527,695 and 6,063,630; and Kmiec et al. (eds.), Gene Targeting Protocols. Vol. 133, Humana Press (2000) (ISBN: 0896033600); Joyner (ed.), Gene Targeting: A Practical Approach. Oxford University Press, Inc. (2000) (ISBN: 0199637938); Sedivy et al, Gene Targeting. Oxford University Press (1998) (ISBN: 071677013X); Tymms et al. (eds.), Gene Knockout Protocols.
  • homologous recombination can be used to alter the expression of GP354, both for purpose of in vitro production of GP354 protein from human cells, and for purpose of gene therapy. See, e.g., U.S. Pat. Nos. 5,981,214, 6,048,524; 5,272,071; the disclosures of which are incorporated herein by reference in their entireties. Fragments of the polynucleotides of the present invention smaller than those typically used for homologous recombination can also be used for targeted gene correction or alteration, possibly by cellular mechanisms different from those engaged during homologous recombination. See, e.g., U.S. Pat. Nos.
  • Polynucleotides of the present invention can also be obtained by amplification, using the nucleic acid primers of the present invention, as further demonstrated in Example 1, herein below. Polynucleotides of the present invention, especially if fewer than about 100 nucleotide, can also be synthesized chemically, typically by solid phase synthesis using commercially available automated synthesizers.
  • the present invention provides nucleic acid constructs, such as vectors, that comprise one or more of the isolated polynucleotides of the invention, and host cells into which such vectors have been introduced.
  • the vectors can be used for propagating the polynucleotides of the present invention in host cells (cloning vectors), for shuttling the polynucleotides of the present invention between host cells derived from disparate organisms (shuttle vectors), for inserting the polynucleotides of the present invention into host cell chromosomes (insertion vectors), for expressing sense or antisense RNA transcripts of the polynucleotides of the present invention in vitro or within a host cell, and for expressing polypeptides encoded by the polynucleotides of the present invention, alone or as fusions to heterologous polypeptides (expression vectors).
  • Vectors of the present invention will often be suitable for several such uses.
  • Vectors are by now well-known in the art, and are described, inter alia, in Jones et al. (eds.), Vectors: Cloning Applications : Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd 1998 (ISBN: 047196266X); Jones et al. (eds.), Vectors: Expression Systems : Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd, 1998 (ISBN:0471962678); Gacesa et al, Vectors: Essential Data. John Wiley & Sons, 1995 (ISBN: 0471948411); Cid-Arregui (eds.), Viral Vectors: Basic Science and Gene Therapy.
  • vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, typically in the form of a polylinker with multiple, tightly clustered, single cutting restriction sites, and at least one selectable marker, although some integrative vectors will lack an origin that is functional in the host to be chromosomally modified, and some vectors will lack selectable markers.
  • Vectors of the invention will further include at least one isolated polynucleotide nucleic acid of the invention inserted into the vector in at least one location. Where present, the origin of replication and selectable markers are chosen based upon the desired host cell or host cells; the host cells, in turn, are selected based upon the desired application.
  • prokaryotic cells typically E. coli
  • E. coli are typically chosen for cloning, i.e., for amplification of polynucleotide sequences in a host cell.
  • vector replication is predicated on the replication strategies of coliform- infecting phage — such as phage lambda, Ml 3, T7, T3 and PI — or on the replication origin of autonomously replicating episomes, notably the Col ⁇ l plasmid and later derivatives, including pBR322 and the pUC series plasmids.
  • selectable markers are, analogously, chosen for selectivity in gram negative bacteria: e.g., typical markers confer resistance to antibiotics, such as ampicillin, tetracycline, chloramphenicol, kanamycin, streptomycin, zeocin; auxotrophic markers can also be used.
  • yeast cells typically S cerevisiae
  • yeast cells are chosen, inter alia, for eukaryotic genetic studies, for identification of interacting protein components, e.g. through use of a two-hybrid system, and for protein expression.
  • Vectors of the present invention for use in yeast will typically, but not invariably, contain an origin of replication suitable for use in yeast and a selectable marker that is functional in yeast.
  • suitable yeast vectors include integrative Yip vectors, replicating episomal YEp vectors containing centromere sequences, CEN, and autonomously replicating sequences, ARS.
  • YACs are based on yeast linear plasmids, denoted YLp, containing homologous or heterologous DNA sequences that function as telomeres (TEL) in vivo, as well as containing yeast ARS (origins of replication) and CEN (centromeres) segments.
  • Selectable markers in yeast vectors include a variety of auxotrophic markers, the most common of which are (in Saccharomyces cerevisiae) URA3, HIS3, LEU2, TRP1 and LYS2, which complement specific auxotrophic mutations, such as ura3-52, his3-Dl, Ieu2-Dl, trpl-Dl and lys2-201.
  • the URA3 and LYS2 yeast genes further permit negative selection based on specific inhibitors, 5-fluoro-orotic acid (FOA) and -aminoadipic acid ( ⁇ AA), respectively, that prevent growth of the prototrophic strains but allows growth of the ura3 and lys2 mutants, respectively.
  • Other selectable markers confer resistance to, e.g., zeocin.
  • Insect cells are often chosen for high efficiency protein expression. Where the host cells are from Spodoptera frugiperda — e.g., Sf9 and Sf21 cell lines, and expresSFTM cells (Protein Sciences Corp., Meriden, CT, USA) — the vector replicative strategy is typically based upon the baculovirus life cycle.
  • baculovirus transfer vectors are used to replace the wild-type AcMNPV polyhedrin gene with a heterologous gene of interest. Sequences that flank the polyhedrin gene in the wild-type genome are positioned 5' and 3' of the expression cassette on the transfer vectors. Following cotransfection with AcMNPV DNA, a homologous recombination event occurs between these sequences resulting in a recombinant virus carrying the gene of interest and the polyhedrin or plO promoter. Selection can be based upon visual screening for lacZ fusion activity. Mammalian cells are often chosen for expression of proteins intended as pharmaceutical agents, and are also chosen as host cells for screening of potential agonist and antagonists of a protein or a physiological pathway.
  • Vectors intended for autonomous extrachromosomal replication in mammalian cells will typically include a viral origin, such as the SV40 origin (for replication in cell lines expressing the large T-antigen, such as COS1 and COS7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use, e.g., in 293-EBNA cells, which constitutively express the EBV EBNA-1 gene product and adenovirus E1A).
  • Vectors intended for integration, and thus replication as part of the mammalian chromosome can, but need not, include an origin of replication functional in mammalian cells, such as the SV40 origin.
  • Vectors based upon viruses, such as lentiviruses, adenovirus, adeno-associated virus, vaccinia virus, and various mammalian retroviruses will typically replicate according to the viral replicative strategy.
  • Selectable markers for use in mammalian cells include resistance to neomycin (G418), blasticidin, hygromycin and to zeocin, and selection based upon the purine salvage pathway using HAT medium.
  • Plant cells can also be used for expression, with the vector replicon typically derived from a plant virus (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) and selectable markers chosen for suitability in plants.
  • a plant virus e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV
  • selectable markers chosen for suitability in plants.
  • the invention further provides artificial chromosomes — BACs, YACs, and HACs — that comprise gp354 nucleic acids, often genomic nucleic acids.
  • the invention further provides artificial chromosomes — BACs, YACs, and HACs — that comprise g ⁇ 354 nucleic acids, often genomic nucleic acids.
  • BACs, YACs, and HACs that comprise g ⁇ 354 nucleic acids, often genomic nucleic acids.
  • Vectors of the invention will also often include elements that permit in vitro transcription of RNA from the inserted heterologous nucleic acid.
  • Such vectors typically include a phage promoter, such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
  • Expression vectors of the invention which will drive expression of polypeptides from the inserted heterologous nucleic acid will often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive and regulate transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination, splicing signals and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences.
  • Other transcription control sequences include, e.g., operators, silencers, and the like. Use of such expression control elements, including those that confer inducible expression, and developmental or tissue- regulated expression are well-known in the art.
  • Tissue-specific regulatory elements capable of expressing GP354 in the pancreas, nervous system or mammary glands may be particularly useful and are known in the art, e.g., the neuron-specific neurofilament promoter (Byrne and Ruddle Proc. Natl. Acad. Sci. USA 86:5473-5477 (1989)), a pancreas-specific promoter (Edlund et al. Science 230:912-916 (1985)), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166).
  • the neuron-specific neurofilament promoter Bos and Ruddle Proc. Natl. Acad. Sci. USA 86:5473-5477 (1989)
  • a pancreas-specific promoter Edlund et al. Science 230:912-916 (1985)
  • mammary gland-specific promoters
  • Developmentally-regulated promoters may also be selected, including but not limited to the murine hox promoters (Kessel and Gruss Science 249:374-379 (1990)) and the ⁇ -fetoprotein promoter (Campes and Tilghman Genes Dev. 3:537-546 (1989)).
  • murine hox promoters Kessel and Gruss Science 249:374-379 (1990)
  • ⁇ -fetoprotein promoter Campes and Tilghman Genes Dev. 3:537-546 (1989)
  • a huge variety of inducible promoters are known and may be selected based on the particular application.
  • Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization. Many such tags are known and available. Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags. Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as luciferase or those that have a green fluorescent protein (GFP)-like chromophore, fusions to the IgG Fc region or other immunoglobulin type constant domains, and fusions for use in two hybrid selection systems.
  • GFP green fluorescent protein
  • vectors For secretion of expressed proteins, a wide variety of vectors are available which include appropriate sequences that encode secretion signals, such as leader peptides.
  • Vectors designed for phage display, yeast display, and mammalian display for example, target recombinant proteins using an N-terminal cell surface targeting signal and a C-terminal transmembrane anchoring domain.
  • FcRn receptor also denominated the FcRp receptor and the Brambell receptor, FcRb
  • Stable expression is readily achieved by integration into the host cell genome of vectors (preferably having selectable markers), followed by selection for integrants.
  • the present invention further includes host cells — either prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells) ⁇ comprising the nucleic acid constructs such as vectors of the present invention, either present episomally within the cell or integrated, in whole or in part, into the host cell chromosome.
  • host cells either prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells) ⁇ comprising the nucleic acid constructs such as vectors of the present invention, either present episomally within the cell or integrated, in whole or in part, into the host cell chromosome.
  • a host cell strain may be chosen for its ability to process the expressed protein in the desired fashion.
  • post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation, and it is an aspect of the present invention to provide
  • host cells include bacterial cells, such as E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium; yeast cells, such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Pichia methanolica; insect cell lines, such as those from Spodoptera frugiperda — e.g., Sf9 and Sf21 cell lines, and expresSF cells (Protein Sciences Corp., Meriden, CT, USA) — Drosophila S2 cells, and Trichoplusia ni High Five® Cells (Invitrogen, Carlsbad, CA, USA); and mammalian cells.
  • bacterial cells such as E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium
  • yeast cells such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Pichia
  • Typical mammalian cells include COS1 and COS7 cells, Chinese hamster ovary (CHO) cells, NTH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, HeLa, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, and BW5147.
  • Other useful mammalian cell lines are well known and readily available from the American Type Culture Collection (ATCC) (Manassas, VA, USA) and the National Institute of General medical Sciences (NIGMS) Human Genetic Cell Repository at the Coriell Cell Repositories (Camden, NJ, USA).
  • ATCC American Type Culture Collection
  • NIGMS National Institute of General medical Sciences
  • the present invention provides GP354 proteins and various fragments thereof suitable for use as antigens (e.g., for epitope mapping), for use as immunogens (e.g., for raising antibodies or as vaccines), and for use in therapeutic compositions. Also provided are fusions of GP354 polypeptides and fragments to heterologous polypeptides, and conjugates of the proteins, fragments, and fusions of the present invention to other moieties (e.g., to carrier proteins, to fluorophores). In some embodiments, the invention provides an isolated GP354 polypeptide comprising the amino acid sequence encoded by a full-length gp354 cDNA (SEQ ED NO:l, 7 or 11), or a degenerate variant.
  • SEQ ED NO:l, 7 or 11 full-length gp354 cDNA
  • the invention also provides an isolated GP354 polypeptide having the amino acid sequence encoded by a full-length gp354 cDNA (SEQ LD NO:l, 7 or 11), optionally having one or more conservative amino acid substitutions.
  • the invention also provides an isolated GP354 polypeptide comprising the amino acid sequence encoded by a polynucleotide sequence that hybridizes under high stringency conditions to a probe having part or all of the nucleotide sequence of a gp354 cDNA (SEQ ED NO:l, 7 or 11).
  • an isolated GP354 polypeptide encoded by a stringently or moderately stringent cross- hybridizing polynucleotide of the invention will have at least one biological activity of GP354.
  • the invention provides an isolated GP354 polypeptide comprising the GP354 amino acid sequence of SEQ ED NO:2, 8 or 12, optionally having one or more conservative amino acid substitutions. Also provided is an isolated GP354 polypeptide having the amino acid sequence encoded by the GP354 polypeptide sequence of SEQ ED NO:2, 8 or 12, optionally having one or more conservative amino acid substitutions.
  • the invention further provides fragments of each of the above-described isolated polypeptides, particularly fragments having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entirety of the sequence given in SEQ ED NO:2, 8 or 12.
  • Each of the above isolated polypeptides includes an N-terminal 18 or 21 amino acid signal sequence which is typically removed upon insertion of the protein through a membrane. Accordingly, the invention provides the above isolated GP354 polypeptides from which the N-terminal signal sequence has been removed. Cleavage is predicted to occur between the G and P residues at positions 18-19 of SEQ ED NO:2 or at positions 21-22 of SEQ ED NO:8.
  • the invention thus provides an isolated GP354 polypeptide comprising all or a portion of the predicted mature N-terminal extracellular domain of GP354. (See Figs. 1 and 5; SEQ ED NOs:2 and 8 for GP354 domains and sequences).
  • the predicted mature extracellular domain of GP354 i.e., lacking the secretion signal sequence, consists of amino acids 19-507 of SEQ ED NO:2, or of amino acids 22-510 of SEQ ED NO:8. Also included are fragments of the above sequences having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entirety of the specified sequence.
  • the invention also provides an isolated GP354 polypeptide comprising or having all or a portion of the N-terminal extracellular domain of GP354. (See Figs. 1 and 5; SEQ ED NOs:2 and 8 for GP354 domains and sequences).
  • the N-terminal extracellular domain of GP354 consists of amino acids 1-507 of SEQ ED NO:2, or of amino acids 1-510 of SEQ ED NO:8. Also included are fragments of the above sequences having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entirety of the specified sequence.
  • the isolated GP354 polypeptide has or comprises the entire extracellular domain of GP354 and lacks a functional GP354 transmembrane domain.
  • the transmembrane domain may either be excluded, deleted or mutated to render it non-functional.
  • the transmembrane domain of GP354 consists of amino acids 508-530 of SEQ ED NO:2, or of amino acids 511- 533 of SEQ ED NO:8.
  • the isolated GP354 polypeptide consists of part or all of the GP354 N-terminal extracellular domain fused to a heterologous protein domain.
  • the isolated GP354 polypeptide comprises at least one extracellular Ig domain, more preferably comprises two GP354 extracellular Ig domains, and most preferably comprises three, four or five GP354 extracellular Ig domains.
  • an isolated GP354 polypeptide comprising a GP354 fragment selected from the group consisting of the transmembrane domain of GP354 and the C-terminal cytoplasmic region of GP354.
  • the isolated GP354 polypeptide consists of part or all of the GP354 cytoplasmic or transmembrane domains fused to a heterologous protein domain.
  • the GP354 fragments of the invention may be continuous portions of the native GP354 protein. However, it will be appreciated that knowledge of the GP354 gene and protein sequences as provided herein permits recombining of various domains that are not contiguous in the native GP354 protein.
  • the invention also provides polypeptides comprising select portions of GP354 and related proteins.
  • these protein fragments especially when coupled to heterologous protein fragments, can be used, for example, to target agents to particular cell types through protein- protein interaction; to inhibit protein-protein interactions between Ig domain containing proteins; for competitive binding assays; and to raise fragment-specific GP354 antibodies.
  • the protein fragment comprises, in at least one copy, one, two, three, four or five of the Ig domains characteristic of the N-terminal extracellular portion of GP354.
  • the five extracellular Ig domains are encoded by amino acids 35-102, 136-203, 239- 290, 323-374 and 410-485, respectively, of the GP354 amino acid sequence of SEQ ED NO:2 (see Fig. 1), and are encoded by amino acids 38-109, 139-206, 242- 293, 326-377 and 413-488, respectively, of the GP354 amino acid sequence of SEQ ED NO: 8 (see Fig. 5).
  • the protein fragment encodes at least two, preferably three, more preferably four and most preferably all five domains in at least one copy.
  • the protein fragment contains an N-terminal signal secretion sequence that will mediate transport of the polypeptide through a membrane.
  • the GP354 signal secretion sequence is encoded by amino acids 1-18 of the GP354 amino acid sequence of SEQ ED NO:2 (see Fig. 1) and by amino acids 1-21 of SEQ ED NO:8 (see Fig. 5). More preferably, the signal secretion sequence of the protein fragment is from GP354.
  • the above preferred protein fragments may optionally include a transmembrane domain, if insertion of the polypeptide into a membrane is so- desired.
  • the transmembrane domain may be a GP354 domain (see below) or may be encoded by a heterologous gene encoding a transmembrane domain of a heterologous membrane-associated protein.
  • the above preferred protein fragments may further comprise an intracellular C-terminal domain if specific signaling reactions are desired in response to GP354 binding interactions.
  • the intracellular domain may be derived from GP354 (see below) or may be encoded by a heterologous gene encoding an intracellular domain of a heterologous membrane-associated protein.
  • Other preferred embodiments of the protein fragments of the invention are those that comprise the transmembrane domain of GP354.
  • the GP354 transmembrane domain is encoded by amino acids 508- 530 of the GP354 amino acid sequence of SEQ ED NO:2 (see Fig. 1).
  • one intracellular domain of GP354 is encoded by amino acids 531-592 of the GP354 amino acid sequence of SEQ ED NO:2 (see Fig. 1).
  • Another form of an intracellular domain of GP354 is encoded by amino acids 534-708 of the GP354 amino acid sequence of SEQ ED NO:8 (see Fig. 5). It is believed that these different intracellular domain forms may be produced by alternative splicing.
  • a preferred protein fragment of the invention is encoded by nucleotides 139-923 of the gp354 cDNA sequence of SEQ LD NO:l (see Fig. 1).
  • the invention further provides proteins that differ in sequence from those described with particularity in the above-referenced SEQ ED NOs, whether by way of insertion or deletion, by way of conservative or moderately conservative substitutions, as hybridization related proteins, or as cross-hybridizing proteins, with those that substantially retain a GP354 activity preferred.
  • the invention further provides fusions of the polypeptides, proteins and protein fragments herein described to heterologous polypeptides.
  • the various protein embodiments of the present invention can be used, inter alia, to elicit antibodies that bind to a variety of epitopes of the GP354 protein.
  • FIG. 1 presents the deduced amino acid sequences (SEQ ED NO:2) encoded by the gp354 cDNA clone (SEQ ED NO: 1). Similarly, the amino acid sequences presented in SEQ ED NOs:4, 8, 10 and 12 are deduced from the nucleotide sequences presented in SEQ ED NOs:3, 7, 9 and 11, respectively. Unless otherwise indicated, amino acid sequences of the proteins of the present invention were determined as a predicted translation from a nucleic acid sequence. Accordingly, any amino acid sequence presented herein may contain errors due to errors in the nucleic acid sequence, as described in detail above.
  • SNPs single nucleotide polymorphisms
  • eukaryotic genomes more than 1.4 million SNPs have already identified in the human genome, International Human Genome Sequencing Consortium, Nature 409:860 -921 (2001) — and the sequence determined from one individual of a species may differ from other allelic forms present within the population. Small deletions and insertions can often be found that do not alter the function of the protein.
  • the present invention provides GP354 polypeptides not only identical in sequence to those described with particularity herein, but also isolated proteins at least about 80%> identical in sequence to those described with particularity herein, typically at least about 85%, 90%, 91%, 92%, 93%, 94%, or 95%o identical in sequence to those described with particularity herein, usefully at least about 96%, 97%>, 98%, or 99% identical in sequence to those described with particularity herein, and, most conservatively, at least about 99.5%, 99.6%, 99.1%, 99.8%o and 99.9% identical in sequence to those described with particularity herein.
  • sequence variants can be naturally occurring or can result from human intervention by way of random or directed mutagenesis.
  • percent identity of two amino acid sequences is determined using the procedure of Tatiana et al, "Blast 2 sequences -a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett.
  • BlastP module of Blast 2 SEQUENCES is used with default values of (i) BLOSUM62 matrix, Henikoff et al, Proc. Natl. Acad. Sci USA 89(22):10915-9 (1992); (ii) open gap 11 and extension gap 1 penalties; and (iii) gap x dropoff 50 expect 10 word size 3 filter, and both sequences are entered in their entireties.
  • the present invention provides proteins not only identical in sequence to those described with particularity herein, but also isolated proteins having the sequence of GP354 proteins, or portions thereof, with conservative amino acid substitutions. Also provided are isolated proteins having the sequence of GP354 proteins, and portions thereof, with moderately conservative amino acid substitutions. These conservatively- substituted or moderately conservatively-substituted variants can be naturally occurring or can result from human intervention.
  • Allelic variation may account for differences in amino acid sequence between SEQ ED NO:2 and SEQ ED NO:8 at positions 195, 196, 539 and 540, for example.
  • Splice variants e.g., differential 5' or 3' splice site selection
  • hybridization related proteins that are encoded by nucleic acids that hybridize under high stringency conditions (as defined herein above) to all or to a portion of various of the isolated polynucleotides of the present invention (“reference nucleic acids").
  • the hybridization related proteins can be alternative isoforms, homologs, paralogs, and orthologs of the GP354 protein of the present invention.
  • Particularly useful orthologs are those from other primate species, such as chimpanzee, rhesus macaque monkey, baboon, orangutan, and gorilla; from rodents, such as rats, mice, guinea pigs; from lagomorphs, such as rabbits, and from domestic livestock, such as cow, pig, sheep, horse, goat.
  • proteins can also be characterized using a second functional test, the ability of a first protein to inhibit competitively the binding of a second protein to an antibody. It is, therefore, another aspect of the present invention to provide isolated proteins not only identical in sequence to those described with particularity herein, but also to provide isolated proteins (“cross- reactive proteins") that competitively inhibit the binding of antibodies to all or to a portion of various of the isolated GP354 proteins of the present invention ("reference proteins"). Such competitive inhibition can readily be determined using immunoassays well known in the art.
  • Residues that are tolerant of change while retaining function can be identified by altering the protein at known residues using methods known in the art, such as alanine scanning mutagenesis, Cunningham et al, Science 244(4908): 1081-5 (1989); transposon linker scanning mutagenesis, Chen et al, Gene 263 (1-2): 39-48 (2001); combinations of homolog- and alanine-scanning mutagenesis, Jin et al, J. Mol. Biol. 226(3):851-65 (1992); combinatorial alanine scanning, Weiss et al, Proc. Natl. Acad. Sci. USA 97(16):8950-4 (2000), followed by functional assay.
  • Transposon linker scanning kits are available commercially (New England Biolabs, Beverly, MA, USA, catalog, no. E7-102S; EZ::TNTM In-Frame Linker Insertion Kit, catalog no. EZI04KN, Epicentre Technologies Corporation, Madison, WI, USA).
  • the isolated proteins of the present invention can readily be used as specific immunogens to raise antibodies that specifically recognize GP354 proteins, their isoforms, homologs, paralogs, and/or orthologs.
  • the antibodies can be used, inter alia, specifically to assay for the GP354 proteins of the present invention — e.g. by ELISA for detection of protein fluid samples, such as serum, by immunohistochemistry or laser scanning cytometry, for detection of protein in tissue samples, or by flow cytometry, for detection of intracellular protein in cell suspensions — for specific antibody- mediated isolation and/or purification of GP354 proteins, as for example by immunoprecipitation, and for use as specific agonists or antagonists of GP354 action.
  • the isolated proteins of the present invention are also immediately available for use as specific standards in assays used to determine the concentration and or amount specifically of the GP354 proteins of the present invention.
  • ELISA kits for detection and quantitation of protein analytes typically include isolated and purified protein of known concentration for use as a measurement standard (e.g., the human interferon- ⁇ OptEIA kit, catalog no. 555142, Pharmingen, San Diego, CA, USA includes human recombinant gamma interferon, baculovirus produced).
  • the isolated proteins of the present invention are also immediately available for use as specific biomolecule capture probes for surface-enhanced laser desorption ionization (SELDI) detection of protein-protein interactions, WO 98/59362; WO 98/59360; WO 98/59361 ; and Merchant et al. , Electrophoresis 21(6): 1164-77 (2000), the disclosures of which are incorporated herein by reference in their entireties.
  • the isolated proteins of the present invention are also immediately available for use as specific biomolecule capture probes on BIACORE surface plasmon resonance probes. See Weinberger et al, Pharmacogenomics 1(4):395-416 (2000); Malmqvist, Biochem. Soc. Trans. 27(2):335-40 (1999).
  • the isolated proteins of the present invention are also useful as a therapeutic supplement in patients diagnosed to have a specific deficiency in GP354 production or activity.
  • the invention also provides fragments of various of the proteins of the present invention.
  • the protein fragments are useful as antigenic and immunogenic fragments of GP354.
  • fragments of a protein is here intended isolated proteins (equally, polypeptides, peptides, oligopeptides), however obtained, that have an amino acid sequence identical to a portion of the reference amino acid sequence, which portion is at least 6 amino acids and less than the entirety of the reference nucleic acid. As so defined, “fragments” need not be obtained by physical fragmentation of the reference protein, although such provenance is not thereby precluded.
  • Fragments of at least 6 contiguous amino acids are useful in mapping B cell and T cell epitopes of the reference protein. See, e.g., Geysen et al, "Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid," Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984) and U.S. Pat. Nos. 4,708,871 and 5,595,915, the disclosures of which are incorporated herein by reference in their entireties. Because the fragment need not itself be immunogenic, part of an immunodominant epitope, nor even recognized by native antibody, to be useful in such epitope mapping, all fragments of at least 6 amino acids of the proteins of the present invention have utility in such a study.
  • Fragments of at least eight contiguous amino acids, often at least fifteen contiguous amino acids, have utility as immunogens for raising antibodies that recognize the proteins of the present invention. See, e.g., Lerner, "Tapping the immunological repertoire to produce antibodies of predetermined specificity," Nature 299:592-596 (1982); Shinnick et al, "Synthetic peptide immunogens as vaccines," Annu. Rev. Microbiol. 37:425-46 (1983); Sutcliffe et al, "Antibodies that react with predetermined sites on proteins," Science 219:660-6 (1983), the disclosures of which are incorporated herein by reference in their entireties.
  • Fragments of at least 8, 9, 10 or 12 contiguous amino acids are also useful as competitive inhibitors of binding of the entire protein, or a portion thereof, to antibodies (as in epitope mapping), and to natural binding partners, such as subunits in a multimeric complex or to receptors or ligands of the subject protein; this competitive inhibition permits identification and separation of molecules that bind specifically to the protein of interest, U.S. Pat. Nos. 5,539,084 and 5,783,674, incorporated herein by reference in their entireties.
  • the protein, or protein fragment, of the present invention is thus at least 6 amino acids in length, typically at least 8, 9, 10 or 12 amino acids in length, and often at least 15 amino acids in length. Often, the protein or the present invention, or fragment thereof, is at least 20, 25, 30, 35, or 50 amino acids or more in length. Larger fragments having at least 75, 100, 150 or more amino acids are also useful, and at times preferred.
  • the present invention further provides fusions of each of the GP354 proteins and protein fragments of the present invention to heterologous polypeptides.
  • fusion is here intended that the protein or protein fragment of the present invention is linearly contiguous to the heterologous polypeptide in a peptide-bonded polymer of amino acids or amino acid analogues; by "heterologous polypeptide” is here intended a polypeptide that does not naturally occur in contiguity with the protein or protein fragment of the present invention.
  • the fusion can consist entirely of a plurality of fragments of the GP354 protein in altered arrangement; in such case, any of the GP354 fragments can be considered heterologous to the other GP354 fragments in the fusion protein. More typically, however, the heterologous polypeptide is not drawn from the GP354 protein itself.
  • the fusion proteins of the present invention will include at least one fragment of the protein of the present invention, which fragment is at least 6, typically at least 8, often at least 15, and usefully at least 16, 17, 18, 19, or 20 amino acids long.
  • the fragment of the protein of the present to be included in the fusion can usefully be at least 25, 50, 75, 100, or 150 amino acids long.
  • Fusions that include the entirety of the GP354 proteins of the invention, or functional domains, such as the N-terminal GP354 Ig domains and the C-terminal intracellular domain have particular utility. Fusions comprising GP354 Ig domains will be useful in engineering fusion proteins that will recognize other Ig domain- containing molecules and cells that displaying them on their surface.
  • heterologous sequence such as a toxin or a therapeutic
  • a pancreatic cell or a CNS-derived cell that expressed GP354 or a binding partner or to all or a portion of a cell surface molecule derived from a pancreatic cell or a CNS-derived cell that expresses GP354 or a binding partner.
  • the heterologous polypeptide included within the fusion protein of the present invention is at least 6 amino acids in length, often at least 8 amino acids in length, and preferably, at least 15, 20, and 25 amino acids in length. Fusions that include larger polypeptides, such as the IgG Fc region, and even entire proteins (such as luciferase or GFP chromophore-containing proteins), have particular utility.
  • heterologous polypeptides included in the fusion proteins of the present invention usefully include those designed to facilitate purification and/or visualization of recombinantly-expressed proteins.
  • purification tags can also be incorporated into fusions that are chemically synthesized, chemical synthesis typically provides sufficient purity that further purification by HPLC suffices; however, visualization tags as above described retain their utility even when the protein is produced by chemical synthesis, and when so included render the fusion proteins of the present invention useful as directly detectable markers of GP354 presence.
  • heterologous polypeptides to be included in the fusion proteins of the present invention can usefully include those that facilitate secretion of recombinantly expressed proteins — into the periplasmic space or extracellular milieu for prokaryotic hosts, into the culture medium for eukaryotic cells — through incorporation of secretion signals and/or leader sequences.
  • Other useful protein fusions of the present invention include those that permit use of the protein of the present invention as bait in a yeast two-hybrid system. See Bartel et al. (eds.), The Yeast Two-Hybrid System. Oxford University Press (1997) (ISBN: 0195109384); Zhu et al, Yeast Hybrid Technologies. Eaton Publishing, (2000) (ISBN 1-881299-15-5); Fields et al, Trends Genet. 10(8):286-92 (1994); Mendelsohn et al, Curr. Opin. Biotechnol. 5(5):482-6 (1994); Luban et al, Curr. Opin. Biotechnol.
  • proteins and protein fragments of the present invention can also usefully be fused to protein toxins, such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins of the present invention.
  • protein toxins such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins of the present invention.
  • the isolated proteins, protein fragments, and protein fusions of the present invention can be composed of natural amino acids linked by native peptide bonds, or can contain any or all of nonnatural amino acid analogues, normative bonds, and post-synthetic (post-translational) modifications, either throughout the length of the protein or localized to one or more portions thereof.
  • nonnatural amino acid analogues e.g., normative bonds
  • post-synthetic (post-translational) modifications either throughout the length of the protein or localized to one or more portions thereof.
  • the range of such nonnatural analogues, normative inter- residue bonds, or post-synthesis modifications will be limited to those that permit binding of the peptide to antibodies.
  • D-enantiomers of natural amino acids can readily be incorporated during chemical peptide synthesis: peptides assembled from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers can also be used to confer specific three dimensional conformations on the peptide.
  • Other amino acid analogues commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine, a non-hydrolyzable analog of phosphotyrosine (Kole et al, Biochem. Biophys. Res. Com. 209:817-821 (1995)), and various halogenated phenylalanine derivatives.
  • the isolated GP354 proteins, protein fragments and fusion proteins of the present invention can also include non-native inter-residue bonds, including bonds that lead to circular and branched forms.
  • the isolated GP354 proteins and protein fragments of the present invention can also include post-translational and post-synthetic modifications, either throughout the length of the protein or localized to one or more portions thereof.
  • the isolated proteins, fragments, and fusion proteins of the present invention will typically include N-linked and/or O-linked glycosylation, the pattern of which will reflect both the availability of glycosylation sites on the protein sequence and the identity of the host cell. Further modification of glycosylation pattern can be performed enzymatically.
  • recombinant polypeptides of the invention may also include an initial modified methionine residue, in some cases resulting from host-mediated processes.
  • post-synthetic modification can be performed before deprotection and cleavage from the resin or after deprotection and cleavage. Modification before deprotection and cleavage of the synthesized protein often allows greater control, e.g. by allowing targeting of the modifying moiety to the N-terminus of a resin-bound synthetic peptide.
  • Useful post-synthetic (and post-translational) modifications include conjugation to detectable labels, such as fluorophores.
  • purification tags have been fused through use of an expression vector that appends such tag
  • purification can be effected, at least in part, by means appropriate to the tag, such as use of immobilized metal affinity chromatography for polyhistidine tags.
  • Other techniques common in the art include ammonium sulfate fractionation, immuno-precipitation, fast protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC), and preparative gel electrophoresis.
  • FPLC fast protein liquid chromatography
  • HPLC high performance liquid chromatography
  • Purification of chemically-synthesized peptides can readily be effected, e.g., by HPLC. Accordingly, it is an aspect of the present invention to provide the isolated GP354 proteins of the present invention in pure or substantially pure form.
  • the substantially purified protein is present at a concentration, measured on a mass basis with respect to total protein in a composition, of at least 75%, 80%, or even at least 85%, 90%, 91%, 92%, 93%, 94%, 94.5%) or even at least 94.9%.
  • the invention provides antibodies, both polyclonal and monoclonal, and fragments and derivatives thereof, the specific binding of which can be competitively inhibited by the isolated proteins and polypeptides of the present invention.
  • antisense therapeutics can be linked to anti-PanCAM antibodies and be directed to the beta islets.
  • the antibodies of this invention can also be conjugated to cytotoxic agents (e.g., nonspecific agents such as radioactive agents; targetable toxins such as ricin and cholera toxin; and chemotherapy agents such as doxorubicin) so as to direct the cytotoxins to the site of insulinomas, which are difficult to treat because they tend to be multi-focal.
  • antibody refers to a polypeptide, at least a portion of which is encoded by at least one immunoglobulin gene, which can bind specifically to a first molecular species, and to fragments or derivatives thereof that remain capable of such specific binding.
  • the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) of the present invention for a GP354 protein or protein fragment of the present invention will be at least about 1 x 10 "6 molar (M), typically at least about 5 x 10 "7 M, usefully at least about 1 x 10 "7 M, with affinities and avidities of at least 1 x 10 "8 M, 5 x 10 "9 M, and 1 x 10 "10 M proving especially useful.
  • the antibodies of the present invention can be naturally-occurring forms, such as IgG, IgM, IgD, IgE, and IgA, from any mammalian species.
  • Human antibodies are particularly useful, and often preferred, when the antibodies of the present invention are to be administered to human beings as in vivo diagnostic or therapeutic agents, since recipient immune response to the administered antibody will often be substantially less than that occasioned by administration of an antibody derived from another species, such as mouse.
  • IgG, IgM, IgD, IgE and IgA antibodies of the present invention are also usefully obtained from other mammalian species, including rodents — typically mouse, but also rat, guinea pig, and hamster — lagomorphs, typically rabbits, and also larger mammals, such as sheep, goats, cows, and horses.
  • fragments of eight or more contiguous amino acids of the proteins of the present invention can be used effectively as immunogens when conjugated to a carrier, typically a protein such as bovine thyroglobulin, keyhole limpet hemocyanin, or bovine serum albumin, conveniently using a bifunctional linker such as those described elsewhere above, which discussion is incorporated by reference here. Immunogenicity can also be conferred by fusion of the proteins and protein fragments of the present invention to other moieties.
  • Peptides of the present invention can, for example, be produced by solid phase synthesis on a branched polylysine core matrix; these multiple antigenic peptides (MAPs) provide high purity, increased avidity, accurate chemical definition and improved safety in vaccine development. Tarn et al, Proc. Natl. Acad. Sci. USA 85:5409-5413 (1988); Posnett et al., J. Biol. Chem. 263, 1719-1725 (1988).
  • the antibodies of the present invention can be produced using any art-accepted technique.
  • Such techniques are well known in the art, Coligan et al. (eds.), Current Protocols in Immunology. John Wiley & Sons, Inc. (2001) (ISBN: 0-471-52276-7); Zola, Monoclonal Antibodies: Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives (Basics: From Background to Bench). Springer Verlag (2000) (ISBN: 0387915907); Howard et al. (eds.), Basic Methods in Antibody Production and Characterization. CRC Press (2000) (ISBN: 0849394457); Harrow et al.
  • Recombinant expression in host cells is particularly useful when fragments or derivatives of the antibodies of the present invention are desired.
  • Prokaryotic hosts are particularly useful for producing phage displayed antibodies of the present invention.
  • the technology of phage-displayed antibodies, in which antibody variable region fragments are fused, for example, to the gene m protein (pEfl) or gene Vm protein (pVEfl) for display on the surface of filamentous phage, such as Ml 3, is by now well-established, Sidhu, Curr. Opin. Biotechnol. l l(6):610-6 (2000); Griffiths et al, Curr. Opin. Biotechnol. 9(l):102-8 (1998); Hoogenboom et al, Immunotechnology, 4(l):l-20 (1998); Rader et al, Curr. Opin. Biotechnol.
  • phage- displayed antibody fragments are scFv fragments or Fab fragments; when desired, full length antibodies can be produced by cloning the variable regions from the displaying phage into a complete antibody and expressing the full length antibody in a further prokaryotic or a eukaryotic host cell.
  • Eukaryotic cells are also useful for expression of the antibodies, antibody fragments, and antibody derivatives of the present invention.
  • antibody fragments of the present invention can be produced in Pichia pastoris, Takahashi et al, Biosci. Biotechnol. Biochem. 64(10):2138-44 (2000); Freyre et al, J. Biotechnol. 76(2-3): 157-63 (2000); Fischer et al, Biotechnol. Appl Biochem. 30 (Pt 2):117-20 (1999); Pennell et al, Res. Immunol. 149(6):599-603 (1998); Eldin et al, J. Immunol. Methods. 201(l):67-75 (1997); and in
  • Antibodies and fragments and derivatives thereof of the present invention may also be produced in plant cells, Giddings et al, Nature Biotechnol. 18(11):1151-5 (2000); Gavilondo et ⁇ /., 5/otec/2 ⁇ r M e5 29(l):128-38 (2000);
  • the present invention thus provides antibody derivatives that bind specifically to one or more of the GP354 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated nucleic acids of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
  • Such useful derivatives are chimeric, primatized, and humanized antibodies; such derivatives are less immunogenic in human beings, and thus more suitable for in vivo administration, than are unmodified antibodies from non-human mammalian species.
  • Chimeric antibodies typically include heavy and/or light chain variable regions (including both CDR and framework residues) of immunoglobulins of one species, typically mouse, fused to constant regions of another species, typically human. See, e.g., U.S. Pat. No. 5,807,715; Morrison et al, Proc. Natl. Acad. Sci [/&4.81(21):6851-5 (1984); Sharon et al, Nature 309(5966):364-7 (1984); Takeda et al, Nature 314(6010):452-4 (1985), the disclosures of which are incorporated herein by reference in their entireties.
  • Primatized and humanized antibodies typically include heavy and/or light chain CDRs from a murine antibody grafted into a non-human primate or human antibody V region framework, usually further comprising a human constant region, Riechmann et al, Nature 332(6162):323-7 (1988); Co et al, Nature 351(6326):501-2 (1991); U.S. Pat. Nos. 6,054,297; 5,821,337; 5,770,196; 5,766,886; 5,821,123; 5,869,619; 6,180,377; 6,013,256; 5,693,761; and 6,180,370, the disclosures of which are incorporated herein by reference in their entireties.
  • Other useful antibody derivatives of the invention include heteromeric antibody complexes and antibody fusions, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies.
  • the antibodies of the present invention can usefully be labeled. It is, therefore, another aspect of the present invention to provide labeled antibodies that bind specifically to one or more of the proteins and protein fragments of the present invention, to one or more of the GP354 proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
  • the label can usefully be an enzyme that catalyzes production and local deposition of a detectable product. Enzymes typically conjugated to antibodies to permit their immunohistochemical visualization are well known, and include alkaline phosphatase, ⁇ -galactosidase, glucose oxidase, horseradish peroxidase (HRP), and urease.
  • the antibodies of the invention can also be labeled using colloidal gold.
  • the antibodies of the present invention When used, e.g., for flow cytometric detection, for scanning laser cytometric detection, or for fluorescent immunoassay, they can usefully be labeled with fluorophores.
  • fluorophores There are a wide variety of fluorophore labels that can usefully be attached to the antibodies of the present invention. Many are available, e.g., from Molecular Probes, Inc., Eugene, OR, USA.
  • the antibodies of the present invention can usefully be labeled with biotin.
  • the antibodies of the present invention When the antibodies of the present invention are used, e.g., for Western blotting applications, they can usefully be labeled with radioisotopes, such as 33 P, 32 P, 35 S, 3 H, and 125 I.
  • the label when the antibodies of the present invention are used for radioimmuno therapy, the label can usefully be 228 Th, 227 Ac, 225 Ac, 223 Ra, 2,3 Bi, 212 Pb, 2,2 Bi, 21 l At, 203 Pb, 194 Os, 188 Re, 186 Re, 153 Sm, ,49 Tb, 131 1, 125 I, 11 'In, 105 Rh, 99m Tc, 97 Ru, 90 Y, 90 Sr, 88 Y, 72 Se, 67 Cu, or 47 Sc.
  • the antibodies of the present invention when they are to be used for in vivo diagnostic use, they can be rendered detectable by conjugation to MRI contrast agents, such as gadolinium diethylenetriaminepentaacetic acid (DTP A), Lauffer et al, Radiology 207(2):529-38 (1998), or by radioisotopic labeling.
  • MRI contrast agents such as gadolinium diethylenetriaminepentaacetic acid (DTP A), Lauffer et al, Radiology 207(2):529-38 (1998), or by radioisotopic labeling.
  • DTP A gadolinium diethylenetriaminepentaacetic acid
  • Lauffer et al Radiology 207(2):529-38
  • the antibodies of the present invention can also be conjugated to biologically deleterious moieties, such as toxins, in order to target the toxin's ablative action to cells that display and/or express the proteins of the present invention.
  • the antibody in such immunotoxins is conjugated to Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, or ricin.
  • Pseudomonas exotoxin A diphtheria toxin
  • shiga toxin A anthrax toxin lethal factor, or ricin.
  • the antibodies of the present invention can usefully be attached to a substrate.
  • the invention thus provides antibodies that bind specifically to one or more of the GP354 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, attached to a substrate.
  • Substrates can be porous or nonporous, planar or nonplanar.
  • the antibodies of the present invention can usefully be conjugated to filtration media, such as NHS-activated Sepharose or CNBr- activated Sepharose for purposes of immunoaffinity chromatography.
  • filtration media such as NHS-activated Sepharose or CNBr- activated Sepharose
  • the antibodies of the present invention can also usefully be attached to paramagnetic microspheres, typically by biotin-streptavidin interaction, which microsphere can then be used for isolation of cells that express or display the proteins of the present invention.
  • the antibodies of the present invention can usefully be attached to the surface of a microtiter plate for ELISA.
  • the antibodies of the present invention can be produced in prokaryotic and eukaryotic cells.
  • the invention thus also provides cells that express the antibodies of the present invention, including hybridoma cells, B cells, plasma cells, and host cells recombinantly modified to express the antibodies of the present invention.
  • the present invention also provides aptamers evolved to bind specifically to one or more of the GP354 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
  • GP354 is a new member of the immunoglobulin (Ig) superfamily expressed predominantly in the pancreas and in lower amounts in neural tissue, e.g., the CNS.
  • Ig immunoglobulin
  • GP354 an integral cell surface membrane protein, has five signature Ig domains in its extracellular portion which are known in other family members to mediate cell-cell recognition and adhesion reactions.
  • Ig superfamily GP354 is likely important for mediating cell-cell recognition, binding and adhesion functions in the pancreatic, neural and potentially other tissues in which it is expressed.
  • GP354 will be a suitable therapeutic target for treating abnormal conditions, disorders and/or diseases related to improper cell-cell binding, adhesion and signaling in the pancreas, particularly during tissue development and during tissue regeneration and/or healing, e.g., after pancreatic damage, trauma or degenerative conditions. It is also envisioned that GP354 will be useful for inhibiting pancreatic cell death associated with immune, auto-immune, and degenerative conditions. It is envisioned that the neural form of GP354 will be a similarly suitable therapeutic target for tissue regeneration and repair and for inhibiting degeneration and cell death in CNS tissue.
  • compositions comprising nucleic acids, proteins, and antibodies of the present invention, as well as mimetics, agonists, antagonists, or modulators of GP354 activity, may be administered as pharmaceutical agents for the treatment (i.e., the amelioration of) of disorders, conditions or diseases associated with mis-expression of GP354 or to overcome abnormal expression or activities of other components which participate in GP354 related molecular and cellular recognition pathways.
  • GP354 expression is relatively concentrated in the pancreas, it is anticipated that GP354 mis-expression may be associated with pancreatic disorder or disease, and/or with congenital defects in pancreatic development of function.
  • disorders and diseases of the pancreas include acute pancreatitis (often but not always manifesting in abnormal pancreatic exocrine functions, such as elevated serum, ascitic and/or pleural fluid amylase levels, or abnormal lipase or trypsinogen levels.
  • pancreatic inflammation and necrosis are also associated with acute as well as with chronic pancreatitis and exocrine insufficiency.
  • pancreatic endocrine tumors have been characterized, and auto-immune disorders which affect the pancreas have also been described.
  • GP354 expression is also detected in neural CNS tissue, albeit at lower levels than is detected in the pancreas. It is therefore envisioned that GP354 mis-expression may be associated with neural dysfunction, disorder or disease, or abnormal development of the CNS.
  • neural disorders which maybe ameliorated by treatment with a composition of the invention include, without limitation, Alzheimer's disease, Parkinson's disease, senile dementia, migraine, epilepsy, neuritis, neurasthenia, neuropathy, and any other diseases involving GP354-mediated neural migration, neural degeneration (e.g., GP354-mediated autoimmune diseases such as certain forms of multiple sclerosis), and neural tumors (e.g., glioma, astroblastoma, and astrocytoma).
  • GP354-mediated neural migration e.g., GP354-mediated autoimmune diseases such as certain forms of multiple sclerosis
  • neural tumors e.g., glioma, astroblastoma, and astrocytoma.
  • compositions of the invention may have utility include endocrine and hormonal problems (e.g., diabetes), pancreatic diseases, cancers (particularly pancreatic cancer), and the like.
  • GP354 modulators including GP354 antisense reagents, GP354 ligands and anti-GP354 antibodies, to treat individuals having or at risk of developing such diseases is an aspect of the invention.
  • a composition of the invention typically contains from about 0.1 to
  • Solid formulations of the compositions for oral administration can contain suitable carriers or excipients, such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • suitable carriers or excipients such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid.
  • Disintegrators that can be used include, without limitation, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid.
  • Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone(PovidoneTM), hydroxypropyl methylcellulose, sucrose, starch, and ethylcellulose.
  • Lubricants that can be used include magnesium stearates, stearic acid, silicone fluid, talc, waxes, oils, and colloidal silica.
  • Liquid formulations of the compositions for oral administration prepared in water or other aqueous vehicles can contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
  • the liquid formulations can also include solutions, emulsions, syrups and elixirs containing, together with the active compound(s), wetting agents, sweeteners, and coloring and flavoring agents.
  • Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.
  • Injectable formulations of the compositions can contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like).
  • water soluble versions of the compounds can be administered by the drip method, whereby a pharmaceutical formulation containing the antifungal agent and a physiologically acceptable excipient is infused.
  • Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients.
  • Intramuscular preparations e.g., a sterile formulation of a suitable soluble salt form of the compounds
  • a pharmaceutical excipient such as Water- for-Injection, 0.9% saline, or 5%> glucose solution.
  • a suitable insoluble form of the compound can be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, such as an ester of a long chain fatty acid (e.g., ethyl oleate).
  • a topical semi-solid ointment formulation typically contains a concentration of the active ingredient from about 1 to 20%, e.g., 5 to 10%>, in a carrier such as a pharmaceutical cream base.
  • a carrier such as a pharmaceutical cream base.
  • formulations for topical use include drops, tinctures, lotions, creams, solutions, and ointments containing the active ingredient and various supports and vehicles.
  • the optimal percentage of the therapeutic agent in each pharmaceutical formulation varies according to the formulation itself and the therapeutic effect desired in the specific pathologies and correlated therapeutic regimens.
  • the pharmaceutical formulation will be administered to the patient by applying to the skin of the patient a transdermal patch containing the pharmaceutical formulation, and leaving the patch in contact with the patient's skin (generally for 1 to 5 hours per patch).
  • transdermal routes of administration e.g., through use of a topically applied cream, ointment, or the like
  • the pharmaceutical formulation(s) can also be administered via other conventional routes (e.g., enteral, subcutaneous, intrapulmonary, transmucosal, intraperitoneal, intrauterine, sub lingual, intrathecal, or intramuscular routes) by using standard methods.
  • the pharmaceutical formulations can be administered to the patient via injectable depot routes of administration such as by using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods.
  • the therapeutic protein or antibody agent typically is administered at a daily dosage of 0.01 mg to 30 mg/kg of body weight of the patient (e.g., lmg/kg to 5 mg/kg).
  • the pharmaceutical formulation can be administered in multiple doses per day, if desired, to achieve the total desired daily dose.
  • the effectiveness of the method of treatment can be assessed by monitoring the patient for known signs or symptoms of a disorder.
  • compositions of the invention may be included in a container, package or dispenser alone or as part of a kit with labels and instructions for administration.
  • the invention provides transgenic cells and non- human organisms comprising gp354 isoform nucleic acids, and transgenic cells and non-human organisms with targeted disruption of the endogenous ortho log of the human gp354 gene.
  • the cells can be embryonic stem cells or somatic cells.
  • the transgenic non-human organisms can be chimeric, non-chimeric heterozygotes, and non-chimeric homozygotes.
  • Host cells of the invention may be used to produce non-human transgenic animals.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which gp354 nucleotide sequences have been introduced.
  • Such a host cell may be used to create non-human transgenic animals in which exogenous gp354 sequences have been introduced into their genome or used to alter or replace related endogenous gp354 sequences in the animal.
  • transgenic animal is a non-human animal, preferably a mammal, more preferably a cow, goat, sheep, or rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene.
  • transgenic animals include non-human primates, dogs, chickens, amphibians, etc.
  • transgenic animal is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and that remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous gp354 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • the non-human transgenic animals of the invention will be useful for studying the function and/or activity of gp354 and for identifying and/or evaluating modulators of gp354 activity. They will also be useful in methods for producing a GP354 protein or polypeptides fragment, i.e., in which the protein is produced in the mammary gland of a non-human mammal.
  • a transgenic animal of the invention can be created by introducing gp354-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • a polynucleotide comprising or having human gp354 DNA sequences of SEQ ED NO:l, 3, 5, 6, 7, 9, or 11, may be introduced as a transgene into the genome of a non-human animal.
  • a non-human homolog of the human gp354 gene such as a mouse gp354 gene, isolated by hybridization to an isolated polynucleotide of the invention, may be used as a transgene.
  • Heterologous transcription control sequence sequences, intronic sequences, polyadenylation signals and the like may also be operatively linked with the transgene to increase the efficiency or otherwise regulate the expression (e.g., in a developmental or tissue specific manner) the transgene in the recipient host animal.
  • transgenic founder animal can be identified based upon the presence of the g ⁇ 354 transgene in its genome and/or expression of gp354 mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding gp354 can further be bred to other transgenic animals carrying other transgenes.
  • a vector is prepared which contains at least a portion of a gp354 gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the gp354 gene.
  • the gp354 gene can be a human gene (e.g., SEQ ED NO: 1, 5, 9 or 11), but more preferably, is a non-human homolog of a human gp354 gene.
  • a mouse homolog of the human gp354 gene of SEQ ED NO:l, 5, 9 or 11 can be used to construct a homologous recombination vector suitable for altering an endogenous gp354 gene in the mouse genome.
  • the vector is designed such that, upon homologous recombination, the endogenous gp354 gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).
  • the vector can be designed such that, upon homologous recombination, the endogenous gp354 gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous GP354 protein).
  • the altered portion of the gp354 gene is flanked at its 5' and 3' ends by additional nucleic acid of the gp354 gene to allow for homologous recombination to occur between the exogenous gp354 gene carried by the vector and an endogenous gp354 gene in an embryonic stem cell.
  • the additional flanking gp354 nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene.
  • several kilobases of flanking DNA are included in the vector. See e.g., Thomas et al. Cell 51 :503 (1987) for an exemplary description of homologous recombination vectors.
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced g ⁇ 354 gene has homologously recombined with the endogenous gp354 gene are selected (see e.g., Li et al. Cell 69:915 (1992)).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras.
  • an animal e.g., a mouse
  • aggregation chimeras See e.g., Bradley 1987, In: TERATOCARCINOMAS AND EMBRYONIC STEM CELLS: A PRACTICAL APPROACH, Robertson, ed. IRL, Oxford, pp. 113-152.
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.
  • Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, Curr. Opin. Biotechnol. 2:823-829 (1991); PCT International Publication Nos.: WO 90/11354; WO 91/01140; WO 92/0968; and WO 93/04169.
  • Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut et al. Nature 385:810-813 (1997).
  • a cell e.g., a somatic cell
  • the quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
  • the reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal.
  • the offspring borne of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated.
  • Regulated expression of transgenes in vivo may be accomplished using controllable recombination systems, such as the cre/loxP recombinase system (see, e.g., Lakso et al. Proc. Natl Acad. Sci. USA 89:6232-6236 (1992)) and the FLP recombinase system(O' Gorman et al. Science 251:1351-1355 (1991)).
  • transgenic animals containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Transgenic animals containing both elements of the system can be obtained, e.g., by mating two transgenic animals, each containing either the transgene encoding the selected protein or the transgene encoding a recombinase.
  • fragment antisense molecules of the invention include (i) those that specifically recognize and hybridize to gp354 RNA (as determined by sequence comparison of DNA encoding GP354 to DNA encoding other known molecules). Identification of sequences unique to GP354 encoding polynucleotides can be deduced through use of any publicly available sequence database, and/or through use of commercially available sequence comparison programs.
  • Antisense polynucleotides are particularly relevant to regulating expression of GP354 by those cells expressing gp354 mRNA.
  • Antisense oligonucleotides, or fragments of a nucleotide sequence set forth in SEQ ED NO:l, 3, 5, 6, 7, 9 or 11, or sequences complementary or homologous thereto, derived from the nucleotide sequences encoding GP354 are useful as diagnostic tools for probing gene expression in various tissues.
  • tissue can be probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiography techniques to investigate native expression of this enzyme or pathological conditions relating thereto.
  • antisense nucleic acid molecules are provided that comprise a sequence complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides or an entire gp354 coding strand, or to only a portion thereof.
  • Nucleic acid molecules encoding fragments, homologs, derivatives and analogs of a GP354 protein of SEQ ED NO:2, 4, 8, 10 or 12, antisense nucleic acids complementary to a GP354 nucleic acid sequence of SEQ ED NO:l, 3, 5, 6, 7, 9 or 11 are additionally provided.
  • Antisense nucleic acid molecules of the invention may be antisense to a "coding region" or non-coding regions of the coding strand of a nucleotide sequence encoding GP354.
  • the term "coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., a protein coding region of human GP354 corresponds to the coding region presented in SEQ ED NO:l, 7 orl 1).
  • Antisense oligonucleotides are preferably directed to a regulatory region of a nucleotide sequence of SEQ ED NO: 1 , 7 or 11 , or mRNA corresponding thereto, including, but not limited to, the initiation codon, TATA box, enhancer sequences, and the like.
  • the antisense nucleic acid molecule can be complementary to the entire coding or non-coding region of gp354, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of gp354 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of gp354 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • Antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
  • the antisense nucleic acid molecules of the invention preferably oligonucleotides of 10 to 20 nucleotides in length
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention.
  • the antisense oligonucleotides may be further modified by adding poly-L-lysine, transfe ⁇ n, polylysine, or cholesterol moieties at their 5' end.
  • An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a tissue site.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol Et or pol HI promoter are preferred.
  • the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule.
  • An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gaultier et al. Nucl. Acids Res 15: 6625-6641 (1987)).
  • the antisense nucleic acid molecule can also comprise a 2'-O-methylribonucleotide (Inoue et al. Nucl. Acids Res 15: 6131-6148 (1987)) or a chimeric RNA -DNA analogue (Inoue et al. FEBS Lett 215: 327-330 (1987)).
  • an antisense nucleic acid of the invention is part of a gp354 specific ribozyme (or, as modified, a "nucleozyme").
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes such as hammerhead, hairpin, Group I intron ribozymes, and the like
  • a ribozyme having specificity for a gp354-encoding nucleic acid can be designed based upon the nucleotide sequence of a gp354 polynucleotide disclosed herein (SEQ ED NO:l, 3, 5, 6, 7, 9, or 11). See, e.g., U.S. Patent Nos. 5,116,742; 5,334,711 ; 5,652,094; and 6,204,027, incorporated herein by reference in their entireties.
  • a derivative of a Tetrahymena L-19 TVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GP354-encoding mRNA.
  • a GP354-encoding mRNA See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742.
  • gp354 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al, Science 261 :1411-1418 (1993).
  • gp354 gene may be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gp354 (e.g., the gp354 promoter and/or enhancers) to form triple helical structures that prevent transcription of the gp354 gene in target cells.
  • nucleotide sequences complementary to the regulatory region of the gp354 e.g., the gp354 promoter and/or enhancers
  • PNA Peptide Nucleic Acids
  • both the sugar and the intemucleoside linkage are replaced with novel groups, such as peptide nucleic acids (PNA).
  • PNA peptide nucleic acids
  • the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
  • Nucleobases are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone, typically by methylene carbonyl linkages.
  • PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols as described in Hyrup et al., supra; and Perry-O'Keefe et al., Proc. Natl. Acad. Sci. USA 93:14670-675 (1996).
  • PNAs of gp354 can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs of gp354 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases; or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; and Perry-O'Keefe, supra).
  • PNAs of gp354 can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of gp354 can be generated that may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup et al, supra).
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup, supra and Finn et al, Nucl. Acids Res. 24:3357-63 (1996).
  • a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry, and modified nucleoside analogs, e.g., 5'-(4-methoxytrityl) amino-5'-deoxy-thymidine phosphoramidite, can be used between the PNA and the 5' end of DNA (Mag et al, Nucl. Acids Res. 17:5973-88 (1989)).
  • PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, supra).
  • chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemaitre et al, Proc. Natl. Acad. Sci. USA 84:648-652 (1987); PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No.
  • oligonucleotides can be modified with hybridization triggered cleavage agents (See, e.g., Krol et al, BioTechniques 6:958-976 (1988)), or intercalating agents (See, e.g., Zon, Pharm. Res. 5: 539-549 (1988)).
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc.
  • the isolated polynucleotides of the invention can be used as nucleic acid probes to assess the levels of gp354 mRNA in tissues in which it is normally expressed (e.g., pancreas and CNS), and in tissues in which it is not normally expressed, if such abnormal tissue mis-expression is suspected.
  • the invention thus provides a method for detecting the presence of a gp354 polynucleotide in a biological sample (e.g., a cell extract, fluid or tissue sample derived from a patient) by contacting the sample with an isolated polynucleotide of the invention which is capable of specifically detecting by hybridization gp354 polynucleotide sequences.
  • a biological sample e.g., a cell extract, fluid or tissue sample derived from a patient
  • the method comprises the steps of contacting the sample with an the isolated nucleic acid under high stringency hybridization conditions and detecting hybridization of the isolated polynucleotide to a nucleic acid in the sample, wherein the occurrence of said hybridization indicates the presence of a gp354-encoding sequence in the sample.
  • the isolated polynucleotides of the invention can be used as nucleic acid probes that are specific to particular cell types in the pancreas and central nervous system based on the specific expression of gp354 in these tissued. Accordingly, the present invention provides a method for identifying a cell as a pancreatic or a neural cell by detecting the presence of a gp354 polynucleotide in a biological sample (e.g., a cell extract, fluid or tissue sample derived from a patient) by contacting the sample with an isolated polynucleotide of the invention which is capable of specifically detecting by hybridization gp354 polynucleotide sequences.
  • a biological sample e.g., a cell extract, fluid or tissue sample derived from a patient
  • the present invention also provides a diagnostic assay for identifying the presence or absence of a genetic lesion or mutation characterized by at least one of: (i) aberrant modification or mutation of a gene encoding a GP354 protein; (ii) mis-regulation of a gene encoding a GP354 protein; and (iii) aberrant post-translational modification of a GP354 protein, wherein a wild-type form of the gene encodes a protein with a GP354 biological activity.
  • the present invention further provides a method of identifying a homolog of a human gp354 gene, comprising the step of hybridizing a nucleic acid library with a nucleic acid probe comprising SEQ ED NO:l, 3, 5, 6, 7, 9 or 11, or a portion thereof having at least 17 nucleotides, under medium or high stringency hybridization conditions; and determining whether the nucleic acid probe hybridizes to a nucleic acid sequence in the library. If the nucleic acid sequence in the library hybridizes under such selected conditions, it is a homolog of a human g ⁇ 354 gene.
  • Antibodies of the present invention can be used to assess the expression levels of GP354 proteins in tissues in which it is normally expressed (e.g., pancreas and CNS), and in tissues in which it is not normally expressed, if such abnormal tissue mis-expression is suspected.
  • the invention thus provides a method for detecting the presence of a GP354 protein or its activity in a biological sample (e.g., a cell extract, fluid or tissue sample derived from a patient) by contacting the sample with an agent capable of detecting an indicator of the presence of GP354 protein or its activity.
  • the agent is an antibody specific for at least one epitope of GP354 protein.
  • the invention provides a method for determining whether a GP354 protein is present in a sample, comprising the step of contacting the sample with an antibody having at least one GP354 epitope and detecting specific binding of the antibody to an antigen, which indicates the presence of a GP354 protein in the sample.
  • the above method will also be useful for identifying a test cell in a subject as a pancreatic or a neural cell by comparing the amount of GP354 polypeptides present in a biological sample (e.g., a cell extract, fluid or tissue sample derived from the subject) from the subject test cell to the amount of GP354 polypeptides present in a parallel biological sample from non-pancreatic or non- neural tissue.
  • a biological sample e.g., a cell extract, fluid or tissue sample derived from the subject
  • anti-PanCAM antibodies described herein can be used to quantify pancreatic islet injury in early type I diabetes, as well as any therapy aimed at restoring islet function.
  • the antibodies are attached to a contrast marker (e.g., Gadolinium) for MRI and CT applications, or to a radioactive marker (e.g., Technecium) for nuclear medicine applications.
  • a contrast marker e.g., Gadolinium
  • a radioactive marker e.g., Technecium
  • the relevant diagnostic modality is then used to quantify and document changes in islet sizes and/or numbers.
  • the antibodies so labeled may also localize islet cell tumors using such a diagnostic modality.
  • the amount or activity of a GP354 protein in a tissue sample is assessed by competitive binding assays using a GP354 polypeptides or fragment of the invention, or by an immunoassay using a GP354 specific antibody of the invention.
  • the method is used to diagnose a disease condition relating to the pancreas or to the nervous system.
  • kits for diagnosing a disease condition in a subject by monitoring relative gp354 mRNA levels in difference tissues comprise the step of comparing the amount of a gp354 mRNA in a test tissue sample from the subject to the amount of gp354 mRNA in a control sample, wherein a significant difference in the amount of the mRNA in the test sample relative to the amount in the control sample indicates that the subject has a disease condition.
  • the amount of gp354 mRNA in a tissue sample is assessed by hybridization using an isolated gp354 polynucleotide or nucleic acid fragment of the invention.
  • the method is used to diagnose a disease condition relating to the pancreas or to the nervous system.
  • nucleic acid and amino acid sequences of the invention are particularly useful as components in databases useful for search analyses as well as in sequence analysis algorithms.
  • nucleic acid sequences of the invention and “amino acid sequences of the invention” mean any detectable chemical or physical characteristic of a polynucleotide or polypeptide of the invention that is or may be reduced to or stored in a computer readable form. These include, without limitation, chromatographic scan data or peak data, photographic data or scan data therefrom, and mass spectrographic data.
  • This invention provides computer readable media having stored thereon sequences of the invention.
  • the computer readable medium can be any composition of matter used to store information or data, including, for example, commercially available floppy disks, tapes, hard drives, compact disks, and video disks.
  • the invention provides a diagnostic assay for identifying a homolog of a human g ⁇ 354 gene, comprising the step of screening a nucleic acid database with a query sequence consisting of SEQ ID NO:l, 3, 5, 6, 7, 9 or 11, or a portion thereof having 300 or more nucleotides, wherein a nucleic acid sequence in said database that is at least 65%> but less than 100% identical to SEQ ED NO:l, 3, 5, 6, 7, 9 or 11, or said portion thereof, if found, is a homolog of a human gp354 gene.
  • Preferred methods of sequence analysis include, for example, methods of sequence homology analysis, such as identity and similarity analysis, RNA structure analysis, sequence assembly, cladistic analysis, sequence motif analysis, open reading frame determination, nucleic acid base calling, and sequencing chromatogram peak analysis.
  • a computer-based method is provided for performing nucleic acid homology identification. This method comprises the steps of providing a nucleic acid sequence comprising the sequence of a nucleic acid of the invention in a computer readable medium; and comparing said nucleic acid sequence to at least one nucleic acid or amino acid sequence to identify homology.
  • a sequence of gp354 cDNA is obtained by performing rapid amplification of cDNA ends (RACE) using the MARATHON-READY RACE kit (Clontech, Palo Alto, CA).
  • RACE rapid amplification of cDNA ends
  • a MARATHON-READY cDNA is a double-stranded cDNA synthesized from human tissue mRNA and ligated to a standard set of adapters (Clontech). All RACE reactions use an adapter primer AP-1, 5'-CCATCCTAATACGACTCACTATAGGGC-3' (SEQ ED NO: 15) provided with the kit.
  • the 3' RACE for gp354 may use AP-1 together with the forward primer GX1-218, 5'-ACTGGGGGCTAGTTCAGTGGACTAA-3' (SEQ ED NO: 16), or the complement of the reverse primer, GXl-219, 5'-
  • the 5' RACE for gp354 may use AP-1 together with the reverse primer GXl-219, or the complement of the forward primer GX1-218.
  • ADVANTAGE 2 DNA polymerase (Clontech) may be used for the amplification reactions.
  • the MARATHON-READY kit may be used according to the manufacturer's specifications except that "touchdown" PCR (Don et al., Nuc. Acids Res. 19:4008 (1991)) conditions are used for thermal cycling.
  • the thermal cycling conditions are as follows: 94°C for 1 minute, one cycle of 94°C for 15 seconds, 72°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 71°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 70°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 69°C for 15 seconds, 68°C for 15 seconds; 35 cycles of 94°C for 15 seconds and 68°C for 30 seconds; and 68°C for 10 minutes.
  • Example 3 Confirmation of GP354 Expression by RT-PCR Inter-exon PCR was used to confirm that the predicted gp354 gene was indeed expressed and to initiate the cloning process that would determine the true (rather than the predicted) gene structure.
  • Templates for the PCR were single- stranded cDNAs contained in a multi-tissue cDNA panel generated by reverse transcription PCR ("RT-PCR") from mRNA isolated from multiple human tissues according to the manufacturer's specifications (Clontech). These tissues were brain, heart, kidney, liver, lung, pancreas, pituitary, skeletal muscle, colon, ovary, peripheral blood leukocyte, prostate, small intestine, spleen, testis, and thymus.
  • Primers for the inter-exon PCR were selected from separate exons so that every PCR experiment had a built-in control to distinguish spliced messages from unspliced messages or from genomic contamination in the cDNA panels.
  • One pair of such primers were GX1-220 and GX1-221 (Example 13, inpra).
  • Another pair used were GX1-218 and GXl-219 (supra).
  • the PCR was carried out according to the specification included with the multiple tissue cDNA panel (Clontech). Typical thermal cycler conditions for the PCR were: 94°C for 1 minute, followed by 35 cycles of 94°C for 20 seconds, 68°C for 2 minutes, followed by 5 minutes at 68°C after the last cycle. PCR products were separated on 1.0% agarose gel and visualized by ethidium bromide staining.
  • Example 4 Identification of Full-Length gp354 cDNA by RACE Because the gene prediction programs GENSCAN and GENEMARK have predictable error rates (Burge et al., supra; Lukashin et al., supra), the PCR fragment described in Example 3 are used as a seed sequence to obtain the rest of the gp354 cDNA sequence via RACE reactions.
  • the primer is GX1-218 or the complement of GXl-219
  • the template is cDNAs derived from human pancreas tissue (see Example 3).
  • the primer is GXl-219 or the complement of GX1-218, and the template is also cDNAs derived from human pancreas tissue.
  • the 5' and 3' RACE fragments so obtained are gel-purified, cloned, and sequenced.
  • the initial PCR product, the 5' RACE product and the 3 'RACE product are assembled into a single contiguous sequence using the ASSEMBLE program in the GCG computer package (Genetics Computer Group, Madison, Wisconsin).
  • Example 5 Confirmation of GP354 Expression by Northern Blot Analysis
  • Northern blot analysis was conducted with each lane of the blot (Clontech catalogue no. 7760-1) containing 2 ⁇ g of polyA RNA.
  • the tissues represented on the blot included heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas.
  • the probe for the Northern blot was the PCR fragment described in Example 3 (SEQ ID NO:3). 50 ng of the probe was labeled by the random-primed method of Feinberg and Vogelstein (Anal. Biochem. 132:6-13 (1983)).
  • Hybridization was carried out at 68°C for one hour in EXPRESSHYB solution (Clontech catalogue no. 8015-1). Prior to autoradiography, the Northern blot was washed with 2X SSC/0.05% SDS at room temperature, followed by two washes with 0.1 X SSC/0.1 % SDS at 50°C.
  • RNA of approximately 3.2 kb was observed in the pancreas but not in any other tissues tested.
  • Example 6 PCR Screening of A Genomic Library And Subcloning of GP354 Coding Regions Subcloning of the g ⁇ 354 genomic locus may be accomplished by
  • PCR from a genomic library or directly from genomic DNA.
  • a human genomic library ⁇ 10 8 PFU/ml
  • K802 cells Clontech
  • the micro tubes are incubated at 37°C for 15 min.
  • Seven milliliters of 0.8% agarose is added to each tube, mixed, then poured onto LB agar + 10 mM MgSO 4 plates and incubated overnight at 37°C.
  • SM phage buffer 0.1 M NaCl, 8.1 mM MgSO 4 « 7H 2 O, 50 mM Tris'Cl (pH 7.5), 0.01% gelatin
  • SM phage buffer 0.1 M NaCl, 8.1 mM MgSO 4 « 7H 2 O, 50 mM Tris'Cl (pH 7.5), 0.01% gelatin
  • a drop of chloroform is added and the tube is placed in a 37°C shaker for 15 min, then centrifuged for 20 min at 4000 rpm (Sorvall RT6000 table top centrifuge) and the supernatant stored at 4°C as a stock solution.
  • PCR may be then performed in 20 ml containing 8.8 ml H 2 O, 4 ml 5X RAPID-LOAD BUFFER (Origene), 2 ml 1 OX PCR BUFFER II (Perkin Elmer), 2 ml 25 mM MgC12, 0.8 ml 10 mM dNTP, 0.12 ml of a primer comprising at least a portion of the sequence of the 5' end of the gp354 polynucleotide of SEQ ED NO:l (1 mg/ml), 0.12 ml of a primer comprising at least a portion of the sequence that is complementary to the 3' end of the gp354 polynucleotide of SEQ ED NO:l (1 mg/ml), 0.2 ml AMPLITAQ GOLD polymerase (Perkin Elmer) and 2 ml of phage solution from each of the 24 tubes.
  • the PCR reaction involves 1 cycle at 80°C for 20 min, 95°C for 10 min, then 22 cycles at 95°C for 30 sec, 72°C for 4 min decreasing 1°C each cycle, 68°C for 2 min, followed by 30 cycles at 95°C for 30 sec, 55°C for 30 sec, 68°C for 60 sec.
  • the reaction is loaded onto a 2%> agarose gel.
  • the series of dilutions and subdividions of the plate is continued until a single plaque is isolated that gives a positive PCR band.
  • 10 ml phage supernatant is added to 100 ml SM and 200 ml of K802 cells per plate with a total of 8 plates set up. The plates are incubated overnight at 37°C. Eight milliliters of SM is added to each plate, and the top agarose is scraped off with a microscope slide and collected in a centrifuge tube.
  • the centrifuge tube Three drops of chloroform are added to the centrifuge tube. Subsequently, the tube is vortexed, incubated at 37°C for 15 min, and centrifuged for 20 min at 4000 ⁇ m (Sorvall RT6000 table top centrifuge) to recover the phage.
  • the recovered phage is used to isolate genomic phage DNA using the QIAGEN LAMBDA MEDI KIT.
  • the sequences for primers may be derived from the sequences given herein.
  • PCR is performed in a 50 ⁇ l reaction containing 33 ⁇ l H 2 O, 5 ⁇ l 10X TT buffer (140 mM ammonium sulfate, 0.1 % gelatin, 0.6 M Tris-tricine pH 8.4), 5 ⁇ l 15 mM MgS0 4 , 2 ⁇ l 10 mM dNTP, 4 ⁇ l genomic phage DNA (0.1 ⁇ g/ml), 0.3 ⁇ l of a primer comprising at least a portion of the 5' most coding sequence of the gp354 polynucleotide of SEQ ED NO:l (1 ⁇ g/ml), 0.3 ⁇ l of a primer comprising a sequence that is complementary to at least a portion of the 3' most coding sequence of the gp354 polynucleotide of SEQ ED NO: 1 (1 ⁇ g/ml), 0.4 ⁇ l HIGH FIDELITY Taq
  • the PCR product is loaded onto a 2% agarose gel.
  • the DNA band of expected size is excised from the gel, placed in GENELUTE AGAROSE spin column (Supelco) and spun for 10 min at maximum speed.
  • the eluted DNA is ethanol-precipitated and resuspended in 12 ⁇ l H 2 O for ligation.
  • the PCR primer sequences may be derived from the sequences provided herein.
  • the ligation reaction uses solutions from the TOPO TA Cloning Kit (Invitrogen). The reaction proceeds in a solution containing 4 ⁇ l of PCR product and 1 ⁇ l of pCRII-TOPO vector at room temperature for 5 min. The reaction is terminated by the addition of 1 ⁇ l of 6X TOPO Cloning Stop Solution. The ligation product is then placed on ice. Two micro liters of the ligation reaction is used to transform ONE-SHOT TOP 10 cells (invitrogen). Briefly, the ligation reaction is mixed with the cells and placed on ice for 30 min. The cells are then heat-shocked for 30 seconds at 42°C and placed on ice for two minutes. Next, 250 ⁇ l of SOC is added to the cells, which are incubated at 37°C with shaking for one hour and then plated onto ampicillin plates.
  • Plasmid DNA is purified from the culture using the CONCERT RAPED PLASMID MINIPREP SYSTEM (GibcoBRL) and the insert of the plasmid DNA is then sequenced.
  • the gp354 genomic phage DNA may be sequenced using the ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems), which uses the advanced capillary electrophoresis technology and the ABI PRISM BIGDYE Terminator Cycle Sequencing Ready Reaction Kit.
  • the cycle-sequencing reaction may contain 14 ml of H 2 0, 16 ml of BIGDYE Terminator mix, 7 ml genomic phage DNA (0.1 mg/ml), and 3 ml primer (25 ng/ml). The reaction is performed in a Perkin-Elmer
  • the product is purified using a
  • gp354 in mammals, such as rat, may be investigated by in situ hybridization histochemistry.
  • coronal and sagittal rat pancreas cryosections (20 ⁇ m thick) are prepared using a Reichert-Jung cryostat. individual sections are thaw-mounted onto silanized, nuclease-free slides (CEL Associates, Inc., Houston, TX), and stored at -80°C.
  • Sections are processed starting with post-fixation in cold 4%> paraformaldehyde, rinsed in cold phosphate-buffered saline (PBS), acetylated using acetic anhydride in triethanolamine buffer, and dehydrated through a series of alcohol washes in 10%, 95%>, and 100% alcohol at room temperature. Subsequently, sections are delipidated in chloroform, followed by rehydration through successive exposure to 100% and 95% alcohol at room temperature. Microscope slides containing processed cryosections are allowed to air dry prior to hybridization. Other tissues may be assayed in a similar fashion.
  • PBS cold phosphate-buffered saline
  • a gp354-specifrc probe may be generated using PCR and sequence information from SEQ ED NO:l or SEQ ED NO:3. Following PCR amplification, the fragment is digested with restriction enzymes and cloned into pBluescript II cleaved with the same enzymes. For production of a probe specific for the sense strand of gp354, a cloned gp354 fragment cloned in pBluescript II may be linearized with a suitable restriction enzyme, which provides a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase.
  • a suitable restriction enzyme which provides a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase.
  • a probe specific for the antisense strand of gp354 may also be readily prepared using the gp354 clone in pBluescript II by cleaving the recombinant plasmid with a suitable restriction enzyme to generate a linearized substrate for the production of labeled run-off cRNA transcripts using the T3 promoter and cognate polymerase.
  • the riboprobes may be labeled with [ 35 S]-UTP to yield a specific activity of about 0.40 x 10 6 cpm/pmol for antisense riboprobes and about 0.65 x 10 6 cpm/pmol for sense-strand riboprobes.
  • Each riboprobe may be subsequently denatured and added (2 pmol/ml) to hybridization buffer which contains 50%> formamide, 10% dextran, 0.3 M NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt's Solution, and 10 mM dithiothreitol.
  • Microscope slides containing sequential pancreas cryosections may be independently exposed to 45 ⁇ l of hybridization solution per slide and silanized cover slips may be placed over the sections being exposed to hybridization solution. Sections are incubated overnight (e.g., 15-18 hours) at 52°C to allow hybridization to occur. Equivalent series of cryosections are then exposed to sense or antisense gp354-specifrc cRNA riboprobes.
  • coverslips are washed off the slides in IX SSC, followed by RNase A treatment by exposing the slides to 20 ⁇ g/ml RNase A in a buffer containing 10 mM Tris » HCl (pH 7.4), 0.5 M EDTA, and 0.5 M NaCl for 45 minutes at 37°C.
  • the cryosections are then subjected to three high-stringency washes in 0.1 X SSC at 52°C for 20 minutes each.
  • cryosections are dehydrated by consecutive exposure to 70%, 95%>, and 100%> ammonium acetate in alcohol, followed by air drying and exposure to KODAK BIOMAX MR-1 film.
  • Example 8 Northern Blot Analysis of gp354-RNA Northern blot hybridizations may be performed to examine the expression of gp354 mRNA. A clone containing at least a portion of the sequence of SEQ ED NO: 1 , SEQ ED NO:3, or a complement thereto, may be used as a probe. Vector-specific primers are used in PCR to generate a hybridization probe fragment for 32 P-labeling. The PCR is performed as follows: (1) mix the following reagents:
  • Taq polymerase such as Amersham Pharmacia Biotech catalogue no. 27-0799-62
  • 83.5 ⁇ l water (2) perform PCR in a thermocylcer using the following program: 94°C 5min; 30 cycles of 94°C, 1 min, 55°C, 1 min, and 72°C 1 min; and then 72°C, 10 min.
  • the PCR product may be purified using QIAQUICK PCR Purification Kit (Qiagen catalogue no. 28104).
  • the purified PCR fragment is labeled with 32 P-dCTP (Amersham Pharmacia Biotech catalogue no. AA0005/250) by random priming using "Ready-to-go DNA Labeling Beads" (Amersham Pharmacia Biotech cat. no. 27-9240-01).
  • Hybridization is carried out on a human multi-tissue Northern blot from Clontech according to the manufacturer's protocol. After overnight exposure on a Molecular Dynamics PHOSPHORIMAGER screen (cat. no. MD 146-814), bands of about 1.35 kb are visualized.
  • GP354-encoding polynucleotide is expressed using recombinant techniques.
  • the GP354-encoding sequence described in Example 1 is subcloned into the commercial expression vector pzeoSV2 (Invitrogen).
  • the resultant expression construct is transfected into Chinese Hamster Ovary (CHO) cells using the transfection reagent FUGENE6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
  • Other eukaryotic cell lines including human embryonic kidney (HEK 293) and COS cells, are suitable as well.
  • GP354 Cells stably expressing GP354 are selected by growth in the presence of 100 ⁇ g/ml zeocin (Stratagene, LaJolla, CA).
  • GP354 may be purified from the cells using standard chromatographic techniques.
  • antisera are raised against one or more synthetic peptide sequences that correspond to portions of the GP354 amino acid sequence, and the antisera are used to affinity-purify GP354.
  • the GP354 protein also may be expressed in-frame with a tag sequence (e.g., polyhistidine, haemagglutinin, or FLAG) to facilitate purification.
  • tag sequence e.g., polyhistidine, haemagglutinin, or FLAG
  • GP354 in 293 cells
  • a plasmid bearing the relevant gp354 coding sequence is prepared, using vector pSecTag2A (Invitrogen).
  • Vector pSecTag2A contains the murine IgK chain leader sequence for secretion, the c-myc epitope for detection of the recombinant protein with the anti-myc antibody, a C-terminal polyhistidine for purification with nickel chelate chromatography, and a Zeocin-resistant gene for selection of stable transfectants.
  • the forward primer for amplification of this gp354 cDNA is determined by routine procedures and preferably contains a 5' extension of nucleotides to introduce the HindHI cloning site and nucleotides matching the gp354 sequence.
  • the reverse primer is also determined by routine procedures and preferably contains a 5' extension of nucleotides to introduce an Xhol restriction site for cloning and nucleotides corresponding to the reverse complement of the gp354 sequence.
  • the PCR conditions are 55°C as the annealing temperature.
  • the PCR product is gel purified and cloned into the HindUI-XhoI sites of the vector.
  • a polynucleotide having a sequence of SEQ LD NO: 1 for example, can be cloned into vector p3-CI.
  • This vector is a pUC18-derived plasmid that contains the HCMV (human cytomegalovirus) promoter-intron located upstream from the bGH (bovine growth hormone) polyadenylation sequence and a multiple cloning site.
  • the plasmid contains the dhrf (dihydrofolate reductase) gene which provides selection in the presence of the drug methotrexane (MTX) for selection of stable transformants.
  • HCMV human cytomegalovirus
  • bGH bovine growth hormone
  • the forward primer is determined by routine procedures and preferably contains a 5' extension which introduces an Xbal restriction site for cloning, followed by nucleotides which correspond to a nucleotide sequence of SEQ ED NO:l.
  • the reverse primer is also determined by routine procedures and preferably contains 5'-extension of nucleotides which introduces a Sail cloning site followed by nucleotides which correspond to the reverse complement of a nucleotide sequence of SEQ ED NO:l.
  • the PCR consists of an initial denaturation step of 5 min at 95°C;
  • GP354 expressed from a COS cell culture can be purified by first concentrating the cell-growth media to about 10 mg protein/ml. The purification can be accomplished by, for example, chromatography.
  • GP354 is concentrated to 0.5 mg/ml in an AMICON concentrator fitted with a YM-10 membrane and stored at -80°C.
  • a polynucleotide having a sequence of SEQ ED NO:l is amplified by PCR.
  • the forward primer is determined by routine procedures and preferably contains a 5' extension which adds the Ndel cloning site, followed by nucleotides which correspond to a nucleotide sequence of SEQ ED NO: 1.
  • the reverse primer is also determined by routine procedures and preferably contains a 5' extension which introduces the Kpnl cloning site, followed by nucleotides which correspond to the reverse complement of a nucleotide sequence of SEQ ED NO:l.
  • the PCR product is gel purified, digested with Ndel and Kpnl, and cloned into the corresponding sites of expression vector pAcHTL-A (Pharmingen, San Diego, CA).
  • the pAcHTL vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV), and a 6XHis tag upstream from the multiple cloning site.
  • Nucleic acid sequences encoding a protein kinase site for phosphorylation and a thrombin site for excision of the recombinant protein precede the multiple cloning site.
  • baculovirus vectors such as pAc373, pVL941 and pAcEMl
  • pAcHTL-A baculovirus vectors
  • suitable vectors for the expression of GP354 polypeptides can be also used, provided that the vector construct includes appropriately located signals for transcription, translation, and trafficking, such as an in-frame AUG and a signal peptide, as required.
  • Such vectors are described in, e.g., Luckow et al, Virology 170:31-39 (1989).
  • the virus is grown and isolated using standard baculovirus expression methods, such as those described in Summers et al, A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • pAcHLT-A containing the gp354 gene is introduced into baculovirus using the BACULOGOLD transfection kit (Pharmingen).
  • Individual virus isolates are analyzed for protein production by radiolabeling infected cells with 35 S -methionine at 24 hours post infection. Infected cells are harvested at 48 hours post infection, and the labeled proteins are visualized by SDS-PAGE. Viruses exhibiting high expression levels can be isolated and used for scaled up expression.
  • a polynucleotide having the sequence of SEQ ED NO: 1 can be amplified by PCR using the methods described above for baculovirus expression.
  • the g ⁇ 354 cDNA is cloned into vector pAcHLT-A (Pharmingen) for expression in Sf9 insect cells.
  • the insert is cloned into the Ndel and Kpnl sites, after elimination of an internal Ndel site (using the same primers described above for expression in baculovirus).
  • DNA is purified with QIAGEN chromatography columns and expressed in Sf9 cells.
  • Kits are commercially available from, e.g., Clontech (MATCHMAKER Two-Hybrid System 3).
  • a fusion of the nucleotide sequences encoding all or partial GP354 and the DNA-binding domain (DNA-BD) of yeast transcription factor GAL4 is constructed using an appropriate vector (i.e., pGBKT7).
  • a GAL4 active domain (AD) fusion library is constructed in a second plasmid (i.e., pGADT7) from cDNA of potential GP354-binding proteins.
  • the DNA-BD/GP354 fusion construct is verified by sequencing, and tested for autonomous reporter gene activation and cell toxicity, both of which would prevent a successful two-hybrid analysis. Similar controls are performed with the AD/library fusion construct to ensure expression in host cells and lack of transcriptional activity. Yeast cells are transformed (ca. 105 transformants/mg of DNA) with both the GP354 and library fusion plasmids according to standard procedure (Ausubel, et al, supra). In vivo binding of DNA-BD/GP354 with
  • AD/library proteins results in transcription of specific yeast plasmid reporter genes (i.e., lacZ, HIS3, ADE2, LEU2).
  • yeast cells are plated on nutrient-deficient media to screen for expression of reporter genes. Colonies are dually assayed for b-galactosidase activity upon growth in Xgal (5-bromo-4-chloro-3-indolyl-b- D-galactoside) supplemented media (filter assay for b-galactosidase activity is described in Breeden et al, Cold Spring Harb. Symp. Quant. Biol, 50:643 (1985).
  • Standard techniques are employed to generate polyclonal or monoclonal antibodies to GP354, and to generate useful antigen-binding fragments thereof or variants thereof, including "humanized” variants. Such protocols can be found, for example, in Sambrook et al, supra, and Harlow et al. (Eds.) supra).
  • recombinant GP354 polypeptides or cells or cell membranes containing such polypeptides
  • one or more peptides having amino acid sequences corresponding to an immunogenic portion of GP354 e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acids are used as antigen.
  • Peptides corresponding to extracellular portions of GP354, especially hydrophilic extracellular portions, are preferred.
  • the antigen may be mixed with an adjuvant or linked to a hapten to increase antibody production.
  • A. Polyclonal or monoclonal antibodies
  • recombinant GP354 or a synthetic fragment thereof is used to immunize a mouse to generate monoclonal antibodies, or to immunize a larger mammal, such as a rabbit, for polyclonal antibodies.
  • peptides can be conjugated to keyhole limpet hemocyanin commercially available from ,e.g., Pierce.
  • the antigen is emulsified with Freund's Complete Adjuvant and injected subcutaneously.
  • GP354 antigen are emulsified with Freund's Incomplete Adjuvant and injected subcutaneously.
  • a serum sample is taken from the immunized mice and assayed by Western blot to confirm the presence of antibodies that immunoreact with GP354.
  • Sera from the immunized animals may be used as polyclonal antisera or used to isolate polyclonal antibodies that recognize GP354. Alternatively, the mice are sacrificed and their spleen removed for generation of monoclonal antibodies.
  • the spleens are placed in 10 ml of serum- free RPMI 1640, and single cell suspensions are formed by grinding the spleens in serum- free RPMI 1640 supplemented with 2 mM L-glutamrne, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 ⁇ g/ml streptomycin (RPMI) (Gibco, Canada).
  • the cell suspensions are filtered and washed by centrifugation and resuspended in serum-free RPMI.
  • Thymocytes taken from three naive Balb/c mice are prepared in a similar manner and used as a feeder layer.
  • NS-1 myeloma cells kept in log phase in RPMI with 10% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, are centrifuged and washed as well.
  • FBS fetal bovine serum
  • spleen cells from the immunized mice are combined with NS-1 cells and centrifuged, and the supernatant is aspirated.
  • the cell pellet is dislodged by tapping the tube, and 2 ml of 37°C PEG 1500 (50% in 75 mM HEPES, pH 8.0) is stirred into the pellet, followed by the addition of serum-free RPMI.
  • the cells are centrifuged, resuspended in RPMI containing 15%> FBS, 100 ⁇ M sodium hypoxanthine, 0.4 ⁇ M aminopterin, 16 ⁇ M thymidine (HAT) (Gibco), 25 units/ml EL-6 (Boehringer-Mannheim) and 1.5 x 10 6 thymocytes/ml, and plated into 10 flat-bottom 96-well tissue culture plates.
  • FBS 100 ⁇ M sodium hypoxanthine
  • 0.4 ⁇ M aminopterin 16 ⁇ M thymidine (HAT) (Gibco) (Gibco)
  • HAT thymidine
  • EL-6 Boehringer-Mannheim
  • GP354-neutralizing antibodies comprise one class of therapeutics useful as GP354 antagonists.
  • Humanized antibodies have improved serum half-life and are less immunogenic in humans. The principles of antibody humanization have been described in the literature. For instance, to minimize potential binding to complement, a humanized antibody is preferred to be of the IgG 4 subtype.
  • variable domains of anti-GP354 antibodies can be cloned from the genomic DNA of an appropriate B-cell hybridoma or from cDNA derived from the hybridoma.
  • the V region gene fragments are linked to exons encoding human antibody constant domains.
  • the resultant construct is expressed in suitable mammalian host cells (e.g., myeloma or CHO cells).
  • variable region gene fragments that encode antigen-binding complementarity determining regions (CDRs) of the non-human monoclonal antibody are cloned into human antibody sequences.
  • CDRs complementarity determining regions
  • the ⁇ -sheet framework of the human antibody surrounding the CDR3 region is also modified (i.e., "back-mutated") to more closely mirror the three dimensional structure of the antigen-binding site of the original monoclonal antibody.
  • back-mutated modified
  • the surface of a non-human monoclonal antibody of interest is humanized by altering selected surface residues of the non-human antibody, e.g., by site-directed mutagenesis, while retaining all of the interior and contacting residues of the non-human antibody. See Padlan, Mol. Immunol, 28(4/5):489-98 (1991).
  • the foregoing approaches are employed using anti-GP354 monoclonal antibodies and the hybridomas that produce them.
  • the humanized anti-GP354 antibodies are useful as therapeutics to treat or palliate conditions wherein GP354 expression or ligand-mediated GP354 signaling is undesirable.
  • Anti-GP354 antibodies can be also generated by phage display techniques such as those described in Aujame et al, Hum. Antibodies 8(4):155-168 (1997); Hoogenboom, supra; and Rader et al, Curr. Opin. Biotechnol. 8:503-508 (1997).
  • antibody variable regions in the form of Fab fragments or linked single chain Fv fragments are fused to the amino terminus of filamentous phage minor coat protein plfl.
  • Expression of the fusion protein and inco ⁇ oration thereof into the mature phage coat results in phage particles that present an antibody on their surface and contain the genetic material encoding the antibody.
  • a phage library comprising such constructs is expressed in bacteria, and the library is screened for GP354-specific phage-antibodies using labeled or immobilized GP354 as antigen-probe.
  • Human GP354-specific antibodies are generated in transgenic mice essentially as described in Br ⁇ ggemann et al, Immunol. Today 17(8):391-97 (1996) and Bruggemann et al, Curr. Opin. Biotechnol. 8:455-58 (1997).
  • Transgenic mice carrying human V-gene segments in germline configuration and that express these transgenes in their lymphoid tissue are immunized with a GP354 composition using conventional immunization protocols.
  • Hybridomas are generated using B cells from the immunized mice using conventional protocols and screened to identify hybridomas secreting anti-GP354 human antibodies (e.g., as described above).
  • Example 12 Assays to Identify Modulators of GP354 Activity Set forth below are several non-limiting assays for identifying modulators (agonists and antagonists) of GP354 activity.
  • modulators that can be identified by these assays are natural ligands of the receptor; synthetic analogs and derivatives of the natural ligands; antibodies and/or antibody-like compounds derived from natural antibodies or from antibody-like combinatorial libraries; and/or synthetic compounds identified by high-throughput screening of libraries; and the like.
  • All modulators that bind GP354 are useful for identifying GP354 in tissue samples (e.g., for diagnostic pu ⁇ oses or therapeutic pu ⁇ oses).
  • Agonist and antagonist modulators are useful for up-regulating and down-regulating GP354 activity, respectively, so as to treat GP354-mediated diseases.
  • the assays may be performed using single putative modulators, and/or may be performed using a known agonist in combination with candidate antagonists (or visa versa).
  • A. cAMP Assays In one type of assay, levels of cyclic adenosine monophosphate
  • cAMP cAMP
  • Protocols for cAMP assays have been described in the literature. See, e.g., Sutherland et al, Circulation 37:279 (1968); Frandsen et al, Life Sci. 18:529-541 (1976); Dooley et ⁇ /., J of Pharmacol. Exp. Therap. 283(2): 735-41 (1997); and George et al, J. Biomol. Screening 2(4):235-40 (1997).
  • An exemplary protocol for such an assay using an Adenylyl Cyclase Activation FLASHPLATE Assay from NEN Life Science Products, is set forth below.
  • a GP354-encoding sequence is subcloned into an expression vector, such as pzeoSV2 (Invitrogen).
  • CHO cells are transiently transfected with the resultant expression construct using known methods, such as the transfection protocol provided by Boehringer-Mannheim when supplying the FUGENE 6 transfection reagent.
  • Transfected CHO cells are seeded into 96-well microplates from the FLASHPLATE assay kit, which are coated with solid scintillant to which antisera to cAMP have been bound. For a control, some wells are seeded with untransfected CHO cells. Other wells in the plate receive various amounts of a cAMP standard solution for use in creating a standard curve.
  • test compounds are added to the cells in each well, with compound-free medium or buffer as control. After treatment, cAMP is allowed to accumulate in the cells for exactly 15 minutes at room temperature. The assay is terminated by the addition of lysis buffer containing [ l25 I]-cAMP, and the plate is counted using a Packard TOPCOUNT 96-well microplate scintillation counter. Unlabeled cAMP from the lysed cells or from standards and fixed amounts of [ 125 I]-cAMP compete for antibody bound to the plate. A standard curve is constructed, and cAMP values for the unknowns are obtained by inte ⁇ olation. Changes in intracellular cAMP levels of cells in response to exposure to a test compound are indicative of GP354 modulating activity.
  • Modulators that act as agonists of receptors which couple to the Gs subtype of G proteins will stimulate production of cAMP, leading to a measurable (e.g., 3-10) fold increase in cAMP levels.
  • Agonists of receptors which couple to the Gi/o subtype of G proteins will inhibit forskolin-stimulated cAMP production, leading to a measurable decrease (e.g., 50-100%) in cAMP levels.
  • Modulators that act as inverse agonists will reverse these effects at receptors that are either constitutively active or activated by known agonists.
  • cells e.g., CHO cells
  • a gp354 expression construct e.g., a construct that encodes the photoprotein apoaquorin.
  • apoaquorin will emit a measurable luminescence that is proportional to the amount of cytoplasmic free calcium. See generally, Cobbold, et al. "Aequorin measurements of cytoplasmic free calcium," In: McCormack J.G. and Cobbold P.H., eds., CELLULAR CALCIUM: A PRACTICAL APPROACH. Oxford:IRL Press (1991); Stables et al, Anal. Biochem. 252:115-26 (1997); and Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth edition, Eugene OR (1996).
  • a gp354 coding sequence is subcloned into pzeoSV2 (Invitrogen).
  • CHO cells are transiently co-transfected with the resultant expression construct and a construct that encodes the photoprotein apoaquorin (Molecular Probes) using the transfection reagent FUGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
  • the cells are cultured for 24 hours at 37°C in MEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin. Then the culture medium is changed to serum-free MEM containing 5 ⁇ M coelenterazine (Molecular Probes). Culturing is continued for two more hours at 37°C. Subsequently, the cells are detached from the plate using VERSEN (Gibco/BRL), washed, and resuspended at 2X10 5 cells/ml in serum-free MEM.
  • MEM Gibco/BRL, Gaithersburg, MD
  • VERSEN Gibco/BRL
  • Dilutions of candidate GP354 modulator compounds are prepared in serum- free MEM and dispensed into wells of an opaque 96-well assay plate at 50 ⁇ l/well. The plate is then loaded onto an MLX microtiter plate luminometer (Dynex Technologies, Inc., Chantilly, VA). The instrument is programmed to dispense 50 ⁇ l cell suspensions into each well, one well at a time, and immediately read luminescence for 15 seconds. Dose-response curves for the candidate modulators are constructed using the area under the curve for each light signal peak. Data are analyzed with SLEDEWRITE, using the equation for a one-site ligand, and EC50 values are obtained.
  • Modulators that act as agonists at receptors which couple to the Gq subtype of G proteins give an increase in luminescence of up to 100 fold.
  • Modulators that act as inverse agonists will reverse this effect at receptors that are either constitutively active or activated by known agonists.
  • Luciferase Reporter Gene Assay The photoprotein luciferase provides another useful tool for identifying GP354 modulators.
  • Cells e.g., CHO cells or COS7 cells
  • a reporter construct which includes a gene for the luciferase protein downstream from a transcription factor binding site, such as the c AMP -response element (CRE), AP-1, or NF-kappa B.
  • CRE c AMP -response element
  • AP-1 NF-kappa B.
  • Expression levels of luciferase reflect the activation status of the signaling events. See generally, George et al, J. Biomol. Screening 2(4):235-240 (1997); and Strata wa et al, Curr. Opin. Biotechnol. 6:574-581 (1995).
  • Luciferase activity may be quantitatively measured using, e.g., luciferase assay reagents that are available
  • CHO cells are plated in 24-well culture plates at a density of 10 5 cells/well one day prior to transfection, and cultured at 37°C in MEM (Gibco/BRL) supplemented with 10%> fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
  • Cells are transiently co-transfected with a gp354 expression construct and a reporter construct containing the luciferase gene.
  • the reporter plasmid constructs CRE-luciferase, AP-1 -luciferase and NF-kappaB-luciferase may be purchased from Stratagene (LaJolla, CA). Transfections are performed using the FUGENE 6 transfection reagent (Boehringer-Mannheim) according to the supplier's instructions. Cells transfected with the reporter construct alone are used as a control.
  • the cells are washed once with PBS pre-warmed to 37°C. Serum-free MEM is then added to the cells either alone (control) or with one or more candidate modulators. The cells are then incubated at 37°C for five hours. Thereafter, the cells are washed once with ice-cold PBS and lysed by the addition of 100 ⁇ l of lysis buffer per well from the luciferase assay kit supplied by Promega.
  • CHO cells stably transfected with a gp354 expression vector are plated at a density of 4X10 4 cells/well in Packard black-walled, 96-well plates specially designed to discriminate fluorescence signals emanating from the various wells on the plate.
  • the cells are incubated for 60 minutes at 37°C in modified Dulbecco's PBS (D-PBS) containing 36 mg/L pyruvate and 1 g/L glucose with the addition of 1%> fetal bovine serum and one of four calcium indicator dyes (FLUO-3 AM, FLUO-4 AM, CALCIUM GREEN- 1 AM, or OREGON GREEN 488 BAPTA-1 AM), each at a concentration of 4 ⁇ M.
  • D-PBS modified Dulbecco's PBS
  • FLUO-3 AM, FLUO-4 AM, CALCIUM GREEN- 1 AM, or OREGON GREEN 488 BAPTA-1 AM each at a concentration of 4 ⁇ M.
  • Plates are washed once with modified D-PBS without 1% fetal bovine serum and incubated for 10 minutes at 37°C to remove residual dye from the cellular membrane.
  • a series of washes with modified D-PBS without 1% fetal bovine serum is performed immediately prior to activation of the calcium response.
  • a calcium response is initiated by the addition of one or more candidate receptor agonist compounds, calcium ionophore A23187 (10 ⁇ M; positive control), or ATP (4 ⁇ M; positive control). Fluorescence is measured by Molecular Device's FLEPR with an argon laser (excitation at 488 nm). See, e.g., Kuntzweiler et al, Drug Dev. Res. 44(l):14-20 (1998). The F-stop for the detector camera is set at 2.5 and the length of exposure is 0.4 milliseconds. Basal fluorescence of cells is measured for 20 seconds prior to addition of a candidate agonist, ATP, or A23187. The basal fluorescence level is subtracted from the response signal.
  • the calcium signal is measured for approximately 200 seconds, taking readings every two seconds.
  • Calcium ionophore A23187 and ATP typically increase the calcium signal about 200%> above baseline levels.
  • activated GP354s increase the calcium signal at least about 10-15%) above baseline signal.
  • a mitogenesis assay the ability of candidate modulators to induce or inhibit gp354-mediated cell division is determined. See, e.g., Lajiness et al., J. Pharmacol. Exp. Therap. 267(3):1573-1581 (1993).
  • CHO cells stably expressing GP354 are seeded into 96-well plates at a density of 5000 cells/well and grown at 37°C in MEM with 10% fetal calf serum for 48 hours, at which time the cells are rinsed twice with serum-free MEM.
  • MEM MEM containing a known mitogen
  • 20 ⁇ l MEM containing varying concentrations of one or more test compounds diluted in serum-free medium As controls, some wells on each plate receive serum-free medium alone, and some receive medium containing 10%> fetal bovine serum. Untransfected cells or cells transfected with vector alone also may serve as controls.
  • [ 3 H]-thymidine in serum- free test wells is compared to the results achieved in cells stimulated with serum (positive control).
  • Antagonists that bind to the receptor are expected to increase [ 3 H]-thymidine inco ⁇ oration into cells, showing up to 80%> of the response to serum. Antagonists that bind to the receptor will inhibit the stimulation seen with a known agonist by up to 100%.
  • G protein-coupled receptors signal through intracellular G proteins whose activities involve GTP binding and hydrolysis to yield bound GDP.
  • measurement of binding of the non-hydrolyzable GTP analog [ 35 S]GTPgS in the presence and absence of candidate modulators provides another assay for modulator activity. See, e.g., Kowal et al, Neuropharmacology 37:179-187 (1998).
  • cells stably transfected with a gp354 expression vector are grown in 10 cm tissue culture dishes to subconfluence, rinsed once with 5 ml of ice-cold Ca 2+ /Mg 2+ -free phosphate-buffered saline, and scraped into 5 ml of the same buffer.
  • Cells are pelleted by centrifugation (500 x g, 5 minutes), resuspended in TEE buffer (25 mM Tris, pH 7.5 , 5 mM EDTA, 5 mM EGTA), and frozen in liquid nitrogen. After thawing, the cells are homogenized using a Dounce homogenizer (1 ml TEE per plate of cells), and centrifuged at 1,000 x g for 5 minutes to remove nuclei and unbroken cells.
  • the homogenate supernatant is centrifuged at 20,000 x g for 20 minutes to isolate the membrane fraction, and the membrane pellet is washed once with TEE and resuspended in binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM MgC12, 1 mM EDTA).
  • binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM MgC12, 1 mM EDTA).
  • the resuspended membranes can be frozen in liquid nitrogen and stored at -70°C until use.
  • MAP Kinase Activity Assay Evaluation of MAP kinase activity in cells expressing GP354 provides another assay to identify modulators of GP354 activity. See, e.g., Lajiness et al, supra, and Boulton et al, Cell 65:663-675 (1991).
  • CHO cells stably transfected with gp354 are seeded into 6-well plates at a density of 7X10 4 cells/well 48 hours prior to the assay. During this 48 hour period, the cells are cultured at 37°C in MEM medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin. The cells are serum-starved for 1-2 hours prior to the addition of stimulants.
  • the cells are treated with medium alone or medium containing either a candidate agonist or 200 nM Phorbol ester- myristoyl acetate (i.e., PMA, a positive control), and the cells are incubated at 37°C for various amounts of time.
  • PMA Phorbol ester- myristoyl acetate
  • the plates are placed on ice, the medium is aspirated, and the cells are rinsed with 1 ml of ice-cold PBS containing 1 mM EDTA.
  • cell lysis buffer (12.5 mM MOPS, pH 7.3, 12.5 mM glycerophosphate, 7.5 mM MgCl 2 , 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM dithiothreitol, 10 ⁇ g/ml leupeptin, 10 ⁇ g/ml aprotinin, 2 ⁇ g/ml pepstatin A, and 1 ⁇ M okadaic acid) is added to the cells.
  • the cells are scraped from the plates and homogenized by 10 passages through a 23 3/4 G needle, and the cytosol fraction is prepared by centrifugation at 20,000 x g for 15 minutes.
  • the filter squares are washed in 4 changes of 1% H 3 PO 4 , and the squares are subjected to liquid scintillation spectroscopy to quantitate bound label.
  • Equivalent cytosolic extracts are incubated without MAPK substrate peptide, and the bound labels from these samples are subtracted from the matched samples with the substrate peptide. The cytosolic extract from each well is used as a separate point. Protein concentrations are determined by a dye binding protein assay (Bio-Rad Laboratories). Agonist activation of the receptor is expected to result in up to a five-fold increase in MAPK enzyme activity. This increase is blocked by antagonists.
  • GP354s may also potentiate arachidonic acid release in cells, providing yet another useful assay for modulators of GP354 activity. See, e.g., Kanterman et al, Mol. Pharmacol. 39:364-369 (1991).
  • CHO cells that are stably transfected with a GP354 expression vector are plated in 24-well plates at a density of 1.5X10 4 cells/well and grown in MEM medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin for 48 hours at 37°C before use.
  • Cells of each well are labeled by incubation with [ 3 H] -arachidonic acid (Amersham Co ⁇ ., 210 Ci/mmol) at 0.5 ⁇ Ci/ml in 1 ml MEM supplemented with 10 mM HEPES, pH 7.5, and 0.5% fatty-acid-free bovine serum albumin for 2 hours at 37°C.
  • the cells are then washed twice with 1 ml of the same buffer.
  • Candidate compounds are added in 1 ml of the same buffer, either alone or with 10 ⁇ M ATP, and the cells are incubated at 37°C for 30 minutes. Buffer alone and mock-transfected cells are used as controls.
  • CHO cells transfected with a GP354 expression vector are seeded into 12 mm capsule cups (Molecular Devices Co ⁇ .) at 4X10 5 cells/cup in MEM supplemented with 10%> fetal bovine serum, 2 mM L-glutamine, 10 U/ml penicillin, and 10 ⁇ g/ml streptomycin. The cells are incubated in this medium at 37°C in 5% CO2 for 24 hours.
  • Extracellular acidification rates are measured using a CYTOSENSOR MICROPHYSIOMETER (Molecular Devices Corp.).
  • the capsule cups are loaded into the sensor chambers of the MICROPHYSIOMETER and the chambers are perfused with running buffer (bicarbonate-free MEM supplemented with 4 mM L-glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl) at a flow rate of 100 ⁇ l/min.
  • running buffer bicarbonate-free MEM supplemented with 4 mM L-glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl
  • Candidate agonists or other agents are diluted into the running buffer and perfused through a second fluid path. During each 60-second pump cycle, the pump is run for 38 seconds and is off for the remaining 22 seconds.
  • the pH of the running buffer in the sensor chamber is recorded during the cycle from 43-58 seconds, and the pump is re-started at 60 seconds to start the next cycle.
  • the rate of acidification of the running buffer during the recording time is calculated by the Cytosoft program. Changes in the rate of acidification are calculated by subtracting the baseline value (the average of 4 rate measurements immediately before addition of a modulator candidate) from the highest rate measurement obtained after addition of a modulator candidate.
  • the selected instrument detects 61 mV/pH unit. Modulators that act as agonists of the receptor result in an increase in the rate of extracellular acidification compared to the rate in the absence of agonist. This response is blocked by modulators which act as antagonists of the receptor.
  • Example 13 Cloning of Other gp354 Genes or Fragments
  • PCR was performed essentially as described in Example 3, supra.
  • Oligonucleotides GX1-220 and GX1-221 were used for inter-exon PCR verification of the ab initio gp354 gene model.
  • GX1-386 and GX1-387 were used to amplify the full extent of the predicted portion of the gene.
  • GX1-218 and GX 1-221 were used to amplify and clone the mouse PanCAM orthologue.
  • GX3-238 and GX3-232 were used to amplify the full length PanCAM cDNA from a pancreas cDNA pool. Their sequences are as following:
  • GX1-218 ACTGGGGGCTAGTTCAGTGGACTAA (SEQ ED NO:16)
  • GX1-220 GCCAGCATGACCTCCACATTAG (SEQ ED NO:19)
  • GX1-221 CAGCCTCAGCTCTGCACACATAGTC (SEQ ED NO:20)
  • GX1-386 ATGCGGGTCCCCGCCCTCCTCGTCCT (SEQ ED NO:21)
  • GX1-387 CTTGGTCTCCAGAGTCCCTTCCTCCTC (SEQ LD NO:22)
  • GX3-232 GGAGGAGTAAGGTCGCCAACTTGTC (SEQ ED NO:23)
  • GX3-238 ACCTTGGGGGACGAATGCTC (SEQ LD NO:24) The PCR products were isolated and cloned as described in Example 3, supra.
  • the cloned GX1-220/GX1-221 PCR product was labeled by random hexamer extension using the protocol provided with the random hexamer kit (Invitrogen, Carlsbad, CA). The labeled fragment was used as a probe in
  • MTE Northern and multiple tissue expression
  • the Northern blot shows a diffused signal detected only in the pancreas, with a size in the range of 2.2-3.5 Kb.
  • Hybridization done with an array of 76 normal human tissues revealed a positive spot in the position of the pancreas RNA sample.
  • the entire 1,779 (including the stop codon) base pair predicted portion of the gene was amplified from a human pancreas cDNA pool by PCR, using primers GX1-386 and GX1-387 (supra) that encompassed the full length of the predicted open reading frame (Fig. 7).
  • primers GX1-386 and GX1-387 (supra) that encompassed the full length of the predicted open reading frame (Fig. 7).
  • GX1-238 and GX1-232, supra Two different cDNA clones were obtained. Both were smaller than AL136654 and were within the size range determined on the Northern blot.
  • the predicted protein encoded by the longest potential ORF of PanCAM is composed of 708 amino acid residues and contains a signal peptide, five Ig domains (three of them are C2 type), a trasmembrane domain, and a 174 amino acid intracellular domain. It is longer than the protein encoded by our original gene prediction on both the amino and carboxy termini.
  • NEPHl Human NEPHl (NP_ 060710) and mouse NEPHl proteins (NP_570937) are potential cell adhesion molecules that play critical roles in kidney development (Donoviel et al, Mol. Cell. Biol. 21(14):4829-36 (2001)).
  • NEPHl has 5 Ig domains, and the human protein is 44% identical to PanCAM in the extracellular domain, while the mouse protein is 47%> identical to PanCAM in the extracellular domain.
  • the second most similar BLASTP score is for human nephrin
  • NPHS1, NP_004637 which shares 33%> identity with GP354 in the extracellular domain.
  • This protein contains eight Ig domains and is localized to the glomerula slit diaphragm.
  • Nepgrin is believed to play a role in cell adhesion and to be involved in the development of glomeruli of kidney (Ruotsalainen et al, Proc. Natl. Acad. Sci. USA 96:7962-7967 (1999); Kestila et al, Mol Cell l(4):575-82 (1998)). Mutations in the nephrin gene cause congenital nephritis in humans (Kestila et al, supra).
  • the Drosophila irregular chiasm C roughest precursor (irre, NP_525058) is another homologous protein. Irre is a cell adhesion protein required for development of compound eyes (Ramos et al, Genes Dev.
  • This protein contains 5 C2 type Ig domains, and shares 31%> identity with PanCAM. Mutations at the Irre locus in Drosophila affect sensory organ development in the fly, apparently due at least in part to abnormal apoptotic activity (Ramos et al, supra). NEPHl, nephrin and Irre are involved in developmental patterning and cell-cell communication. The similarity between GP354 and these proteins suggests that GP354 also plays a role in similar developmental pathways and, in particular, cell-cell interactions which trigger signal transduction pathways involved in organ and tissue development and/or maintenance in the pancreas and nervous system.
  • pancreas cDNA clones differ from one another in the extracellular domain, but have identical transmembrane and intracellular domains.
  • the shorter cDNA clone (PanCAM-2) from pancreas encodes a protein that is missing part of Ig domain 1, due to splicing out of exon 2 (Fig. 9B).
  • the intracellular domains of the two pancreas cDNA clones are shorter than that of the other inferred protein sequences (Fig. 9 A) due to splicing out part of the last exon.
  • Example 16 Cloning a partial cDNA of mouse PanCAM
  • oligonucleotide pairs were designed based on the human gene sequence, and tested by PCR on cDNA pools from multiple mouse tissues.
  • One oligonucleotide pair generated a faint band from a mouse brain cDNA pool.
  • This PCR product was cloned and sequenced.
  • the mouse cDNA clone (SEQ ED NO:32) was 934 nucleotides in length, and the encoded protein is 85% identical to the human counte ⁇ art (Figs. 10A-B).
  • Example 17 PanCAM is Beta Cell Specific in the Pancreas
  • a soluble form of the extracellular domain was used in a screen for phage antibodies.
  • Four human Fab fragments against extracellular portion of this protein were screened out from a phage antibody library (Knappik et al, J. Mol. Biol. 296(l):57-86 (2000). All of these Fabs recognized the recombinant protein on Western blot. Three of them recognized PanCAM on paraffin-fixed tissue slides.
  • EHC Immunohistochemical staining was performed on slides containing human heart, brain, kidney, liver, lung, pancreas, spleen and muscle tissues, and on pancreas tissue from monkey (Cynomolqous) and mouse. Among the human tissues tested, only the pancreas showed staining. The results clearly showed that the gene was expressed specifically in pancreatic islets of human, monkey and mouse.
  • the mouse anterior pituitary was also positive for EHC, with somewhat weaker and scattered staining.
  • the pituitary staining explained the appearance of EST clones in brain libraries, as well as our ability to clone the mouse ortholog from brain cDNA.
  • pancreata from NOD mice at ages of 4, 8, and 12 weeks, as well as retired breeders (animals with fully developed diabetes) were examined by EHC.
  • the staining pattern was the same as in wild type mice, with the majority of cells in pancreatic islets being positive for PanCAM.
  • T cell invasion of islets was seen, and the number of PanCAM-positive cells started to diminish.
  • most of PanCAM- positive cells were lost, and T cells were observed where the islets used to be. The results demonstrated that overall expression of PanCAM was correlated with the development of diabetes in the NOD mice.
  • Example 19 Isolation of Beta Cells Using Anti-PanCAM Antibodies

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Psychology (AREA)
  • Emergency Medicine (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un polynucléotide isolé codant pour un nouveau membre de la superfamille des immunoglobulines appelé PanCAM (également appelé GP354). PanCAM comprend un domaine transmembranaire unique prédit et cinq domaines de type immunoglobuline (Ig) dans la partie extracellulaire de la protéine. La structure protéique et la répartition tissulaire de PanCAM indiquent que cette dernière joue un rôle dans les événements de reconnaissance, de liaison, de signalisation et d'adhérence entre cellules, dans le pancréas (en particulier dans les îlots bêta), l'hypophyse, et le système nerveux central (SNC). L'invention concerne également des polynucléotides et des polypeptides isolés apparentés à PanCAM, des vecteurs et des cellules hôtes comprenant l'un de ceux-ci, des anticorps dirigés contre PanCAM, des cellules produisant de tels anticorps, et des méthodes diagnostiques et thérapeutiques connexes.
EP02756316A 2001-06-22 2002-06-24 Acides nucleiques et polypeptides pancam Withdrawn EP1409523A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
PCT/US2001/019904 WO2001098360A2 (fr) 2000-06-22 2001-06-22 Acides nucleiques et polypeptides de gp354
WOPCT/US01/19904 2001-06-22
PCT/US2002/020275 WO2003000021A2 (fr) 2001-06-22 2002-06-24 Acides nucleiques et polypeptides pancam

Publications (2)

Publication Number Publication Date
EP1409523A2 true EP1409523A2 (fr) 2004-04-21
EP1409523A4 EP1409523A4 (fr) 2005-06-15

Family

ID=21742663

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02756316A Withdrawn EP1409523A4 (fr) 2001-06-22 2002-06-24 Acides nucleiques et polypeptides pancam

Country Status (5)

Country Link
EP (1) EP1409523A4 (fr)
JP (1) JP4224395B2 (fr)
AU (1) AU2002322331B2 (fr)
CA (2) CA2459985A1 (fr)
WO (1) WO2003000021A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007127476A2 (fr) * 2006-04-28 2007-11-08 Oregon Health & Science University Anticorps monoclonaux et leur utilisation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996025497A1 (fr) * 1995-02-17 1996-08-22 Incyte Pharmaceuticals, Inc. Nouvelles chemokines exprimees dans le pancreas
WO1998036062A1 (fr) * 1997-02-13 1998-08-20 Smithkline Beecham Plc Variantes d'epissage de molecule d'adherence cellulaire neuronale
WO2001068848A2 (fr) * 2000-03-01 2001-09-20 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques codant pour ces polypeptides

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996025497A1 (fr) * 1995-02-17 1996-08-22 Incyte Pharmaceuticals, Inc. Nouvelles chemokines exprimees dans le pancreas
WO1998036062A1 (fr) * 1997-02-13 1998-08-20 Smithkline Beecham Plc Variantes d'epissage de molecule d'adherence cellulaire neuronale
WO2001068848A2 (fr) * 2000-03-01 2001-09-20 Genentech, Inc. Polypeptides secretes et transmembranaires et acides nucleiques codant pour ces polypeptides

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] EBI, Hinxton, UK; 11 June 1997 (1997-06-11), LAMERDIN J E ET AL: "Sequence analysis of a 1 Mb region in 19q13.1" XP002212520 Database accession no. AC002133 *
DATABASE EMBL [Online] EBI, Hinxton, UK; 31 January 2000 (2000-01-31), ABOLA A P ET AL: "Homo sapiens chromosome 19 clone RP11-38C1" XP002212519 Database accession no. AC022315 *
DATABASE EMBL [Online] EBI, Hinxton, UK; 5 January 2001 (2001-01-05), DUESTERHOEFT A ET AL: "Homo sapiens mRNA" XP002212521 Database accession no. AL136654 *
RAMOS RICARDO G P ET AL: "The Irregular chiasm C-roughest locus of Drosophila, which affects axonal projections and programmed cell death, encodes a novel immunoglobulin-like protein." GENES & DEVELOPMENT, vol. 7, no. 12B, 1993, pages 2533-2547, XP008007783 ISSN: 0890-9369 *
See also references of WO03000021A2 *
VAN SCHILFGAARDE R ET AL: "Factors influencing the properties and performance of microcapsules for immunoprotection of pancreatic islets." JOURNAL OF MOLECULAR MEDICINE (BERLIN, GERMANY) JAN 1999, vol. 77, no. 1, January 1999 (1999-01), pages 199-205, XP002311896 ISSN: 0946-2716 *

Also Published As

Publication number Publication date
JP4224395B2 (ja) 2009-02-12
JP2005508147A (ja) 2005-03-31
EP1409523A4 (fr) 2005-06-15
WO2003000021A3 (fr) 2003-11-20
WO2003000021A2 (fr) 2003-01-03
CA2451271A1 (fr) 2003-01-03
CA2459985A1 (fr) 2003-01-03
AU2002322331B2 (en) 2008-01-03

Similar Documents

Publication Publication Date Title
US20030211517A1 (en) Gp354 nucleic acids and polypeptides
EP1173456A1 (fr) Proteines secretees et acides nucleiques codant pour elles
JPH10511936A (ja) ヒトソマトスタチン様受容体
US20030165495A1 (en) Nucleic acids and polypeptides
AU761425B2 (en) Cadherin-like asymmetry protein-1, and methods for its use
AU2001270058B2 (en) GP354 nucleic acids and polypeptides
AU2001272982B2 (en) GP286 nucleic acids and polypeptides
AU2002322331B2 (en) Pancam nucleic acids and polypeptides
WO2001062928A2 (fr) Polypeptides et acides nucleiques codant pour
AU2001270058A2 (en) GP354 nucleic acids and polypeptides
AU2001270058A1 (en) GP354 nucleic acids and polypeptides
WO2000052039A2 (fr) Materiaux de lectomedine et procedes
AU2002322331A1 (en) Pancam nucleic acids and polypeptides
AU2001272982A1 (en) GP286 nucleic acids and polypeptides
NZ530696A (en) Pancam nucleic acids and polypeptides
JP2002516079A (ja) 新規分泌型および膜会合型タンパク質ならびにそのための用途
WO1999045111A1 (fr) Materiaux de lectomedines et procedes associes
US20020146807A1 (en) Novel polypeptides and nucleic acids encoding same
US20030017585A1 (en) Novel sodium/solute symporter-like protein and nucleic acids encoding same
WO2001051632A2 (fr) Nouveaux polypeptides et acides nucleiques codant pour ceux-ci
JP2002529053A (ja) Ｌｄｌ関連タンパク質およびその使用
JP2002112784A (ja) 抗リン脂質抗体症候群治療用ｔ細胞レセプター可変領域
GB2380478A (en) Human RALGDS-like protein 3
WO2001057087A2 (fr) Nouvelle proteine du type sous-unite beta de recepteur de haute affinite pour l'immunoglobuline epsilon (fceb) et acides nucleiques codant pour celle-ci

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040120

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 61K 48/00 B

Ipc: 7G 01N 33/53 B

Ipc: 7C 12Q 1/68 B

Ipc: 7C 12N 15/74 B

Ipc: 7C 12N 5/02 B

Ipc: 7C 12P 21/06 B

Ipc: 7C 07H 21/04 B

Ipc: 7C 07K 16/28 B

Ipc: 7C 07K 16/46 B

Ipc: 7C 07K 14/00 A

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GARDNER, HUMPHREY, ATHELSTAN, ROY

Inventor name: KILBURN, DANIEL, R.

Inventor name: LUKASHIN, ALEXANDER, V.

Inventor name: CARULLI, JOHN, P.

Inventor name: SUN, CHAO

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 61K 39/395 B

Ipc: 7A 61K 38/17 B

Ipc: 7A 61K 31/7088 B

Ipc: 7G 01N 33/50 B

Ipc: 7C 12Q 1/68 B

Ipc: 7C 07K 16/28 B

Ipc: 7C 07K 14/705 B

Ipc: 7C 12N 15/12 A

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1067370

Country of ref document: HK

A4 Supplementary search report drawn up and despatched

Effective date: 20050428

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BIOGEN IDEC MA INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090930

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1067370

Country of ref document: HK