EP1385873A2 - A ligand for enhancing oral and cns delivery of biological agents - Google Patents
A ligand for enhancing oral and cns delivery of biological agentsInfo
- Publication number
- EP1385873A2 EP1385873A2 EP01934229A EP01934229A EP1385873A2 EP 1385873 A2 EP1385873 A2 EP 1385873A2 EP 01934229 A EP01934229 A EP 01934229A EP 01934229 A EP01934229 A EP 01934229A EP 1385873 A2 EP1385873 A2 EP 1385873A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- derivative
- amino acid
- peptide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention generally relates to a composition comprising a peptide or analog or derivative thereof (Ligand) that is capable of enhancing oral and CNS bioavailability of therapeutics. More particularly, the present invention involves compositions comprised of a Ligand, or a complex of a Ligand with a carrier, which is associated with a biological agent.
- Ligand a peptide or analog or derivative thereof
- Bioavailability represents both the quantity of a biological agent, e. the active component, absorbed from a pharmaceutical composition that is absorbed into blood and circulated, and the rate of this absorption. This implies that the molecule crosses one or several biological membranes before reaching the blood circulation. It has been generally considered that the physico-chemical properties of an orally administered drug determine its bioavailability. Among these parameters are the molecular weight (very low permeability is known for therapeutics with molecular weight more than
- the quantity of drug reaching the general circulation depends on the drug quantity absorbed by the intestinal epithelium, and drug solubility and stability in the gastrointestinal tract. Many classes of drugs present a large inter-individual variability in their absorption and/or a low bioavailability.
- Cytotoxic drugs used in anticancer therapy are a good example of drugs that are often poorly absorbed.
- Therapeutic peptides and proteins have also very low bioavailability by the oral route because they are easily metabolized in the stomach and intestine. In addition to problems related to degradation, the molecular weights of such peptides and proteins are typically too high to allow for significant transport across the gut wall into the circulatory system.
- the present invention provides a polypeptide comprising at least one peptide or derivative thereof, wherein the polypeptide or derivative thereof is capable of crossing the small intestine and blood brain barrier.
- a polypeptide is herein referred to as Ligand.
- the present invention provides a peptide or derivative thereof that capable of is crossing the small intestine and blood brain barrier.
- polypeptide of the present invention comprising at least one peptide or derivative thereof, wherein the polypeptide or derivative thereof is capable of delivering biological agents across the small intestine and blood brain barrier.
- a preferred peptide of the present invention provides the amino acid sequence of Arg-Val-Leu-Asp- Gly-Asp-Arg-Thr-Arg-Trp-Gly (SEQ. ID. NO.:4) wherein the peptide is capable of crossing the small intestine and blood brain barrier and delivering biological agents across the small intestine and blood brain barrier.
- the present invention further provides a polypeptide, wherein the polypeptide or derivative thereof comprise the amino acid sequence of SEQ. ID. Nos.: 1, 2, 3, 4, 5, 6, or 7.
- a preferred peptide, variant or derivative of peptide of the present invention has the sequence Arg-Val-X-Asp- X-Asp-X-Thr (SEQ. ID. NO.:7) (also abbreviated in single letter amino acid code as R V X D X D X T), where X is any amino acid).
- Another embodiment of the present invention provides at least one peptide compound having the motif SEQ. ID. NO.:6: where Yi is positively charged amino acid such as Arg or Lys Y 2 is Val, Leu, lie or Met
- Y 3 is negatively charged amino acid such as Glu or Asp Y 4 is negatively charged amino acid such as of Glu or Asp Y 5 is Thr or Ser X is any amino acid.
- the polypeptide of the present invention further provides an extension at the carboxyl termini of polypeptide or derivative thereof wherein the carboxyl termini amino acid of the polypeptide or derivative thereof is bound to the C-terminal carboxyl group of the peptide.
- One embodiment of the present invention provides a pharmaceutical composition comprising the amino acid sequence of SEQ. ID. Nos.: 2, 3, or 5 wherein the carboxyl termini of alanine of said SEQ. ID. Nos.: 2, 3, or 5 is bound to carboxytetramethylrodamine.
- the present invention also provides analogs of the polypeptide which can comprise in its molecular structure residues being derivatives of compounds other than amino acids, referenced herein as “peptide mimetics” or “peptidomimetics".
- Other analogs of peptide Ligand are compounds having changed topology of its chain, in particular nonlinear compounds which have chemical bonds that close cycle or cycles in the molecule and constraint its structure.
- Other analogs of a Ligand of the present invention include peptides with an altered sequence comprising another selection of L- -amino acid residues, D- ⁇ -amino acid residues, non- ⁇ -amino acid residues.
- the peptide Ligand of the present invention can be made by using well-known methods including recombinant methods and chemical synthesis. Recombinant methods of producing a peptide through the introduction of a vector including nucleic acid encoding the peptide into a suitable host cell is well known art, such as in described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed, Vols. 1 to 8, Cold Spring Harbor, New York (1989), which is herein incorporated by reference. A linear amino acid sequence is synthesized, for example, by the solid phase peptide synthesis of Merrifield (Merrifield et al., J. Am. Chem. Soc, 85:2149 (1964), which is incorporated herein by reference).
- a Ligand of the present invention can be synthesized using standard solution methods well known in the art (see, for example, Bodanszky, M., Principles of Peptide Synthesis (Springer-Verlag, 1984)), which is herein incorporated by reference).
- Newly synthesized Ligands of the present invention can be readily purified, for example, by high performance liquid chromatography (HPLC), and can be characterized using, for example, mass spectrometry or amino acid sequence analysis. Although a purity of greater than 95 percent for the synthesized peptide is preferred, lower purity is acceptable.
- the polypeptide of the present invention provides that derivatives of SEQ. ID. NO.:4 comprise of oligopeptides, chemical derivatives or peptidomimetic that are capable of crossing the small intestine and blood brain barrier and delivering biological agents across the small intestine and blood brain barrier.
- the Ligand is associated with a biological agent.
- Such an association can be achieved by chemical, genetic or physical linking of the Ligand and the biological agent, or by mixing the above components, or by heir co-administration.
- the peptide, derivative or peptidomimetic of this invention has one or more of the following activities:
- the present invention provides a polypeptide comprising at least one peptide or derivative thereof, wherein the polypeptide or derivative thereof is capable of crossing the small intestine and blood brain barrier and delivering biological agents across the small intestine and blood brain barrier, wherein the polypeptide or derivative thereof which has at least about 20% of the biological activity of the polypeptide or derivative thereof of SEQ. I. NO.:4.
- the present invention provides a polypeptide comprising at least one peptide or derivative thereof, wherein the polypeptide or derivative thereof has an oral therapeutic efficiency index of at least 0.0005, or a blood brain partitioning index of at least 1.
- the biological activity of the present polypeptide can be measured by but is not limited to using in vitro bioassays comprising transport across Caco2 cells; transport across in vitro models of blood brain barrier, in vivo oral bioavailability analysis; or in vivo central nervous system bioavailability analysis.
- the invention further includes a polypeptide comprising one or more Ligands in association with a carrier.
- the Ligand is association with a protein, virus, polymer or any other carrier to improve pharmacological properties of the Ligand to increase selectivity and efficacy the Ligand to of deliver biological agents across blood brain barriers.
- the association of the ligand and the carrier can be achieved by chemical, genetic or physical linking of the Ligand and the carrier, or by mixing the above components, or by their co-administration.
- the Ligand associated with the carrier is further associated with a biological agent which is achieved by chemical, genetic or physical linking of the Ligand-carrier composition described in the previous embodiment of the invention and a biological agent.
- the invention further provides a pharmaceutical composition comprising one or more Ligands or their complex with a carrier in association with a biological agent.
- the Ligand is associated with a modified biological agent, which is achieved by chemical linking of the Ligand to the modified biological agent, such an associate being a prodrug and revealing no activity of the biological agent.
- the active biological agent is released from such an associate upon action of chemical or enzymatic reaction in the body.
- the present invention extends to a polypeptide comprising at least one Ligand of the present invention that is capable of enhancing oral and CNS bioavailability of therapeutic compounds.
- the invention further includes a polypeptide comprising one or more Ligands of the present invention in association with a carrier.
- the present invention extends to polypeptide for diagnostics and treatment of disease, where such diseases are associated with central nervous system (CNS) pathologies.
- CNS central nervous system
- the invention is further directed to a polypeptide useful for diagnostics and treatment of CNS pathologies, comprising (a) any of the above peptides, variants or chemical derivatives including, but not limited to peptidomimetics; (b) a pharmaceutically acceptable carrier or excipient, either chemically conjugated or physically associated with the Ligand; and (c) at least one therapeutic agent.
- the present invention further provides a polypeptide useful for diagnostics or treatment of CNS pathologies, comprising any of the above peptides, variants or chemical derivatives including a peptidomimetics conjugated chemically or genetically fused to a therapeutic agent.
- the present invention also provides a method of treating a disease associated with CNS pathologies in s patient in need of such therapy comprising administering to said patient an effective amount of the pharmaceutical composition of the present invention and a pharmaceutical acceptable carrier.
- the present invention provides a pharmaceutical composition comprising a Ligand that is capable of enhancing oral and CNS bioavailability of biological agents or formulations.
- the present invention also provides pharmaceutical compositions in which the Ligand is used as a targeting moiety to improve the delivery of a biological agent used to therapeutic or diagnostic purpose.
- Ligand of the present invention is effected by means of one of the known organic chemical methods for peptide synthesis, or with the aid of recombinant DNA techniques.
- the organic chemical methods for peptide synthesis are considered to include the coupling of amino acid residues by means of a condensation reaction, either in homogeneous phase or with the aid of a solid phase.
- the condensation reaction can be carried out as follows: a) condensation of a compound (amino acid, peptide) with a free carboxyl group and protected other reactive groups with a compound (amino acid, peptide) with a free amino group and protected other reactive groups, in the presence of a condensation agent;
- Activation of the carboxyl group can take place, inter alia, by converting the carboxyl group to an acid halide, azide, anhydride, imidazolide or an activated ester, such as the N-hydroxy-succinimide, N- hydroxy-benzotriazole or p-nitrophenyl ester.
- the most common methods for the above condensation reactions are: the carbodiimide method, the azide method, the mixed anhydride method and the method using activated esters, such as described in The Peptides, Analysis, Synthesis, Biology Vol. 1-3 (Ed. Gross, E. and Meienhofer, J.) 1979, 1980, 1981 (Academic Press, Inc.).
- a particularly useful method is the Castro type method using benzotriazole-1-yl-oxy-uronium, or -phoshponium esters, e ⁇ .
- PyBOP benzotriazole-1-yl-oxy- tris-pyrrolidino-phosphonium hexafluorophosphate
- Preparation of a Ligand of the present invention using the "solid phase” is for instance described in /. Amer. Chem. Soc. 85, 2149 (1963) and Int. J. Peptide Protein Res. 35, 161-214 (1990).
- the coupling of the amino acids of a peptide to be prepared usually starts from the carboxyl end side.
- a solid phase is needed on which there are reactive groups or on which such groups can be introduced.
- This can be, for example, a copolymer of benzene and divinylbenzene with reactive chloromethyl groups, or a polymeric solid phase rendered reactive with hydroxymethyl or amine function.
- detaching the peptide from the resin follows. For example, contacting the resin with hydrogen fluoride with trifluoromethanesulphonic acid, or with methanesulphonic acid dissolved in trifluoroacetic acid will detach the peptide from the resin.
- the peptide can also be removed from the carrier by transesterification with a lower alcohol, preferably methanol or ethanol, in which case a lower alkyl ester of the peptide is formed directly.
- splitting with the aid of ammonia gives the amide of a peptide according to the invention.
- a particularly suitable solid phase is, for example, the Rink Amide resin (4-(2',4'-Dimethoxyphenyl- Fmoc-aminomethyl)-phenoxy-copolystrene-l% divinylbenzene resin), described by Rink (1987) Tetrahedron Lett., 28, 3787.
- the peptide can be split from the solid phase under mild conditions using trifluoroacetic acid producing a carboxyamide derivative.
- the reactive groups which may not participate in the condensation reaction, are, as stated, effectively protected by groups, which can be removed again very easily by hydrolysis with the aid of acid, base or reduction.
- a carboxyl group can be effectively protected by, for example, esterification with methanol, ethanol, tertiary butanol, benzyl alcohol or p-nitrobenzyl alcohol and amines linked to solid support.
- Groups that can effectively protect an amino group are the ethoxycarbonyl, benzyloxycarbonyl, t- butoxy-carbonyl (t-boc) or p-methoxy-benzyloxycarbonyl group, or an acid group derived from a sulphonic acid, such as the benzene-sulphonyl or p-toluenesulphonyl group.
- Other groups can also be used, such as substituted or unsubstituted aryl or arylalkyl groups, e ⁇ , benzyl and triphenylmethyl, or groups such as orthonitrophenyl-sulphenyl and 2-benzoyl-l -methyl-vinyl.
- a particularly suitable ⁇ -amino-protective group is, for example, the base-sensitive 9-fluorenyl-methoxycarbonyl (Fmoc) group (Carpino & Han (1970) /. Amer. Chem. Soc. 92, 5748).
- Fmoc base-sensitive 9-fluorenyl-methoxycarbonyl
- a more extensive account of possible protecting groups can be found in The Peptides, Analysis, Synthesis, Biology, Vol.1-9 (Eds. Gross, Udenfriend and Meienhofer) 1979-1987 (Academic Press, Inc.).
- Customary protective groups in this connection are a Boc group for lysine and a Pmc, Pms, Mbs, or Mtr group for arginine.
- the protective groups can be split off by various conventional methods, depending on the nature of the particular group, for example with the aid of trifluoroacetic acid or by mild reduction, for example with hydrogen and a catalyst, such as palladium, or with HBr in glacial acetic acid.
- Ligands of the present invention can be prepared by any technique, including by well-known recombinant methods. The above techniques are more fully described in laboratory manuals such as "Molecular Cloning: A Laboratory Manual”, Second Edition by Sambrook et al., Cold Spring Harbor Press, 1989; “Current Protocols in Molecular Biology", Volumes I-M, Ausubel, R. M., ed., 1994; “Cell Biology: A Laboratory Handbook”, Volumes I-III, J. E. Celis, ed., 1994; “Current Protocols in Immunology", Volumes I- III, Coligan, J. E., ed., 1994; "Oligonucleotide Synthesis", M. J.
- DNA encoding a Ligand of the present invention can be prepared by a variety of methods known in the art. These methods include, but are not limited to, chemical synthesis by any of the methods described in Engels et al., Agnew. Chem. Int. Ed. Engl., 28: 716-734 (1989), the entire disclosure of which is incorporated herein by reference, such as the triester, phosphite, phosphoramidite and H-phosphonate methods. In one embodiment, codons preferred by the expression host cell are used in the design DNA that encodes a Ligand of the present invention.
- One example of a method of producing a Ligand using recombinant DNA techniques entails die steps of (1) synthetically generating DNA oligonucleotide that encodes a Ligand, appropriated linkers and restriction sites coding sequences (2) inserting the DNA into an appropriate vector such as an expression vector such that the DNA is operably linked with a promoter, (3) inserting the vector into a microorganism or other expression system capable of expressing the DNA, and (7) isolating the recombinantly Ligand.
- a Ligand of the present invention can also be produced in various cell systems, both prokaryotic and eukaryotic, all of which are within the scope of the present invention.
- the appropriate vectors include viral, bacterial and eukaryotic expression vectors.
- a nucleic acid molecule, such as DNA, is said to be "capable of expressing" a Ligand of the present invention if it contains nucleotide sequences that contain transcriptional and translational regulatory information and such sequences are "operably linked" to nucleotide sequences which encode the polypeptide.
- regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation.
- promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation.
- Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
- the entire coding sequence of a DNA molecule that encodes a Ligand of the present invention may be combined with one or more of the following in an appropriate expression vector to allow for such expression: (1) an exogenous promoter sequence (2) a ribosome binding site (3) carrier protein (4) a polyadenylation signal (4) a secretion signal.
- Modifications can be made in the 5 '-untranslated and 3'- untranslated sequences to improve expression in a prokaryotic or eukaryotic cell; or codons may be modified such that while they encode an identical amino acid, that codon may be a preferred codon in the chosen expression system. The use of such preferred codons is described in, for example, Grantham et al., Nuc.
- the DNA can be altered in numerous ways as described to produce analogs, derivatives or variants of a peptide comprising an amino acid sequence of SEQ. ID. NO.:l, which are themselves Ligands of the present invention.
- a Ligand of the present invention can be expressed as a fusion protein in which the Ligand is fused at its N-terminus or its C-terminus, or at both termini, to one or more of peptide copies.
- the fusion protein is specifically cleavable such that at least a substantial portion of Ligand can be proteolytically cleaved away from the fusion protein to yield the Ligand.
- Such a fusion protein can be designed with cleavage sites recognized by chemical or enzymatic proteases.
- the fusion protein is designed with a unique cleavage site (or sites) for removal of the Ligand sequence, e.
- the fusion protein is designed such that a given protease (or proteases) cleaves away the Ligand but does not cleave at any site within the Ligand, and thus avoids fragmentation of the Ligand.
- the cleavage site (or sites) at the fusion joint (or joints) is designed such that cleavage of the fusion protein with a given enzyme liberates the authentic, intact sequence of the Ligand from the remainder of the fusion protein sequence.
- the pTrcHisA vector (Invitrogen) and other like vectors can be used to obtain high-level, regulated transcription from the trc promoter for enhanced translation efficiency of a fusion protein comprising a Ligand of the present invention in E. coli.
- a Ligand of the present invention can also be expressed fused to an N-terminal nickel-binding poly-histidine tail for one-step purification using metal affinity resins.
- the enterokinase cleavage recognition site in the fusion protein allows for subsequent removal of the N-terminal histidine fusion protein from the purified Ligand.
- the Ligand fusion protein can be produced using appropriated carrier protein, for example, ⁇ -galactosidase, green fluorescent protein, luciferase, dehydrofolate reductase, thireodoxin, protein A Staphylococcus aureus and glutathione S- transferase. These examples are, of course, intended to be illustrative rather than limiting.
- a Ligand of present invention can also be synthesized as a fusion protein with a virus coat protein, and expressed on the surface of virus particle, for example bacteriophage M13, T 7, T4 and lambda, gamma.gtlO, gamma.gtll and the like; adenovirus, retrovirus and pMAM-neo, pKRC and the like.
- prokaryote expression vectors contain replication and control sequences, which are derived from species compatible with the host cell.
- the vector ordinarily carries a replication site, as well as sequences that encode proteins capable of providing phenotypic selection in transformed cells.
- vectors include pBR322 (ATCC No. 37,017), phGH107 (ATCC No. 40,011), pBO475, pS0132, pRIT5, any vector in the pRTT20 or pRIT30 series (Nilsson and Abrah sen, Meth.
- Eukaryotic pWLneo, pSV2cat, pOG44, pXTl, pSG (Stratagene) pSVK3, PBPV, pMSG, pSVL (Pharmacia) are suitable for expression in prokaryotic hosts.
- Such plasmids are, for example, disclosed by Sambrook (cf. "Molecular Cloning: A Laboratory Manual", second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)).
- Bacillus plasmids include pC194, pC221, pT127, and the like.
- Streptomyces plasmids are disclosed by Gryczan (hi: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329).
- Suitable Streptomyces plasmids include plJlOl (Kendall et al., J. Bacteriol. 169:4177-4183 (1987)), and streptomyces bacteriophages such as .phi.C31 (Chater et al.. In: Sixth International Symposium on Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp.45-54).
- Pseudomonas plasmids are reviewed by ohn et al. (Rev. Infect. Dis. 8:693-704(1986)), and Izaki (Jpn. J. Bacteriol.33:729-742(1978)).
- Prokaryotic host cells containing the expression vectors that encode for a Ligand of the present invention include E. coli K12 strain 294 (ATCC NO. 31446), E coli strain JM101 (Messing et al., Nucl. Acid Res., 9: 309 (1981)), E. coli strain B, E. coli strain .sub..chi. 1776 (ATCC No. 31537), E. coli c600 (Appleyard, Genetics, 39: 440 (1954)), E. coli W3110 (F-, gamma-, prototrophic, ATCC No. 27325), E.
- E. coli strain 27C7 W3110, tonA, phoA E15, (argF-lac)169, ptr3, degP41, ompT, kan.sup.r
- Bacillus subtilis Bacillus subtilis
- Salmonella typhimurium Salmonella typhimurium
- Serratia marcesans and Pseudomonas species.
- E. coli K12 strain MM 294 (ATCC No. 31,446) is particularly useful.
- Other microbial strains that may be used include E. coli strains such as E. coli B and E. coli X1776 (ATCC No. 31,537). These examples are, of course, intended to be illustrative rather than limiting.
- a Ligand of the present invention in a prokaryotic cell, it is necessary to operably link the Ligand-encoding DNA to a functional prokaryotic promoter.
- Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or derepressible).
- constitutive promoters include the int promoter of bacteriophage .lambda., the bla promoter of the .beta.-lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
- inducible prokaryotic promoters examples include the major right and left promoters of bacteriophage .lambda. (P.sub.L and P.sub.R), the tip, recA, .lambda.acZ, .lambda.acl, and gal promoters of E. coli, the alpha. -amylase (Ulmanen et al., J. Bacteriol. 162:176-182(1985)) and the .zeta.-28-specific promoters of B. subtilis (Gilman et al.
- ribosome binding site upstream of the gene sequence-encoding sequence.
- ribosome binding sites are disclosed, for example, by Gold et al. Ann. Rev. Microbiol. 35:365-404 (1981).
- the ribosome binding site and other sequences required for translation initiation are operably linked to the nucleic acid molecule encoding peptides of invention. Translation in bacterial system is initiated at the codon that encodes the first methionine.
- eukaryotic organisms such as yeasts, or cells derived from multicellular organisms can be used as host cells.
- Saccharomyces cerevisiae or common baker's yeast, is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available.
- the plasmid YRp7 for example (Stinchcomb et al.. Nature 282, 39, 1979; Kingsman et al.. Gene 7, 141 (1979); Tschemper et al.. Gene 10: 157 (1980.), is commonly used.
- This plasmid already contains the trpl gene that provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44,076 or PEP4-1 (Jones, Genetics, 85, 12 ,1977.).
- the presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
- Suitable promoting sequences in yeast vectors include the promoters for 3- phosphoglycerate kinase (Hitzeman et al., /. Biol. Chem. 255, 2073 (1980)) or other glycolytic enzymes (Hess et al., . Adv.
- the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.
- Other promoters which have the additional advantage of transcription controlled by growth conditions, are the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3 -phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
- Any plasmid vector containing yeast-compatible promoter, origin of replication and termination sequences is suitable.
- plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences.
- Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used. Rubin, Science 240:1453-1459 (1988).
- a Ligand of present invention can be produced in vertebrate host cells.
- the propagation of vertebrate cells in culture has become a routine procedure in recent years (Tissue Culture, Academic Press, Kruse and Patterson, editors (1973).
- useful mammalian host cells include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., /. Gen Virol, 36: 59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci.
- mice Sertoli cells TM4, Mather, Biol. Reprod., 23: 243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL- 1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al.. Annals N.Y. Acad.
- useful vectors include, but not limited vectors derived from SV40, vectors derived from cytomegalovirus such as the pRK vectors, including pRK5 and pRK7 (Suva et al., Science, 237: 893-896 (1987), EP 307,247 (Mar. 15, 1989), EP 278,776 (Aug. 17, 1988)) vectors derived from vaccinia viruses or other pox viruses, and retroviral vectors such as vectors derived from Moloney's murine leukemia virus (MoMLV).
- pRK vectors including pRK5 and pRK7 (Suva et al., Science, 237: 893-896 (1987), EP 307,247 (Mar. 15, 1989), EP 278,776 (Aug. 17, 1988) vectors derived from vaccinia viruses or other pox viruses
- retroviral vectors such as vectors derived from Moloney's murine leukemia virus (Mo
- eukaryotic regulatory regions Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
- Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al., J. Mol. Appl. Gen.
- An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient. Satisfactory amounts of protein are produced by cell cultures; however, refinements, using a secondary coding sequence, serve to enhance production levels even further.
- an exogenous origin such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient. Satisfactory amounts of protein are produced by cell cultures; however, refinements, using a secondary coding sequence, serve to enhance production levels even further.
- One secondary coding sequence comprises dihydrofolate reductase (DHFR that is affected by an externally controlled parameter, such as methotrexate (MTX), thus permitting control of expression by control of the methotrexate concentration (Urlaub and Chasin, Proc. Natl. Acad, Sci. (USA) 77, 4216 (1980)).
- DHFR dihydrofolate reductase
- MTX methotrexate
- a Ligand of the present invention is operably linked to a secretory leader sequence resulting in secretion of the expression product by the host cell into the culture medium.
- secretory leader sequences include stll, ecotin, lamB, herpes GD, lpp, alkaline phsophatase, invertase, and alpha factor.
- secretory leader sequences include stll, ecotin, lamB, herpes GD, lpp, alkaline phsophatase, invertase, and alpha factor.
- secretory leader sequences include stll, ecotin, lamB, herpes GD, lpp, alkaline phsophatase, invertase, and alpha factor.
- 36 amino acid leader sequence of protein A Abrahmsen et al., £M ⁇ C> ./., 4: 3901 (1985)).
- the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, Le., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, lipofection, calcium phosphate precipitation, direct microinjection, DEAE-dextran transfection, and the like.
- suitable means Le., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, lipofection, calcium phosphate precipitation, direct microinjection, DEAE-dextran transfection, and the like.
- the most effective method for transfection of eukaryotic cell lines with plasmid DNA varies with the given cell type.
- recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene molecule(s) results in the production of a Ligand of the present invention.
- a variety of incubation conditions can be used to form a Ligand of the present invention. The most preferred conditions are those that mimic physiological conditions.
- Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaPO.sub.4 precipitation and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
- Transformation refers to introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant.
- fransformation is done using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride, as described in section 1.82 of Sambrook el al., Molecular Cloning (2nd ed.), Cold Spring Harbor Laboratory, New York (1989), is generally used for prokaryotes or other cells that contain substantial cell-wall barriers.
- Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et_aL, Gene, 23: 315 (1983) and WO 89/05859 published 29 June 1989.
- Host cells used to produce a Ligand of the present invention can be cultured in a variety of media as described generally in Sambrook et al.
- a wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host to control the expression.
- Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated.
- regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.
- recombinantly produced Ligands of the present invention can be recovered from the culture cells by disrupting the host cell membrane/cell wall (e ⁇ g. by osmotic shock or solubilizing the host cell membrane in detergent).
- a Ligand of the present invention that is recombinantly produced can be recovered from the culture medium.
- the culture medium or lysate is centrifuged to remove any particulate cell debris.
- the membrane and soluble protein fractions are then separated.
- the Ligand can then be purified from the soluble protein fraction.
- the membrane bound peptide can be recovered from the membrane fraction by solubilization with detergents.
- the crude peptide extract can then be further purified by suitable procedures such as fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; hydrophobic affinity resins and ligand affinity using IgG ligand immobilized on a matrix.
- In vitro transcription/translation systems can also be employed to produce a Ligand of the present Invention using RNAs derived from a DNA molecule that encodes a peptide comprising an amino acid sequence of SEQ. ID. NO.: 1.
- Cell-free translation systems have been used in the biosynthesis of proteins and peptides, and have become a standard tool in molecular biology for protein production (In vitro transcription and translation protocols, Methods in Molecular Biology , 37 Edited by M.J. Tymms, 1995, Humana Press. Inc., Merrick, Translation of exogenous mRNAs in reticulocyte lysates, Meth. Enzymol. 101:38 (1983)). Kigawa, T.
- the expression unit for in vitro synthesis comprises a 5' untranslated region and may additionally comprise a 3' region.
- the 5' untranslated region of the expression unit contains a promoter or RNA polymerase binding sequence, a ribosome binding sequence, and a translation initiation signal.
- the 5' untranslated region (“head") may also contain convenient restriction sites and a translation enhancer or "Activator" sequence(s).
- the 3' region may contain convenient restriction sites and a 3' tail of a selected sequence.
- the expression unit may be chemically synthesized by protocols well known to those skilled in the art. Alternatively, these elements may be incorporated into one or more plasmids, amplified in microorganisms, purified by standard procedures, and cut into appropriate fragments with restriction enzymes before assembly into the expression unit.
- the 5' untranslated region contains a promoter or RNA polymerase binding sequence, such as those for the T7, T3, or SP6 RNA polymerase. Positioned downstream of or within the promoter region is a DNA sequence, which codes for a ribosomal binding site.
- This ribosome binding site may be specific for prokaryotic ribosomal complexes (including ribosomal RNAs) if a prokaryotic translation procedure is used.
- a particular embodiment of the present invention utilizes a eukaryotic sequence and an in vitro eukaryotic translation system, such as the rabbit reticulocyte system (Krawetz et al.. Can. J. Biochem. Cell. Biol.
- a consensus translation initiation sequence, GCCGCCACCATGG , as well as other functionally related sequences have been established for vertebrate mRNAs (Kozak, Nucleic Acids Res, 15:8125-8148, 1987). This sequence or related sequences may be used in the DNA construction to direct protein synthesis in vitro.
- the ATG triplet in this initiation sequence is the translation initiation codon for methionine; in vitro protein synthesis is expected to begin at this point.
- Black beetle virus Nodavirus
- RNA 2 Fariesen and Rueckert, /. Virol. 37:876-886 (1981)
- turnip mosaic virus and brome mosaic virus coat protein mRNAs
- brome mosaic virus coat protein mRNAs also translate at high efficiencies.
- certain untranslated leaders severely reduce the expression of the SP6 RNAs (Jobling et al., ibid., (1988)).
- a DNA molecule encoding a Ligand of the present invention may be incorporated into the in vitro expression unit.
- the expressed polypeptides contain both carrier polypeptide/peptide and Ligand amino acid sequences.
- the carrier peptide would be useful for quantifying the amount of fusion polypeptide and for purification (given that an antibody against the carrier polypeptide is available or can be produced).
- One example is the 11 amino acid Substance P, which can be attached as a fusion peptide to peptides of the invention.
- Anti-Substance P antibodies are commercially available for detecting and quantifying fusion proteins containing Substance P.
- a preferable form of the carrier polypeptide is one, which may be cleaved from the novel polypeptide by simple chemical or enzymatic means.
- a Ligand having applications in a present invention comprises a peptide comprising an amino acid sequence of SEQ. ID. NO.:4, along with analogs, derivatives and variants of such a peptide.
- amino acid and any reference to a specific amino acid is meant to include naturally occurring proteogenic amino acids as well as non-naturally occurring amino acids such as amino acid analogs.
- proteogenic indicates that the amino acid can be incorporated into a protein in a cell through well-known metabolic pathways.
- the choice of including an (L)- or a (D)- amino acid into a Ligand of the present invention depends, in part, on the desired characteristics of the peptide.
- the incorporation of one or more (D)-amino acids can confer increasing stability on the peptide in vitro or in vivo.
- the incorporation of one or more (D)- amino acids also can increase or decrease the binding activity of the peptide as determined, for example, using the binding assays described herein, or other methods well known in the art.
- it is desirable to design a peptide that retains activity for a short period of time for example, when designing a peptide to administer to a subject.
- the incorporation of one or more (L)-amino acids in the peptide can allow endogenous peptidases in the subject to digest the peptide in vivo, thereby limiting a subject's exposure to an active peptide.
- amino acid equivalent refers to compounds, which depart from the structure of the naturally occurring amino acids, but which have substantially the structure of an amino acid, such that they can be substituted within a peptide, which retains is biological activity.
- amino acid equivalents can include amino acids having side chain modifications or substitutions, and also include related organic acids, amides or the like.
- amino acid is intended to include amino acid equivalents.
- reducts refers both to amino acids and amino acid equivalents.
- peptide is used in its broadest sense to refer to compounds containing amino acid equivalents or other non-amino groups, while still retaining the desired functional activity of a peptide.
- Peptide equivalents can differ from conventional peptides by the replacement of one or more amino acids with related organic acids (such as PAB A), amino acids or the like or the substitution or modification of side chains or functional groups. It is to be understood that limited modifications can be made to a peptide without destroying its biological function. Thus, modification of a peptide comprising an amino acid sequence of SEQ. ID. NO.:l that does not completely destroy the activity of the peptide is a Ligand of the present invention. Such modifications can include, for example, additions, deletions, or substitutions of amino acids residues, substitutions with compounds that mimic amino acid structure or functions, as well as the addition of chemical moieties such as amino or acetyl groups. The modifications can be deliberate or accidental, and can be modifications of the composition or the structure.
- Ligands of the present invention are also useful when they are maintained in a constrained secondary conformation.
- constrained secondary structure stabilized
- the terms “constrained secondary structure,” “stabilized” and “conformationally stabilized” indicate that the peptide bonds comprising the a Ligand are not able to rotate freely, , but instead are maintained in a relatively fixed structure.
- a Ligand of the present invention can be stabilized by incorporating it into a sequence that forms a helix such as an alpha helix or a triple helix, according to methods described, for example, by Dedhar et al., J. Cell. Biol. 104:585 (1987); by Rhodes et aL, Biochem 17:3442 (1978); and by Carbone et al.. J. Immunol 138:1838 (1987), each of which is incorporated herein by reference. Additionally, a Ligand of the present invention can be incorporated into larger linear, cyclic or branched peptide, so long as its activity is retained.
- a particular method for constraining the secondary structure of a newly synthesized linear peptide is to cyclize the peptide using any of various methods well known in the art.
- a cyclized Ligand of the present invention can be prepared by forming a peptide bond between non-adjacent amino acid residues as described, for example, by Schiller et al., Int. J. Pept. Prot. Res. 25:171 (1985), which is incorporated herein by reference.
- Ligands can be synthesized on the Merrifield resin by assembling the linear peptide chain using N ⁇ -Fmoc -amino acids with Boc and tertiary-butyl side chain protection. Following the release of the Ligand from the resin, a peptide bond can be formed between the amino and carboxyl termini of the Ligand.
- a newly synthesized linear Ligand of the present invention can also be cyclized by the formation of a bond between reactive amino acid side chains.
- a Ligand comprising a cysteine-pair can be synthesized and a disulfide bridge can be formed by oxidizing a dilute aqueous solution of the peptide with K 3 [Fe(CN) 6 ].
- a lactam such as an ⁇ ( ⁇ -glutamyl)-lysine bond can be formed between lysine and glutamic acid residues
- a lysi onorleucine bond can be formed between lysine and leucine residues
- a dityrosine bond can be formed between two tyrosine residues.
- Cyclic Ligands of the present invention can be constructed to contain, for example, four lysine residues, which can form the heterocyclic structure of desmosine (see, for example, Devlin, Textbook of Biochemistry 3rd ed. (1992), which is herein incorporated by reference).
- a Ligand of the present invention can also comprise a peptidometic of a peptide comprising an amino acid sequence of SEQ. ID. NO.:. 1.
- Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics” or “peptidomimetics” (Fauchere, J. (1986) Adv. Drug Res. 15:29; Veber and Freidinger (1985) TINS p.392; and Evans et al. (1987) /. Med. Chem 30:1229, which are incorporated herein by reference) and can be developed, for example, with the aid of computerized molecular modeling.
- Peptide mimetics that are structurally similar to a therapeutically useful peptide may be used to produce an equivalent therapeutic or prophylactic effect.
- peptidomimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a biochemical property or pharmacological activity), such as a peptide comprising an amino acid sequence of SEQ. ID. NO.:.:l, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: --CH 2 ⁇ NH--, ⁇ CH 2 S ⁇ , — CH 2 -CH.
- Spatola A. F. in "Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins," B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications” (general review); Morley, J. S., Trends Pharm Sci (1980) pp. 463-468 (general review); Hudson, D.
- Such peptide mimetics may have significant advantages over a polypeptide, including, for example: more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad- spectrum of biological activities), reduced antigenicity, and others.
- Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure-activity data and/or molecular modeling.
- Such non-interfering positions generally are positions that do not form direct contacts with the macromolecules(s) or cells to which the peptidomimetic interact to produce the therapeutic effect.
- Derivitization (e.g., labeling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic.
- Derivatives of a peptide comprising an amino acid sequence of SEQ. ID. NO.: 1, which are Ligands of the present invention can be produced using recombinant nucleic acid molecule techniques. Modifications to a specific peptide may be deliberate, as through site-directed mutagenesis and amino acid substitution during biosynthesis, or may be accidental such as through mutations in hosts, which produce the peptide. Peptides including derivatives can be obtained using standard mutagenesis techniques such as those described in Sambrook et al. Molecular Cloning, Cold Spring Harbor Laboratory Press (1989). For example, Chapter 15 of Sambrook describes procedures for site-directed mutagenesis of cloned DNA.
- Derivatives of a peptide comprising an amino acid sequence of SEQ. ID. NO.:l include, but certainly are not limited to modification of the peptide during or after translation, for example, by phosphorylation, glycosylation, crosslinking, acylation, proteolytic cleavage, linkage to a therapeutic protein, an antibody molecule, membrane molecule or other ligand (see Ferguson et al., 1988, Annu. Rev. Biochem. 57:285-320).
- genetically produced derivatives also include, but not limit by amino acid alterations such as deletions, substitutions, additions, and amino acid modifications.
- a “deletion” refers to the absence of one or more amino acid residue(s) in the related peptide.
- An “addition” refers to the presence of one or more amino acid residue(s) in the related peptide. Additions and deletions to a peptide may be at the amino terminus, the carboxyl terminus, and/or internal, can be produced by mutating a DNA molecule that encodes a peptide comprising an amino acid sequence of SEQ. ID. NO.: l, and/or by peptide post-translation modification.
- Amino acid "modification” refers to the alteration of a naturally occurring amino acid to produce a non-naturally occurring amino acid.
- Analogs of a peptide comprising an amino acid sequence of SEQ. ID. NO.:l with unnatural amino acids can be created by site-specific incorporation of unnatural amino acids into polypeptides during the biosynthesis, as described in Christopher J. Noren, Spencer J. Anthony- Cahill, Michael C. Griffith, Peter G. Schultz, Science, 244:182-188 (April 1989).
- substitution refers to the replacement of one or more amino acid residue(s) by another amino acid residue(s) in the peptide. Mutations can be made in a DNA molecule encoding a peptide comprising an amino acid sequence of SEQ.
- a substitution mutation of this sort can be made to change an amino acid in the resulting peptide in a non-conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping).
- amino acids which are interchangeable: the basic amino acids lysine, arginine, and histidine; the acidic amino acids aspartic and glutamic acids; the neutral polar amino acids serine, threonine, cysteine, glutamine, asparagine and, to a lesser extent, methionine; the nonpolar aliphatic amino acids glycine, alanine, valine, isoleucine, and leucine (however, because of size, glycine and alanine are more closely related and valine, isoleucine and leucine are more closely related); and the aromatic amino acids phenylalanine, tryptophan, and tyrosine.
- proline is a nonpolar neutral amino acid, its replacement represents difficulties because of its effects on conformation. Thus, substitutions by or for proline are not preferred, except when the same or similar conformational results can be obtained.
- the conformation conferring properties of proline residues may be obtained if one or more of these is substituted by hydroxyproline (Hyp).
- Derivatives can contain different combinations of alterations including more than one alteration and different types of alterations.
- “Derivatives" of a peptide comprising an amino acid sequence of SEQ. ID. NO.: 4 are functional equivalents having similar amino acid sequence and retaining, to some extent, the activities of a peptide comprising an amino acid sequence of SEQ. ID. NO.:4.
- “functional equivalent” is meant the derivative has an activity that can be substituted for the activity of a peptide comprising an amino acid sequence of SEQ. ID. NO.:4.
- Preferred functional equivalents retain the full level of transport efficacy through IB and BBB as measured by assays known to these skilled in the art, and/or described infra.
- Preferred functional equivalents have activities that are within 1% to 10,000% of the activity of a peptide comprising an amino acid sequence of SEQ. ID.
- derivatives have at least 50% sequence similarity, preferably 70%, more preferably 90%, and even more preferably 95% sequence similarity to a peptide comprising an amino acid sequence of SEQ. ID. NO.:4.
- sequence similarity refers to "homology" observed between amino acid sequences in two different polypeptides, irrespective of polypeptide origin.
- a variety of biological agents are suitable for use in the present invention. These include, without limitation, proteins, peptides (e.g., oligopeptides and polypeptides) including cytokines, hormones (such as insulin), and the like, recombinant soluble receptors, monoclonal antibodies, human growth hormones, tissue plasminogen activators, clotting factors, vaccines, colony stimulating factors, erythropoietins, enzymes, and dsalvtase.
- proteins peptides (e.g., oligopeptides and polypeptides) including cytokines, hormones (such as insulin), and the like, recombinant soluble receptors, monoclonal antibodies, human growth hormones, tissue plasminogen activators, clotting factors, vaccines, colony stimulating factors, erythropoietins, enzymes, and dsalvtase.
- Preferred classes of biological agents include anti-neoplastic agents, antibacterial agents, antiparasitic agents, anti-fungal agents, CNS agents, immunomodulators and cytokines, toxins and neuropeptides.
- Biological agents for which target cells tend to develop resistance mechanisms are also preferred.
- Particularly preferred biological agents include anthracyclines such as doxorubicin, daunorubicin, epirubicin, idarubicin, mithoxanthrone or carminomycin, vinca alkaloids, mitomycin-type antibiotics, bleomycin-type antibiotics, azole antifungals such as fluconazole, polyene antifungals such as amphotericin B, taxane-related antineoplastic agents such as paclitaxel and immunomodulators such as tumor necrosis factor alpha (TNF- ⁇ ), interferons and cytokines.
- anthracyclines such as doxorubicin, daunorubicin, epirubicin, idarubicin, mithoxanthrone or carminomycin, vinca alkaloids, mitomycin-type antibiotics, bleomycin-type antibiotics, azole antifungals such as fluconazole, polyene antifungals such as amphotericin B, taxan
- Preferred biological agents include, without limitation, additional antifungal agents such as amphotericin-B, flucytosine, ketoconazole, miconazole, itraconazole, griseofulvin, clotrimazole, econazole, terconazole, butoconazole, ciclopirox olamine, haloprogin, toinaftate, naftifine, nystatin, natamycin, undecylenic acid, benzoic acid, salicylic acid, propionic acid and caprylic acid.
- additional antifungal agents such as amphotericin-B, flucytosine, ketoconazole, miconazole, itraconazole, griseofulvin, clotrimazole, econazole, terconazole, butoconazole, ciclopirox olamine, haloprogin, toinaftate, naftifine, nystatin, natamycin, undecyle
- Such agents further include without limitation antiviral agents such as zidovudine, acyclovir, ganciclovir, vidarabine, idoxuridine, trifluridine, foxcarnet, amantadine, rimantadine and ribavirin.
- antiviral agents such as zidovudine, acyclovir, ganciclovir, vidarabine, idoxuridine, trifluridine, foxcarnet, amantadine, rimantadine and ribavirin.
- Such agents further include without limitation antibacterial agents such as penicillin-related compounds including 9-lactam antibiotics, broad spectrum penicillins and penicillinase-resistant penicillins (such as methicillin, nafcillin, oxacillin, cloxacillin, dicloxacillin, amoxicillin, ampicillin, ampicillin-sulbactam, azocillin, bacampicillin, carbenicillin, carbenicillin indanyl, cyclacillin, mezlocillin, penicillin G, penicillin V, piperacillin, ticarcillin, imipenem and aztreonam), cephalosporins (cephalosporins include first generation cephalosporins such as cephapirin, cefaxolin, cephalexin, cephradine and cefadroxil; second generation cephalosporins such as cefamandole, cefoxitin, cefaclor, cefuroxime, cefuroxime axetil, cefonici
- agents further include agents active against protozoal infections such as chloroquine, diloxanide furoate, emetine or dehydroemetine, 8-hydroxyquinolines, metronidazole, quinacrine, melarsoprol, nifurtimox, pentamidine, sodium stibogluconate and suramin.
- protozoal infections such as chloroquine, diloxanide furoate, emetine or dehydroemetine, 8-hydroxyquinolines, metronidazole, quinacrine, melarsoprol, nifurtimox, pentamidine, sodium stibogluconate and suramin.
- a variety of central nervous system biological agents are suitable for use in the present invention. These include neuroleptics such as the phenothiazines (such as compazine, thorazine, promazine, chlorpromazine, acepromazine, aminopromazine, perazine, prochlorperazine, trifluoperazine, and thioproperazine), rauwolf ⁇ a alkaloids (such as reserpine and deserpine), thioxanthenes (such as chlorprothixene and tiotixene), butyrophenones (such as haloperidol, moperone, trifluoperidol, timiperone, and droperidol), diphenylbutylpiperidines (such as pimozide), and benzamides (such as sulpiride and tiapride); tranquilizers such as glycerol derivatives(such as mephenesin and methocarbamol), propanediol
- sedative-hypnotics such as the benzodiazepines, psycho-pharmacological agents such as the phenothiazines, thioxanthenes, butyrophenones, and dibenzoxazepines, and central nervous system stimulants.
- the brain treatment embodiment of the invention is directed to compositions that improve the activity of biological agents, this embodiment of the invention can be applied to a wide variety of central nervous system agents by applying the principles and procedures described herein.
- a biological agent administered to a subject pursuant to the present invention can also comprise a variety of polypeptides such as antibodies, toxins such as diphtheria toxin, peptide hormones, such as colony stimulating factor, and tumor necrosis factors, neuropeptides, growth hormone, erythropoietin, and thyroid hormone, lipoproteins such as ⁇ -lipoprotein, proteoglycans such as hyaluronic acid, glycoproteins such as gonadotropin hormone, immunomodulators or cytokines such as the interferons or interleukins, hormone receptors such as the estrogen receptor.
- polypeptides such as antibodies, toxins such as diphtheria toxin, peptide hormones, such as colony stimulating factor, and tumor necrosis factors, neuropeptides, growth hormone, erythropoietin, and thyroid hormone, lipoproteins such as ⁇ -lipoprotein, proteoglycans such as hyaluronic acid, glycoproteins such as gonado
- polypeptides are those with molecular weight of at least about 500, more preferably at least about 5,000, most preferably at least about 10,000.
- Biological agents having applications herein can also comprise enzyme inhibiting agents such as reverse transcriptase inhibitors, protease inhibitors, angiotensin converting enzymes, 5 ⁇ -reductase, and the like.
- Typical of these agents are peptide and nonpeptide structures such as finasteride, quinapril, ramipril, lisinopril, saquinavir, ritonavir, indinavir, nelfinavir, zidovudine, zalcitabine, allophenylnorstatine, kynostatin, delaviridine, fos-tefrahydrofuran ligands (see, for example Ghosh et al, J. Med. Chem. 39 (17): 3278-90 1966), and didanosine.
- peptide and nonpeptide structures such as finasteride, quinapril, ramipril, lisinopril, saquinavir, ritonavir, indinavir, nelfinavir, zidovudine, zalcitabine, allophenylnorstatine, kynostatin, delaviridine, fos-t
- Such agents can be administered alone or in combination therapy; e.g., a combination therapy utilizing saquinavir, zalcitabine, and didanosine or saquinavir, zalcitabine, and zidovudine. See, for example, Collier et al., Antiviral Res., 1996 Jan. 29 (1):99.
- cytokines are suitable for use as biological agents in the present compositions. These include interferons, interleukins, tumor necrosis factors (TNFs) such as TNF ⁇ , and a number of other protein and peptide factors controlling functions of the immune system. It will be appreciated that this extends to mixtures of several such agents, and the invention is not directed to the underlying specific activity of the cytokines themselves, but rather to the compositions themselves.
- TNFs tumor necrosis factors
- a variety of carriers can be associated with a Ligand of the present invention, including, but not limiting by synthetic, semi-synthetic and natural compounds such as polypeptides, lipids, carbohydrates, polyamines, synthetic polymers, that form solutions (unimolecular systems), dispersions (supramolecular systems), or any particular systems such as nanoparticles, microspheres, matrixes, gels and other.
- synthetic, semi-synthetic and natural compounds such as polypeptides, lipids, carbohydrates, polyamines, synthetic polymers, that form solutions (unimolecular systems), dispersions (supramolecular systems), or any particular systems such as nanoparticles, microspheres, matrixes, gels and other.
- the polymeric carriers can be nonionic water-soluble, nonionic hydrophobic or poorly water soluble, cationic, anionic or polyampholite, such as a polypeptides. It is preferred that the degrees of polymerization of these polymer carriers were from about 3 to about 500,000 more preferably from about 5 to about 5000, still more preferably from about 20 to about 500.
- a preferred hydrophilic carrier is a nontoxic and non-immunogenic polymer that is soluble in water.
- Such segments include, but certainly not are limited to polyethers (e.g., polyethylene oxide), polysaccharides (e.g., dextran), polyglycerol, homopolymers and copolymers of vinyl monomers (e.g., polyacrylamide), polyacrylic esters (e.g., polyacryloyl morpholine), polymethacrylamide, poly(N-(2- hydroxypropyl)methacrylamide, polyvinyl alcohol, polyvinyl pyrrolidone, polyvinyltriazole, N-oxide of polyvinylpyridine, copolymer of vinylpyridine and vinylpyridine N-oxide) polyortho esters, polyaminoacids, polyglycerols (e.g., poly-2-methyl-2-oxazoline, poly-2-ethyl-2-oxazoline) and copolymers and derivatives
- a preferred nonionic hydrophobic and poorly water soluble segments include polypropylene oxide, copolymers of polyethylene oxide and polyethylene oxide, polyalkylene oxide other than polyethylene oxide and polypropylene oxide, homopolymers and copolymers of styrene (e.g., polystyrene), homopolymers and copolymers isoprene (e.g., polyisoprene), homopolymers and copolymers butadiene (e.g., polybutadiene), homopolymers and copolymers propylene (e ⁇ g., polypropylene), homopolymers and copolymers ethylene (e.g., polyethylene), homopolymers and copolymers of hydrophobic aminoacids and derivatives of aminoacids (e.g., alanine, valine, isoleucine, leucine, norleucine, phenylalanine, tyrosine, tryptophan, threonine, pro
- Preferred polyanionic carriers include those such as polymethacrylic acid and its salts, polyacrylic acid and its salts, copolymers of methacrylic acid and its salts, copolymers of acrylic acid and its salts, heparin, polyphosphate, homopolymers and copolymers of anionic aminoacids (e.g., glutamic acid, aspartic acid), polymalic acid, polylactic acid, polynucleotides, carboxylated dextran, and the like.
- Preferred polycationic carriers include polylysine, polyasparagine, homopolymers and copolymers of cationic aminoacids (e.g., lysine, arginine, histidine), alkanolamine esters of polymethacrylic acid (e.g., poly- (dimethylammonioethyl methacrylate), polyamines (e.g., spermine, polyspermine, polyethyleneimine, polypropyleneimine, polybutileneimine, polypentyleneimine, polyhexyleneimine and copolymers thereof), copolymers of tertiary amines and secondary amines, partially or completely quaternized amines, polyvinyl pyridine and the quaternary ammonium salts of the polycation segments.
- cationic aminoacids e.g., lysine, arginine, histidine
- alkanolamine esters of polymethacrylic acid e.
- These preferred polycation segments also include aliphatic, heterocyclic or aromatic ionenes (Rembaum et al.. Polymer letters, 1968, 6; 159; Tsutsui, T., In Development in ionic polymers -2, Wilson A.D. and Prosser, H.J. (eds.) Applied Science Publishers, London, new York, vol. 2, pp. 167-187, 1986).
- dendrimers for example, polyamidoamines of various generations (Tomalia et al., Angew. Chem., Int. Ed. Engl. 1990, 29, 138) can be also used.
- copolymers selected from the following polymer groups:
- segmented copolymers having at least one anionic segment and at least one nonionic segment ("anionic copolymers”);
- segmented copolymers having at least one polypeptide segment and at least one non-peptide segment (“polypeptide copolymers”);
- segmented copolymers having at least one polynucleotide segment and at least one segment which is not a nucleic acid "polypeptide copolymers”);
- hydrophilic-hydrophobic copolymers are the block copolymers of ethylene oxide and propylene oxide having the formulas:
- segmented copolymers are the block copolymers of ethylene oxide and propylene oxide having the formulas:
- x, y, z, i and j have values from about 2 to about 800, preferably from about 5 to about 200, more preferably from about 5 to about 80, and wherein for each R 1 , R 2 pair, one is hydrogen and the other is a methyl group.
- Formulas (I) through (III) are oversimplified in that, in practice, the orientation of the isopropylene radicals within the B block will be random. This random orientation is indicated in formula (TV), which is more complete.
- Such poly(oxyethylene)-poly(oxypropylene) compounds have been described by Santon, Am. Perfumer Cosmet., 72(4):54-58 (1958); Schmolka, Loc. cit. 82(7):25 (1967); Schick, ⁇ on-ionic Surfactants, pp. 300-371 (Dekker, ⁇ Y, 1967).
- Polyoxypropylene-polyoxyethylene block copolymers can also be designed with hydrophilic blocks comprising a random mix of ethylene oxide and propylene oxide repeating units. To maintain the hydrophilic character of the block, ethylene oxide will predominate. Similarly, the hydrophobic block can be a mixture of ethylene oxide and propylene oxide repeating units. Such block copolymers are available from BASF under the tradename PluradotTM.
- the diamine-linked pluronic of formula (IV) can also be a member of the family of diamine-linked polyoxyethylene-polyoxypropylene polymers of formula:
- R* is an alkylene of 2 to 6 carbons, a cycloalkylene of 5 to 8 carbons or phenylene, for R 1 and R 2 , either (a) both are hydrogen or (b) one is hydrogen and the other is methyl, for R 3 and R 4 either (a) both are hydrogen or (b) one is hydrogen and the other is methyl, if both of R 3 and R 4 are hydrogen, then one R 5 and R 6 is hydrogen and the other is methyl, and if one of R 3 and R 4 is methyl, then both of R 5 and R 6 are hydrogen.
- the units making up the first block need not consist solely of ethylene oxide.
- the B-type block need consist solely of propylene oxide units.
- the blocks can incorporate monomers other than those defined in formulas (I)-(V), so long as the parameters of the first embodiment are maintained.
- at least one of the monomers in block A might be substituted with a side chain group as previously described.
- hydrophilic-hyrophobic block copolymers have been synthesized that can be used in the present invention. These copolymers have the general formula A n B m , wherein A is the hydrophilic homopolymer or copolymer segment, and B is a hydrophobic homopolymer or copolymer segment; n is number of units in block A, and m is number of units in block b. Each of the A and B segments can be either straight chain or branched.
- hydrophilic homopolymer or copolymer A segments in hydrophilic-hyrophobic block copolymers that can be used in the present invention will contain at least three monomeric units, each of which unit will have the same or different pendant group. Each pendant group will contain at least one atom selected from the group consisting of oxygen and nitrogen.
- hydrophilic homopolymers or copolymers include but are not limited to polyethylene oxides, copolymers of ethylene oxide and propylene oxide, polysaccharides, polyacrylamides, polygycerols, polyvinylalcohols, polyvinylpyrrolidones, polyvinylpyridine N-oxides, copolymers of vinylpyridine N-oxide and vinylpyridine, polyoxazolines, and polyacroylmorpholines.
- the hydrophilic A segment is:
- each of m and has a value of from 3 to 5000.
- hydrophobic B segments useful in this invention can also contain fluorocarbon moieties including but not limited to fluoroalkyl segments, and copolymers containing both fluorocarbon and hydrocarbon.
- fluorocarbon moieties including but not limited to fluoroalkyl segments, and copolymers containing both fluorocarbon and hydrocarbon.
- segmented block copolymers having the formula:
- R 1 is a monovalent fluorinated hydrocarbon of 2 to 50 carbon atoms and R 2 is a divalent hydrocarbon of 2 to 50 carbon atoms or (ii) R 1 is a monovalent hydrocarbon of 2 to 50 carbon atoms and R 2 is a divalent fluorinated hydrocarbon of 2 to 50 carbon atoms;
- R 3 is (i) hydrogen, (ii) a monovalent fluorinated hydrocarbon of 2 to 50 carbon atoms, or (iii) a monovalent hydrocarbon of 2 to 50 carbon atoms;
- R 4 is (i) a bond if R 3 is hydrogen; (ii) a divalent hydrocarbon of 2 to 50 carbon atoms if R 3 is a fluorinated hydrocarbon, or (iii) a divalent fluorinated hydrocarbon of 2 to 50 carbon atoms if R 3 is a hydrocarbon; each of L 1 and L 2 , independently of the other, is a linking group; L 3 and L 4 taken together with R 4 , is a bond if R 3 is hydrogen or if R 3 is other than hydrogen each of L 3 and L 4 , taken independently is a linking group;
- A is a hydrophilic homopolymer or copolymer comprising at least three monomeric units each having the same or different pendant group containing at least atom selected from the group consisting of oxygen and nitrogen; and w has a value of from 1 to 100.
- the hydrophilic homopolymer or copolymer A will contain at least three monomeric units, each of which unit will have the same or different pendant group. Each pendant group will contain at least one atom selected from the group consisting of oxygen and nitrogen.
- Representative hydrophilic homopolymers or copolymers include polyethylene oxides, copolymers of ethylene oxide and propylene oxide, polysaccharides, polyacrylamides, polygycerols, polyvinylalcohols, polyvinylpyrrolidones, polyvinylpyridine N-oxides, copolymers of vinylpyridine N-oxide and vinylpyridine, polyoxazolines, and polyacroylmorpholines.
- Useful segmented copolymers include a class of copolymers in which at least one segment is a polycation.
- One example of these structures is a basis of copolymers comprising a plurality of covalently bound polymer segments wherein the segments have (a) at least one polycation segment which segment is a cationic homopolymer, copolymer, or block copolymer comprising at least three aminoalkylene monomers, the monomers being selected from the group consisting of at least one of the following:
- R 1 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; each of R 2 and R 3 , taken independently of the other, is the same or different straight or branched chain alkanediyl group of the formula:
- R is hydrogen satisfying one bond of the depicted geminally bonded carbon atom; and R 5 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; R 6 is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; R 7 is a straight or branched chain alkanediyl group of the formula:
- z has a value of from 2 to 8; and R is hydrogen, alkyl of 2 to 8 carbon atoms, an A monomer, or a B monomer; and at least one straight or branched nonionic hydrophilic segment A having from about 5 to about 1000 monomeric units which is defined above.
- the polycationic segments in the copolymers of the invention can be branched.
- polyspermine-based copolymers are branched.
- the cationic segment of these copolymers was synthesized by condensation of 1,4-dibromobutane and N-(3-aminopropyl)-l,3-propanediamine. This reaction yields highly branched polymer products with primary, secondary, and tertiary amines.
- branched polycations are products of the condensation reactions between polyamines containing at least 2 nitrogen atoms and alkyl halides containing at least 2 halide atoms (including bromide or chloride).
- the branched polycations are produced as a result of polycondensation.
- An example of this reaction is the reaction between N-(3-aminiopropyl)-l,3-propanediamine and 1,4-dibromobutane, producing polyspermine.
- polyethyleneimine represented by the formula:
- polystyrene-based copolymers One example of useful polyamine-based copolymers is the polymer of formula:
- F is a polyamine segment comprising a plurality of repeating units of formula -NH-R 0 , wherein R° is an aliphatic group of 2 to 6 carbon atoms, which may be substituted;
- G is polyethylene oxide or copolymer ethylene oxide and propylene oxide a straight or branched nonionic segment defined above;
- K 1 and K 2 independently of the other, is hydrogen, hydroxyl group, amonogroup, G or F polymer segments;
- each of L 1 , L 2 and L 3 is a linking group or chemical bond.
- polycationic segments can be quatemized to produce ammonium salts.
- examples include polyspermine and polyamines that are modified with alkylhalides to produce tertiary and quatemized polyamines.
- Another useful type of cationic segments of well defined chemical structure are ionenes that can be aliphatic, heterocyclic or aromatic (Rembaum et al. Polymer Letters, 1968, 6:159; Tsutsui, T., Development in ionic polymers - 2. Wilson, A.D. and Prosser, H.J. (eds.), Applied Science Publishers, London, New York, vol. 2, pp. 163-187, 1986).
- Anionic copolymers contain at least one polyelectrolyte segment that yields a polyanion in an aqueous environment. This includes both strong polyacids having high ionization degrees in a broad range of pH, and weak polyacids characterized by pH-dependent ionization degrees.
- Anionic segments normally have a plurality of pendant amino groups such as carboxylic groups, sulfate groups, sulfonate groups, phosphate groups, and the like.
- anionic copolymers include but are not limited to polyoxyethylene-b- polymethacrylic acid (Wang, et al., /. Polym. Sci, Part A: Polym.
- Polypeptide copolymers have a plurality of covalently bound polymer segments wherein the segments have at least one polypeptide segment and at least one non-peptide polymer segment.
- Polypeptide segments have a plurality of amino acid units or derivatives thereof.
- segmented copolymers containing polypeptides include the poly(oxyethylene)- poly-L-lysine) diblock copolymer of the following formula:
- i is an integer of from about 2 to about 500, and; is an integer from about 4 to about 500.
- a second example is the poly(oxyethylene)-poly-(L-alanine-L-lysine) diblock copolymer of formula:
- i is an integer of from about 2 to about 500, and; is an integer from about 2 to about 500.
- polypeptide copolymers in the invention allows for better control of the polypeptide segment lengths by using solid-phase and solution-phase chemistries.
- Segmented copolymers based on polypeptides with well defined chemical structures have been described in the literature, such as poly(amino acid)-b-poly(N,N-diethylacrylamide)-b-poly (amino acid) (Bromberg and Levin, Bioconjugate Chem. 9:40 (1998)).
- the unit composition and sequence in polypeptides can be varied including hydrophobic, hydrophilic, ionizable, hydrogen and chemical bond forming amino acids and derivatives thereof to produce broader variability in the basis of the segmented copolymers.
- Polynucleotide copolymers have a plurality of covalently bound polymer segments wherein the segments have at least one segment containing at least three nucleic acid units or the derivatives thereof. Similar to polypeptide copolymers, the polynucleotide copolymers provide for better control over segment length and sequence by using solid-phase and solution-phase chemistries. Segmented copolymers based on polynucleotides with well-defined chemical structure have been described including, polyoxyethylene-b- polynucleotide copolymer and polycation-b-polynucleotide copolymer (Vinogradov et al. , Bioconjugate Chemistry, 7:3 (1996); U.S. Patent No. 5,656,611). As with polypeptide copolymers, polynucleotide copolymers permit variation of the unit composition and sequence in polynucleotide segments that is particularly useful in selecting proper biological agent compositions pursuant to this invention.
- the present invention provides a Ligand of the present invention conjugated to a biological agent.
- a biological agent having applications herein are described above.
- the present invention provides a Ligand conjugated to a drug carrier system, such a carrier system being a polymer molecule, a block copolymer molecule, or a derivative of said polymer.
- a carrier system being a polymer molecule, a block copolymer molecule, or a derivative of said polymer.
- the carrier system may also comprise a protein molecule. Particular carrier systems are described above.
- the preparation of the conjugates of a Ligand of the present invention to the biological agent, or to the carrier is effected by means of one of the known organic chemical methods for chemical ligation.
- the structural link between the Ligand and the macromolecule, as well as the chemical method by which they are joined, should be chosen so that the binding ability of the Ligand and the biological activity of the Ligand, when joined in the conjugate, are minimally compromised.
- suitable chemical conjugation methods there are a number of suitable chemical conjugation methods.
- the selection of the appropriate conjugation method can be rationalized by the inspection of the chemical groups present in the conjugated molecules, as well as evaluation of possible modification of these molecules to introduce some new chemical groups into them. Numerous chemical groups can subject conjugation reactions.
- hydroxyl group (-OH), primary and secondary amino group (-NH 2 and -NH-), carboxylic group (-COOH), sulfhydryl group (-SH), aromatic rings, sugar residues, aldehydes (-CHO), aliphatic and aromatic halides, and others.
- Reactivity of these groups is well known in the art (Morrison and Boyd, Organic Chemistry, 6th Ed. (Prentice Hall, 1992), Jerry March, Advanced Organic Chemistry, 4 th Ed. (Wiley 1992), which are herein incorporated by reference).
- a more extensive description of conjugation methods and techniques can be found in: G. T. Harmanson, Bioconjugate Techniques, Academic Press, Inc.1995, and in: S. S. Wong, Chemistry of Protein Conjugation and Cross-Linking, CRC Press, Inc. 1991, which are herein incorporated by reference.
- a hydroxyl group is present in peptides and proteins in side chains of serine, threonine, and tyrosine residues, and in sugar residues in saccharides and glycoproteins.
- a hydroxyl group is also present in many chemical compounds, including biological agents such as paclitaxel, and in polymeric compounds, such as polysaccharides and poloxamers. Hydroxyl groups exhibit nucleophilic properties and are subject substitution reactions such as, for example alkylation (etherification), and acylation (esterification).
- alkyl halides R-Cl, R-Br
- cyanogen bromide CNBr
- acyl anhydrides acyl halides
- aldehydes -CHO
- hydrazides R-CO-NH-NH 2
- Particularly preferred are: acyl anhydrides ((R-CO) 2 0), and l,l'-Carbonyldiimidazole (see, Anderson, G.W. and Paul, R., (1958) /. Am. Chem. Soc, 80, 4423, which is herein incorporated by reference).
- amino group (-NH 2 ) is present in peptides and proteins at their N-terminus, if these are not acylated, and in side chains of lysine residues. Amino group is also present in many chemical compounds, including therapeutic agents such as doxorubicin. Chemical and genetic methods allow for introduction of amino group into numerous other molecules, including peptides, proteins, small organic molecules and polymeric molecules. An amino group reveals nucleophile properties, and is subject to a substitution reaction such as, for example alkylation, acylation, and condensation with aldehydes.
- alkyl halides R-Cl, R-Br, R-I
- aryl azides aryl azides
- acyl anhydrides acyl halides
- acyl esters carboxylates activated with carbodiimides, aldehydes (-CHO), and others.
- a sulfhydryl group is present in peptides and proteins comprising cysteine residues.
- a sulfhydryl group is also present in many chemical compounds, and can be introduced into other compounds (see for example Carlsson, J., Drevin, H. and Axen, R. (1978) Biochem. J. 173, 723).
- a sulfhydryl group is subject to electrophonic substitution reactions, for example alkylation, and oxidation reaction.
- iodoacetamides R-CO-CH 2 -I
- maleimides R-N(CO-CH) 2
- dithiopyridyls R-S-S-2-pyridyl
- Carboxyl group (-COOH) is present in peptides and proteins at their C-terminus (if not amidated), and in side chains of aspartic acid and glutamic acid residues. Carboxyl group is also present in many chemical compounds, including therapeutic agents such as methotrexate. Chemical and genetic methods allow for introduction of a carboxyl group into numerous other molecules, including peptides, proteins, small organic molecules and polymeric molecules. Carboxyl group is able to acylate nucleophilic groups, such as amines and hydroxyls. Carboxyl group requires activation prior to conjugation.
- organic or inorganic acid halides for example pivaloyl chloride, ethyl chloroformate, thionyl chloride, PCI 5
- EDC EDC
- DCC reaction with benzotriazolyl uronium or phosphonium salts
- the conjugation of the Ligand receptor to other molecules is achieved with the support of cross-linking reagent.
- cross-linking reagent particularly preferred are heterobifunctional cross-linking reagents.
- variety of cross-linking regents is known to those skilled in the art (see, for example, S. S. Wong, Chemistry of Protein Conjugation and Cross-Linking, CRC Press, Inc. 1991, which are herein incorporated by reference).
- Heterobifunctional reagents are particularly useful for linking two molecule, one of them having amino group, and the other having sulfhydryl group.
- the Ligand has a sulfhydryl group, and therefore is available for conjugation with variety of compounds bearing amino group.
- the following heterobifunctonal cross-linking reagents for example, conjugate amino to sulfhydryl compounds: GMBS (N-[» -Maleimidobutyryloxy]succinimide ester, Fujiwara, K., et al. (1988).. J. Immunol. Meth.
- heterobifunctional linkers have polyoxyethylene chain between the two reactive groups. Conjugation with such linkers yields products having hydrophilic junction between the two conjugated molecules, therefore it increases the solubility of the product in aqueous media.
- the following linkers with polyoxyethylene are mentioned here as examples: N-Maleimido-polyoxyethylene-succinimide ester (Sharewater Polymers, Cat. No. 2D2Z0F02), vinylsulfone-polyoxyethylene-succinimide ester (Sharewater Polymers, Inc. Al, Cat. No. 2Z5B0F02).
- the said biological agents may be used in the invention as biologically active substances. They may as well be used as inactivated chemical derivatives of biological agents, i.e. prodrugs that are being converted to the active substances in certain physiological conditions by means of chemical or enzymatic modification of their structure.
- prodrugs i.e. prodrugs that are being converted to the active substances in certain physiological conditions by means of chemical or enzymatic modification of their structure.
- paclitaxel derivatives in which the 2' or 7-hydroxyl group is converted into an ester of a carboxylic acid form a prodrug (Deutsch et al., "Synthesis of congeners and prodrugs. 3. Water- soluble prodrugs of taxol with potent antitumor activity," J. Med. Chem., 32:788-792, 1989.).
- doxorubicin derivative in which its amino group is acylated with a carboxylic group of amino acid derivative forms a prodrug
- Boistol K et al. "Superior therapeutic efficacy of N-L-leucyl-doxorubicin versus doxorubicin in human melanoma xenografts correlates with higher tumour concentrations of free drug.” Eur J Cancer. 1999 Jul;35(7): 1143-9.
- DeFeo- Jones D et al. "A peptide-doxorubicin 'prodrug' activated by prostate- specific antigen selectively kills prostate tumor cells positive for prostate-specific antigen in vivo.” Nat Med 2000 Nov; 6(11): 1248-52).
- nucleic acid sequences encoding the Ligand may be ligated to a biological active polypeptide sequence to encode a fusion protein.
- the general methods suitable for the construction and expression of Ligand fusions with therapeutic proteins are the same as those described herein above for recombinant production of Ligand.
- Chimeric Ligand- polypeptides may be most conveniently constructed by fusing in-frame the DNA sequence encoding the Ligand of present invention to a cDNA sequence encoding the polypeptide of interest. However, fusion to genomic fragments of therapeutic polypeptides can also be used. Alternatively, PCR techniques can be used to join the two parts of the molecule in-frame with an appropriate vector.
- Spacer of various length and structure can be inserted between the Ligand sequence and therapeutic protein in order to provide the fusion protein with additional flexibility and preserve the protein folding.
- the fusions of Ligand of the present invention can be purified by various well-known methods including affinity chromatography and immobilized metal chelate chromatography (Al-Mashikhi et al., J. Dairy Sci. 71:1756-1763 (1988)). Suitable fusion partners are as discussed in Section "Biological agents".
- the Ligand of present invention can be introduced into viral particles in order to change a tropism of virus.
- Different viruses are capable of being used as vectors for the in vivo transfer and expression of genes.
- retroviruses RSV, HMS, MMS, and the like
- HSV virus adeno-associated viruses
- adenoviruses vaccinia virus, and the like
- vaccinia virus vaccinia virus
- the targeting of adenoviruses can be provided by construction of chimeric adenovirus fiber protein, which differs from the wild-type coat protein by the introduction of the Ligand amino acid sequence in a conformationally-restrained manner.
- a chimeric adenovirus fiber protein will be able to direct entry into cells of a vector comprising the chimeric fiber protein that is more efficient than entry into cells of a vector that is identical except for comprising a wild-type adenovirus fiber protein rather than the chimeric adenovirus fiber protein.
- the Ligand encoding sequence is introduced into the fiber protein at the level of gene expression.
- Such the Ligand amino acid sequence either is introduced in place of adenoviral sequences, or in addition to adenoviral sequences. Regardless of the nature of the introduction, its integration into an adenoviral fiber protein at the level of either DNA or protein, results in the generation of a SEQ. ID. NO.: 6 peptide motif in the chimeric fiber protein.
- Redirecting viral vectors to CNS and enhancing of transport through biological barriers can be achieved by using bispesific conjugates produced by chemical linkage of anti-virus antibody to the Ligand of present invention, as described, for example for anti-adenovirus antibody (Haisma HJ., et al., Cancer Gene Ther., 2000, Alvarez RD., et al., Clin. Cancer Res., 2000).
- genetically fused proteins comprising of anti-fiber knob AB (or cellular adenovirus receptor, CAR) and the Ligand can be produced (Dmitriev I et al., J. Virol, 2000).
- a composition comprising a Ligand of the present invention, a biological agent, and/or a carrier can be administered orally, topically, rectally, vaginally, by pulmonary route by use of an aerosol, or parenterally, i.e. intramuscularly, subcutaneously, intraperitoneallly or intravenously.
- the ligand composition can be administered alone, or it can be combined with a pharmaceutically acceptable carrier or excipient according to standard pharmaceutical practice.
- the ligand compositions can be used in the form of tablets, capsules, lozenges, troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like.
- carriers that can be used include lactose, sodium citrate and salts of phosphoric acid.
- Various disintegrants such as starch, and lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc, are commonly used in tablets.
- useful diluents are lactose and high molecular weight polyethylene glycols.
- the polynucleotide compositions can be combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring agents can be added.
- sterile solutions of the conjugate are usually prepared, and the pH of the solutions are suitably adjusted and buffered.
- ointments or droppable liquids may be delivered by ocular delivery systems known to the art such as applicators or eyedroppers.
- Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or poly(vinyl alcohol), preservatives such as sorbic acid, EDTA or benzylchromium chloride, and the usual quantities of diluents and/or carriers.
- diluents and/or carriers will be selected to be appropriate to allow the formation of an aerosol.
- the dosage for a biological agent in a composition comprising inter alia, a Ligand of the present invention, will be set by the prescribing medical professional considering many factors including the age, weight and condition of the patient and the pharmacokinetics of the agent. Often the amount of the composition of the invention of an agent required for effective treatment may be less than the amount required using the free biological agent.
- an effective amount is an amount effective to either (1) reduce the symptoms of the disease sought to be treated or (2) induce a pharmacological change relevant to treating the disease sought to be treated.
- an effective amount includes an amount effective to: reduce the size of a tumor; slow the growth of a tumor; prevent or inhibit metastases; or increase the life expectancy of the affected animal.
- the metabolites of various biological agents create or enhance the unwanted effects resulting from administering the agent. For example, this is certainly the case for anthracycline-based drugs, where metabolites are believed to lead to cardiotoxicity. See, Mushlin et al., Br. J. Pharmacol. 110: 975-982 (1993).
- the ligand compositions of the invention can reduce the rate of metabolism for biological agents, thereby reducing the potential for harmful side effects.
- Penetration of the small intestine or blood brain barrier by a biological agent can be measured by a number of techniques, as will be recognized by those of ordinary skill in the art. Such methods include isotope labeling, assessing animal behavior for the effects of a biological agent, and measuring lethal dosages for drugs with toxic effects that occur at the brain. Such methods further include measuring decreases in the dosage required to elicit the appropriate biological response.
- fluconazole Although fluconazole has a low incidence of side effects, the incidence of resistance is an increasing problem. Delivery vehicles that are effective in enhancing chemotherapeutic activity and reversing resistance to such agents is therefore desirable for this agent, as well as for other antimicrobial agents.
- the starting material for the synthesis was 0.6 g (0.4 mmol) of Rink Amide resin (4-(2',4'- Dimethoxyphenyl-Fmoc-aminomethyl)-phenoxy resin) substituted at a level of 0.66 mEq per gram of resin (Nova Biochem, CA).
- Rink Amide resin 4-(2',4'- Dimethoxyphenyl-Fmoc-aminomethyl)-phenoxy resin substituted at a level of 0.66 mEq per gram of resin (Nova Biochem, CA).
- Each of the amino acids, starting with C-terminal glycine was added in sequence in a synthesis cycle comprising the steps of: piperidine deprotection (step 1), coupling (step 2) and ninhydrin test (step 3). If the test showed incomplete coupling, the coupling step was repeated.
- NO.:l was completed with additional Fmoc-deprotection (step 1), and acetylation (step 4), followed by trifluoroacetic acid cleavage (step 5) and purification (step 6). All the operations were performed in a glass reactor with a glass frit for draining the solvent. The resin was agitated with the solvents and the respective solutions using a shaker rotating the reactor for 180 degree.
- the Fmoc- protecting group was removed from the starting resin, or from the ⁇ -amino nitrogen of the amino acid previously attached to the resin, by treating the resin twice with 20% piperidine in dimethylformamide (DMF) (20 mL) for 3 min, and for 17 min. The resin was then washed six times with 10 mL of DMF, each wash taking one minute.
- DMF dimethylformamide
- the resin was agitated with acetic anhydride (0.22 mL) and dusopropylethylamine (0.84 mL) in 5 mL DMF for 90 minutes at room temperature.
- the resin was agitated with 5(and 6-)-tetramethylrhodamine (0.9 g dissolved in 5 mL DMF), PyBOP (1.25 g dissolved in 3 mL DMF), and dusopropylethylamine (0.84 mL) for 120 min.
- the resin was washed 6 times with DMF, twice with DMF/methanol (1:1 v/v), and three times with methanol, and dried in vacuum for 1 hour.
- a mixture of trifluoroacetic acid (TFA, 8.5 mL), water (0.5 mL), phenol (0.5 mL) and thioanisol (0.5 mL) was added to the dry resin, and was agitated for 5 hours.
- the liquid was drained, and the resin was washed with 2 mL TFA. Combined liquids were evaporated in a stream of dry nitrogen. The residue was washed twice with 20 mL of anhydrous ether, and the product was dissolved in water (20 mL), and freeze dried.
- the lyophilized powder was dissolved in water (10 mg of crude peptide in 2 mL) and loaded onto a Vydac C18 preparative column (25x2.25 cm). The column was eluted with a two-component eluent gradient 0.5% per minute, starting from 10% of solution B in solution A, at flow rate 5 mL/min. Solution A was 0.1% TFA in H 2 0, and solution B was 0.1% TFA in CH 3 CN. Fractions 60-80 mL after the void volume were pooled together and freeze-dried. The product was then dissolved in CH 3 COOH:H 2 0 (1:9, v/v, 1 mL per 1 mg of product), and freeze-dried.
- Caco-2 cells were cultured in Dulbecco's Modified Eagle Medium (D-MEM) (Life Technologies), supplemented with 10% fetal bovine serum at 37 ° C in humidified atmosphere with 5% C0 2 .
- D-MEM Dulbecco's Modified Eagle Medium
- the desired numbers of Transwell (6.5mm diameter, 0.4 ⁇ m pore size) were placed in the wells of the tissue culture plates.
- the filters were wetted with medium (0.1 ml to the apical and 0.6 ml to the basolateral sides of Transwell) for 30 min in the C0 2 incubator before the harvest of the cells from the flasks.
- the cells were re-suspended in the medium 5 x 10 5 cells / ml and 0.2ml of cell suspension medium was added to the apical side of the Transwell and cultured in the C0 2 incubator.
- the medium was changed every second day for 8-12 days to obtain well- differentiated monolayers suitable for transport experiences.
- the cell monolayers on the insert filter apically and basolaterally were rinsed twice on each side with PBS and pre-incubated with pre-warmed D-MEM for 30 min.
- the medium in apical chamber was gently removed.
- the fresh pre-warmed D-MEM (1.2 ml) was placed to new basolateral chamber ("FALCON" 3504 Tissue Culture Plate).
- the inserts were transferred to the new chamber.
- Fluoresceine-labelled dextrane MW 3000 from Molecular Probes
- Peptide SEQ. ID. NO.: 2 or SEQ. ID. NO.: 3 was added to the apical sides to give the concentration 50 micromol/L.
- Cb is a concentration of compound in basolateral chamber
- Ca is a concentration of compound in the apical chamber
- Vb is a volume of media in basolateral chamber
- Va is a volume of media in the apical chamber.
- the concentration of peptide in sample was determined by the fluorescence of the sample using excitation 530 nm, emission 590 nm.
- the concentration of dextran in samples was determined by the fluorescence of the sample using excitation 480 nm, emission 530 nm.
- peptide SEQ. ID. NO.:2 Digestion of peptide SEQ. ID. NO.:2 in apical chamber was determined using HPLC. The samples were diluted 100 times with the media, and 0.200 mL of each was injected on a column RP-HPLC column Vydac 218TP54, pre equilibrated 15 minutes with 5 acetonitroile/water (10 mM phosphoric acid) at flow rate 1 mL per minute. Sample was eluted with two component gradient 1% per minute of acetonitrole (10 mM phosphoric acid) / water (10 mM phosphoric acid) at flow rate 1 mL per minute. Fluorescent detection was used with excitation wavelength 555 nm and emission wavelength 580 nm. The peptide SEQ. ID. NO.: 2 was eluted as sharp peak at 22.3 min. The percentage of remaining peptide was calculated as:
- T A/SUM(Ai) where A - area under the peak at 22.3 min, SUM(Ai) - the sum of area of all peaks eluted between 13 and 26 minutes.
- a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 was expressed as a fusion protein with minor coat protein III of E.coli bacteriophage Ml 3.
- the linearized vector contained two non- complementary Sfi I ends, cannot be self ligated and allows oriented ligation of oligonucleotides with the appropriate cohesive ends.
- the oligonucleotide inserts coding a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 were synthesized by automatic solid phase oligonucleotide synthesis and purified by reverse phase chromatography.
- the sequence of the oligonucleotide, OLIGO ID. NO.:l, encoding a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 is the following:
- oligonucleotide comprising a DNA sequence of OLIGO ID. NO.:l was annealed to two "half- site" fragments, OLIGO ID NO 2 and OLIGO ID. NO.: 3 to form cohesive termini complementary to Sfi I sites 1 and 2 in the vector.
- Oligonucleotides were phosphorylated with T4 kinase, and annealed in 20 mM Tris-HCl, pH 7.5, 2 mM MgCl 2 , 50 mM NaCl, by mixing 1.5 ⁇ g OLIGO ID NO 2, 1.2 ⁇ g OLIGO ID. NO.: 3, and 0.5 ⁇ g OLIGO ID. NO.: 1, heating to 65°C for 5 minutes and allowing the mixture to cool slowly to room temperature. This mixture represented an approximate molar ratio of 5:100:100 (OLIGO ID. NO.:l: OLIGO ID NO.: 2: OLIGO ID. NO.: 3).
- the annealed oligonucleotide insert (200ng) was then ligated to 20 ⁇ g of Sfi-I-cut fUSE5 RF DNA (molar ratio 1:5) to produce a double-stranded circular molecule with a small, single stranded gap.
- the annealed DNA was ligated in 20 mM Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 2 mM DTT, 1 mM ATP, by the addition of 20 units of T4 DNA ligase and incubated overnight at 15°C.
- the ligated DNA was ethanol precipitated in the presence of 0.3M sodium acetate, resuspended in water and electro- transformed into competent E.
- E.coli MC1061 cells using a Gene Pulser electroporation apparatus (Bio Rad) at l,8kV/cm, 200 ⁇ , 25mF. After electroporation, E.coli cells were allowed to reparate at 37° C for 1 hour in 2 ml of SOC medium (2% Bacto tryptone, 0.5% Bacto yeast extract, lOmM NaCl, 2.5 mM KC1, 10 mM MgCl 2 , 10 mM MgS04, 20 mM glucose, 0.2mg/ml tetracycline) and plated on Petri dishes with Luria-Bertani (LB) agar, containing lOOmg/ml kanamycine and 40mg/ml tetracycline.
- SOC medium 2% Bacto tryptone, 0.5% Bacto yeast extract, lOmM NaCl, 2.5 mM KC1, 10 mM MgCl 2 , 10 mM MgS04, 20
- OLIGO ID NO 1 0 LENGTH: 54 nucleotides .
- TYPE nucleotide GGGCCGGTAGGGTGCTGGACGGTGACCGGACGCGTTGGGGTGGTGGCGCTTCTG
- Caco-2 cell monolayers In vitro rates of drug transport across Caco-2 cell monolayers are frequently used to obtain an initial prediction of oral bioavailability for therapeutic compounds.
- This cell line was established by Fogh in 1977 (Fogh J., et al, J.Natl. Acad. Sci. 59 (1977) 221-226) as immortalized cell line derived from human colon carcinoma.
- Caco-2 cells can grow as a polarized monolayer on porous support and demonstrate morphological characteristics of intestinal epithelium (well-defined brush border on the apical face expressing typical small intestine hydrolases and markers, and well-formed tight junctions between the cells).
- Caco-2 cells were cultured in Dulbecco's Modified Eagle Medium (D-MEM) (Life Technologies), supplemented with 10% fetal bovine serum at 37 ° C in humidified atmosphere with 5% C0 2 .
- D-MEM Dulbecco's Modified Eagle Medium
- the desired numbers of Transwell (6.5mm diameter, 0.4 ⁇ m pore size) were placed in the wells of the tissue culture plates.
- the filters were wetted with medium (0.1 ml to the apical and 0.6 ml to the basolateral sides of Transwell) for 30 min in the C0 2 incubator before the harvest of the cells from the flasks.
- the cells were re-suspended in the medium 5 x 10 5 cells/ml and 0.2ml of cell suspension medium was added to the apical side of the Transwell and cultured in the C0 2 incubator. The medium was changed every second day for 8-12 days to obtain well- differentiated monolayers suitable for transport experiences.
- the cell monolayers on the insert filter apically and basolaterally were rinsed twice on each side with PBS and pre-incubated with pre-warmed D-MEM for 30 min.
- the medium in apical chamber was gently removed.
- the fresh pre-warmed DMEM (1.2 ml) was placed to new basolateral chamber ("FALCON" 3504 Tissue Culture Plate).
- the inserts were transferred to the new chamber.
- 3 H-Manitol was used as a probe to monitor Caco-2 monolayer leakiness.
- HCEC cultures are derived from small samples of human temporal lobe excised surgically from patients treated for idiopathic epilepsy and are routinely isolated and maintained in culture.
- HCEC demonstrated a polygonal, 'cobblestone' morphology, immunoreactivity for the endothelial cell markers, factor VIH-related antigen and angiotensin-converting enzyme, and high levels of the BBB-specific markers, enzymes GGTP and alkaline phosphatase (ALP), glucose transporter-1 (GLUT-1), HT7 antigen (26, 27), and express MDR-phenotype (mdr-1), an important feature of the BBB.
- ALP alkaline phosphatase
- GLUT-1 glucose transporter-1
- HT7 antigen 26, 27
- MDR-phenotype MDR-phenotype
- a compartmentalized BBB model comprises a monolayer of HCEC grown on semi-permeable membranes positioned between two separated compartments.
- the bottom chamber of the insert assembly contains growth medium supplemented with the fetal human astrocyte (FHAS)-conditioned medium in a 1:1 (v/v) ratio.
- FHAS-conditioned medium is obtained by incubating confluent FHAS in a serum free M199 for 72 hr, and has been shown to induce markers of the BBB phenotype in HCEC.
- TEER transendothelial electrical resistance
- the relative transport of compounds was calculated as described in Example #3.
- the phage that expresses a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 was able to cross HCEC monolayers with efficacy 1000 fold higher than control phage.
- the compounds of the invention are tested for their ability to transport proteins across intestinal barrier.
- a peptide comprising an amino acid sequence of SEQ. ID. NO.:l was chemically conjugated to the carrier protein.
- the carrier protein for example horseradish peroxidase (ICN, 250u/mg) was dissolved in phosphate buffer (0,1M Na2HP04, 0,1M NaCl, ImM EDTA and pH 8,5) at final concentration 3mg/ml.
- N-succinimidyl- 3-(2-pyridylthio)propionate (SPDP, Sigma Chemical) was dissolved in 133,ul of dimethylformamide (DMFA), in a proportion of 0.234 mg SPDP 39 ul DMFA.
- SPDP dimethylformamide
- the solution of peroxidase was applied to the Sephadex G-25 column (Fisher, 20 ml) and eluted with 50 ml of phosphate buffer. Detect at 280nm with a sensitivity of 50 and lamp intensity of 0.005 Au.
- the fractions (1ml) were collected using a fraction collector (Pharmacia Biotech).
- the fractions containing modified Peroxidase were selected and combined (total volume of 5-7 ml). An aliquot of 1 ml was kept for the control.
- a number of activated groups were evaluated by treatment of the aliquot of activated protein with lmg/ml of L-cysteine methyl ester hydrochloride (Aldrich Chemical).
- the amount of recovered 2-pyridyl disulphide was measured by UV absorbency at 343nm.
- the control sample was treated with cysteine for 15 hours at room temperature, purified by gel filtration and used as a reference in receptor binding assays.
- 1 mg of a peptide comprising an amino acid sequence of SEQ. ID. NO.:2 was dissolved in 200 ⁇ l of phosphate buffer.
- Activated peroxidase was mixed with the peptide and incubated with stirring for 24 hours, at room temperature.
- the reaction was controlled by UV detection at 343nm (detection of 2-pyridyl disulphide).
- the conjugate was purified by gel filtration using a Sephadex G-25 column.
- conjugate fractions were collected and combined, and the protein concentration was determined using a Bradford assay (Coomasie blue, Bio-Rad). Conjugation of the peptide comprising an amino acid sequence of SEQ. ID. NO.: 1 was confirmed by SDS/PAGE electrophoresis. Peroxidase activity of the conjugate per mg of protein was determined by incubation of conjugate aliquots with ABTS solution (0.22mg/ml 2 2 v -azino-bis-93 v - ethylbenzthiazoline-6-sulphonic acid) diammonium salt, 0.05M citric acid, pH 4.0, 0.05% H 2 0 2 ) for 30 min at room temperature and detection the absorbance at 405 nm.
- ABTS solution 0.22mg/ml 2 2 v -azino-bis-93 v - ethylbenzthiazoline-6-sulphonic acid
- a two-chamber Caco-2 model was used to evaluate the transport of a conjugate comprising peroxidase and a peptide comprising an amino acid sequence of SEQ. ID. NO.: l across the intestinal barrier (IB) in vitro.
- Caco-2 cell monolayers were prepared as described in Example 4 above.
- the medium containing isotope-labeled compound, the SEQ. ID. NO.:l-Peroxidase conjugate (25 g/ml) or Control Peroxidase conjugate (25 g/ml) was added to the apical side of cultured Caco-2 monolayers.
- mice Female Sprague Dawley rats, weighing 150 to 175 g, were received from Charles River Canada Inc. (St. Constant, Quebec, Canada). The animals were kept 3 per cage with an air filter cover under light (12h light/dark cycle, light on at 06h00) and temperature (22° + l°C)-controlled environment. All manipulations with the animals were performed under a sterilized laminar hood. The animals had ad libitum access to Purina mouse chow (Pro Lab PMH 4018, Trademark of Agway, Syracuse, New York), and water.
- the animal studies were conducted according to the "Guidelines for Care and Use of Experimental Animals.” The animals were randomly divided into two following groups (control phage and phage that expresses a peptide comprising an amino acid sequence of SEQ. ID. NO.:4) and anesthetized with "KETASET" (Wyeth- Ayerst Canada Inc., Ontario).
- the small intestine was exposed with surgical instruments and the phage sample solutions (lxlO 11 cfu in 200ul of PBS, pH 7.5) were gently injected into small intestine. The blood samples were collected at 5; 30; 60 and 120 min after the phage administration inside the small intestine.
- phage titer cell transducting units per ml of plasma
- results represented in the Table 5 set forth that the that expresses a peptide comprising an amino acid sequence of SEQ. ID. NO.: l could reach the bloodstream with 10,000 fold higher efficacy than control phage.
- Rats Female Sprague Dawley rats, weighing 150 to 175 g Rats (3 per group) were injected IN. with 10 12 cfu/100 » 1 of either a phage that expresses a peptide comprising an amino acid sequence of SEQ. ID. ⁇ O.:4 or a control phage. Blood samples were collected in 5 min, 30 min, 1 h and 2 hours after injection. Phage titer in the blood samples was detected (Table 5). After 24 h, the animals were sacrificed and the brain, heard, liver, lung and kidney of the animals were harvested.
- each of these organs for each animal was homogenized, and the titer of phage in the organs (cell transducting units per gram of tissue) was determined as described in Pasqualini R. et. al.. Nature 380:364-366 (1996).
- the organ biodistribution of phage is presented in the Table 6.
- a high accumulation of the phage that expresses a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 was detected in the brain, kidney, lung and the heart of analyzed animals.
- the 80-fold higher accumulation of the phage that expresses a peptide comprising an amino acid sequence of SEQ. ID. NO.:4 was detected in the brain compared levels of control phage detected in the brain.
- Caco-2 cells were cultured in Dulbecco's Modified Eagle Medium (D-MEM) (Life Technologies), supplemented with 10% fetal bovine serum at 37 ° C in humidified atmosphere with 5% C0 2 , and grown in Transwell system as described in Example 4.
- D-MEM Dulbecco's Modified Eagle Medium
- the cell monolayers on the insert filter apically and basolaterally were rinsed twice on each side with PBS and pre-incubated with pre-warmed D-MEM for 30 min.
- the medium in apical chamber was gently removed.
- the fresh pre-warmed D-MEM (1.2 ml) was placed to new basolateral chamber ("FALCON" 3504 Tissue Culture Plate).
- the inserts were transferred to the new chamber.
- 3 H-Manitol was used as a probe to monitor Caco-2 monolayer leakiness.
- SEQ. ID. NO.:4 The single point mutations in the phage insert coding amino acid sequence SEQ. ID. NO.:4 were produced as described previously in Hoess, R., et al. Gene, 128:43-49 (1993). Briefly, a series of SEQ. ID. NO.:4 coding oligonucleotides in with a particular amino acid coding triplet was changed to GCT (alanine coding triplet) were synthesized. Mutated oligonucleotides were cloned in to fUSE5 phage vector as described in Example 3. All mutant phage clones were purified and verified by DNA sequencing.
- the murine erythropoietin (mEPO) gene was cloned in pcDNA/Ampl.l expression vector using RT/PCR.
- CDNA encoded mEPO was obtained by reverse transcription of mRNA extracted from kidneys of mice treated for 3 days with phenylhydrazine (Shoemaker CB., et al., Mol.Cel.Biol. (1986)).
- Amplification of DNA was performed using the sense 5'-ATAACAAGCTTGGCGCGGAGATGGGGGTG and antisense 5'ATAACTCTAGAACGGTGGCAGCAGCATGTCAC primers.
- the amplified mEPO gene was inserted into the Xbal and Hind HI sites of pcDNA/Ampl.l, and sequence was confirmed by DNA sequencing.
- Cos-7 cells were transfected with pCMV/EPO plasmide, and expression of recombinant mEPO was evaluated by Quantikine IVD Erythropoietin ELISA kit. The physiological activity of recombinant mEPO was evaluated in vivo by measured of hematocrit.
- Double strand DNA fragment was synthesized by using DNA extension reaction and short complementary oligo. Further, the SEQ. ID. NO.:4 encoding DNA was restricted by Xba I and cloned in open reading frame of mEPO into pCMV/EPO vector. Structure of SEQ. ID. NO.:4-EPO fusion protein was confirmed by DNA sequencing.
- Paclitaxel was esterified using maleimidepropionic acid to produce paclitaxel-2' maleimidepropionate (step 1).
- Paclitaxel-2' maleimidepropionate was then conjugated with peptide (SEQ. ID. NO.:l), and produced the product paclitaxel (S-maleimidepropionate)-peptide(SEQ. ID. NO.: 1).
- the product was purified by HPLC. Solution of paclitaxel (6 mg, 0.01 mmol) in 0.1 mL dimethylformamide was mixed with maleimidepropionic acid (2.5 mg) solution in 0.1 mL dimethylformamide, and dicyclohexylcarbodiimide (3 mg solution in 0.1 mL dimethylformamide).
- the mixture was stirred for 60 minutes.
- the mixture was fractionated using reverse phase HPLC with water - acetonitrile gradient (1% per minute, starting from 10% acetonitrile).
- the fractions containing the product paclitaxel-2' maleimidepropionate were identified by MS (m/z 1003.3).
- Paclitaxel-2' maleimidepropionate (1 mg dissolved in 0.1 mL dimethylformamide) was mixed with peptide SEQ. ID. NO.:l (2 mg dissolved in 0.02 mL DMF), and was stirred for 18 hrs. Then the mixture was diluted with 2 mL water and freezedried. The remaining material was purified with using reverse phase HPLC with water - acetonitrile gradient (1% per minute, starting from 10% acetonitrile). The fractions containing the product paclitaxel-(S-maleimidepropionate)-peptide (SEQ. ID. NO.: l)) were identified by MS (m/z 1240 double charged).
- Leucyl-doxorubicin was modified using the heterobifunctional linker maleimidepropionic acid N- hydroxysuccinimide ester, and gave the produced maleimidepropionylleucyl-doxorubicin (step 1).
- the conjugate peptide (SEQ. ID. NO.: l)-(S-maleimidepropionylleucyl-doxorubicin) was then prepared by reaction of maleimidepropionylleucyl-doxorubicin with peptide SEQ. ID. NO.: 1 (step 2).
- Yi is positively charged amino acid such as Arg or Lys
- Y 2 is Val, Leu, Re or Met
- Y 3 is negatively charged amino acid such as Glu or Asp
- Y is negatively charged amino acid such as of Glu or Asp
- Y 5 is Thr or Ser
- X is any amino acid
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicinal Preparation (AREA)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2001/000926 WO2001090139A2 (en) | 2001-05-07 | 2001-05-07 | A ligand for enhancing oral and cns delivery of biological agents |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1385873A2 true EP1385873A2 (en) | 2004-02-04 |
Family
ID=11004110
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01934229A Withdrawn EP1385873A2 (en) | 2001-05-07 | 2001-05-07 | A ligand for enhancing oral and cns delivery of biological agents |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1385873A2 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2004514410A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2001260526A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2408387A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2001090139A2 (cg-RX-API-DMAC7.html) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7723296B2 (en) | 2001-01-18 | 2010-05-25 | Genzyme Corporation | Methods for introducing mannose-6-phosphate and other oligosaccharides onto glycoproteins and its application thereof |
| FR2830016B1 (fr) * | 2001-09-27 | 2004-06-25 | Synt Em | Compositions pour la vectorisation de derives taxoides a travers la barriere hematoencephalique et leur utilisation pour le traitement des cancers, plus particulierement des cancers du cerveau |
| EP1877099B1 (en) | 2005-04-06 | 2012-09-19 | Genzyme Corporation | Therapeutic conjugates comprising a lysosomal enzyme, polysialic acid and a targeting moiety |
| WO2008089403A2 (en) | 2007-01-18 | 2008-07-24 | Genzyme Corporation | Oligosaccharides comprising an aminooxy group and conjugates thereof |
| CN102369023A (zh) | 2008-12-16 | 2012-03-07 | 建新公司 | 寡糖-蛋白缀合物 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0599303A3 (en) * | 1992-11-27 | 1998-07-29 | Takeda Chemical Industries, Ltd. | Peptide conjugate |
| US6635623B1 (en) * | 1997-06-13 | 2003-10-21 | Baylor College Of Medicine | Lipoproteins as nucleic acid vectors |
| US6015787A (en) * | 1997-11-04 | 2000-01-18 | New England Medical Center Hospitals, Inc. | Cell-permeable protein inhibitors of calpain |
-
2001
- 2001-05-07 EP EP01934229A patent/EP1385873A2/en not_active Withdrawn
- 2001-05-07 WO PCT/IB2001/000926 patent/WO2001090139A2/en not_active Ceased
- 2001-05-07 JP JP2001586326A patent/JP2004514410A/ja active Pending
- 2001-05-07 AU AU2001260526A patent/AU2001260526A1/en not_active Abandoned
- 2001-05-07 CA CA002408387A patent/CA2408387A1/en not_active Abandoned
Non-Patent Citations (2)
| Title |
|---|
| KOSSMANN J. ET AL: "Sequence analysis of the chromosomal and plasmid genes encoding phosphoribulokinase from Alcaligenes eutrophus", GENE, vol. 85, 1898, pages 247 - 252 * |
| See also references of WO0190139A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2004514410A (ja) | 2004-05-20 |
| AU2001260526A1 (en) | 2001-12-03 |
| WO2001090139A2 (en) | 2001-11-29 |
| CA2408387A1 (en) | 2001-11-29 |
| WO2001090139A3 (en) | 2002-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7112654B2 (en) | Ligand for vascular endothelial growth factor receptor | |
| US10745442B2 (en) | Compstatin analogs with improved pharmacokinetic properties | |
| US6696274B2 (en) | Ligand for enhancing oral and CNS delivery of biological agents | |
| EP3998077B1 (en) | Cholix toxin-derived fusion molecules for oral delivery of biologically active cargo | |
| AU2019218786B2 (en) | Cell-permeable stapled peptide modules for cellular delivery | |
| JP2003514852A (ja) | 炎症反応を阻害する細胞透過性ペプチドおよび使用方法 | |
| US20090252703A1 (en) | Use of alcohol co-solvents to improve pegylation reaction yields | |
| US20230414702A1 (en) | Compounds and pharmaceutical use thereof in the treatment of cancer | |
| CN115485287A (zh) | Panx1相关疾病的治疗 | |
| WO2001090139A2 (en) | A ligand for enhancing oral and cns delivery of biological agents | |
| JP2004514410A5 (cg-RX-API-DMAC7.html) | ||
| CN112543807B (zh) | 片段化的grs多肽、其变体及其应用 | |
| CN106536548A (zh) | Dr3变体及其用途 | |
| US20050277575A1 (en) | Therapeutic compositions and methods for treating diseases that involve angiogenesis | |
| US20260041753A1 (en) | Respiratory syncytial virus surface glycoprotein peptides, conjugates, and uses thereof | |
| CN121627860A (zh) | 一种靶向cxcr1/2的母体肽或衍生肽及其应用 | |
| EP4676938A2 (en) | Hendra virus and nipah virus surface glycoprotein peptides, conjugates, and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20021127 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: ALAKHOV, VALERY Inventor name: PIETRZYNSKI, GRZEGORZ Inventor name: LI, SHENGMIN Inventor name: TCHISTIAKOVA, LIOUDMILA |
|
| 17Q | First examination report despatched |
Effective date: 20050317 |
|
| 17Q | First examination report despatched |
Effective date: 20050317 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070217 |