Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1241—Nucleotidyltransferases (2.7.7)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/53—DNA (RNA) vaccination
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the invention relates to the identification of cellular genes involved in oncogenesis, and in particular capable of playing a role in hepatic carcinogenesis.
• HBV hepatitis B virus
• HCC hepatocellular carcinoma
• Cirrhosis characterized by hepatocyte regeneration and hepatic fibrosis, is a pre-tumor pathology which progresses to HCC with a frequency of 5% per year; b) the viral genome determines the expression of viral proteins (X, truncated PreS2 / S protein) which can directly modulate the pathways
• HBV insertional mutagenesis was an anecdotal event in HCC.
• the authors of the present invention have now managed to screen 45 HBV-positive CHC tumors and to isolate therefrom 21 sites from these. Integration of HBV into the cell genome, from 18 tumors. 13 cellular genomic sequences flanking these integration sites were thus identified. 11 of these sequences indicated the existence of genes of interest near the integration sites. These genes correspond either to previously unknown genes, or to known genes but whose implication in oncogenesis had not been reported or confirmed. These are in particular the sequences of the following known genes:
• TRAP 150 a protein of a nuclear receptor co-activator complex (protein designated "Thyroid hormone Receptor Associated Protein"), (Ito et al, 1999);
• hTERT gene which codes for human telomerase, which catalyzes the synthesis of telomeric DNA from chromosomes (Urquidi et al, 2000);
• IP 3 R 1 inositol receptor 1, 4,5-triphosphate type 1 which codes for an intracellular calcium channel, located at the level of the membrane of the endoplasmic reticulum, and which controls the release of calcium from this compartment towards the cytosol, in response to signals induced by tyrosine kinase receptors and plasma membrane receptors coupled to G proteins.
• SEQ ID No. 1 is the cell nucleotide sequence close to an integration site of HBV in the tumor designated FR7 by the inventors, the sequence SEQ ID No. 2 being the transcribed part of this sequence.
• sequences SEQ ID No. 3 to No. 10 are the nucleotide sequences present uniquely in the cell genome, which are proximity of HBV integration sites, respectively in tumors designated 54T, 83T, 95T, FR2, FR3, SA1, SA2, and GR2S.
• sequence SEQ ID No. 11 represents the cell sequence found near the site of insertion of the HBV into the tumor designated 77T by the inventors (cell sequence which is found in the sequence of the genomic clone AL035461 of Genbank).
• sequences SEQ ID No. 1, 3 to 11, 20 and 23-24 correspond to the 13 cellular sequences flanking the integration sites of the HBV genome.
• sequence SEQ ID No. 12 is the cDNA sequence isolated from a normal liver by the inventors, identified by them as coding for a new protein member of the family of proteins MCM (for "Minichromosome maintenance", Bik K . Tye, 1999), and designated MCM8.
• the corresponding amino acid sequence is represented by SEQ ID No. 13.
• the nucleotide sequences SEQ ID No. 14, 16 and 18 are also transcribed sequences of the MCM8 gene, following three different splices.
• the sequences SEQ ID No. 15, 17 and 19 represent the amino acid sequences encoded respectively by these nucleotide sequences.
• the sequence SEQ ID No. 20 represents the cell sequence found near the site of insertion of the HBV into the tumor designated 100T by the inventors (corresponding to the TRAP 150 gene), the sequence SEQ ID No. 21 being the sequence of the CDNA of the TRAP 150 gene, and the sequence SEQ ID No. 22, the corresponding amino acid sequence.
• the sequences SEQ ID No. 23 and 24 represent the cellular sequences found near sites of integration of HBV in the tumors designated 83T and 86T respectively, corresponding to the hTERT and hSERCA genes
• sequence SEQ ID No. 25 represents the cDNA sequence of the complete SERCA 1 gene and the sequence SEQ ID No. 26, the corresponding amino acid sequence.
• sequences SEQ ID No. 27 and 29 are transcribed sequences of the SERCA1 gene, designated respectively S1T + 4 and S1 T-4, produced by splicing exon 11 and alternative splicing of Pexon 4 (the form S1T-4 having a splicing of exon 4 and exon 11, and the form S1T + 4 having only a splicing of the exon 11).
• the sequences SEQ ID No. 28 and 30 are the corresponding amino acid sequences, respectively.
• the sequences SEQ ID No. 31 and 33 represent the genes identified close to the cell sequence (SEQ ID No. 4) flanking one of the two integration sites of HBV in the tumor designated 83T, and correspond respectively to the new gene called 83T and the CCT7 gene.
• sequences SEQ ID No. 32 and 34 are the polypeptide sequences corresponding to the sequences SEQ ID No. 31 and 33.
• sequences SEQ ID No. 35, 37, 39, 41 and 43 represent the genes identified near the cellular sequences flanking the integration sites of HBV in tumors 54T, 95T, FR2, SA1 and SA2 respectively, corresponding to the gene for the Nuclear Matrix Protein p84, with the TRKB, TRUP, ST3GalVI and IP3R1 genes; the sequences SEQ ID No. 36, 38, 40, 42 and 44 being the corresponding polypeptide sequences.
• a first aspect of the invention therefore relates to a method for detecting genes involved in oncogenesis by identifying genes containing or located near a cellular nucleotide sequence flanking an integration site of the HBV genome.
• the detection method according to the invention notably comprises the steps consisting in extracting DNA from a tumor liver tissue, amplifying in nucleotide sequence at the viral DNA / cellular DNA junction, in sequencing said nucleotide sequence, and identifying one or more genes comprising or located near said sequence thus sequenced.
• DNA extraction from tissues is carried out according to methods well known to those skilled in the art, for example by phenol extraction preceded or not by proteinase K digestion.
• the identification of the genes of interest is carried out by comparison of sequence with known genes deposited in databases or with genes predicted by sequence analysis software, such as Genescan, in genomic clones or supercontigs.
• the amplification step is based on an Alu-PCR technique using primers specific for the HBV-X gene and for the Alu repeat sequence (Minami et al, 1995).
• a first amplification involves primers synthesized with dUTP instead of dTTP. These primers are destroyed after 10 replication cycles, in particular by the enzyme uracyl DNA glycosylase. Only the specifically targeted sequences are then amplified with a primer specific for the HBV-X region and a tag sequence introduced into the primer specific for the Alu sequence.
• amplification involves four amplification steps successively using the pairs of primers HB1 (SEQ ID No. 47) / A5 (SEQ ID No.
• nucleic acid comprising a cellular nucleotide sequence chosen from SEQ ID No. 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 23 and 24, or located near one of these sequences.
• this nucleic acid will correspond to a gene.
• the present invention relates in particular to the use of the sequence SEQ ID No. 7 or SEQ ID No. 10 for the identification of genes involved in oncogenesis. More particularly, the invention relates to the use of the sequence SEQ ID No. 7 or SEQ ID No. 10 for the identification of new genes located close to these sequences.
• the invention relates in particular to an isolated nucleic acid, comprising a nucleotide sequence chosen from SEQ ID No. 2, 12, 14, 16, 18, 27, 29, 31, 45, 1, 3, 4, 5, 6, 7 , 8, 9, 10 and 11 or a nucleotide sequence as it codes for one of the amino acid sequences SEQ ID No. 13, 15,
• homologous sequences of said identified sequences are also included, defined as: i) sequences similar to at least 70% of one of the identified sequences; or ⁇ ) sequences hybridizing with one of said identified sequences or its complementary sequence, under stringent hybridization conditions, or iii) sequences coding for a polypeptide, as defined below.
• a homologous nucleotide sequence according to the invention is similar to at least 75% of the identified sequences, more preferably at least 85%, or at least 90%.
• such a homologous nucleotide sequence specifically hybridizes to the sequences complementary to one of the sequences identified under stringent conditions.
• the parameters defining the stringency conditions depend on the temperature at which
• Tm 50% of the paired strands separate (Tm).
• Tm 50% of the paired strands separate (Tm).
• Tm 4 (G + C) + 2 (A + T).
• the hybridization temperature can preferably be 5 to 10 ° C below Tm, and the hybridization buffers used are preferably force solutions high ionic content such as 6xSSC solution for example.
• similar sequences used above refers to the perfect resemblance or identity between the nucleotides compared but also to the non-perfect resemblance which is called similarity. This search for similarities in nucleic sequences distinguishes for example purines and pyrimidines.
• a homologous nucleotide sequence therefore includes any nucleotide sequence which differs from one of the identified sequences, by mutation, insertion, deletion or substitution of one or more bases, or by the degeneration of the genetic code.
• homologous sequences are included the sequences of genes from mammals other than humans, preferably from a primate, from a bovine, ovine or pig, or even from a rodent, as well as allelic variants.
• the invention also relates to isolated polypeptides encoded by these nucleic acids.
• the invention comprises an isolated polypeptide, comprising an amino acid sequence chosen from SEQ ID No. 13, 15, 17, 19, 28, 30, 32 and 46, or a sequence encoded by one of the sequences nucleotides SEQ ID No. 2, 12, 14, 16, 18, 27, 29, 31, 45, 1, 3, 4, 5, 6, 7, 8, 9, 10 and 1 1 or by a nucleotide sequence located at proximity to one of the sequences SEQ ID No. 7 and 10.
• a more particular subject of the invention is an isolated polypeptide comprising the sequence SEQ ID No. 13, identified as a new member of the family of MCM proteins.
• homologous sequences are also included, defined as: i) sequences similar to at least 70% of one of the amino acid sequences identified; or ii) the sequences coded by a homologous nucleic acid sequence as defined above, that is to say a nucleic acid sequence hybridizing with one of the identified nucleotide sequences or its complementary sequence, under stringent conditions hybridization.
• similar refers to the perfect resemblance or identity between the amino acids compared but also to the non-perfect resemblance which is termed similarity.
• amino acid substitutions for uncharged side chains such as asparagine, glutamine, serine, threonine, and tyrosine
• amino acids with basic side chains such as lysine, arginine, and histidine
• amino acids with acid side chains such as aspartic acid and glutamic acid
• amino acids with apolar side chains such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and cysteine).
• homologous amino acid sequence any amino acid sequence which differs from the amino acid sequence identified by substitution, deletion and / or insertion of an amino acid or a number reduced amino acids, in particular by substitution of natural amino acids with non-natural amino acids or pseudo-amino acids at positions such that these modifications do not significantly affect the biological activity of the encoded polypeptide.
• such a homologous amino acid sequence is similar to at least 85% of the identified sequence, preferably at least 95%.
• Homology is usually determined using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wl 53705). Similar amino acid sequences are aligned to obtain the maximum degree of homology (i.e. identity or similarity, as defined above). To this end, it may be necessary to artificially introduce spaces ("gaps") in the sequence. Once the optimal alignment has been achieved, the degree of homology is established by recording all the positions for which the amino acids of the two sequences compared are identical, relative to the total number of positions.
• a particular aspect of the invention also relates to new forms of transcripts of the MCM8 and SERCA1 genes, which are distinguished transcripts coding for the proteins MCM8 and SERCA1 by differential splicing.
• a subject of the invention is therefore also a nucleic acid comprising a nucleotide sequence chosen from SEQ ID No. 14, 16, 18, 27 and 29, it being understood that all homologous sequences are included, the homology being defined in a similar manner to the definition given above.
• the subject of the invention is also a polypeptide comprising an amino acid sequence encoded by said nucleotide sequence, such as the sequences SEQ ID No. 15, 17, 19, 28 or 30.
• the expression of the truncated forms of SERCA1 can induce apoptotic cell death.
• SERCA2b SERCA2b. They also highlighted a regulatory role for these proteins on the calcium stocks of the endoplasmic reticulum (ER), by promoting the escape of calcium from the ER.
• polypeptides of the present invention can be synthesized by any method well known to those skilled in the art.
• the polypeptides of the invention can for example be synthesized by the techniques of synthetic chemistry, such as Merrifield-type synthesis which is advantageous for reasons of purity, antigenic specificity, absence of unwanted side products and for its ease of production.
• a recombinant protein can also be produced by a method in which a vector containing a nucleic acid comprising one of the identified sequences or a homologous sequence is transferred into a host cell which is cultured under conditions allowing expression of the polypeptide corresponding. The protein produced can then be recovered and purified.
• the purification methods used are known to those skilled in the art.
• the recombinant polypeptide obtained can be purified from lysates and cell extracts, from the supernatant of the culture medium, by methods used individually or in combination, such as fractionation, chromatography methods, immunoaffinity techniques using specific mono- or polyclonal antibodies, etc.
• the nucleic acid sequence of interest can be inserted into an expression vector, in which it is operably linked to elements allowing the regulation of its expression, such as in particular promoters, activators and / or transcription terminators. .
• the signals controlling the expression of the nucleotide sequences are chosen according to the cell host used.
• the nucleotide sequences according to the invention can be inserted into vectors with autonomous replication within the chosen host, or integrative vectors of the chosen host.
• vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into an appropriate host by standard methods, such as for example electroporation or precipitation with calcium phosphate.
• cloning and / or expression vectors as described above, containing a nucleotide sequence defined according to the invention also form part of the present invention.
• the invention further relates to host cells transfected, transiently or stable, with these expression vectors.
• These cells can be obtained by introducing into host cells, prokaryotic or eukaryotic, a nucleotide sequence inserted into a vector as defined above, then culturing said cells under conditions allowing replication and / or expression of the transfected nucleotide sequence.
• host cells include mammalian cells such as COS-7, 293, MDCK cells, insect cells such as SF9 cells, bacteria such as E. coli and yeast strains such as L40 and Y90.
• the nucleotide sequences of the invention can be of artificial origin or not. They may be DNA or RNA sequences, obtained by screening of sequence banks using probes developed on the basis of the identified sequences. Such libraries can be prepared by conventional techniques of molecular biology, known to those skilled in the art.
• nucleotide sequences according to the invention can also be prepared by chemical synthesis, or also by mixed methods including chemical or enzymatic modification of sequences obtained by screening libraries.
• the nucleotide sequences of the invention allow the production of probes or primers, specifically hybridizing with one of the sequences identified according to the invention, or its complementary strand.
• the appropriate hybridization conditions correspond to the temperature and ionic strength conditions usually used by those skilled in the art, preferably under stringent conditions as defined above.
• probes can be used as an in vitro diagnostic tool for the detection, by hybridization experiments, in particular of "in situ” hybridization, of specific transcripts of the polypeptides of the invention in biological samples or for the demonstration aberrant syntheses or genetic anomalies resulting from polymorphism, mutations or improper splicing.
• the nucleic acids of the invention useful as probes comprise at least 15 nucleotides, preferably at least 20 nucleotides, preferably still at least 100 nucleotides, but are preferably less than the total length of the identified cell sequences.
• the nucleic acids useful as primers comprise at least 15 nucleotides, preferably at least 18 nucleotides, and preferably less than 40 nucleotides. More specifically, the subject of the present invention is a nucleic acid having at least 15 nucleotides, which specifically hybridizes with one of the identified nucleic acid sequences or its complement, under stringent hybridization conditions. Preferably, the probes or primers of the invention are marked, prior to their use.
• the DGGE method denaturing gradient gel electrophoresis
• the SSCP method single-stranded conformation polymorphism
• the DHPLC method denaturing high performance liquid chromatography; Kuklin et al., 1997; Huber et al. , 1995
• the RT-PCR method can advantageously be used to detect anomalies in the transcripts of the genes described, because it makes it possible to visualize the consequences of a splicing mutation causing the loss of one or more exons at the level of the transcript , or an aberrant splicing due to the activation of a cryptic site.
• This process is also preferably followed by direct sequencing. More recently developed methods using DNA chips can also be used to detect an anomaly in the genes described (Bellis et a /., 1997).
• the identified sequences or fragments thereof can be used for the manufacture of DNA microarrays of the "microarrays” type (comprising cDNAs) or "DNA chips” (comprising oligonucleotides synthesized in situ or fixed after synthesis ).
• These chips include a very large number of different probes (up to several tens of thousands on an area of approximately 1 cm 2 ) fixed on an inert support, each in a specific location. These chips can be placed in the presence of a sample of labeled nucleic acids to be tested and the sequences complementary to the probes match. The sequences of the invention can thus be integrated into these chips as probes. Fleas are particularly advantageous in the context of a genetic diagnosis, as seen above, but also for the identification of unknown genes revealing, by hybridization with the sequences of the invention, a possible implication in oncogenesis.
• the subject of the invention is also antibodies directed against the polypeptides as defined above. They can be poly- or monoclonal antibodies or their fragments, chimeric antibodies, in particular humanized or immunoconjugated.
• Polyclonal antibodies can be obtained from the serum of an animal immunized against a polypeptide according to the usual procedures.
• an appropriate peptide fragment as defined above, which can be coupled via a reactive residue to a protein or another peptide, can be used as antigen.
• Rabbits are immunized with the equivalent of 1 mg of the peptide antigen according to the procedure described by Benoit et al. (1982). At four-week intervals, the animals are treated with injections of 200 ⁇ g of antigen and bled 10-14 days later. After the third injection, the antiserum is examined to determine its ability to bind to peptide antigen radiolabelled with iodine, prepared by the chloramine-T method and is then purified by chromatography on a column of carboxymethyl-cellulose ion exchange (CMC). The antibody molecules are then collected in mammals and isolated to the desired concentration by methods well known to those skilled in the art, for example, using DEAE Sephadex to obtain the IgG fraction.
• CMC carboxymethyl-cellulose ion exchange
• the antibodies can be purified by immunoaffinity chromatography using solid phase immunizing polypeptides.
• the antibody is brought into contact with the immunizing polypeptide in solid phase for a sufficient time so as to make the polypeptide immunoreact with the antibody molecule in order to form an immunological complex in solid phase.
• the monoclonal antibodies can be obtained according to the conventional method of culture of hybridomas described by K ⁇ hler and Milstein (1975).
• the antibodies or antibody fragments of the invention can be, for example, chimeric antibodies, humanized antibodies, Fab and F (ab ') 2 fragments. They can also be in the form of immunoconjugates or labeled antibodies.
• the antibodies of the invention, in particular the monoclonal antibodies, can in particular be used for the immunohistochemistry analysis of the polypeptides on sections of specific tissues, for example by immunofluorescence, gold labeling, immunoperoxidase, etc.
• the antibodies thus produced can advantageously be used in any situation where the expression of the polypeptides of the invention must be observed.
• a more general subject of the invention is the use of at least one antibody thus produced for the detection or purification of a polypeptide as defined above in a biological sample.
• the invention also relates to a kit for the implementation of this method comprising:
• the invention also relates to a method of in vitro detection of polypeptides of the invention or of antibodies directed against these polypeptides in a biological sample, in which said biological sample is brought into contact with respectively an antibody or a polypeptide of the invention (namely in particular a polypeptide comprising a sequence chosen from
• SEQ ID No. 13 15, 17, 19, 22, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46 or coded by a sequence comprising a nucleotide sequence chosen from SEQ ID No. 13, 15, 17, 19, 22, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46 or coded by a sequence comprising a nucleotide sequence chosen from SEQ ID No. 13, 15, 17, 19, 22, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46 or coded by a sequence comprising a nucleotide sequence chosen from SEQ
• ID # 43 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 23, 24, 2, 12, 14, 16, 18, 21, 25, 27,
• Another aspect of the invention relates to diagnostic and therapeutic applications relating to the sequences identified by the inventors near the integration sites of HBV, as well as the corresponding polypeptides and antibodies.
• Nucleic acids comprising at least one of the sequences of the genes described above or their counterparts, are useful for the detection of an anomaly in these genes or in their transcripts.
• the subject of the invention is therefore a method of in vitro diagnosis of a tumor or of a predisposition to develop a tumor, comprising the steps consisting in:
• the biological sample in question can in particular be blood, or a tissue fragment taken from a patient.
• These methods may aim to detect the mRNA encoding these polypeptides or these polypeptides themselves.
• the invention relates to a method of in vitro diagnosis of a tumor or of a predisposition to develop a tumor, comprising the steps consisting in:
• a biological sample containing mRNA obtained from a sample of suspect cells from a patient with specific oligonucleotides allowing the amplification of all or part of the transcript of the targeted genes (namely in particular a gene comprising a sequence chosen from SEQ ID No. 43, 1, 3, 7, 9, 10, 11, 20, 24, 2, 12, 14, 16, 18, 21, 25, 27, 29, 31, 33, 35, 37, 39, 41 and 45); - amplifying said transcript;
• a change in the transcript level of the targeted genes compared to normal control being indicative of a tumor or of a predisposition to develop a tumor.
• the invention relates to an in vitro method for the diagnosis of a tumor or of a predisposition to develop a tumor comprising the detection or the measurement of the level of expression of the polypeptides described above in a biological sample. , obtained for example from a sample of suspect cells from a patient.
• the presence of polypeptides or genes transcribed from genes in quantities different from normal can be correlated with a more or less serious prognosis, in terms of aggressiveness of the tumor for example.
• polypeptides described above or the corresponding nucleic acids can then be useful as a medicament.
• the invention therefore also relates to a pharmaceutical composition
• a pharmaceutical composition comprising a polypeptide as defined above or a nucleic acid encoding said polypeptide, in association with a pharmaceutically acceptable vehicle.
• the modes of administration, the dosages and the galenical forms of the pharmaceutical compositions according to the invention, containing at least one polypeptide can be determined in the usual way by a person skilled in the art, in particular according to the criteria generally taken into account for the establishment of a therapeutic treatment adapted to a patient, such as for example the age or the body weight of the patient, the seriousness of his general condition, the tolerance to the treatment, and the observed side effects, etc.
• a therapeutically or prophylactically effective amount ranging from about 0.1 ⁇ g to about 1 mg can be administered to human adults.
• the invention also relates to a pharmaceutical composition comprising a nucleic acid as defined above, and a pharmaceutically acceptable vehicle, said composition being intended for use in gene therapy.
• the nucleic acid preferably inserted into a generally viral vector can be administered in nude form, free of any vehicle promoting transfer to the target cell, such as ani lipnic liposomes, cationic lipids, microparticles, for example gold microparticles, precipitating agents, for example calcium phosphate, or any other agent which facilitates transfection.
• the polynucieotide can be simply diluted in a physiologically acceptable solution, such as a sterile solution or a sterile buffer solution, in the presence or in the absence of a vehicle.
• a nucleic acid of the invention can be combined with agents which facilitate transfection. It can be, inter alia, (i) associated with a chemical agent which modifies cell permeability such as bupivacaine; (ii) encapsulated in liposomes, optionally in the presence of additional substances which facilitate transfection; or (iii) associated with cationic lipids or microparticles of silica, gold or tungsten.
• agents which facilitate transfection can be, inter alia, (i) associated with a chemical agent which modifies cell permeability such as bupivacaine; (ii) encapsulated in liposomes, optionally in the presence of additional substances which facilitate transfection; or (iii) associated with cationic lipids or microparticles of silica, gold or tungsten.
• the nucleic acid constructs of the invention cover microparticles, these can be injected intradermally or intraepidermally by the gene gun technique, "gene gun” (WO 94/2
• the amount to be used as a drug depends in particular on the construction of nucleic acid itself, the individual to whom this nucleic acid is administered, the mode of administration and the type of formulation, and the pathology.
• a therapeutically or prophylactically effective amount varying from approximately 0.1 ⁇ g to approximately 1 mg, preferably from approximately 1 ⁇ g to approximately 800 ⁇ g and, preferably from approximately 25 ⁇ g to approximately 250 ⁇ g, can be administered to human adults.
• the nucleic acid constructs of the invention can be administered by any conventional route of administration, such as in particular parenterally.
• the choice of administration route depends in particular of the formulation chosen. Targeted administration to the target tumor site may be particularly advantageous.
• the target patient is generally a human being, but the application can also be extended to any mammal if necessary.
• an overexpression of the polypeptides described above is observed, in correlation with a tumor phenotype, it is possible to seek to block or inhibit the activity of said polypeptides.
• the invention therefore also relates to a pharmaceutical composition
• a pharmaceutical composition comprising an antibody directed against said polypeptide, in association with an acceptable pharmaceutical vehicle.
• the invention further relates to a pharmaceutical composition
• a pharmaceutical composition comprising a nucleic acid comprising an antisense sequence blocking the expression of the genes described above, in combination with a pharmaceutically acceptable vehicle.
• compositions and the associated dosage are within the reach of those skilled in the art, in view in particular of the information given above, concerning pharmaceutical compositions based on polypeptides or nucleic acid encoding the polypeptides.
• the subject of the invention is the use of a nucleic acid comprising a sequence chosen from SEQ ID No. 43, 1, 3, 7, 9, 10, 11, 20, 24, 2, 12, 14, 16, 18, 21, 25, 27, 29, 31, 33, 35, 37, 39, 41 and 45 of an antisense of said nucleic acid, of a polypeptide encoded by said nucleic acid, or of an antibody against said polypeptide for the manufacture of a medicament for the treatment of tumors.
• sequences identified by the inventors as being involved in oncogenesis, or the polypeptides or antibodies Correspondents can advantageously be used as tools for the search (screening and identification) of therapeutic agents having a stimulatory or inhibitory activity targeted towards them.
• SERCA1 with a splicing of exon 1 1 and an alternative splicing of exon 4, according to cloning in a normal liver.
• the splicing of exon 1 1 leads to a mutated sequence of 22 amino acids (black frame), a premature stop codon appearing in exon 12.
• the spliced SERCA1 transcripts therefore code for truncated proteins in their part C- terminal.
• This method provides for the amplification of DNA extracted from liver tumors with the primer HB1 (5 ⁇ CAUGAACCUUUACCCCGUUGC3 ', SEQ ID No. 47) and the primer A5
• the MX2-Tag5 amplification is carried out in a final reaction volume of 100 ⁇ l, in a Tris pH 8.9 25 mM buffer, 40 mM potassium acetate, 2.5 mM magnesium choride and 4% glycerol.
• the molarity of each primer is 10 pmol and each of the dNTPs is present at a concentration of 250 ⁇ M.
• the amplification is carried out using the enzymes Taq polymerase (Gibco BRL, MD, USA) 1, 2 units plus Vent exo + polymerase (New England Biolabs, MA, USA).
• HBV DNA has in fact been located near a sequence of 485 base pairs (SEQ ID No. 11) identical to part of the gene-like sequence MCM 2/3/5 on chromosome 20p12.3 -13.
• SEQ ID No. 11 corresponds to nucleotides 51574 to 52059 of the gene-like sequence MCM 2/3/5 (accession number: AL035461).
• HBV has been identified on chromosome 2p24.-24.3.
• the isolated cell sequence is positioned between nucleotides 883565 and 884238 in the supercontig NT025651 (SEQ ID No. 4). This sequence is located 2 kb upstream of the ATG codon of a new predicted gene, containing a homeobox-like domain.
• This new gene called gene 83T (SEQ ID No. 31), is located between bases 881787 (ATG) to 812959 (polyA sequence) of this supercontig NT025651.
• the HBV genome and the 83T ORF have an opposite orientation.
• the HBV DNA integrates into chromosome 3q11.2, 3 kb upstream of the alpha 2,3 sialyltransferase gene (ST3GalVI, SEQ ID No. 41).
• the isolated cell sequence is positioned between nucleotides 29061 and 28695 of the supercontig NT005494 (SEQ ID No. 8).
• the HBV genome has an opposite orientation relative to the ORF of the ST3GalVI gene.
• Alpha 2,3 sialyltransferases are involved in the glycosylation of proteins.
• the genes of this family are hyperexpressed in several types of tumors: breast, stomach and colon cancer, and liver metastases (Pétretti et al., 2000).
• Integration of the HBV genome into the SA2 tumor occurs in chromosome 3p25, at the 38 th intron of the IPR 3 R 1 gene.
• the isolated cell sequence is delimited by nucleotides 4987889 to 5009109 of supercontig NT 005927 (SEQ ID n ° 9).
• the ORF of the inositol 1, 4,5-triphosphate type 1 receptor gene (IP 3 R 1 , SEQ ID No. 43) and the HBV genome have the same orientation.
• the authors of the invention have thus found that the integration of the hepatitis B virus into cellular genes of hepatic carcinoma occurs both in cirrhotic and non-cirrhotic livers and in both patients positive and negative for l hepatitis B surface antigen, indicating its general interest in this viral integration in hepatic cell transformation.
• the calcium leakage rate from the ER was measured after the plateau of calcium accumulation in the ER following the addition of TbuBHQ (SERCA inhibitor).
• the level of calcium leakage was assessed at different calcium concentrations using a function derived from the leakage slope.
• the authors of the invention obtained results which show an increase in the rate of calcium leakage in the cells expressing S1T + 4 and S1T-4 compared to the control. This result is consistent with the hypothesis that the dimers of SERCA1-T could act as a cation pore.
• - Paterlini et al Primary liver cancer in HbsAg-negative patients: A study of HBV genome using the polymerase chain reaction. In "viral hepatitis and Liver Disease", 556-559, Williams and Wilkins, Baltimore (1990). - Paterlini et al, Hepatitis B virus and primar liver cancer in hepatitis B surface antigen-positive and negative patients. In: Primary liver cancer, etiological and progression factors, Londo BC 167-190 (1994).

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Zoology (AREA)
• Biophysics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Immunology (AREA)
• Biomedical Technology (AREA)
• Gastroenterology & Hepatology (AREA)
• General Engineering & Computer Science (AREA)
• Toxicology (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Cell Biology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Investigating Or Analysing Biological Materials (AREA)

Applications Claiming Priority (5)

Publications (1)

Family

ID=26212616

Family Applications (1)

Country Status (3)

Families Citing this family (6)

Family Cites Families (8)

• 2001
  • 2001-07-31 WO PCT/FR2001/002509 patent/WO2002022777A2/fr not_active Application Discontinuation
  • 2001-07-31 US US10/380,374 patent/US20040072185A1/en not_active Abandoned
  • 2001-07-31 EP EP01963042A patent/EP1317527A2/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events