EP1301607A1 - Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes - Google Patents

Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes

Info

Publication number
EP1301607A1
EP1301607A1 EP01903610A EP01903610A EP1301607A1 EP 1301607 A1 EP1301607 A1 EP 1301607A1 EP 01903610 A EP01903610 A EP 01903610A EP 01903610 A EP01903610 A EP 01903610A EP 1301607 A1 EP1301607 A1 EP 1301607A1
Authority
EP
European Patent Office
Prior art keywords
cell wall
plant
wall polysaccharide
enzyme
polysaccharide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01903610A
Other languages
German (de)
English (en)
Inventor
Peter Ulvskov
Henk Shols
Richard Visser
Bernhard Borkhardt
Susanne O. Sorensen
Ronald Oomen
Jean-Paul Vincken
Maureen Mccain
Michael Skjot
Chantal Doeswijk Voragen
Gerrit Beldman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BLM ApS
Original Assignee
BioLogic AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BioLogic AS filed Critical BioLogic AS
Priority to EP01903610A priority Critical patent/EP1301607A1/fr
Publication of EP1301607A1 publication Critical patent/EP1301607A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L15/00—Chemical aspects of, or use of materials for, bandages, dressings or absorbent pads
    • A61L15/16—Bandages, dressings or absorbent pads for physiological fluids such as urine or blood, e.g. sanitary towels, tampons
    • A61L15/22—Bandages, dressings or absorbent pads for physiological fluids such as urine or blood, e.g. sanitary towels, tampons containing macromolecular materials
    • A61L15/28—Polysaccharides or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L24/00—Surgical adhesives or cements; Adhesives for colostomy devices
    • A61L24/04—Surgical adhesives or cements; Adhesives for colostomy devices containing macromolecular materials
    • A61L24/08—Polysaccharides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/14—Macromolecular materials
    • A61L27/20—Polysaccharides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Definitions

  • the present invention relates to methods for remodelling the polysaccharide structure of the cell wall in higher plants by means of in vivo expression of polysaccharide-modifying enzymes.
  • the cell wall of higher plants is comprised of cellulose, an interconnecting load bearing structure of mostly hemicellulosic polymers, pectic matrix polymers and globular and non- globular proteins. With the possible exception of the globular proteins, all polymer classes play structural roles in the cell wall. As the wall matures, cross links, both inter- and intra- chain links, are formed and eventually lignin is deposited in the cell wall rendering the cell wall quite stable and thus difficult to separate into its constituents, digest and process.
  • the present invention relates to gaining control in vivo over the structures of the complex cell wall polysaccharides.
  • wall polymers the simple, semicrystalline cellulose mi- crofibrils are excluded from this class, as are the various categories of polymers which are built from non-sugar moieties, i.e. the proteins, lignin as well as suberin and waxes found in epidermal walls.
  • Hemicelluloses and pectins sensu lato define the class of complex wall polysaccharides, although some of these may be referred to by a name indicating a narrower classification if particularly enriched or significant in a particular species or tissue, arabinogalactans in Larix wood and beta-glucan in cereal seeds to name a few examples.
  • polysaccharides are, in the context of the present invention, those polysaccharides that are not structural components but serve other purposes, typically that of storage of carbohydrates to be remobilised during seed germination.
  • Galactomannan as in guar, and xyloglucan as in tamarind are two examples.
  • Hemicellulosic polymers differ in type and abundance in, on one hand, plants belonging to the grasses, sedges and families closely related thereto and, on the other hand, the group of vascular plants.
  • Carpita and Gibeaut (1993) refer to the non-grass type wall as a type-l cell wall, and the grass type cell wall as a type-ll cell wall.
  • Primary walls of type-l are characterized by roughly equal amounts of cellulose, hemicellulose and pectin.
  • the predominant hemicellulosic polymer in undifferentiated cells is xyloglucan (not to be confused with the seed storage xyloglucan referred to above).
  • Xyloglucan is a minor hemicellulosic polysaccharide in type-ll cell walls ( ⁇ 5%), and also pectins are less abundant herein as compared to the type-l wall.
  • a broad class of hemicellulosic polymers i.e. xylans, arabinoxylans and glucans make up the remainder of the hemicellulosic polymers in the type-ll wall.
  • These hemicellulosic polymers are particularly relevant targets for the present invention when it is applied to remodel polysaccharide structures in type-ll walls.
  • the present invention is particularly deve- loped for the matrix polymers, i.e. pectins.
  • Pectins consist of two basic parts, i.e. an essentially unbranched polymer consisting of galacturonic acid residues (homogalacturonan, also known as the smooth region), and a polymer composed of alternating rhamnosyl and galacturonosyl residues, which can be substituted with long neutral side-chains (rhamnogalacturonan I, with "hairs", also known as the hairy region).
  • Pectic polysaccharides comprise between 30 and 50% of the cell walls of dicotyledonous plants (Carpita and Gibeaut 1993).
  • HGA homogalacturonan
  • RG-I rhamnogalacturonan I
  • RG-II rhamnogalacturonan II
  • HGA Relatively unesterified lengths of HGA (junction zones) can become Ca 2+ cross-linked with similar regions of other HGA molecules to form polymers and higher-order structures that are capable of forming gels, whereas highly esterified HGA has a reduced potential for calcium promoted gelling. Gelling by other mechanisms often depends on a high methyl ester content.
  • RG-I is a branched hetero- polymer of alternating 1,2-alpha-L-Rhamnose (Rha) and 1 ,4-alpha-D-GalA residues (Lau et al 1985) that carry neutral side-chains of predominantly 1 ,4-beta-D-Galactose (Gal) and/or 1 ,5-alpha-L-Arabinose (Ara) residues attached to the rhamnose (Rha) residues of the RG-I backbone.
  • They can either be single unit (beta-D-Galp-(1(4)), or polymeric such as arabinogalactan I and arabinan.
  • arabinogalactan II is mainly associated with proteins (arabinogalactan proteins).
  • the branching pattern of the hairs is species-dependent.
  • the side-chains of RG-I may be cross-linked to other pectic molecules by ester linkages through hydroxycinnamic acid residues such as ferulic acid (Fry 1986). It is generally accepted that homogalacturonan (HG) and rhamnogalacturonan I (RG-I) are covalently linked. However, the exact sequence of stretches of smooth and hairy regions remains to be determined.
  • the highly conserved RG-I I molecule has a homogalacturonan backbone decorated with side-chains containing the richest diversity of sugars and linkages known, which may dimerise through a borate di-ester cross link (O'Neill et al. 1996).
  • pectic polymers Besides determining cell wall porosity, additional roles have been proposed for pectic polymers, including regulating cell-cell adhesion, cell expansion (McCann and Roberts 1994), wall mechanical properties (Chanliaud and Gidley 1997), as a source of signalling molecules (oligosaccharins) (Cote and Hahn 1994) and involvement in cell differentiation and organogenesis (Satoh 1998).
  • pectin for food applications is governed by many parameters, including its molecular weight, neutral sugar content, the proportion of smooth versus hairy regions, the degree of methyl and acetyl esterification, as well as the distribution of these ester groups along the homogalacturonan backbone (Daas et al. 1998, Braccini et al. 1999). For instance, cross-linking of homogalacturonans with Ca 2+ is promoted when only small amounts of hairs are present, and consequently, gels with increased stability can be formed.
  • pectin from many abundant sources e.g. potato tubers and sugar beets
  • pectin from many abundant sources e.g. potato tubers and sugar beets
  • the primary structure of pectin from many abundant sources is such that it is of an inferior quality for food applications when compared to e.g. apple or citrus pectin.
  • the proportion of hairy regions of potato pectin is too high, and the degree of methyl esterification is too low (Ryden et al. 1990), the latter potentially caused by pectin methyl esterase acting post harvest.
  • Additional problems with endogenous enzyme activities not withstanding, adjustments in the potato pectin structure are required to obtain satisfactory gelling properties, and to compete with higher-quality pectins.
  • enzymes include in particular glucanases, xyloglu- canases, cellulases, fucosidases, xylanases, encfo-polygalacturonases (endo-PGs or EPGs), pectin esterases, acetyl esterases specific to the different classes of polysaccha- ride decorated with acetyl groups, pectin lyases, exo-polygalacturonases and pectate ly- ases.
  • rhamnogalacturonases rhamnogalacturonan lyases
  • the ga- lactanases the arabinanases and the corresponding furanosidases
  • alfa- and beta-specific enzymes are of interest.
  • galactosidases as an example, some isoforms of alfa-galactosidases can mobilise galactomannan while the particular beta-specific variants can depolymerise pectic galactans. Similar considerations are relevant to virtually all classes of polysacchcaride modifying enzymes listed above.
  • pectin which may be modified using post-harvest methods in which pectin is first extracted from the source plant material and only subsequently subjected to modification in order to result in modified pectin having desired characteristics for a given application.
  • new polysaccharide structure and new pectin structure refer to polymers with a new arrangement and/or changed ratios of the monosaccharide building blocks of the polymer.
  • linkage pattern as described hereinbelow, the quantitatively insignificant amount of new end-groups which result from a molecular weight down-shift (as seen e.g. during ripening) is disregarded, and polymers which are altered only in size, are not regarded herein as new structures.
  • decoration with non-sugar substituents are also disregarded so that a polysaccharide which is diffe- rent solely by virtue of e.g. increased methyl esterification, is not regarded a new structure.
  • the present invention provides, in contrast to current technology, for in vivo generation of new complex cell wall polysaccharide structures as defined above.
  • pectin structure using potato as an example.
  • the invention is in no way limited to pectin or potato but it is useful in modifying a large range of cell wall polysaccharides and it is relevant to many crop species, and many plant organs in addition to tubers, but potato is an important crop in many countries, not only because it is consumed as such (boiled, baked, etc.) or after processing (French fries, chips, purees), but also because it produces a high- quality starch which can be used in many industrial applications.
  • the potato fibre fraction is a collection of various polysaccharides which together form the packaging material of the cell contents, i.e. the plant cell wall.
  • pectin is probably the most interesting polymer because it is a known gelling agent in many food applications (Visser and Voragen 1996, Daas et al. 1998).
  • the hairy regions of pectin rather than on, for instance, decoration of the homogalacturonan with ester groups.
  • the amount of hairy regions determines the neutral sugar to uronic acid ratio.
  • this ratio is high, the water-binding capacity of the pectin is also high. This may be desirable in some food applications as well as non-food applications.
  • this ratio is low, the pectin structure approaches that of citrus pectins normally preferred by the food industry.
  • lowering the neutral sugar-to-uronic acid ratio is important for the valorisation of pulp by-products from e.g. potato starch and beet sugar production.
  • Another important objective of the present invention is to decrease the pro- portion of hairy regions of pectins in planta by genetic modification. In addition to an improvement of the gelling characteristics of potato pectin, this should also facilitate the starch extraction process, resulting in a higher starch yield.
  • Another objective is to tailor and recover pectin hairy regions for their use in low viscosity food products (e.g. drinking yoghurt and similar diary products).
  • self-processing tubers or self-processing plant material in general
  • Self processing refers to the property that the plant tissue, upon disruption post harvest, releases enzymes stored intracellularly.' The released enzyme catalyses a modification of the cell wall material, typically excision of the poly- or oligosaccharides of interest for easy recovery. This technology can also be applied to medical uses of tailored pectic polymers and oli- gomers derived from these.
  • in vivo modification can also make use of genes encoding biosynthetic enzymes or components of synthase complexes. It will be appreciated that up- or down-regulation of the activity of the synthases or decorative enzymes will broaden the engineering options. A few decorative transferases have been identified and may turn out to be valuable in this regard (Perrin et al. 1999, Edwards et al. 1999, WO 99/60103). Such enzymes are candidates for pectin modification according to the present invention.
  • genes encoding these enzymes may be useful for indirect manipulation of biosynthesis of pectin and other cell wall polysaccharides.
  • genes encoding polysaccharide-modifying enzymes already demonstrated to be useful for post-harvest pectin modification are among preferred tools for modifying pectin in vivo.
  • WO 91/08299 discloses a process for the inhibition of the production of a gene product in a plant cell using antisense technology with the objective of controlling fruit ripening.
  • Target genes include pectin esterases, galactosidases, glucanases and xylanases. Accord- ingly, this disclosure is not concerned with in vivo generation of new complex cell wall polysaccharides as provided herein.
  • WO 99/07857 discloses nucleic acids encoding pectate lyase from plants and transgenic plants and parts and progeny hereof having altered pectate lyase activity. Although it is evident that increased pectate lyase activity in a plant may lead to altered pectins, this alteration is only in the sense that molecular weight changes of the pectic polymers may occur which, however, does not lead to a new pectin structure as defined herein.
  • WO 93/13212 discloses DNA encoding a pectin esterase iso-enzyme for transformation of e.g. tomato to reduce pectin esterase activity.
  • the poster reports that transgenic plants expressing the galactanase gene in leaves and tuber under control of the Granule Bound Starch Synthase (GBSS) promoter or the patatin promoter were produced, but possible effects of the galactanase expression on the cell wall polysaccha- rides was not addressed neither theoretically nor by experiment.
  • GBSS Granule Bound Starch Synthase
  • the present invention relates to novel technology for targeted, specific remodelling or modification of complex plant cell wall polysaccharides.
  • benefits from this technology fall in four broad categories:
  • Modified plant architecture Certain selective interferences with the course of cell wall metabolism will affect cell differentiation, morphology and development.
  • Self-pruning plants for example may be engineered by modifying cell wall components which are critical for determining cell fate and course of development.
  • Pathogen invasion pathogenic fungi and bacteria invade plant tissues through the orchestrated deployment of a set of polysaccharide degrading enzymes which match the architecture of the host cell wall.
  • the present technology provides the means for altering the cell wall so as to retard the penetration.
  • signalling molecules the so-called oligo- saccharins
  • a new cell wall architecture may result in a different pattern of oligosaccharin release from the wall, and hence alter the course of pathogenesis. Reduced symptom development will be achieved.
  • Dietary fibre may be used to increase the abundance of dietary fibre in food products, and alter the ratio between insoluble and soluble dietary fibres, most often in favour of the latter with which many health claims are associated.
  • Texture Cell walls are responsible for vegetable and fruit texture, and plays a role in the textural changes which accompany storage. Both texture and shelf life will thus be subject to modification using the current invention. As it pertains to shelf life the technology pre- sented here complements control of ripening (speed up or delay) by transgenic modification as described in the prior art.
  • Material properties Structural properties of wood and fibres rely on overall plant anatomy, fibre cell geometry, secondary wall formation, lignification and polysaccharide polymer make up. Plant material properties originating in the latter may be improved through the targeted cell wall engineering made possible by the present invention. Properties of relevance for medical materials, hydrocolloids for coating of implants and some medical instruments, include water binding capacity. Water binding capacity can be controlled through modifications of e.g. pectin structure as enabled by the present invention (see also "Tailored pectins" heading 4 below). Added value to by-products.
  • pulp from paper or fibre manufacturing, from breweries, from production of starch or sugar represents a rich source of complex plant polysaccharides which do not fulfil criteria for a particular industrial use
  • the present invention may be employed for the engineering of the crop plant in question so as to valorise the pulp by making it a source of higher value-polysaccharides.
  • One example hereof is targeting the valorisation at the pectic fraction as exemplified in the following.
  • Functional feed cell wall composition largely determines digestibility and hence nitrogen use efficiency in livestock and poultry. Notably in non-ruminant animals, young piglets for example and in poultry the cell wall polysaccharide digestibility is a limiting factor in re- spect of efficient feed utilisation.
  • Beverage filtering properties Liquefication of plant materials is applied in juice and wine manufacturing, e.g. using food industrial enzymes so as to increase yield and retard clotting of filters.
  • the present invention is useful with respect to complement or supplant these practices and to decrease/remove certain polysaccharide fractions that cause problems during such processes.
  • Baking properties Rheological properties of doughs are often modified using technical enzymes rich in xylanase and glucanase activities acting upon the cell wall polysaccharides.
  • Starting materials in which the cell wall polysaccharides have already been modified as desired using the present invention will be able to complement or supplant the practice of adding technical enzymes and in addition, other modifications of the polysaccharides and cell wall components will improve the properties of the dough and improve the baking properties.
  • Fibre retting Fibres, e.g. of flax, are isolated either using treatment with industrial enzymes or through a classical "fermentation" process known as retting. Either may be supplanted or complemented using fibre plants in which the fibres themselves, or the tissue in which they are embedded, are modified with regard to cell wall properties as enabled by the present invention. In addition, improvement (including the processing) of other plant fibres (cotton, hemp etc.) employed as textiles can also be achieved using the technology of the invention.
  • Tailored pectins as food ingredients and additives Designed pectin, e.g. from plant materials normally containing pectins of inferior quality as described above can be obtained using the present invention.
  • benefits from such technology may include main- tenance of the physiological activity of pectin at low viscosity, uniformity of ester distribution, production of high molecular weight pectin with low viscosity, elimination of acid from waste water and manufacture of low ester pectin with no loss in molecular weight.
  • Other benefits include simpler processing, high yield, high strength, utilisation of inexpensive raw materials, moderate process conditions, ease of recovery, low cost, low environ- mental impact of processing and higher quality.
  • the present technology will also make use of non-refined (e.g. produced without most of the traditional extraction procedures) products possible as the technology makes it possible to remove undesired polysaccharide and cell wall components involved in e.g. the creation of non-palatable appearance and to improve the quality of "ingredients" of low quality components.
  • Tailored pectins as medical materials and pharmaceuticals.
  • Bioactive poly- and oligosaccharides derived from cell wall polysaccharides including pectins have been detected in several plant species, many of which are exotic plants.
  • the present invention will provide significant control over cell wall polysaccharide polymer structure, and allow poly- and oli- gosaccharides of e.g. crop plants to be designed and thus rendered bioactive. Benefits include high efficiency and low cost in processing using well known processing steps at e.g. sugar factories, starch factories, breweries etc., optimised for one or more particular crop plants.
  • the invention pertains to a method for providing a transgenic plant material that, relative to the wild type state, is modified in a complex cell wall polysaccharide structure, the modification being at least one of the overall glycosidic linkage pattern and the monosaccharide profile, the method comprising the steps of: (i) providing a nucleic acid construct comprising a nucleotide sequence, which, following the introduction of the construct into a plant cell, results in an altered production of at least one target cell wall polysaccharide-modifying enzyme, (ii) transforming a plant cell with the nucleic acid construct, and (iii) deriving from said transformed plant cell a plant cell culture, a plant tissue or a transgenic plant in which the production of the at least one cell wall polysaccharide-modifying enzyme is altered to obtain transgenic plant cells, plant tissues or plants in which the targeted substrate cell wall polysaccharide, relative to the wild type plant, is modified to have a monosaccharide profile where the proportion of at least one mono
  • the nucleotide sequence which, following the introduction of the construct into a plant cell, results in an altered production of at least one target cell wall polysaccharide-modifying enzyme is a sequence coding for such an enzyme, such as a cell wall polysaccharide-modifying enzyme of fungal or microbial origin, that is capable of modifying the targeted cell wall polysaccharide including an embodiment wherein the coding sequence is operably linked to a promoter directing the expression of the coding sequence which promoter e.g. is of plant origin such as a plant tissue or organ specific promoter including a storage organ specific promoter.
  • promoter e.g. is of plant origin such as a plant tissue or organ specific promoter including a storage organ specific promoter.
  • an interesting pro- moter is a promoter that is capable of directing expression of the cell wall polysaccharide- modifying enzyme in potato tubers including a promoter selected from the group consisting of the granule bound starch synthase (GBSS) promoter and the B33 promoter.
  • GBSS granule bound starch synthase
  • the at least one target cell wall polysaccharide-modifying enzyme is an endogenous enzyme, i.e. an enzyme naturally produced in the transformed plant cell, including a particular embodiment wherein the nucleotide sequence, which, following the introduction of the nucleic acid construct into a plant cell results in an altered production of at least one target cell wall polysaccharide- modifying enzyme, is a sequence that modulates the expression of an endogenous sequence coding for an enzyme that is capable of modifying the targeted cell wall polysaccharide.
  • the sequence that modulates the expression of an endogenous sequence coding for an enzyme that is capable of modifying the targeted cell wall polysaccharide is a sequence coding for an antisense sequence that reduces the expression of a repressor or reduces the production of an inhibitor of the endogenous target cell wall polysaccharide-modifying enzyme.
  • the sequence that modulates the expression of an endogenous sequence coding for an enzyme that is capable of modifying the targeted cell wall polysaccharide is a sequence that, following a recombination event, causes the insertion of a new or modified promoter operably linked to the endogenous target cell wall-modifying enzyme, said promoter is capable of directing the expression of the coding sequence for the cell wall-modifying enzyme.
  • the nucleotide sequence which, following the introduction of the construct into a plant cell results in an altered production of at least one target cell wall polysaccharide-modifying enzyme, is a sequence that, following a recombination event, causes the expression of an endogenous sequence coding for an enzyme that is capable of modifying the targeted cell wall polysaccharide to be targeted to a location in the plant cell where such enzyme is not normally present.
  • the nucleic acid construct is a viral vector that, following introduction into a plant cell, is not integrated into the genome of the cell.
  • the targeted complex cell wall polysaccha- ride which is modified by a cell wall polysaccharide-modifying enzyme is a pectin or a hemicellulosic polysaccharide.
  • Suitable pectin- or hemicellulose-modifying enzymes include enc/o-rhamnogalacturonan hydrolases, e ⁇ fo-rhamnogalacturonan lyases, endo- galactanases, et?cfo-arabinanases, arabinofuranosidases, galactosidases such as beta- galactosidases, xylosidases and exo-galacturonases and orthologs or isoforms hereof.
  • nucleotide sequence which, following the introduction of the construct into a plant cell, results in an altered production of at least one target cell wall polysaccharide-modifying enzyme, is sufficiently different from endogenous genes of the host plant so that co-suppression will not occur.
  • an auxiliary enzyme including as examples a methyl esterase, an acetyl esterase or a glycosidase that removes single mono- saccharides from polymers, such as e.g. an arabinofuranosidase, a galactosidase, a xylo- sidase or a fucosidase, is co-expressed with the target cell wall polysaccharide-modifying enzyme, wherein co-expression facilitates access of the polysaccharide-modifying enzyme to its substrate.
  • the present invention relates to a method for modifying the biosynthesis in a plant cell of at least one complex cell wall polysaccharide to obtain a transgenic plant material that, relative to the wild type state, is modified in a complex cell wall polysaccharide structure, the modification being at least one of the overall glycosidic linkage pattern and the monosaccharide profile.
  • This method comprises the following steps: (i) providing a nucleic acid construct comprising a nucleotide sequence, the expression of which in a plant cell results in that at least one cell wall polysaccharide-modifying enzyme is targeted to a compartment in the plant cell where it is not normally present or in that the expression of a polypeptide naturally produced in the plant cell and affecting the biosynthesis of a cell wall polysaccharide is changed, (ii) transforming a plant cell with the nucleic acid construct, and (iii) deriving from said transformed plant cell a plant cell culture, a plant tissue or a transgenic plant in which the at least one cell wall polysaccharide-modi- fying enzyme, relative to the wild type plant, occurs in a different compartment.
  • the above method includes an embodiment wherein the obtained transgenic plant cells, plant tissues or plants in which the targeted substrate cell wall polysaccharide, relative to the wild type plant, is modified to have a monosaccharide profile where the proportion of at least one monosaccharide is changed by at least 10% or the proportion of at least one glycosidic linkage is changed by at least 10%.
  • the at least one cell wall polysaccha- ride-modifying enzyme is targeted to the Golgi apparatus including membrane vesicles fusing with or budding off from the Golgi stacs including an embodiment wherein the nucleotide sequence, the expression of which in a plant cell results in that at least one cell wall polysaccharide-modifying enzyme is targeted to the Golgi apparatus, is a sequence coding for a chimeric gene product comprising the at least one cell wall polysaccharide- modifying enzyme and a sequence capable of targeting the chimeric gene product to the Golgi.
  • a targeting sequence is e.g. a type II membrane anchored Golgi protein, e.g.
  • a sialyl transferase a N-acetylglucosaminyl- transferase, a fucosyl transferase, a xylosyl transferase or a galactosyl transferase including a fragment thereof, or a soluble Golgi targeted protein such as e.g. Pisum sativum reversibly glycosylatable polypeptide (RGP1) or a fragment thereof.
  • RGP1 Pisum sativum reversibly glycosylatable polypeptide
  • the present invention pertains to a method for providing a transgenic plant comprising parts in which at least one complex cell wall polysaccharide, such as pectin or a hemicellulosic polysaccharide, can be enzymatically processed after harvest by an enzyme present in the plant material itself, i.e.
  • a "self-processing" plant comprising: (i) providing a nucleic acid construct comprising a nucleotide sequence, which, following the introduction of the construct into a plant cell, causes a cell wall polysaccharide-modifying enzyme to be expressed in a non-apoplastic or non-Golgi compart- ment of the plant cell or the expression of a cell wall polysaccharide-modifying enzyme in a form that is inactive under in vivo conditions but can be activated following harvest of plant material derived from the plant cell, (ii) transforming a plant cell with the nucleic acid construct, and (iii) deriving from said transformed plant cell a transgenic plant material in which, under appropriate post harvest conditions, the at least one complex cell wall poly- saccharide can be enzymatically processed after harvest by bringing the at least one complex cell wall polysaccharide into contact with the cell wall polysaccharide-modifying enzyme that is expressed in a non-apoplastic or non-Golgi compartment or by
  • the nucleotide sequence which, following the introduction of the nucleic acid construct into a plant cell, causes a cell wall polysaccharide- modifying enzyme to be expressed in a non-apoplastic or non-Golgi compartment is a sequence that causes the cell wall polysaccharide-modifying enzyme to be targeted during growth of the plant to a cell compartment selected from the group consisting of a vacuole, the endoplasmic reticulum, the cytoplasm and a plastid, including embodiments wherein the cell wall polysaccharide-modifying enzyme caused to be expressed in a non-apoplastic or non-Golgi compartment is encoded by a sequence comprised in the nucleic acid construct that is introduced into the plant cell or by an endogenous sequence present in the genome of the cell into which the nucleic acid construct is introduced.
  • the cell wall polysaccharide-modifying enzyme is selected from the group consisting of an endo-polygalacturonase, an endo-pectin lyase, a pectate lyase, a rhamnogalac- turonan hydrolase, a rhamnogalacturonan lyase, an encfo-glucanase, an encfo-xylanase and an isoform or ortholog hereof.
  • the expression of such enzymes is directed by a plant promoter.
  • the processing of pectin is in the regions between rhamnogalacturonan and homogalacturonan regions.
  • one useful embodiment is one wherein the plant cell is further transformed with a nucleic acid sequence causing an enzyme that is capable of in vivo modifying the structure of at least one complex cell wall polysaccharide, including a cell wall polysaccharide that can be enzymatically processed after harvest by an enzyme present in the plant material itself, to be expressed.
  • a nucleic acid sequence is e.g. a sequence coding for a cell wall polysaccharide-modifying enzyme, or a sequence coding for a product that affects the expression of an endogenous sequence coding for a cell wall polysaccharide-modifying enzyme.
  • the cell wall polysaccharide-modifying enzyme is targeted to the apoplast.
  • Useful enzymes that are capable of in vivo modifying the structure of at least one complex cell wall polysaccharide include endo-rhamnogalacturonan hydrolases, endo-rhamnoga- lacturonan lyases, endo-galactanases, e ⁇ do-arabinanases, arabinofuranosidases, galac- tosidases such as beta-galactosidases, xylosidases and exo-galacturonases and orthologs or isoforms hereof.
  • the invention relates to a method of providing a plant cell wall polysaccharide material having, relative to the wild type state, a modified structure and composition, the method comprising the steps of: (i) providing transgenic plants, e.g. potato plants, using the above method of providing post harvest "self-processing" plants, (ii) cultivating and harvesting said plants and isolating herefrom parts in which at least one complex cell wall polysaccharide, such as e.g.
  • pectin can be enzymatically processed after harvest by an enzyme present in the plant material itself, (iii) subjecting said parts to conditions where the cell wall polysaccharide-modifying enzyme expressed in a non-apoplastic or non-Golgi compartment is brought into contact with its cell wall polysaccharide substrate or the cell wall polysaccharide-modifying enzyme expressed in a form that is inactive under in vivo conditions becomes activated to obtain a modified cell wall polysaccharide, and (iv) isolating the modified cell wall polysaccharide material.
  • the modified cell wall polysaccharide in the material as obtained is modified to have a monosaccharide profile where the proportion of at least one monosaccharide is changed by at least 10% or the proportion of at least one glycosidic linkage is changed by at least 10%.
  • the invention provides a plant cell wall polysaccharide material having, relative to the wild type state, a modified structure and composition, which material is ob- tained by the above method.
  • transgenic plant or progeny of the plant or part thereof obtained by the method according to the first aspect of the invention for providing a transgenic plant material that, relative to the wild type state, is modified in a complex cell wall polysaccha- ride structure and plant cell wall polysaccharide-containing materials obtained from such transgenic plants or progeny or parts including such transgenic plant materials which, relative to a material containing the corresponding wild type cell wall polysaccharide, has at least one altered functional characteristic such as an altered pharmaceutical activity, water binding capacity, processibility, gelling property, thickening property and digestibi- lity.
  • the invention pertains to the use of the above transgenic plants or progeny of the plants or parts thereof or plant cell wall polysaccharide-containing material in the manufacturing of food products, food additive products, feed products, pharmaceu- tical or medical products and cosmetic products and pharmaceutical or medical products comprising the above plant cell wall polysaccharide-containing material, including as examples pharmaceutical compositions, implant materials, medical devices and surgical ad- hesives.
  • transgenic plant or progeny of the plant or part thereof obtained by the above method for modifying the biosynthesis in a plant cell of at least one complex cell wall polysaccharide and plant cell wall polysaccharide-containing materials obtained from such transgenic plants or progeny or parts including such transgenic plant materials which, relative to a material containing the corresponding wild type cell wall polysaccha- ride, has at least one altered functional characteristic such as an altered pharmaceutical activity, water binding capacity, processibility, gelling property, thickening property and digestibility.
  • the invention pertains to the use of the above transgenic plants or progeny of the plants or parts thereof or plant cell wall polysaccharide-containing material in the manufacturing of food products, food additive products, feed products, pharmaceutical or medical products and cosmetic products and pharmaceutical or medical products comprising the above plant cell wall polysaccharide-containing material, including as examples pharmaceutical compositions, implant materials, medical devices and surgical ad- hesives.
  • a method of producing a material comprising a complex plant cell wall polysaccharide having, relative to the corresponding cell wall polysaccharide in the wild type state, a modified structure and/or a modified composition, the method comprising the steps of: (i) providing a cultivatable transgenic plant, such as e.g.
  • a potato plant using the method according to the first aspect of the invention or the above method for modifying the biosynthesis in a plant cell of at least one complex cell wall polysaccharide, or a cultivatable progeny hereof, (ii) cultivating said transgenic plant or progeny under appropriate plant cultivation conditions to obtain a plant material comprising at least one complex cell wall polysaccharide having a modified structure and/or modified composition, and (iii) isolating from the cultivated plants the material comprising the modified cell wall polysaccharide.
  • the material isolated from the cultivated plants comprises a cell wall polysaccharide that, relative to the wild type plant, is modified to have a monosaccharide profile where the proportion of at least one monosaccharide is changed by at least 10% or the proportion of at least one glycosidic linkage is changed by at least 10%.
  • new polysaccharide structure and “new pectin structure” designate polymers with a new glycosidic linkage arrangement and/or changed ratios of the monosaccharide building blocks of the polymer, i.e. a changed monosaccharide profile.
  • linkage pattern the quantitatively insignificant amounts of new end-groups which result from a molecular weight down-shift (as seen e.g. during ripening) is disregarded, and polymers which are altered only in size, are not regarded as new structures.
  • decoration with non-sugar substituents are also disregarded so that a polysaccharide which is different solely by virtue of e.g.
  • Monosaccharide profile of a polysaccharide, or polysaccharide mixture is determined by gas-chromatography of e.g. aditol acetate derivatives of polysaccharide hydrolysates, or by HPAEC with or without separate colourimetric determination of uronic acids.
  • Linkage analysis is usually performed by removal of non-sugar decorations of the poly- or oligosaccharides followed by thoroughly methylating all free hydroxyl groups prior to hydrolysis and derivatisation for gas chromatography.
  • Monosaccharide profile is a property with both quantitative and qualitative components to it, while linkage pattern is a largely qualitative trait. In particular, quantitative traits are subject to biological variation.
  • the present invention allows for the introduction of new structures as defined herein in complex cell wall polysaccharides, and these are recognised by comparison with a wild type control (defined below).
  • a transformant is recognised as being different from the wild type state if the monosaccharide profile differs in one monosaccharide by at least 10 mol% including at least 15 mol%, at least 20 mol% or at least 25 mol%, or if it differs, relative to the wild type plant, in linkage pattern analysis by at least 10 mol% including at least 15 mol%, at least 20 mol% or at least 25 mol% in at least one residue. Simultaneous changes in both monosaccharide profile and linkage pattern are not required but may occur.
  • transgenic or “transformed” plant refers to a plant which by the process of genetic transformation is made to contain nucleic acid sequences, including DNA-methyla- tion patterns, which are not normally present in the plant, or nucleic acid sequences which are in addition to the sequences which are normally present in the plant, or DNA se- quences which are normally present in the plant but which are altered compared to the native sequence.
  • alterations also include changes in their DNA- methylation pattern or changes in placement in the genome.
  • wild type refers to a plant which is neither stably transformed nor manipulated to transiently express extraneous genetic material. Wild type plants are used to gauge biological variation and thus by comparison allow for identification of manipulated plants which display a genuinely new phenotype. Wild type control plants should be of the same cultivar as the modified plant under investigation and should be grown under essentially identical conditions to serve as a proper control in the context of the present invention. Organs and tissues for control analysis shall be sampled from experimental and control plants at similar developmental stages.
  • nucleic acid refers to any nucleic acid substance including DNA, RNA , LNA (locked nucleic acids), PNA, RNA, dsRNA, RNA-DNA-hybrids that is capable of changing the maintenance or inheritance of the genetic material and/or the DNA-methylation pattern in the plant. Also included are nucleic acids comprising non-naturally occurring nucleosides.
  • nucleic acid construct refers to a genetic sequence used to transform plant cells to generate progeny transgenic plants.
  • a nucleic acid construct comprises at least a coding region for a desired gene product, operably linked to the 5' and 3' regulatory sequences for the expression in plants.
  • Such constructs may be chimeric, i.e. consisting of a mixture of sequences from different sources, or non-chimeric.
  • the orientation of the coding region may be either of a sense or antisense orientation, depending on the intended function of the gene product in question.
  • nucleic construct is to be understood as encompassing these new technologies.
  • Particular technical approaches to implementing the present invention using homologous recombination include, but is not limited to: Recruitment of endogenous cell wall polysaccharide-modifying enzymes by replacement of the promoter sequence or by knock-out of a repressor. This may be generally acceptable to the plant, or at least ac- ceptable where the gene in question exists in more than one isoform.
  • subcellular targeting of an endogenous gene product can be changed by replacement of its signal sequence.
  • heterologous genes in toto or their coding regions can be introduced in the plant genome through replacement of an endogenous gene.
  • antisense refers to the sequence of a DNA strand that is complementary to the sequence of the sense strand and that cannot be translated into the polypeptide encoded by the structural gene.
  • antisense refers to a nucleic acid construct that is operably linked to a promoter with all or part of the sequence in reverse orientation so that following transcription into an RNA molecule, hybridisation can occur between sense and antisense sequences thereby leading to a reduced level of the polypeptide in question.
  • sense refers to the sequence of the DNA strand of a structural gene that is transcribed into an mRNA molecule copy which is then translated into the polypeptide encoded by the structural gene.
  • operably linked means that the regulatory sequences which are necessary for the expression of the coding sequence are placed in the nucleic acid molecule in the ap- basementte position relative to the coding sequence so as to effect the expression of the coding sequence.
  • the coding sequence can be operably linked to regulatory sequences in the genome of the cell which is transformed with the coding sequence.
  • promoter refers to a DNA sequence which causes, or is needed for transcription of DNA into an RNA molecule.
  • the promoter may be a tissue specific or organ specific promoter, a promoter which is active at specific developmental stages or it may be an inducible promoter, e.g. one of the inducible promoters discussed below or another inducible promoter known in the art, or a constitutive promoter such as the cauliflower mosaic virus 35S promoter or another constitutive promoter known in the art.
  • vector means a nucleic acid molecule that is capable of replicating in a cell (or capable to be multiplied in vitro, e.g. by PCR methods) and to which another nucleic acid sequence can be operably linked so as to bring about replication of the attached nucleic acid sequence.
  • vectors Commonly used vectors are discussed below and include bacterial plas- mids and bacteriophages.
  • nucleic acid constructs as defined above can be incorporated into plant cells using conventional recombinant nucleic acid technologies. Generally, such techniques involve inserting nucleic acid in an expression vector which contains the necessary elements for the transcription and translation of the inserted protein coding sequence and one or more marker sequences to facilitate selection of transformed cells or plants. Once the nucleic acid construct has been cloned into an expression vector, it may be introduced into the plant cell using conventional transformation procedures known by a person skilled in the art. These include, but are not limited to, use of Agrobacterium vectors such as A. tume- faciens and A.
  • transformation refers to the event of intro- duction of a nucleic acid into a plant cell irrespective of whether or not subsequent incorporation of the nucleic acid into the genome of the transformed cell occurs.
  • plant cell is meant to encompass any cell derived from the plant, including un- differentiated tissues such as callus and suspension cultures, as well as plant seed, pollen or plant embryos.
  • Plant tissues suitable for transformation include leaf tissue, root tissue, meristems, protoplasts, hypocotyls, cotyledons, scutellum, shoot apex, root, immature embryo, callus, somatic embryos, embryogenic structures, pollen and anther.
  • targeted when related to methods for in vivo cell wall polysaccharide remodel- ling or modification, is meant to distinguish the present invention from mutation approaches which are inherently random in nature, and also distinguish it from transgenic approaches in which polysaccharide precursor pools are altered. The latter approach allows for concurrently changing the monosaccharide profile of all polymers using the affected building block, while the present invention is targeted in the sense that particular cell wall polymers can be modified specifically.
  • targeted indicates that side effects on the composition of the targeted polysaccharide, e.g. reducing the amount of fibrillar cellulose or lignin of the wall, are regarded as random modifications. The remainder of the wall following a reduction in any major component will often lead to simple replenishment with other wall building blocks.
  • complex cell wall polysaccharide refers to the classes of polymers from vascular plants to which the present invention pertains. Intracellular complex polysaccharides, starch and fructans, are not included. Neither are specialised seed storage polysaccharides exemplified by mannans, galactomannan and storage xyloglucan deposited in secondary walls of seeds. The simple, crystalline fibrils of cellulose does not qualify as “complex” in the present context. Covered by the definition are for example the broad classes of hemicellulose and pectin as defined below.
  • hemicellulose or "hemicellulosic polysaccharide” refers to structural xyloglucan (as opposed to storage xyloglucan), xylans, arabinoxylans and various non-cellulosic beta-glucans.
  • pectin or “pectic polysaccharide” refers to the group of polysaccharides described above and commonly known as pectins, i.e. polysaccharide materials found in plant cell walls in the form of a mixture of homogalacturonan, xylogalacturonan, rhamnogalacturonan and arabinogalactan polymers.
  • smooth region refers to the primarily straight chained, unbranched regions of pectin comprising homogalacturonan, which contain galacturonic acid units which may be esterified to varying degrees, typically with O-acetyl and O-methyl groups.
  • the smooth regions may further contain stretches of xylogalacturonan and rhamnogalacturonan II.
  • hairy region refers to the branched chain regions of pectin comprising rhamnogalacturonan I, whose backbone is made up of GalA and Rha and its various side chains containing arabinose and galactose as the major constituents.
  • polysaccharide-modifying enzyme refers to any enzyme which is capable of modifying the structure of complex cell wall polysaccharides or any part thereof.
  • a polysaccharide structure is regarded new if it displays a new structure as defined above.
  • enzymes responsible for transfer of these moities are not considered polysaccharide modifying enzymes (see also the definition of "auxiliary enzyme” below).
  • Glycosyltrans- ferases involved in the biosynthesis of the polysaccharide back-bones are not considered herein as a polysaccharide-modifying enzyme either.
  • Manipulating the expression of the synthases may indeed cause major changes to the polysaccharide structures, but, compared to the present invention, this is regarded as a fundamentally different approach to obtaining new polysaccharides, a technique that does not rely on modifications. Yet to be identified genes with roles in single sugar residue decorations of the polysaccharides may be of relevance to the present invention (see definition of "decorative enzymes" below).
  • Polysaccharide modifying enzymes generally belong to the category of enzymes involved in the degradation or turn-over of polysaccharides.
  • Non-limiting examples of these enzymes include e ⁇ do-rhamnogalacturonan hydrolases, endo-rhamnogalacturonan lyases, e ⁇ do-polygalacturonases, e ⁇ do-pectate lyases, e ⁇ do-pectin lyases, e ⁇ do-galactanases, et?do-arabinanases, endo-xyloglucanases, endo-glucanases, xylanases, arabi- noxylanases, xylogalacturonases, arabinofuranosidases, galactosidases, fucosidases, exo-galacturonases and xylosidases.
  • Specific accessions of particular polysaccharide- modifying enzymes of interest include: Aspergillus aculeatus endo-galactanase (AC-num- ber L34599) or an isoform or ortholog thereof, e.g. the ortholog AJ012316 from Aspergillus tubigensis; rhamnogalacturonan lyase (AC-number L35500) or an isoform or ortholog thereof; and Aspergillus aculeatus endo-1 ,5-alpha-arabinanase (SEQ ID # 1 from WO 94/20611) or an isoform or ortholog thereof, e.g. the ortholog L23430 from Aspergillus ni- ger.
  • Aspergillus aculeatus endo-galactanase AC-num- ber L34599
  • an isoform or ortholog thereof e.g. the ortholog AJ012316 from Aspergillus tubigensis
  • decorative enzyme refers to an enzyme, such as a transferase, which adds single monosaccharide side chains or non-sugar substituents, typically feroyl, acetyl or methyl esters, to the pectic backbone or side chains.
  • Decorative enzymes are thus set apart from synthase complexes which are also transferases and which undertake poly- merisation of the pectic backbone (homogalacturonan and the alternating rhamnogalacturonan backbone) as well as long side chains (most abundantly galactans and arabinans).
  • auxiliary enzyme refers to an enzyme which removes a pectin decoration as understood from the definition of a decorative enzyme above. Decoration often renders pectin inaccessible to polysaccharide-modifying enzymes, and hence, co-expression of the latter with a matching auxiliary enzyme enables or optimises interaction between the primary enzyme and its pectic substrate.
  • auxiliary enzymes include esterases, e.g. a methyl esterase or an acetyl esterase, both of which may be specific to homogalacturonan or rhamnogalacturonan, as well as glycosidases that remove single monosaccharides from polymers, e.g. arabinofuranosidases, galactosidases, xylosidases or fucosidases.
  • Molecular farming refers to the practice of using plants as production vehicles for the production of a particular molecule as opposed to production of vegetables, fruits or frac- tions thereof (juice or flour for example).
  • Classical examples of plant production for the recovery of well-defined molecules are vegetable oil, sugar and starch.
  • Transgenic technology dramatically increases the range of molecules that can be farmed in plants, and the term is used here with particular reference to these wider perspectives.
  • the term “ortholog” is used to denote the following relationship between two (enzyme encoding) genes from different organisms: The genes are regarded as being orthologs if sequence similarity indicates evolutionary relatedness (however marginal), their gene products catalyse the same reaction, and they serve essentially similar or overlapping physiological purposes in the two organisms.
  • isoform is used to denote the following relationship between two genes from the same organism:
  • the genes encode isoforms of the same gene product if sequence similarity indicates evolutionary relatedness and the encoded enzymes catalyse similar reactions. Isoforms may, or may not, serve different physiological functions in the organism.
  • tissue specific and organ specific are used with regard to promoters in such a way that also assimilate inducible promoters are included.
  • Assimilate inducible promo- ters often direct expression in sink organs solely by virtue of their assimilate, e.g. sucrose, inducibility. For all practical purposes, these are considered storage organ specific in the present context.
  • the invention relates to ectopic expression of a plant gene, or heterologous expression of a microbial gene in general without regard to any modification required to ensure proper subcellular localisation.
  • Signal sequences of apoplastic enzymes encoded by plant genes generally function across plant species, also when used in chimeric constructs directing expression to organs where the gene product does not normally accumulate. Even secreted fungal enzymes are trafficked to the apoplast when expressed in plant cells.
  • Those skilled in the art will be familiar with available techniques for engineering a gene where secretion to the apoplast does not function using the native gene, i.e. by replacing a non-functional signal sequence with, typically, a plant or fungal sequence which is known to function, or providing the gene with said sequence without replacement.
  • Example 8 describes a particular em- bodiment of the invention in which advantage is taken of the fact that signal sequences often operate accurately across phylogenetically large distances in that a portion of a rat gene is used to ensure Golgi targeting.
  • Another aspect of the invention relates to co-expression of a gene encoding an enzyme which removes a particular kind of pectin decoration so as to facilitate access to the substrate of an enzyme which catalyses the desired remodelling of the polysaccharide.
  • This embodiment of the invention is referred to as the use of an auxiliary enzyme.
  • Example 9 hereinbelow illustrates the engineering and transformation involved.
  • Another aspect of co-expression of enzymes pertains to self-processing plant material (e.g. self-processing tubers in the case of potatoes).
  • This embodiment involves the enzymatic excision of a pre-selected part or a fragment of the targeted cell wall polysaccharide, e.g. pectin, which part or fragment may or may not have been subject to remodelling (in the latter case, the technology may not involve co-expression).
  • Excision of the pre-selected part or fragment occurring post-harvest can be exercised by an enzyme which is stored in the plant cells separately from the substrate, i.e. this enzyme does not catalyse any changes in cell wall polysaccharide structure in the growing plant.
  • Non-limiting examples of possible locations for the enzyme affording the excision include the vacuole, en- doplasmic reticulum, cytoplasm and plastids. The location is chosen based upon stability in the plant and possible toxicity to the plant of the gene product in question.
  • the enzyme may, however, also be stored directly in the apoplast if interaction with the substrate (apart for binding) can be avoided either by utilising an enzyme which is substantially inactive at ambient temperatures, or substantially inactive in the pH range found in the plant apoplast (pH 3-7.5) so that the enzyme can be activated by an appropriate change of conditions when desired.
  • Activating treatments include (but are not limited to) heat, addition of salts, addition of organic compounds, physical treatment (pH changes), addition of proteases (e.g.
  • the targeted polysaccharide is remodelled in vivo if desired.
  • the plant is treated post-harvest, e.g. by introducing an incubation step of macerated plant material under conditions dictated by the requirements of the enzyme catalysing the excision, and the stored enzyme is thus allowed to act upon its substrate.
  • the released fragments are then recovered in a state suitable for purification.
  • This technology is superior to the use of technical enzymes in two respects: Technical enzymes are rarely pure enough to act solely by excising a desired part or fragment of a polysaccharide without degrading the product due to the presence of side activities.
  • Example 3 illustrate retaining of a cell wall polysaccharide-modifying enzyme in the endoplasmic reticulum and targeting of such an enzyme to the vacuole.
  • Example 12 provides an example of a particular strategy for designing self- processing plant materials including potato tubers releasing galactanase modified hairy regions, and this example also demonstrates accumulation of a gene product in the cytoplasm.
  • Pulp resulting from beet sugar production and pulp resulting from starch production are non-limiting examples of by-products rich in cell wall polysaccharides including pectin of low value in its native state, but whose value can be improved by means of the present invention.
  • Medical applications include the provisions of pharmaceutical compounds as well as medical materials such as wound dressings, materials for transplants or implants, bio- compatible surgical adhesives, immunomodulating compounds and blood clotting modulators etc.
  • Use of the technology presented herein is not limited to molecular farming of the end-products, but is important already in the discovery phase. Plants producing tai- lored polysaccharides, such as pectins, can be used for the systematic generation of Ii- braries of polymers and oligomers covering the structure activity space for some medical applications, i.e. to delineate the structural variability allowed while at the same time preserving the functional properties for the application under consideration. It is known perse in the art how to apply chemometric multivariate analysis, QSAR (quantitative structure activity relationships) and QSPR (quantitative structure property relationships) on data from evaluations of such libraries.
  • QSAR quantitative structure activity relationships
  • QSPR quantitative structure property relationships
  • remodelling i.e. enzymatic modification of the complex cell wall polysaccharides, of any plant belonging to the vascular plants is con- templated, including both monocots and dicots among the angiosperms.
  • remodelling of hemicellulosic polymers is of significant relevance in some species of the latter category, not least forage grasses and the cereals.
  • Additional non-limiting examples of commercially important plants which may be modified in accor- dance with the invention include: soybean, tobacco, parsley, carrots, cauliflower, cabbage, broccoli, potato, sweet potato, bean, pea, chicory, lettuce, beet, turnip, radish, spinach, onion, garlic, pepper, celery, willow, poplar, squash, pumpkin, zucchini, cucumber, apple, pear, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, citrus species, Arabidopsis, duck weed, and tomato.
  • the algae and the sea-weeds are important.
  • the invention is directed to the use of enzymes that modify the hairy regions of pectin, e.g. by cleaving the hairy regions from the smooth regions, and/or by removing or shortening individual side chains of the hairy regions.
  • enzymes that modify the hairy regions of pectin e.g. by cleaving the hairy regions from the smooth regions, and/or by removing or shortening individual side chains of the hairy regions.
  • nucleotide sequences that result in expression of such enzymes so as to result in transgenic plants in which pectin is modified in vivo in the hairy regions, are important.
  • enzymes which render parts of the polymer more soluble, or release it from the wall matrix are important. The focus here is thus on enzymes which cleave the polymeric backbone of the polysaccharide in question.
  • the cell wall polysaccharides in questions are quantitatively and functionally important constituents of plant cell walls. This being the case, it must be assumed that nature sets certain limits as to the extent of modifications that are possible. It is therefore clear that the modifications performed in the context of the present invention should not be so drastic so as to result in a non-viable plant. Some developmental changes resulting from growth impairing cell wall changes may be exploited to obtain localised cell ablation as a route to male sterility and other desirable traits al- ready mentioned. On the other hand, as indicated above, the present inventors have surprisingly found that significant modifications of the monosaccharide profile and the overall linkage pattern of cell wall polysaccharides are possible, while still maintaining viable plants. Based on these surprising findings, it is contemplated that using the teachings herein, a wide variety of modified cell wall polysaccharides may be produced in vivo with- out sacrificing plant viability.
  • complex cell wall polysaccharides may be modified ei- ther in planta or following harvest of the plant material in question in several different ways. These will be briefly summarised in the following:
  • Such targeted expression of polysaccharide-modifying enzymes according to the present invention may suitably be performed using tissue specific regulatory sequences. Many such tissue specific sequences are known in the art.
  • US 5,723,757 e.g. discloses the use of 5' transcriptional regulatory regions of plant genes which ensure "sink tissue” specific expression of a desired DNA sequence.
  • Such transcriptional regulatory regions allow expression of a desired DNA sequence to specifically take place in "sink organs", i.e. photosynthetically inactive parts of a plant such as roots, grains, fruits or tubers.
  • gene products of interest can be either expressed or inhibited in certain tissues.
  • the regulatory regions are in particular derived from genes coding for patatin proteins belonging to class I patatin genes.
  • US 5,436,393 discloses the DNA sequence of an expression cassette comprising potato tuber specific regulatory regions from the patatin gene from potato, in particular the B33 promoter sequence of a patatin gene. Transformation of potato cells using an expression cassette makes possible the production of transgenic potato plants in which a DNA sequence of heterologous origin, fused to the B33 promoter sequence, can be expressed in a tuber specific manner.
  • promoters directing expression to tubers include the putative metallocar- boxypeptidase inhibitor from potato (accession number U30388), the potato lipoxygenase (accession number X95513) and the cathepsin D inhibitor (accession number X74985).
  • Potato lipoxygenase accession number U30388
  • potato lipoxygenase accession number X95513
  • cathepsin D inhibitor accession number X74985
  • tuber specific promoters owe their organ specificity to their sucrose inducibility, it is not surprising that these promoters often will be operational in organs of other species where sucrose accumulates, for example beet roots (the activity of the GBSS promoter in tobacco leaves is illustrated in Example 10 herein). Conversely, it will not be surprising to those skilled in the art that sucrose inducible promoters can be identified from other species and be found to be not only storage organ specific in the originating species but also to confer tuber specificity in potato. Promoters that ensure high expression e.g. in tubers of potato include the GBSS and the B33 promoter.
  • Interference with biosynthesis can, in accordance with the invention, be accomplished by targeting a polysaccharide-modifying enzyme to the Golgi apparatus to interfere with biosynthesis.
  • the enzyme can be engineered so that it becomes membrane anchored, and thus retained in the Golgi, or it can be targeted to the Golgi as a soluble enzyme which eventually will be secreted along with the cell wall polysaccharides into the apoplast. It was a surprising finding that an enzyme which is anchored to the Golgi membrane successfully interacts with a biosynthetic complex which itself is bound to the membrane. Hence both the membrane anchored and the soluble variations are of interest, with the former expected to be most specific. This embodiment also affords a possible solution to the problem arising from possible toxicity to plants of some secreted polysaccharide hy- drolases.
  • Example 5 illustrates the use of a fungal galactanase for the targeted change of the monosaccharide profile of a pre-selected part or fragment of a cell wall polysaccharide as exemplified by the pectin hairy region.
  • Galactan side chains are shortened to an extent where the side chains are no longer substrates for the enzyme. The plant compensates by increasing the relative and absolute content of uronic acids and by increasing the degree of acetylation.
  • the galactans contained few or no decorations with short monosaccharide side-chains (most typically arabinosyl decorations), so that co-expression of an auxiliary enzyme was unnecessary.
  • a particular embodiment of the invention employs double constructs charged with the remodelling enzyme of interest, plus the auxiliary enzyme which co-acts during the processing, see Examples 4 and 9 below.
  • Examples 2 and 7 herein illustrate the expression of a rhamnogalacturonan lyase, i.e. an enzyme which nicks the pectin hairy region backbone and it was demonstrated that this enzyme is capable of cleaving the pectin polymer irrespective of its decoration with acetyl and methyl esters.
  • an auxiliary enzyme typically a rhamnogalacturonan or homogalacturonan acetyl esterase or a methyl esterase, is co- expressed with the primary remodelling enzyme to afford back-bone nicking.
  • Self-processing plant material e.g. tubers
  • This expression may be co-ordinated with expression of additional enzyme(s) catalysing the remodelling of the target cell wall polysaccharide during growth.
  • sequestering of the processing enzyme(s) during growth of the plant may e.g. be in the vacuole, endoplasmic reticulum, cytoplasm and/or plastids, or it may be through chemical sequestering.
  • the in- ternally stored enzyme may e.g. be targeted to the endoplasmic reticulum using the KDEL retention signal or to the vacuole using a signal sequence derived from patatin or spora- min.
  • post-harvest Upon being subjected to a treatment post-harvest, typically a physical treatment in the form of homogenisation or maceration, the internally stored enzyme is brought into contact with the cell wall polysaccharides to catalyse a post-harvest modification of the cell wall material.
  • post-harvest modification is the release of the in vivo modified polymers from pulp material. Using tailored pectin hairy regions as an example, these are released by the action of an enzyme which cleaves the smooth regions of the pectin.
  • Example 12 below illustrates targeting of plant or fungal endo-polygalacturonases to the cytoplasm, to the vacuole and retained in the endoplasmic reticulum (ER).
  • the site inside the cell is selected based on stability and attained accumulation in each site of the enzyme as well as on possible toxicity of the enzyme to the plant when stored in different locations.
  • Conditions for maceration and incubation of the plant material for self-processing are chosen according to properties of the internally stored enzyme, the occurrence of interfering endogenous enzymes in the plant tissue and possibly of the stability of the polymers or oligomers to be recovered. It will be realised from the foregoing that either enzyme may require an auxiliary enzyme, and hence, that ternary or higher order vector constructs can be developed to thus extend this embodi- ment of the invention.
  • Enzymes with the desired property of being able to release pectic polysaccharides from the cell wall polysaccharide mesh comprise in particular those enzymes which (optionally assisted by an auxiliary enzyme) cleave a polysaccharide backbone.
  • Pectin and pectate hydrolases and lyases, rhamnogalacturonan hydrolases and lyases are known enzyme categories with this property.
  • Enzymes active against xylogalacturonan will be similarly useful and should be regarded as exemplifying new activities against specialised structural features of the polysaccharide backbone.
  • Enzymes capable of removing pectic side chains are in the present context viewed primarily as remodelling enzymes. However, it is evident that there may well be examples where side chain removal will solubilise particular oligosaccharides.
  • Pectin is an important food additive and ingredient and it is known to be an important factor in determining the texture of plant material. Modification of its structure, especially at the regions where the molecule is heavily branched (hairy regions) will alter both the physical properties of the polymers and the properties of the cell wall material. This technology allows the ratio of neutral sugar side-chains to homogalacturonan to be manipulated.
  • the functional properties of the pectic phase which correlate with this ratio, and which are of major interest in the food industry, are gelling, gel stability and water- binding efficiency, with the latter being favoured in polymers with larger proportions of hairy regions, and the first two in polymers with a high content of homoglacturonan.
  • Potato pectins have not found any use in food applications due to their high neutral sugar content and the presence of acetyl groups preventing gelation. From a historical point of view, the use of high quality lemon and lime pectins has usually been directed to applications in jellies, jam etc. (high methyl-ester pectins) on the one hand and in low sugar products (low methyl-ester pectins such as calcium pectates) on the other hand. In the last decade, however, the field of application has broadened and now includes use as an emulsifier and stabiliser and as a coating for products prior to frying. New applications for pectin derived molecules include use as a drinkable dietary fibre.
  • pectin gives a rather high viscosity. It has, however, been shown that when degrading the homogalacturonan part of pectins, the rhamnogalacturonan part (Modified Hairy Region - MHR) maintains the same fibre effect while at much lower viscosity (EP 0868854-A2). Similar MHR can be obtained according to the invention from tailored pectins produced by potatoes. Keywords here are low cost and large volume of raw material, both characteristics of the potato pulp raw material. Ideally, a potato can be produced that incorporates PG-activity activated during the starch processing, giving the modified hairy regions directly in the potato juice, i.e. self r processing tubers are of relevance here.
  • Rhamnogalacturonans native or tailored, may find uses as low viscosity products like milk shakes, drinking yoghurt, etc.
  • Pectin engineering would furthermore be useful for the juice, cider and wine industry and would hence be relevant for grapes, apples and other fruits. Juice and must are often subjected to filtering to remove hydrocolloids and suspended oligo- and polysaccharides so as to clarify the juice and prevent the occurrence of haze or precipitates in later processing steps. Filtering may be facilitated by tailoring pectin so as to increase solubility, or conversely to increase precipitability.
  • the present invention provides new opportunities for gaining control over those juice and must characteristics which rely on soluble and suspended pectic polymers.
  • the invention therefore provides a method for improving food industrial processability of plant material in general, e.g. with respect to canning, calcium firming, filtering, etc., by using plant material with modified pectin as described herein. Medical applications of modified plant cell wall polysaccharides
  • modified cell wall poly- saccharides including modified pectin substances will be useful for a variety of applications in the pharmaceutical and medical fields.
  • the present invention makes it possible to modify the structure of a cell wall polysaccharide in vivo to produce a polysaccharide modified to have specific properties with respect to e.g. immunomodulation.
  • modified cell wall polysaccharides developed and pro- quizzed in accordance with the present invention may be suitable for general use as anti- inflammatory compounds for any type of inflammatory reaction, whatever the cause, including inflammation resulting from physical damage, chemical agents, and biological agents such as bacteria, fungi, viruses and other microorganisms.
  • Modified cell wall polysaccharides will be able to act as a water buffering system where the dressing either removes water produced by the wound, or supplies it to dry gangrene so that the cellular immune system gains access to the surface.
  • the biological activities of pectin are unique to pectins. Desirable bioactivities include the potential of the pectins to act as a reservoir for cellular growth factors and hence stimulate cell growth in the chronic wound.
  • Another interesting perspective is to use a pectin membrane as a scaffold for regrowing skin from cultured skin cells to be used as transplants.
  • autoimmune-associated conditions include: Autoimmune hepatitis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Autoimmune hemolytic anemias, Grave's disease, Myasthenia gravis, Type 1 Diabetes Mellitus, Inflammatory myopathies, Multiple sclerosis, Hashimoto's thyreoiditis, Autoimmune adrenalitis, Crohn's Disease, Ulcerative Colitis, Glomerulonephritis, Progressive Systemic Sclerosis (Scleroderma), Sjogren's Disease, Lupus Erythematosus, Primary vasculitis, Rheumatoid Arthritis, Juvenile Arthritis, Mixed Connective Tissue Disease, Pso- riasis, Pemfigus, Pemfigoid, Dermatitis Herpetiformis, etc.
  • modified pectins and other polysaccharides are in combating some types of cancer.
  • MCP modified citrus pectin
  • melanoma skin cancer
  • prostate cancer prostate cancer
  • This effect is believed to be associated with a cytostatic or "antiad- hesive" effect provided by the MCP in the early stages of metastasis (Ralph W. Moss, http://ralphmoss.com/mcp.html).
  • modified pectic polysaccharides By use of the method outlined herein for identifying and producing modified pectic polysaccharides, it is believed that novel modified cell wall polysaccharide substances including modified pectins suitable for use as anti-cancer agents can be developed and commercially produced e.g. by means of molecular farming techniques.
  • pectic polymers are synthesised as repeating structures which in turn consist of other, smaller repeating structures. While the remodelling technology described herein does not change the fact that pectic polymers remain less than fully characterised, it is possible to produce populations of molecules in which the difference between molecules is rather precisely known.
  • rhamnogalacturonan from tubers expressing endo-galactanase described in Example 5 differs from the corresponding wild-type polymers by the length of the galactan hairs, degree of acetylation and uronic acid content. Hence, it can be determined with certainty whether these features are es- sential for an observed bioactivity.
  • a library in which the differences between entries are known can be generated using the following steps:
  • Tailored pectins are recovered from a range of transgenic plants each producing poly- saccharides modified in a well-defined way.
  • step 2 Samples from step 1 are subdivided and treated post-harvest with enzymes in vitro.
  • Step 2 Samples from step 2 are subdivided and modified by chemical treatments, saponifica- tion and partial hydrolyses for example and derivatisation in vitro; permethylation, acetyla- tion, epoxidation and amidation are non-limiting examples of the latter.
  • Types of derivati- sations and methods are known per se from the food ingredient industry, the textile industry and from organic synthesis and spectroscopy of carbohydrates.
  • Step 2 and 3 may, if desired, be performed in the opposite order so that the chemical modification serves the purpose of protecting or exposing some parts of the molecule to enzymatic reactions.
  • the library entries are then subjected to screening for medical activity using screening procedures known per se in the art. As the structure-function relationship of particular compounds becomes evident, this will provide information useful for deciding whether to transfer some of the enzymatic treatments used post-harvest (step 2) into the plant (where compensation by the plant allows for it), and thus develop transformed plants for the molecular farming of a starting material which is tailored as much as possible in the plant by means of in vivo processing of pectin.
  • Fig. 1 illustrates the use of exploratory principal component analysis (PCA) to discriminate two transgenic potato plants, Tn., and T 13 1 , expressing Aspergillus aculeatus endo-ga- lactanase from wild type, and it shows the comparison between T 1 3. 1 and wild type, using the third and fifth Principal Component (PC) score;
  • Fig. 2 shows size exclusion chromatographic analysis (detection by refractive index) (arbitrary units) of rhamnogalacturonan I (RGI) specifically extracted from cell walls of wild type potato tubers (WT) and transgenic potato plants, T ⁇ ⁇ and T 13.1 , respectively by treatment with a combination of fungal EPG and PME.
  • PCA principal component analysis
  • EPG/PME treatment released nearly twice as much uronic acid (UA) from the cell walls of transformed tubers compared to wild type.
  • the RGI extracted by EPG/PME from wild type cell walls contained two major fractions as indicated by UA content and refractive index detection: fraction A (molecular weight > 500 kDa) and fraction C (molecular weight 0.2 - 8 kDa).
  • EPG/PME extracts from T 11 . 1 and T 13 . 1 have a different profile from the wild type containing less of fraction A, substantially more of fraction C and in addition, fragments of ⁇ 120 kDa (fraction B), not present in wild type extracts.
  • the asterisk indicates a large peak due to the presence of sample buffer salts devoid of pectic material; and
  • Fig. 3 shows sections of wild type (A, C) and endo-galactanase-expressing (T 131 ) (B, D) potato tubers gold labelled with monoclonal antibody LM5, silver enhanced and viewed by reflection confocal scanning microscopy (A, B) and transmission electron microscopy (C, D).
  • the walls of wild type parenchymal cells are strongly labelled (white in A, black particles in C), whereas in T 13 1 tubers, the labelling density is greatly reduced and localised only to some cell corners (arrow heads in B) close to the plasma membrane (ar- rows in D).
  • Asterisks represent spaces once occupied by starch granules.
  • ML indicates the expanded middle lamella of these filled corners. Scale bars: A and B 100 mm, C and D 2 mm.
  • Nicotiana tabacum (L) cv. Xanthi. leaf discs was performed essentially as described by Horsch et al., 1985. Internodes, from in vitro plants of both transformants and wild type plants, were transferred to the greenhouse to generate mature plants. Leaves were harvested and used for analysis. Potatoes, cv Posmo and Karnico were used for Agrobacterium tumefaciens mediated transformation (Visser, 1991). In vitro shoots of transgenic and control clones were transferred to the greenhouse to generate mature plants.
  • DNA was extracted from leaves ground in liquid N 2 according to the CTAB protocol as described by Rogers and Belich (1988).
  • isolated genomic DNA was digested with EcoRI, which cuts twice within the cDNA, and Kpnl, which cuts once within the cDNA.
  • the digested DNA was separated by electrophoresis and blotted onto Hybond N membranes (Amersham) under alkaline conditions as described by Sambrook et al. (1989).
  • the membranes were hybridised, as described by Salehuzzaman et al. (1992), with a 32 P-ATP labeled 1 kb Kpn ⁇ -Xba ⁇ cDNA fragment of rhamnogalacturonan-lyase/pYES2.
  • extraction buffer 50 mM Tris, pH 9.0, 10 mM EDTA, 2 % SDS
  • RNA was precipitated overnight at 0°C with 375 ⁇ l of 8 M LiCI and centrifuged (10 min at 13,000g). The RNA pellet was dissolved in 0.4 ml of H 2 O and precipitated with 40 ⁇ l of 3 M NaAc and 1 ml of ethanol. Following centrifugation the pellet was washed in 70% ethanol, dried, and resuspended in H 2 O. RNA gel blotting and hybridisation were carried out using 40 ⁇ g of tuber RNA per sample, as described by Sambrook et al. (1989).
  • the membranes were hybridised with the following 32 P-ATP la- belled cDNA probes: a 1 kb Kpnl-Xbal fragment of rhamnogalacturonan-lyase/pYES2 and a 2.3 kb EcoRI fragment of a potato 28S ribosomal RNA gene (Landsmann and Uhrig, 1985).
  • Freshly harvested leaves were frozen in liquid N 2 and comminuted using a pestle and mortar with 3 ml extraction buffer A (25 mM NaOAc pH 5.0 containing Complete TM, Boehringer Mannheim) per g tissue (fresh weight). The sample was incubated for 10 min. on ice and insoluble material precipitated by centrifugation (18,000 x gma X ) for 10 min., the supernatant was recovered and stored at 20°C. Freshly harvested tubers were cut into small cubes, frozen in liquid N 2 and comminuted in an electric grinder to a fine powder. The powder was extracted with extraction buffer A as described above.
  • the enzyme activity was determined using a plate assay with a 0.5% upper and 1 % lower agarose layer in 50 mM sodium citrate pH 4.5.
  • the upper layer contained a suspension of the substrate, azurine-coupled potato galactan (Megazyme International, Bray, Ireland), at a concentration of 1 mg/ml. Aliquots (20 ⁇ l) of tissue supernatants were added to wells punched in the upper layer only. Plates were incubated at room temperature for 24 hr.
  • Tuber extracts of wild type and transformants (T 1t1 and T 13 . ⁇ ) were assayed for endo-galactanase activity using the p-hydroxybenzoic acid hydrazine assay (Lever 1972) with potato galactan (P-GALPOT from Megazyme) at a concentration of 0.1 % in 0.1 M NaOAc pH 4.0 as substrate at 40°C.
  • the enzyme activity was determined using a plate assay with a 0.5% upper and 1% lower agarose layer in 50 mM sodium citrate pH 5.5.
  • the upper layer contained a suspension of the substrate, azurine-coupled sugar-beet arabinan (Megazyme International, Bray, Ireland), at a concentration of 1 mg/ml. Aliquots (20 ⁇ l) of tissue supernatants were added to wells punched in the upper layer only. Plates were incubated at room temperature for 24 hr.
  • Frozen potato tissue was ground with a mortar under addition of liquid nitrogen. Approximately 1 gram of ground potato tissue was homogenized using an Ultra-Turrax TP 18-10 (14,000 rpm, Ika Werk, Staufen, Germany) in 2 ml of a 0.25 M sodium phosphate buffer (pH 6.5; 4°C) containing 0.4 M NaCI. After 1 h of extraction at 4°C (with periodic shaking), the suspension was centrifuged (10 min, 2,000 g). The supernatant was used as the enzyme extract.
  • Tuber extracts were subjected to SDS-PAGE and Western Blot analysis according to standard procedures.
  • the blot was probed with a rabbit antibody raised against purified Aspergillus aculeatus galactanase (a gift from Jens-Christian Navarro Poulsen, Centre for Crystallographic Studies, University of Copenhagen).
  • Epidermal peels from 20 leaves from in vitro plants and Vibratome sections (60 ⁇ m) from 20 individual freshly harvested wild type and transgenic (11.1 , 11.2 and 13.1) tubers were mounted on barium fluoride windows and air dried.
  • the barium fluoride window was supported on the stage of a UMA500 microscope accessory of a Bio-Rad FTS175c FTIR spectrometer equipped with a liquid nitrogen-cooled mercury cadmium telluride detector. Areas of 100 ⁇ m 2 of the cortex and perimedullary regions were selected and spectra obtained. Sixty-four interferograms were collected in transmission mode with 8 cm "1 resolu- tion and co-added to improve the signal-to-noise ratio for each sample.
  • CWM cell wall material
  • octanol were also added to minimise frothing during blending.
  • the detergent was removed by washing through a 250 and 36 ⁇ m sieve with chilled mixed-cation buffer. This procedure was carried out at 4°C. The washed residue was removed from the sieve and stirred in chilled 50% acetone. The sample was filtered and weighed into a large beaker. Five times the sample weight of a saturated phenol solution was added. After 30 minutes stirring the saturated phenol was removed by suction and the residue was washed with the mixed-cation buffer solution on a grade 3 sintered glass funnel.
  • the residue was frozen into small pellets in liquid nitrogen and cryomilled for 2 x 15 seconds in a coffee grinder. Immediately after thawing, the sample was mixed into a paste with mixed-cation buffer. This paste was stirred quickly into a large volume of boiling mixed-cation buffer and boiled for 30 seconds. Immediately following the 30 second boil the mixture was decanted into chilled mixed-cation buffer (10 volumes), resulting in immediate cooling.
  • Starch removal was effected with ca 1,500 units of alpha-amylase (Boehringer) and 400 units of pullulanase (Megazyme) in mixed-cation buffer with 0.01% w/v NaN 3 .
  • the sample was agitated in an orbital shaker at 37°C overnight. If starch still remained, the enzyme treatment was repeated. The presence of starch was detected using 1% KI/0.5% l 2 under the light microscope.
  • When starch removal was complete as assessed by Kl staining the cell walls were washed on a 36 ⁇ m sieve to remove glucose and salt. The residue was freeze-dried as the cell wall material.
  • the obtained CWM was fractionated by extraction with different solvents as described by Huisman et al. (1999).
  • CBSS Cold Buffer Soluble Solids
  • HBSS Hot Buffer Soluble Solids
  • ChSS Chelating Agent Soluble Solids
  • ASS Alkali Soluble Solids
  • Res a hemicellulose rich residue
  • Neutral sugar composition was determined by subjecting the samples to a 1 M H 2 SO 4 hydrolysis (3 h at 100°C). Next, the released neutral sugars were converted into their alditol acetates and separated on a 2-mm i.d. glass column packed with Chrom WAW 80-100 mesh, coated with 3% OV275 (Chrompack, Middelburg, The Netherlands) in a Carlo Erba Fractovap 2300 gas chromatograph (Milan, Italy) operated at 200°C and equipped with a flame ionization detector set at 270°C. Inositol was used as the internal standard.
  • the degree of acetyl and methyl esterification was estimated by HPLC using the procedure desribed by Voragen er al. (1986).
  • Pectinases e.g. polygalacturonase, pectin methyl esterase, endo-arabinase, endo-ga- lactanase, arabinofuranosidase, galactosidase, pectate lyase, rhamnogalacturonan acetyl esterase, in combination with High Performance Size Exclusion Chromatography (BioGel TSK 40XL, 30XL, and 20XL columns in series) and High Performance Anion Exchange Chromatography using a Dionex (Sunnyvale, CA, USA) Bio-LC GPM-II quaternary gradient module equipped with a Dionex CarboPac PA-100 column (250 x 4 mm, 20°C) were used to further elucidate the structure of the pectin fractions. However, solubility problems hindered these experiments.
  • de-starched cell wall material (10 mg) was suspended in 2 ml 50 mM ammonium formate, pH 4.5, containing 0.05% sodium azide.
  • the suspension was then filtered through a double layer of nylon (30 ⁇ m pore size) to separate the EPG/PME extracts from the remaining wall material which was suspended in 1 ml ice-cold 50 mM sodium carbonate containing 10 mM sodium borohydride.
  • Seaman hydrolysis (Selvendran et al., 1979) was used to hydrolyse crude or insoluble cell wall residues for monosaccharide composition analysis, whereas solubilised wall fractions were hydrolysed to monosaccharides using 2 M aqueous TFA for 1 h at 121 °C.
  • the Seaman hydrolysis was carried out as described below. Wall residues (2-4 mg) were added to 100 ⁇ l ultrapure water in a screw-capped borosilicate test tube, 300 ⁇ l cone. H 2 SO 4 was added and the suspension was left for 3 h at room temperature with occasional vortexing. The suspension was then diluted with 6.6 ml ultrapure water and heated for 2 h at 100°C.
  • Monosaccharide mixtures (5-15 ⁇ g) were applied to a Carbo-Pac PA10 column (Dionex, Sunnyvale, CA, USA) and eluted isocratically with water at a flow rate of 1.5 ml/min.
  • Sodium hydroxide 300 mM was added to the column eluent continuously at a flow-rate of 0.5 ml/min, and the eluent was monitored using a pulsed amperometric detector (Dionex).
  • the degree of acetyl and methyl esterification was estimated by HPLC using the proce- dure desribed by Voragen et al. (1986).
  • the granule bound starch synthase promoter region from the vector pPGB121s was amplified by the polymerase chain reaction (PCR) with primers 5'GATTACGCCAAGCTTTAACG3' (SEQ ID NO:1) and 5'GGTTTGTCGACGAAATCAGAAATAATTGGAGG3' (SEQ ID NO:2) introducing a H/ndlll site 5' and a Sail site in the 3' end of the PCR product.
  • the PCR approach deleted a spurious translational start codon in the GBSS 5' untranslated region.
  • the product was then purified by agarose-gel electrophoresis and ligated into HindlMBall- cleaved pGUSNos (a gift from L. Sander) producing pGBSS-GUSNos.
  • the GBSS promoter fragment was then excised from pGBSS-GUSNos with H/ndlll and Xba ⁇ , purified, and subsequently cloned in H/ndlll/XJ al digested pBI121 (Datla et al, 1992), generating the vector pPGB121-new.
  • This vector was digested with Smal and Sacl in order to remove the GUS coding region. Subsequently, the Sacl overhang were blunted with Klenow fragment and the vector closed by ligation resulting in pPGB121 s-new.
  • the vector pPGB121 s-new was digested to completion with Sail and BamHI and purified by agarose gel-electrophoresis.
  • the H/ndlll site was deleted in pPGB121 s-new by digestion with H/ndlll followed by fill-in of the overhangs by reaction with Taq in the presence of nucleotides for 7 min. at 72°C.
  • the resulting product was purified by agarose-gel electrophoresis and closed by ligation, generating pPGB121s-new-DHindlll.
  • MCS multiple cloning site
  • pGED was digested with Sail and BamHI and purified by agarose gel-electrophoresis.
  • a novel polylinker produced by annealing of two synthetic oligonucleotides with the sequences 5'TCG ACC GGT ACC AAG CTT GCG GGC TCT AGA CTC GAG CCT AGG CCC GG' (SEQ ID NO:7) and 5' GAT CCC GGG CCT AGG CTC GAG TCT AGA GCC CGC AAG CTT GGT ACC GG' (SEQ ID NO:8) was cloned into the remaining part of the original MCS of pGED, generating the plasmid pADAP.
  • the novel MCS introduced restriction sites for Aga , Kpnl, H/ndlll, Xbal, Xnol, Avril and Smal.
  • the vector pBINB33 (a kind gift from L. Willmitzer) was digested with EcoRI and purified by agarose gel-electrophoresis. Following a linker encoding a H/ndlll site produced by annealing of the oligonucleotides 5' AATTCAAGCTTG 3' (SEQ ID NO:9) and 5' AATTCAAGCTTG 3' (SEQ ID NO: 10) was cloned in the EcoRI cut pBINB33 vector. This step resulted in generation of the vector pBINB33-EHE. In order to isolate a fragment harbouring the patatin B33 promoter the pBINB33-EHE vector was digested with H/ndlll and Sail. The resulting fragment was cloned in H/ndlll/Sa/l digested pPGB121s-B, generating the plasmid pPGB121s-B-B33.
  • the 1 ,3 kb cDNA encoding an Aspergillus aculeatus galactanase was excised from the vector pC1G1 (a generous gift from S. Kauppinen) by digestion with H/ndlll and Xbal, pu- rified and cloned in the corresponding sites in the pGED MCS, creating the expression cassette: GBSS promoter, endo-galactanase, nopaline synthase terminator.
  • This DNA construct is referred to as pGED-GAL.
  • a 1 ,2 kb cDNA encoding an Aspergillus aculeatus arabinanase was excised from the vector pC1A4 (a generous gift from S. Kauppinen) by digestion with H/ndlll and Xbal, purified and cloned in the corresponding sites in the pGED MCS giving rise to the plasmid pGED-ARA.
  • the 1.2 kb fragment encoding the Aspergillus aculeatus arabinanase was isolated from pGED-ARA by digestion with H/ndlll/Sa/l and cloned into pre-cut pADAP. This step resulted in the vector pADAP-ARA.
  • the 1.3 kb fragment encoding the Aspergillus aculeatus galactanase was isolated from pGED-GAL by digestion with H ndlll/Sa/l and cloned into pre-cut pADAP. This step resulted in the DNA construct pADAP-GAL.
  • the 1.2 kb fragment encoding the Aspergillus aculeatus arabinanase was isolated from pADAP-ARA by digestion with Kpnl and Smal. The fragment was then cloned in pre-cut pPGB121s-B-B33. This step generated the DNA construct pPGB121s-B-B33-ARA.
  • the 1.3 kb fragment encoding the Aspergillus aculeatus galactanase was isolated from pADAP-GAL by digestion with Kpnl and Smal. The fragment was then cloned in pre-cut pPGB121s-B-B33, creating the expression cassette: patatin B33 promoter, endo-galac- tanase, nopaline synthase terminator. This step generated the DNA construct pPGB121s-
  • the plant transformation vector pPGB121s-new was digested with the restriction enzyme Sail, blunt-ended with Klenow enzyme, and after heat-inactivation of the two enzymes further digested with the restriction enzyme Xbal.
  • the vector pYES2/RHGB containing the cDNA clone encoding the Aspergillus aculeatus rhamnogalacturonan lyase was digested with the restriction enzyme Ba HI, blunt-ended with Klenow enzyme, and after heat-inac- tivation of the two enzymes further digested with the restriction enzyme Xbal.
  • the treated vector and cDNA insert were purified after agarose gel electrophoresis and ligated, creating the DNA construct pPGB121s-new-RHGB.
  • the arabinanase encoding cDNA was amplified with the primers
  • the majority of the ARA-KDEL coding region was swapped with the coding region originating from the original ARA cDNA included in the yeast expression vector pC1A4.
  • the vectors pCR2.1-TOPO/ARA-KDEL1 and 2 was cleaved with Sail and Xbal and the resulting KDEL encoding fragment cloned into Sall/Xbal-cut pC1A4. This resulted in generation of the vector pYES2.0/ARA-KDEL.
  • the ARA-KDEL fragment was then ex- cised from pYES2.0/ARA-KDEL with H/ndlll and Xbal and cloned in H/ndlll/Xbal digested pADAP. This generated the vector pADAP/ARA-KDEL.
  • the ARA-KDEL fusion was excised from pADAP/ARA-KDEL with Kpnl and Smal and the fragment purified by agarose gel-electrophoresis. The resulting fragment was cloned into Kpnl/Smal digested pPGB121s-B-B33. This step generated the vector pPGB121s-B- B33/ARA-KDEL.
  • the ARA-KDEL fusion was excised from pADAP/ARA-KDEL with Kpnl and Smal and the fragment purified by agarose gel-electrophoresis. The resulting fragment was cloned into KpnllSmal digested pPGB121s-B-B33. This step generated the vector pPGB121s-B- B33/ARA-KDEL.
  • the glycosyltransferase alpha-2,6-sialyltransferase is a Type II membrane protein localised to the Golgi apparatus.
  • the first 44 amino acids of this protein have previously been shown to direct Golgi retention of a fused marker protein, lysozyme (Munro 1991).
  • Golgi targeting of GFP has been accomplished by fusion of the 52 N-terminal amino acids of ST (Boevink et al. 1998).
  • ST SOE FWD ST specific sequences underlined
  • GACGAAGCTTATGATTCATACCAACTTG 3' SEQ ID NO: 13
  • ST SOE REV ST specific sequences underlined
  • GGAGCCGGGGTTGGCGTA-GGCCACTTTCTCCTGGCTC 3' (SEQ ID NO: 14).
  • the plasmid pST-MYC used as a template was a kind gift from S ⁇ ren M ⁇ gelsvang.
  • the mature part of the arabinanase was then amplified with primers (ARA SOE FWD, arabinanase specific sequences in bold) 5'GAGCCAGGAGAAAGTGGCCTACGCCAACCCCGGCTCC 3' (SEQ ID NO: 15) and (ARA SOE REV, arabinanase specific sequences in bold) 5'
  • CAGTCTAGACTACACAACAGGCCAGCC 3' (SEQ ID NO: 16).
  • the two products were purified by agarose gel-electrophoresis and subsequently fused by sequence overlap extension PCR (Higuchi 1988) resulting in fusion of the 52 N-terminal amino acids of the ST to the mature part of the arabinanase (302 amino acids).
  • the fusion product was purified by agarose-gel electrophoresis digested with H/ndlll and Xbal and cloned in H/ndlll/Xbal digested pADAP.
  • the resulting plasmid was named pADAP/ST-ARA.
  • the vector pPGB121s-B was cleaved with H/ndlll and EcoRI.
  • the resulting fragment harbouring the GBSS-Tnos expression cassette was end-filled with Taq and the resulting product was cloned in the vector pCR2.1-TOPO as described by the manufacturer (Invi- trogen).
  • This step generated the vectors pCR2.1-TOPO/GBSS-nosterm1 and pCR2.1- TOPO/GBSS-nosterm 2.
  • Each vector was digested with EcoRI and the resulting fragment purified by agarose-gel electrophoresis.
  • the fragment was cloned in the vector pGED which had been digested with EcoRI and dephosphorylated with alkaline shrimp phos- phatase as described by the manufacturer (Boehringer Mannheim). This step resulted in the vectors pGED/double/1 and pGED/double/2 harbouring two GBSS promoters followed by multiple cloning sites carrying Sail, H/ndlll, Xbal, Xbol, BamHI (MCS1) and Sail, Age ⁇ , Kpnl, Avrll, Smal, Xmal and BamHI sites (MCS2).
  • DNA construct harbouring genes encoding a remodelling and an auxiliary enzyme, pPGB121s-new-RHGB-RHA1:
  • the vector pBI221 (Clontech) was digested with the restriction enzyme EcoRI, dephosphorylated, phenol/chloroform extracted and precipitated with alcohol.
  • the phospho- rylated oligonuleotide P-AATTAAGCTT (SEQ ID NO: 17) was self-annealed and ligated into the EcoRI restricted pBI221 vector, creating the vector pBI221-2Hindlll.
  • the vector pBI221-2Hindlll was digested with the restriction enzyme Sacl, blunt-ended with T4 DNA polymerase, and after heat-inactivation of the two enzymes further digested with the restriction enzyme SamHI.
  • the treated vector ( pBI221-2Hindlll*B*Sb) was purified after agarose gel electrophoresis.
  • the vector pGEM-7Z/RHA1 containing the cDNA clone encoding the Aspergillus aculeatus rhamnogalacturonan acetyl esterase was digested with the restriction enzyme Xbal, blunt-ended with Klenow enzyme, and after heat-inactivation of the two enzymes further digested with the restriction enzyme SamHI.
  • the treated cDNA insert was purified after agarose gel electrophoresis and ligated into the gel-purified vector part pBI221-
  • the vector pBI221-2Hindlll- RHA1 was digested with the restriction enzyme H/ndlll and the expression cassette containing the 35S promoter-rhamnogalacturonan acetyl esterase, nopaline synthase terminator was purified after gel electrophoresis.
  • the DNA construct pPGB121s-new-RHGB was digested with the restriction enzyme Hin- dlll, de-phosphorylated, purified after gel electrophoresis, and ligated with the purified Hindlll fragment containing the expression cassette: :35S promoter, rhamnogalacturonan acetyl esterase, nopaline synthase terminator, creating the DNA construct pPGB121s- new-RHGB-RHA1.
  • the construct pGED/GAL is digested with H/ndlll/Xbal and the resulting GAL encoding fragment is isolated by agarose-gel electrophoresis
  • the vectors pGED/double/1 and pGED/double/2 are cleaved with H/ndlll and Xbal and purified by agarose-gel electrophoresis followed by cloning of the GAL encoding fragment.
  • These steps generate two vectors designated pGED/apoGAL/empty/1 and pGED/apoGAL/empty/2, respectively.
  • the two vectors have been equipped with an apoplastic targeted galactanase between the GBSS promoter and the Nos terminator in the first GBSS/Nos terminator cassette.
  • the 1.3 kb cDNA fragment encoding the Aspergillus aculeatus endo-galactanase is isolated from one of the previously constructed vectors and cloned in between the GBSS promoter and the Nos terminator in one of the two GBSS/Nos terminator cassetes present in pGED/double/1 or 2, thus creating the apoplastic expression cassette GBSS promoter- endo-galactanase-Nos terminator.
  • These vectors are termed pGED/apoGAL/1 and 2, and are the starting vectors used for the design of all double DNA constructs.
  • the second GBSS promoter- Nos terminator cassette is used for the construction of expression cas- settes designed for delivery of cell wall modifying enzymes, to the cytoplasm, the endoplasmic reticulum (ER) or the plant vacuole.
  • the enzyme is preferentially an enzyme whose action post harvest releases the product of interest from the pulp cell walls.
  • Example 12 self-processing using as non-limiting examples the endo-galactanase as the remodelling enzyme, and endo-PG as the excising enzyme is demon- strated.
  • Vector constructs introducing the endo-PG and targeting it for various subcellular locations are prepared as outlined:
  • Cytoplasmic targeting For cytoplasmic targeting, endo-PGs from plants, bacteria or fungi with high stability in a neutral pH environment are preferred. The targeting to the cyto- plasm is accomplished by removing the sequence from the endo-PG cDNA encoding the endo-PG signal peptide, thus abolishing its transport across the endoplasmic reticulum. If the N-terminus of the mature protein is not known from protein sequences, the cleavage site for the signal peptide is determined empirically using computer programs optimised for this purpose.
  • the cDNA encoding the mature endo-PG protein is then cloned in be- tween the GBSS promoter and the Nos terminator in the second GBSS/Nos terminator cassette in the constructs pGED/apoGal/empty/1 and pGED/apoGal/empty/2.
  • ER retention For ER retention, endo-PGs from plants, bacteria or fungi with high stability in a slightly acidic to neutral pH environment are preferred.
  • the targeting to the ER is ac- complished by incorporating into the cDNA encoding the endo-PG a sequence encoding the tetrapeptide KDEL at the very end of the coding region, giving rise to an expressed protein with a KDEL extension at its C-terminal.
  • the cDNA encoding the fusion protein is then cloned in between the GBSS promoter and the Nos terminator in the second GBSS/Nos terminator cassette in the vectors pGED/apoGal/empty/1 and pGED/apoGal/empty/2.
  • Vacuolar targeting For vacuolar targeting, endo-PGs from plants, bacteria or fungi with high stability in an acidic environment are preferred.
  • Targeting to the vacuole can e.g. be accomplished by attachment of a nucleotide sequence encoding a signal sequence en- suring translocation of the hybrid into the ER followed by a vacuolar signal sequence which e.g. comprises the amino acids NPIRL (an example of an N-terminal propeptide (NTPP)).
  • NPIRL an example of an N-terminal propeptide (NTPP)
  • the NPIRL extension or the like is fused to the C-terminal end of the protein in question while a signal sequence ensuring translocation into the ER is fused to the N-terminal part of the protein destined for vacuolar targeting (Koide et al. 1997).
  • a protein which harbours an NTPP in its N-terminus is sweet potato spo- ramin.
  • the N-terminal part of sporamin has been shown previously to direct proteins not normally found in the vacuole to this compartment when fused to the sporamin N-terminus.
  • a nucleotide sequence encoding ' the N-terminal part of sporamin can be fused directly to the nucleotide sequence encoding an enzyme which hydrolyses the pectin backbone (i.e. with the signal peptide deleted) and thereby direct vacuolar targeting of the pectinase.
  • the cDNA encoding the fusion protein is then cloned in between the GBSS promoter and the Nos terminator in the second GBSS/Nos terminator cassette.
  • This vector is termed pGED/apoGALvacPG/1.
  • Potato plants expressing a fungal (Aspergillus aculeatus) endo-galactanase (Christgau et al, 1995) under the control of the tuber-specific GBSS promoter have been generated, see Example 2. Apart from a low transformation efficiency the obtained plants displayed no altered phenotype compared to wild type plants. The lower frequency may indicate that the promoter is active during in vitro culture and that a high level of endo-galactanase activity at this very early stage of development may be lethal to the transformed cells.
  • Tm and T 13 1 were selected for analysis because of their cell wall phenotype as initially picked up by FTIR- spectrometry, see below.
  • Endo-galactanase activity in the transgenic plants was extracted quantitatively in low salt buffer, indicating that the enzyme is not tightly bound to the cell wall. Extracts from transgenic and wild type plants were also analysed by Western blot. All extracts having endo- galactanase activity contained a protein with a molecular mass of 38 kDa similar to that of isolated recombinant endo-galactanase.
  • Galactosyl residues are present in different wall polysaccharides (hemicellulose, arabinogalactan proteins and RGI), but only RGI is known to contain beta-1 ,4-linked galactan, so our subsequent analysis of cell wall material focused on this polymer.
  • RGI is specifically extracted from walls by treatment with a combination of fungal EPG and PME.
  • This EPG/PME treatment released nearly twice as much UA from the cell walls of transformed tubers compared to wild type (Table 3).
  • the EPG/PME-solubilised pectin was analysed by size exclusion chromatography to separate the digest fragments ac- cording to molecular size.
  • the RGI extracted by EPG/PME from wild type cell walls contained two major fractions as indicated by UA content and refractive index detection (Fig. 2): these were termed fraction A (molecular weight > 500 kDa) and fraction C (molecular weight 0.2 - 8 kDa).
  • EPG/PME extracts from Tn and T 13 -i have a different profile from the wild type (Fig. 2), containing less of fraction A, substantially more of fraction C and in addition, fragments of ⁇ 120 kDa (fraction B), not present in wild type extracts.
  • the asterisk indicates a large peak due to the presence of sample buffer salts devoid of pectic material.
  • fraction A of the wild type tuber contained high proportions of UA, rhamnose, arabinose and galactose with virtually no other monosaccharides, indicative of high molecular weight HGA and RGI polymers.
  • Fraction A from wild type tubers contained 64 mol% galactosyl residues
  • transgenic tubers contained only 15-20 mol%, suggesting a major reduction in the amount of galactan.
  • the arabinosyl content of the transgenic tubers is slightly increased and the UA content is significantly higher.
  • fucosyl residues could not be detected in the transgenic fraction A, but were present, albeit in a very low percentage, in wild type fraction A.
  • Pectins may remain in the wall after the enzymatic and carbonate buffer extractions.
  • the monosaccharide compositions of cell walls before and after the sequential treatments with EPG/PME and carbonate were compared to quantify the efficiency at which pectins were solubilised (Table 3). No rhamnose could be detected in the walls after pectin extraction; although rhamnose is detected with only moderate sensitivity, this suggests that the RGI present in the unextracted walls was completely removed by the sequential extractions. However, the extracted walls of wild type and transformed tubers still contained galactose in similar quantities.
  • This galactose most likely originates from other wall components than RGI, such as xyloglucan, which are known to contain beta-1 ,2-linked galactosyl residues, and cannot be hydrolysed by the endo-galactanase.
  • xyloglucans are only extracted by concentrated alkali or xyloglucanase treatment and would therefore be expected to be present in walls treated by the procedure used in this study.
  • the UA content is more than 3-fold higher in the remaining walls of the wild type than in the transformants, indicating an increased extractability of pectin from the transformants.
  • Fig. 3 shows sections of wild type (A, C) and endo-galactanase-expressing (T 13 1 ) (B, D) potato tubers gold labeled with monoclonal antibody LM5, silver enhanced and viewed by reflection confocal scanning microscopy (A, B) and transmission electron microscopy (C, D).
  • the walls of wild type parenchymal cells are strongly labeled (white in A, black particles in C), whereas in T 13 ⁇ tubers, the labeling density is greatly reduced and localized only to some cell corners (arrow heads in B) close to the plasma membrane (arrows in D).
  • Asterisks represent spaces once occupied by starch granules.
  • ML indicates the expanded middle lamella of these filled corners. Scale bars: A and B 100 mm, C and D 2 mm.
  • Electron micrographs indicate the occurrence of small amounts of longer galactans on the side of the walls facing the plasma membrane (the most recently synthesised part of the wall), suggesting that deposition of newly synthesised galactans competes with removal of galactans, albeit with removal being the dominant process.
  • This is the first demonstration of remodelling of monosaccharide profile and linkage pattern of a plant cell wall polysaccharide. The results are summarised in Table 1 :
  • Transgenic potato plants were produced essentially as described in Example 5 using the pPGB121s-B-B33-GAL so that the galactanase would be driven by the patatin promoter rather than the GBSS-promoter.
  • Analysis of gene expression has shown that expression was effectively confined to the tubers, and required higher concentrations of sucrose for induction in other organs as compared with the GBSS-promoter. Expression in tubers was 10 not significantly different from that seen with the GBSS-promoter.
  • Tubers can be subjected to immunological characterisation using the LM5 antibody to confirm that the cell wall phenotype in the tubers does not depend on the promoter driving expression of the galactanase gene.
  • RNA gel blot hybridisation with a ribosomal potato DNA fragment as a probe showed equal amounts of RNA in each lane.
  • Hybridisation of tuber RNA using the rhamnogalacturonan-lyase probe showed a clear transcript of the gene for most of the plants (nine out of eleven). Four of these nine can be designated as high expressors, while the other five show a lower expression level, among which a further differentiation could be made. The two that did not show any hybridisation also gave a negative result in the Southern blot analysis. We did not find a clear correlation between the number of copies (one or two) of the transgene and the RNA expression level. All the lines in which expression of the transgene could be detected were used for further analysis.
  • the sugar composition of the tubers of the RGL transformants were found to be rather similar to that of the control plants with regard to the substrate for the rhamnoglacturonan lyase.
  • Table 4 below provides data on analysis of total cell walls from a high and a low expressing transformant and wild type potato tubers. A reduction from 1.5 to 1 % rhamnose is indicative of a reduction in hairy region content.
  • the above results might be surprising at first, especially when considering the altered phenotype of the tubers.
  • the results can be explained as follows.
  • the hairy regions are considered to interconnect homogalacturonan sequences in native pectin (Shols & Vor- agen 1996).
  • the rhamnogalacturonan lyase attacks these interconnecting sequences, but cannot degrade the rhamnogalacturonan completely.
  • a relatively small part of the hairy regions can escape from the cell wall as oligosaccharides released by endo- rhamnogalacturonan lyase.
  • Rhamnose indicative of rhamnogalacturonan is a relatively minor sugar in the cell wall.
  • Galacturonic acid is much more abundant in the cell wall, but resides for the largest part in homogalacturonan.
  • the new cell wall phenotype is indeed an architectural rather than compositional phenotype as can be described using immunolo- calization of particular epitopes in the wall as was done in Example 5.
  • Rhamnogalacturonan side chains consisting of galactans and arabinans rely on rhamnose residues for their attachments. It is noteworthy that there are very significant reductions in both sugars indicating major architectural changes in the hairy regions leading to a sparsely substitution with neutral sugar side chains.
  • Immunolocalisation using arabinan and galactan antibodies in confocal microscopy corroborate the compositional analysis. Further these examinations reveal that paranchymal starch containing cells show very minor labelling for both epitopes whereas some cortical cells in the transformants label for galactans and arabi- nans in cell corner reinforcements.
  • Golgi-targeting of enzyme activity should be seen as an alternative to secretion to the apoplast (not as an intracellular site for storing enzymes in 'self processing plant mate- rial').
  • the strength of this technology is to be able to interfere directly with polysaccharide biosynthetic processes occurring in the Golgi.
  • the technology provides greater latitude in engineering options without compromising plant viability.
  • a glycosyl transferase alpha-2,6-sialyltransferase (ST) originating from rat has previously been shown to be targeted to the plant cell Golgi apparatus, both alone (Wee et a/., 1998) and in truncated forms fused to lysozyme (Munro, 1991) or Green Fluorescent Protein (GFP) (Boevink et al., 1998).
  • GFP Green Fluorescent Protein
  • the amino terminus located in the cytosol consisting of a signal sequence which is post-translationally cleaved of during transit into the ER, a short amino- terminal cytoplasmic domain, an uncleaved hydrophobic signal anchor directing Golgi localisation and a large catalytic lumenal domain (Weinstein et al., 1987).
  • the internal signal anchor should be sufficient to retain any heterologous protein N-terminally fused to this part of the ST. This has been indicated by the work of Boevink et al. (1998) and Munro (1991), who fused 52 and 44 amino acids, respectively, of the N- terminal part of ST to chicken lysozyme (Munro 1991) and GFP (Boevink et al., 1998).
  • the rat sialyl tranferase therefore fulfills the general demands that are expected of a protein which is tightly bound to the Golgi membrane as opposed to proteins found in a solu- ble form in the Golgi apparatus.
  • the soluble ones are expected to move through the Golgi and periodically reside at the plasma membrane, thereby coming in direct contact with the cell wall.
  • the rat sialyl transferase was fused to the mature part of the Aspergillus aculeatus arabinanase using recombinant PCR (Higuchi 1988) and the resulting fusion introduced into the expression vectors pADAP and pPGB121s-B-B33, thereby generating two constructs with the ST-ARA fusion under control of the GBSS and patatin promoter, respectively.
  • the constructs have been transferred into Agrobacterium by electroporation and the bacterial hosts used for transformation of Nicotiana tabacum (L.) cv. Xanthi and Solanum tuberosum (L.) cv. Posmo.
  • Plants harbouring the ST-ARA fusion under the control of the GBSS-promoter was ana- lysed. Expression of active enzyme was demonstrated in tuber extracts using the arabinanase plate assay. Western blotting was used to demonstrate the association of the activity with a microsomal fraction, and following organelle separation, it could be demonstrated that the majority of the arabinanase was associated with Golgi vesicles, while no enzyme protein could be detected in the soluble apoplastic and cytoplasmic fractions, nor in the plasma membrane. Detectable, but lower levels were observed in the endoplas- matic reticulum which may well represent newly produced arabinanase in transit to the Golgi.
  • Retaining a polysaccharide-modifying enzyme in the ER Retention in the ER will be exemplified in the following because of its relevance for 'self processing plant material' as defined herein.
  • an enzyme typically a hydrolase or a lyase, which cleaves polysaccharide backbones is retained in the ER.
  • the enzyme Upon homogenisation of the plant material the enzyme is brought into contact with the cell wall and renders soluble a component to be recovered in the supernatant fraction.
  • ER-retention is exemplified here with reference to arabinanase; other pertinent enzymes are listed in Example 12 below.
  • the arabinanase SEQ ID NO:1 from WO 94/20611 , was found to be toxic to potato, at least when secreted to the apoplast (Libiakova et al, 1999). Tobacco was used in the present case to demonstrate accumulation of a polysaccharide-modifying enzyme in active form in the ER. As detailed in Materials and Methods, the gene was a KDEL tagged variant of the endo-arabinanase in tobacco cv. Xanthi transformed with a pADAP-based construct harbouring an arabinanase-KDEL cDNA.
  • Extracts from leaves of transformed plants were evaluated for their enzyme accumulation using the plate assay (see Materials and Methods) and all successfully transformed plants also produced active arabinanase.
  • the assay is semi-quantitative in nature but activity in crude leaf extracts was detectable (blue halos more than 1 mm wide around the punched wells holding the samples) within just 15 minutes (with some variation between transformants) indicating very significant enzyme activity.
  • differential centrifugation it can be demonstrated that an appreciable proportion of the enzyme is trapped in the microsomal fraction, indicating retention in the ER.
  • the apoplastic fluid of tobacco leaves can be isolated using the method of Husted et al. (1995). Possible absence of appreciable arabinanase activity in the apoplastic fluid can be taken as evidence against missorting of the enzyme to the apoplastic space.
  • vacuolar potato patatin protein 146 amino acids
  • sweet potato sporamin protein 111 amino acids
  • the vacuolar targeting information resides in the N-terminal part of the primary structure. Following cleavage of the N-terminal signal sequence, which en- sures transport of the protein to ER, the pro-form is efficiently targeted to the vacuole where the pro-peptide is cleaved off (Koide et al, 1997). Unlike potato patatin, where the exact localization of the vacuolar targeting determinant is known to reside in the N-terminal but where the exact localisation is unknown, the vacuolar targeting signal in sporamin is well characterized. Accordingly, sporamin is used for targeting of heterologous proteins to the plant vacuole.
  • vacuole-directing potato patatin CDR and 111 amino acids of the sweet potato sporamin coding region were cloned and sequenced.
  • Constructs can be generated that harbour fusions between the N-terminal of sporamin/patatin and suitable endo- polygalacturonase; see the following example.
  • Western blot analysis can be used to verify processing upon vacuolar entry (where applicable). Evaluation of transformants parallel to what has been described for ER-retained endo-arabinanase will show accumulation of active endo-PG in the vacuole.
  • Self-processing tubers comprising double constructions expressing galactanase + endo-polygalacturonase
  • a double construct harbouring the galactanase destined for secretion into the apoplast as well as an endo-PG of fungal or plant origin targeted for internal storage can be prepared, see “Design of "Self processing" DNA constructs" in Example 4.
  • the galactanase should be regarded as a place holder for any enzyme catalysing a desirable pectin tailoring in vivo.
  • Plant and fungal endo-polygalacturonases are used to exemplify 'self processing plant material' in this example. However, it should be borne in mind that also lyases of plant or microbial origin are similarly useful in this context.
  • Fungal endo-polygalacturonases are selected for their stability properties (e.g. with the acidic vacuolar environment in mind), with regard to their sensitivity to homogalacturonan decoration (acetylation in particular) and with regard to pH-optimum for catalysis.
  • Polyga- lacturonases I, II and III from Aspergillus aculeatus, accession number AFO74213, WO 94/14952 and WO 94/14952 cover much of the range in biochemical properties of interest, but other polygalacturonases can also be used.
  • Targeting of the double construct harbouring non-secreted endo-PG of the type which does not posses a propeptide can be done as already exemplified for the targeting of the endo-arabinanase to the ER (Example 10) and the vacuole (B and C) (Example 11). In this case, however, accumulation of the gene products in the cytoplasm is also considered (A). Wegener et al. (1996) describe how an Erwinia ca- rotovora pectate lyase was accumulated in the cytoplasm in both leaves and tubers of transgenic potatoes without detectable phenotypic changes.
  • thermostable bacterial cellulases have also been successfully accumulated in the cytoplasm of transgenic plants.
  • Ziegelhoffer and co-workers produced the E2 and E3 cellulases from Ther- momonospora fusca in transgenic alfalfa, potato and tobacco, although in very limited amounts (Ziegelhoffer et al., 1999). No phenotypic effect of cellulase expression was de- tected.
  • the signal peptide is responsible for the actual translocation.
  • the signal peptide has to be re- moved prior to expression in the plant host.
  • determination of the most likely cleavage site can be made, for example using the neural network SignalP (Nielsen et al, 1997).
  • the physical removal of the signal peptide is done at the DNA level by the use of PCR with primers specific for the mature part of the enzyme in question. This approach also ensures the introduction of a start codon and sequences for optimal translation of the mature part of the enzyme destined for cytoplasmatic accumulation.
  • Representative plant endo-PGs without propeptide include, but are not limited to, AF128266: PG1 from Glycine max and U70480:TAPG2 from tomato.
  • Non-secreted endo-PG of the type which posses a propeptide (modified endo-PG D-l) to the cytoplasm, the ER, or the vacuole should for each compartment be accomplished by two versions of modified endo-PG.
  • Examples of plant endo-PGs with propeptide are X9500: RDPG1 from oilseed rape and P35336 from kiwi fruit.
  • Example 6 Analysis according to Example 6 can be used to verify that the wall phenotype resulting from galactanase expression is as expected from the results of Examples 5 and 6.
  • expression and accumulation of functional endo-polygalacturonase will be established by Northern and Western blot analysis as well as assays of polygalacturonase activity.
  • Pectic epitopes are differentially distributed in the cell 20 walls of potato (Solanum tunberosum) tubers. Physiol. Plant. 107:201-213.
  • thermostable Xylanase from Clostridium thermocellum expressed at high levels in the apoplast of transgenic tobacco Bio/technology 13:63-66

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Dermatology (AREA)
  • Nutrition Science (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Materials Engineering (AREA)
  • Rheumatology (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Transplantation (AREA)
  • Surgery (AREA)
  • Pain & Pain Management (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne des procédés d'élaboration de plantes transgéniques et de parties de plantes transgéniques modifiées, par rapport au type sauvage, quant à la structure de polysaccharide de paroi cellulaire complexe (renfermant des pectines et des hémicelluloses). La modification porte sur le schéma global de lien glycoside ou sur le profil monosaccharide. On transforme une cellule de plante avec une séquence nucléotidique modifiant la production d'une enzyme de modification de polysaccharide de paroi cellulaire complexe, à savoir par exemple: endo-rhamnogalacturonan hydrolase, endo -rhamnogalacturonan lyase, endo -galactanase, endo -arabinanase, arabinofuranosidase, galactosidase du type bêta-galactosidase, xylosidase et exo-galacturosidase. Il peut s'agir d'une modification in vivo ou post-récolte, et dans ce deuxième cas l'enzyme de modification est séparée de son substrat dans la plante en développement, par exemple par ciblage de l'enzyme sur le type Golgi, le réticulum endoplasmique ou une vacuole, ou bien elle est présente dans la plante sous une forme inactive. Après la récolte, l'enzyme est mise en contact avec son substrat ou activée pour fournir la modification post-récolte souhaitée dans le polysaccharide de paroi cellulaire. Les matériaux de plante transgénique offrent des fonctionnalités améliorées et ils sont utiles dans la fabrication d'aliments pour l'homme et l'animal, mais aussi comme substances pharmaceutiquement ou médicalement actives.
EP01903610A 2000-02-10 2001-02-12 Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes Withdrawn EP1301607A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP01903610A EP1301607A1 (fr) 2000-02-10 2001-02-12 Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
EP00610020 2000-02-10
EP00610020 2000-02-10
US54498800A 2000-04-07 2000-04-07
US544988 2000-04-07
PCT/DK2001/000093 WO2001059137A1 (fr) 2000-02-10 2001-02-12 Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes
EP01903610A EP1301607A1 (fr) 2000-02-10 2001-02-12 Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes

Publications (1)

Publication Number Publication Date
EP1301607A1 true EP1301607A1 (fr) 2003-04-16

Family

ID=26073687

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01903610A Withdrawn EP1301607A1 (fr) 2000-02-10 2001-02-12 Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes

Country Status (5)

Country Link
EP (1) EP1301607A1 (fr)
JP (1) JP2004505603A (fr)
CN (1) CN1237176C (fr)
AU (1) AU2001231534A1 (fr)
WO (1) WO2001059137A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7858836B2 (en) * 2004-12-27 2010-12-28 Convatec Technologies Inc. Enzyme inhibiting adhesives
WO2008000511A2 (fr) * 2006-06-30 2008-01-03 Freie Universität Berlin Pectine méthyltransférases et leurs applications
WO2008059542A1 (fr) * 2006-11-17 2008-05-22 Nobil Bio Ricerche S.R.L. Implant osseux à propriétés de surface améliorées
WO2012025621A1 (fr) 2010-08-26 2012-03-01 Vib Vzw Compositions pour le traitement de graines
US11512299B2 (en) * 2015-12-29 2022-11-29 Amano Enzyme Inc. Beta-galactosidase enzymes
CN110819649A (zh) * 2019-10-08 2020-02-21 南京农业大学 一种重组果胶甲酯酶PbrPME的体外表达方法及其编码基因与应用
CN117512032B (zh) * 2023-11-07 2024-04-30 北京市农林科学院 低分子量hg型果胶的制备方法及其构象表征

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999007830A1 (fr) * 1997-07-27 1999-02-18 Yissum Research Development Company Of The Hebrew University Of Jerusalem PLANTES TRANSGENIQUES A MORPHOLOGIE MODIFIEE ET GENE, PROMOTEUR ET PROTEINE DE L'ENDO-1,4-β-GLUCANASE ISOLES A PARTIR D'ARABIDOPSIS THALIANA

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8927048D0 (en) * 1989-11-30 1990-01-31 Ici Plc Dna,constructs,cells and plants derived therefrom
US5786470A (en) * 1991-11-16 1998-07-28 Dalgety Food Ingredients Limited Gel production from plant matter
GB9127098D0 (en) * 1991-12-20 1992-02-19 Ici Plc Dna,dna constructs,cells and plants derived therefrom
DK24593D0 (fr) * 1993-03-05 1993-03-05 Novo Nordisk As
JPH06329546A (ja) * 1993-05-25 1994-11-29 Kao Corp 創傷治癒促進剤
GB9403406D0 (en) * 1994-02-23 1994-04-13 Zeneca Ltd DNA,DNA constructs, cells and plants derived therefrom
GB9716766D0 (en) * 1997-08-07 1997-10-15 Innes John Centre Pectin degrading enzymes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999007830A1 (fr) * 1997-07-27 1999-02-18 Yissum Research Development Company Of The Hebrew University Of Jerusalem PLANTES TRANSGENIQUES A MORPHOLOGIE MODIFIEE ET GENE, PROMOTEUR ET PROTEINE DE L'ENDO-1,4-β-GLUCANASE ISOLES A PARTIR D'ARABIDOPSIS THALIANA

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
REITER W.D.; CHAPPLE C.; SOMMERVILLE C.R.: "Mutants of Arabidopsis thaliana with altered cell wall polysaccharide composition", THE PLANT JOURNAL, vol. 12, no. 2, 1997, pages 335 - 345 *
See also references of WO0159137A1 *
SORENSEN S.O. ET AL: "PECTIN ENGINEERING: MODIFICATION OF POTATO PECTIN BY IN VIVO EXPRESSION OF AN ENNDO-1,4-BETA-D-GALACTANASE", PROCEEDING OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 97, no. 13, June 2000 (2000-06-01), pages 7639 - 7644 *

Also Published As

Publication number Publication date
WO2001059137A1 (fr) 2001-08-16
CN1418254A (zh) 2003-05-14
AU2001231534A1 (en) 2001-08-20
CN1237176C (zh) 2006-01-18
JP2004505603A (ja) 2004-02-26

Similar Documents

Publication Publication Date Title
Rose et al. Cell wall disassembly
Egelund et al. Molecular characterization of two Arabidopsis thaliana glycosyltransferase mutants, rra1 and rra2, which have a reduced residual arabinose content in a polymer tightly associated with the cellulosic wall residue
Zhong et al. Arabidopsis fragile fiber8, which encodes a putative glucuronyltransferase, is essential for normal secondary wall synthesis
Hatfield et al. Grass cell walls: a story of cross-linking
Farrokhi et al. Plant cell wall biosynthesis: genetic, biochemical and functional genomics approaches to the identification of key genes
Harholt et al. Biosynthesis of pectin
Brownleader et al. Molecular aspects of cell wall modifications during fruit ripening
Darley et al. The molecular basis of plant cell wall extension
Hayashi Xyloglucans in the primary cell wall
Fischer et al. Role of cell wall hydrolases in fruit ripening
Oomen et al. In muro fragmentation of the rhamnogalacturonan I backbone in potato (Solanum tuberosum L.) results in a reduction and altered location of the galactan and arabinan side‐chains and abnormal periderm development
EP2588494B1 (fr) Polypeptide doté d'une activité de bêta-glucosidase et ses utilisations
Woolley et al. Purification and properties of an endo-β-1, 4-glucanase from strawberry and down-regulation of the corresponding gene, cel1
Pogorelko et al. Post-synthetic modification of plant cell walls by expression of microbial hydrolases in the apoplast
Orfila et al. Expression of mung bean pectin acetyl esterase in potato tubers: effect on acetylation of cell wall polymers and tuber mechanical properties
Tateishi et al. Isolation, characterization, and cloning of α-L-arabinofuranosidase expressed during fruit ripening of Japanese pear
Skjøt et al. Direct interference with rhamnogalacturonan I biosynthesis in Golgi vesicles
Harpster et al. Constitutive overexpression of a ripening-related pepper endo-1, 4-β-glucanase in transgenic tomato fruit does not increase xyloglucan depolymerization or fruit softening
US20030159178A1 (en) Method for remodelling cell wall polysaccharide structures in plants
WO2001059137A1 (fr) Procede de remodelage des structures de polysaccharide de paroi cellulaire dans les plantes
Ochoa-Jiménez et al. Rhamnogalacturonan lyase: a pectin modification enzyme of higher plants
Brummell Primary cell wall metabolism during fruit ripening
Huang et al. Evaluation of both targeted and non-targeted cell wall polysaccharides in transgenic potatoes
Tateishi et al. Heterologous expression of tomato glycoside hydrolase family 3 α‐L‐arabinofuranosidase/β‐xylosidases in tobacco suspension cultured cells and synergic action of a family 51 isozyme under antisense suppression of the enzyme
Brummell et al. Xylan metabolism in primary cell walls

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030127

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: POALIS A/S

17Q First examination report despatched

Effective date: 20050118

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BLM APS

Owner name: ULVSKOV, PETER

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070901