EP1297137A2 - Gp286 nuklein saüre und polypeptide - Google Patents
Gp286 nuklein saüre und polypeptideInfo
- Publication number
- EP1297137A2 EP1297137A2 EP01952197A EP01952197A EP1297137A2 EP 1297137 A2 EP1297137 A2 EP 1297137A2 EP 01952197 A EP01952197 A EP 01952197A EP 01952197 A EP01952197 A EP 01952197A EP 1297137 A2 EP1297137 A2 EP 1297137A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- protein
- polynucleotide
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
Definitions
- the present invention relates generally to the field of molecular biology. More particularly, this invention relates to members of the immunoglobulin superfamily.
- Cell membrane receptor molecules expressed on the cell surface.
- Cell surface receptors are a first essential link for translating an extracellular signal into a cellular physiological response.
- Many such receptors have been identified, characterized, and sometimes classified into major receptor superfamilies based on conserved structural motifs and biological functions such as signal transduction features.
- a superfamily is broadly defined as a group of proteins that share a certain degree of sequence homology, usually at least 15%.
- the conserved sequences shared by superfamily members often contribute to the formation of compact tertiary structures referred to as domains, and often the entire sequence of a domain characteristic of a particular superfamily is encoded by a single exon (see, e.g., Abbas et al., CELLULAR AND MOLECULAR IMMUNOLOGY, W.B. Saunders Co., Philadelphia, PA. 1997).
- Members of a superfamily are likely derived from a common precursor gene by divergent evolution, and multidomain proteins may belong to more than one superfamily.
- protein superfamilies include the ligand-gated ion channel receptor superfamily, the voltage- dependent ion channel receptor superfamily, the receptor tyrosine kinase superfamily, the receptor protein tyrosine phosphatase superfamily, the G protein-coupled receptor superfamily, and the immunoglobulin (Ig) superfamily.
- the immunoglobulin (Ig) superfamily encompasses a number of structurally related proteins with a wide variety of functions.
- the Ig superfamily molecules mediate recognition, adhesion and binding in the immune system (see, e.g., Abbas et al., supra), as well as other functions outside of the immune system.
- Ig domains are three-dimensional globular structures having about 70 to 110 amino acid residues and an internal Cys- Cys disulfide bond. These domains contain two layers of ⁇ -pleated sheet, each layer composed of three to five antiparallel strands of five to ten amino acid residues. Ig domains are classified as V-like or C-like on the basis of closest homology to either the Ig V or C domains. For a general review, see, e.g., Abbas et al., supra.
- Ig superfamily Most identified members of the Ig superfamily are integral plasma membrane proteins with one or more Ig domains in the extracellular portions and widely divergent cytoplasmic tails, usually with no intrinsic enzymatic activity.
- Ig superfamily members There are exceptions to these generalizations.
- One recurrent characteristic of the Ig superfamily members is that interactions between Ig domains on different polypeptide chains (of the same or different amino acid sequences) are essential for the biological activities of the molecules. Heterophilic interactions can also occur between Ig domains on entirely distinct molecules expressed on the surfaces of different cells. Such interactions provide adhesive forces that stabilize cell-cell binding.
- Ig superfamily members are cell surface or soluble molecules that mediate cell recognition, adhesion and binding functions in the vertebrate immune system.
- Two prominent cell types that produce Ig superfamily molecules are B and T lymphocytes.
- Exemplary Ig superfamily member proteins of importance in the immune system include antibodies, T cell receptors, Class I and II major histo-compatibility complex (MHC) molecules, CD2, CD3, CD4, CD5, CD8, CD28, CD20 (Bl), CD32 (FcgRII), CD44, CD54 (ICAM-1), CD80 (B7-1), CD86 (B7-2), CD90 (Thy-1), CD102 (ICAM-2), CD106 (VCAM-1), CD121 (E -1R), CD152 (CTLA-4), p-IgR, NCAM, and CD140 (PDGFR) (Abbas et al., supra).
- MHC major histo-compatibility complex
- B lymphocytes are responsible for humoral immunity.
- Ig heavy and light chains are composed of regions derived from separate genes. Both heavy and light chains have .variable (V), constant (C), and joining (J) segments which are joined in-frame by genetic recombination during B cell maturation (Abbas, et al. 1997). In addition heavy chains have an additional segment called the diversity (D) segment (Abbas, et al. 1997).
- V variable
- C constant
- J joining
- D Diversity
- the genetic rearrangement allows the expression of functional molecules called Ig or antibodies. Due to a large number of genes that may be used to create the heavy and light chains during genetic recombination, a plethora of antibodies may be produced that have specificity for a vast array of antigens.
- B cells produce Ig in both membrane-bound forms and secreted forms.
- a B cell is immunologically activated when antigen binds to a membrane-bound antibody on the surface of the B cell, and under conditions wherein necessary soluble factors are present that "help" B cells produce antibodies in secreted form.
- T lymphocytes are responsible for cell-mediated immunity.
- a T cell is immunologically activated when it interacts with antigen presenting cells through the T cell receptor, as well as through a number of co-receptors and adhesion molecules.
- the T cell receptor is a multiprotein complex that consists of variable ⁇ or ⁇ receptors associated with invariant CD3 ⁇ , ⁇ , e, and ⁇ proteins.
- T cell receptors specifically recognize MHC-antibody complexes on antigen presenting cells (Cantrell et al., 1995. pp. 151-163 in T Cell Receptors. Bell, J.I., MJ. Owen and E. Simpson, Eds. Oxford University Press, New York).
- Other T cell surface molecules contributing to MHC recognition include CD4 and CD8, while molecules such as CD28, CTLA4, CD5 and CD44 recognize molecules other than MHC on the surface of antigen producing cells.
- Ig superfamily members continue to be identified in immune and non-immune tissues, for instance, in the nervous system. Based on their conserved structural motifs, these novel Ig superfamily members are thought to perform cell recognition, binding and adhesion functions as well. Novel Ig superfamily members will be suitable targets for immune, auto-immune and immunological disease therapies because Ig superfamily members act in conjunction with other Ig superfamily members in the immune system and in non-immune systems.
- the present invention is based, at least in part, on the discovery of a gene encoding a heretofore unknown Ig superfamily member, termed GP286.
- GP286 a gene encoding a heretofore unknown Ig superfamily member
- gp286, refers to the new nucleic acids of the invention
- GP286 refers to the new polypeptides of the present invention.
- gp286 and GP286 refer to both splice variants of the invention. See infra
- the human gp286 cDNA described below (SEQ ID NO: 1) has a 558 base pair open reading frame that encodes an 186 amino acid protein (SEQ ID NO:2).
- the human gp286 gene is located on chromosome 19 and encodes a GP286 protein predicted to have a single membrane-spanning domain and one immunoglobulin (Ig) domain in the N-terminal, extracellular portion of the protein.
- gp286 mRNA is enriched in T lymphocytes, and is detectable in various immune system tissues such as peripheral blood leukocytes, lymph nodes, spleen, thymus and tonsil.
- gp286 mRNA is detectable at low levels in some non-immune tissues, which is likely due to infiltration of T cells into these non- immune tissues.
- the protein structure and tissue distribution of GP286 indicates a role for GP286 in T cell interactions with other cells or the extracellular environment during an immune response.
- GP286a appears to be a splice variant of GP286.
- GP286a has a 834 base pair open reading frame (SEQ ID NO: 14) that encodes a 278 amino acid protein (SEQ ID NO: 15).
- SEQ ID NO: 14 834 base pair open reading frame
- SEQ ID NO: 15 the GP286a protein is predicted to have a single membrane-spanning domain and one extracellular Ig domain.
- Novel Ig superfamily members localized to particular cell types such as GP286, which is expressed at high levels in T cells, will be useful cell and tissue markers for diagnostic purposes and in forensic science.
- Tissue-specific Ig superfamily members will also be suitable therapeutic targets for treating abnormal conditions, disorders and/or diseases related to improper cell-cell adhesion and signaling in the tissue, particularly during tissue development or during tissue regeneration, e.g., after tissue damage or trauma.
- GP286 and GP286a are useful in mediating cell adhesion of T cells to extracellular matrix molecules and to other cells.
- the invention features a polynucleotide which includes a nucleotide sequence that encodes a protein which comprises an amino acid sequence that is at least 80% (85%, 95% or 98%) identical to the amino acid sequence of SEQ ID NO:2, or to the Ig domain of SEQ ID NO:2.
- a polynucleotide has the sequence of SEQ ID NO:l, or a fragment thereof having at least 17 nucleic acid units (e.g., nucleotides). Examples of such fragments are SEQ ID NOs:3, 4, 5, 16, 20, 22, 26, 28 and 32.
- the invention features a polynucleotide which includes a nucleotide sequence that encodes a protein which comprises an amino acid sequence that is at least 80% (85%, 95% or 98%) identical to the amino acid sequence of SEQ ID NO : 15 or to the Ig domain of SEQ ID NO : 15.
- a polynucleotide has the sequence of SEQ ID NO: 14, or a fragment thereof having at least 17 nucleic acid units (e.g., nucleotides). Examples of such fragments are SEQ ID NOs: 18, 24 and 30.
- a polynucleotide comprises the sequence of SEQ ID NO: 13, or a fragment thereof having at least 17 nucleic acid units. Examples of such fragments are SEQ ID NOs: 3, 4, 5, 16, 18, 20, 22, 24, 26, 28, 30 and 32.
- the invention provides a polynucleotide which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs:2 or 15, wherein the nucleic acid hybridizes to any one of SEQ ID NOs: 1, 13 or 14 under stringent conditions.
- the invention also provides isolated polynucleotides that encode select portions of GP286. As will be further discussed herein below, these "nucleic acid fragments" can be used, for example, to express specific portions of the GP286, either alone or as elements of a fusion protein. A nucleic acid fragment may also be used as a region-specific nucleic probe.
- an isolated GP286 protein comprising an amino acid sequence that is at least 80% (85%, 95% or 98%) identical to an Ig domain encoded by the amino acid sequence of either of SEQ ID NOs:2 or 15.
- the invention also provides an isolated GP286 protein encoded by a polynucleotide having a sequence which is at least about 65%, preferably 75%, 85%, or 95% identical to either of SEQ TD NOs:l or 14, and an isolated protein encoded by a polynucleotide having a sequence which hybridizes under stringent conditions to a nucleic acid having the sequence of either of SEQ ID NOs:l or 14.
- the invention provides gp286 polynucleotides that specifically detect gp286 nucleic acids relative to nucleic acids encoding other members of the Ig superfamily.
- the invention also provides a nucleic acid construct, e.g., a recombinant vector such as an expression vector, comprising gp286 polynucleotides of the invention.
- the present invention also provides a diagnostic assay for identifying the presence or absence of a genetic lesion or mutation characterized by at least one of: (i) aberrant modification or mutation of a gene encoding a GP286 protein; (ii) mis-regulation of a gene encoding a GP286 protein; and (iii) aberrant post- translational modification of a GP286 protein, wherein a wild-type form of the gene encodes a protein with a GP286 biological activity.
- Host cells containing such nucleic acid constructs are also provided, as is a method for producing a GP286 polypeptide by culturing, in a suitable medium, a host cell of the invention containing a recombinant expression construct such that a GP286 polypeptide is produced.
- Isolated or recombinant GP286 proteins and polypeptides are provided by the invention.
- Preferred GP286 proteins and polypeptides possess at least one of the following (overlapping) biological activities possessed by naturally occurring human GP286: (1) the ability to interact with (e.g., bind to) a ligand (e.g., a protein receptor, a polysaccharide, etc.) that naturally binds to GP286 protein; (2) the ability to bind to an auto-antibody to naturally occurring human GP286 or an antibody raised against naturally occurring human GP286; (3) the ability to participate in a T lymphocyte-mediated function (e.g., a signal transduction function in immune development); and (4) the ability to mediate cell- cell interactions such as recognition, binding and/or adhesion.
- a ligand e.g., a protein receptor, a polysaccharide, etc.
- T lymphocyte-mediated function e.g., a signal transduction function in
- the GP286 proteins or biologically active portions thereof can be operably linked to a non-GP286 polypeptide (e.g., heterologous amino acid sequences, such as sequences that facilitate protein stability, detection, purification, or in vivo delivery to target cells) to form GP286 fusion proteins.
- a non-GP286 polypeptide e.g., heterologous amino acid sequences, such as sequences that facilitate protein stability, detection, purification, or in vivo delivery to target cells
- the invention further features antibodies (e.g., polyclonal or monoclonal antibodies), including humanized and fully human antibodies, that specifically bind to GP286 proteins or portions thereof.
- compositions which optionally include pharmaceutically acceptable carriers.
- compositions are useful in therapeutic methods for ameliorating disorders, conditions and diseases in a subject associated with abnormal GP286 cellular localization, expression and/or activity.
- the present invention thus provides methods of treatment comprising the step of administering a gp286-related compound or composition of the invention.
- Such methods will be useful, for example, for treating abnormal conditions affecting T cells, and disorders or diseases which correlate with cell recognition, binding, signaling and adhesion functions in the developing or adult immune and/or central nervous system.
- the invention provides a method for modulating GP286 activity.
- a target cell is contacted with an agent that modulates (e.g., inhibits or stimulates) GP286 activity or expression such that the GP286 activity or expression is altered.
- the agent is an antibody that specifically binds to GP286.
- the agent modulates the GP286 activity or expression by modulating transcription of a gp286 gene, splicing of gp286 RNA, or translation of a gp286 mRNA.
- the agent is a nucleic acid having a sequence that is antisense to the coding strand of the gp286 mRNA or the gp286 gene.
- the agent can be a GP286 protein, a nucleic acid encoding a GP286 protein, or an antagonist or agonist of the GP286 protein such as a peptide, a peptidomimetic, or other small molecules.
- the present invention provides a method for detecting the presence of a gp286 polynucleotide, a GP286 protein or its activity in a biological sample (e.g., a fluid or tissue sample derived from a patient) by contacting the sample with an agent capable of detecting an indicator of the presence of gp286 polynucleotide sequences, GP286 protein or its activity.
- a biological sample e.g., a fluid or tissue sample derived from a patient
- the invention also provides a method for identifying a compound that binds to a GP286 protein.
- the invention provides a method for identifying a compound that modulates the biological activity of a GP286 protein, comprising measuring a biological activity or expression of the protein in the presence and absence of a test compound and identifying those compounds which alter the activity of the protein.
- Combinatorial libraries can be used as sources of candidate compounds in these methods.
- the invention provides a non-human animal (e.g., a mammal such as a mouse, rat, guinea pig, sheep, goat, horse or cow) at least some cells of which comprise a polynucleotide of this invention.
- a non-human animal e.g., a mammal such as a mouse, rat, guinea pig, sheep, goat, horse or cow
- Such an animal can be chimeric where only some of its somatic and/or germ cells carry the polynucleotide.
- Such an animal can alternatively be transgenic where all of its somatic and germ cells carry the polynucleotide.
- the invention also provides a non-human animal whose endogenous ortholog of the gp286 gene is disrupted by gene targeting (i.e., "knocked out").
- the invention provides a computer readable means of storing the nucleic acid and amino acid sequences of the instant invention.
- the records of the computer readable means can be accessed for reading and display of sequences and for comparison, alignment and ordering of the sequences of the invention to other sequences.
- FIG. 1A-1B The nucleotide and deduced amino acid sequences of GP286.
- the immunoglobulin (Ig) domain in the extracellular portion is underlined and the transmembrane domain is boxed.
- the cDNA is 973 bases long. See SEQ ID NOs:l and 2.
- FIG. 2A-2B The nucleotide and deduced amino acid sequences of GP286a.
- the immunoglobulin (Ig) domain in the extracellular portion is underlined and the transmembrane domain is boxed. The exon-intron boundaries are denoted by a backslash (/).
- the cDNA is 1065 bases long. See SEQ ID NOs: 14 and 15.
- FIG. 3 Expression of GP286 in human immune system tissues as determined by reverse transcription polymerase chain reaction (RT-PCR). RT-PCR was performed as described in the text.
- BM bone marrow
- PBL peripheral blood lymphocytes
- Li liver
- LN lymph nodes
- Sp spleen
- Thy thymus
- - no template control
- Genomic genomic DNA control lane.
- FIG. 4 Expression of GP286 RNA in human tissues as determined by RT-
- FIG. 5 Expression of GP286 RNA in human cell lines by Northern blotting.
- FIG. 6A-6H The nucleotide sequence of human genomic gp286, with gp286 exons underlined. The methionine codon is double-underlined and the stop codon is thick-underlined.
- FIG. 7A-7H The nucleotide sequence of human genomic gp286, with gp286a exons highlighted and underlined. The initiating methionine codon is double- underlined and the stop codon is thick-underlined. See SEQ ID NO: 13.
- FIG. 8 Homology between GP286 (SEQ ID NO:2, top sequence) and mouse T cell receptor beta chain (SEQ ID NO:6, bottom sequence). Vertical lines show identity and dots indicate gaps.
- the present invention is based, at least in part, on the discovery of a novel human gene encoding a heretofore unknown protein, GP286.
- This gene, gp286, was identified by computational analysis of ("mining") the published nucleic acid sequences of the human genome.
- the gp286 gene is alternatively spliced and normally resides on human chromosome 19.
- One transcript, gp286, contains 4 exons, while gp286a contains 5 exons.
- Exons 2 and 3 are the same in both the gp286 and gp286a transcripts and exon 1 is similar; however, gp286 comprises exon 4 while gp286a comprises exons 4a (which contains part of exon 4) and exon 5.
- the gp286 mRNA transcribed from this gene is approximately 971 bases in length, has an open reading frame of 558 base pairs, and encodes a protein predicted to be 186 amino acid residues.
- the gp286a mRNA transcribed from this gene is approximately 1065 bases in length, has an open reading frame of 834 base pairs, and encodes a protein predicted to be 278 amino acid residues.
- the novel GP286 proteins are predominantly expressed in the immune system.
- nucleic acid includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA).
- RNA molecules e.g., mRNA
- the term also is intended to include analogs of DNA or RNA containing non-natural nucleotide analogs, non-native internucleoside bonds, or both.
- the nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or in a padlocked conformation. See, e.g., Baner et al, Curr. Opin.
- an “isolated nucleic acid” is one which is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid. Specifically excluded are isolated, non-recombinant native chromosomes and fragments thereof that are larger than 500 kilobases.
- an “isolated” nucleic acid is substantially free of sequences that naturally flank that nucleic acid in the genome of the organism from which the nucleic acid is derived.
- a preferred isolated gp286 nucleic acid is flanked by less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the isolated nucleic acid is derived.
- isolated does not necessarily require that the nucleic acid or polynucleotide so described has itself been physically removed from its native environment.
- an endogenous nucleic acid sequence in the genome of an organism is deemed “isolated” herein if a heterologous sequence (i.e., a sequence that is not naturally adjacent to this endogenous nucleic acid sequence) is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered.
- a non- native promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gp286 gene in the genome of a human cell, such that this gene has an altered expression pattern.
- This gene would now become “isolated” because it is separated from at least some of the sequences that naturally flank it.
- a nucleic acid is also considered “isolated” if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome.
- an endogenous gp286-coding sequence is considered “isolated” if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention.
- isolated nucleic acid also includes a nucleic acid integrated into a host cell chromosome at a heterologous site, a nucleic acid construct present as an episome and a nucleic acid construct integrated into a host cell chromosome.
- an "isolated nucleic acid" can be substantially free of other cellular material, or substantially free of culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- a polynucleotide of the invention is considered “full-length” if it is able to encode a full-length GP286 protein.
- the phrase "degenerate variant" of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence.
- microarray refers to a substrate-bound plurality of nucleic acids, hybridization to each of the bound nucleic acids being separately detectable.
- the substrate can be solid or porous, planar or non-planar, unitary or distributed, or in any other configuration.
- microarray includes all the devices so called or similarly called in Schena (ed.), DNA Microarrays: A Practical Approach (Practical Approach Series). Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl):l-60 (1999); and Schena (ed.), Microarray Biochip: Tools and Technology, Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376); Brenner etal, Proc. Natl Acad. Sci. USA 97(4): 1665-1670 (2000). The disclosures of all of these references are incorporated herein by reference in their entireties. As used herein with respect to nucleic acid hybridization, the term
- probe refers to an isolated nucleic acid of known sequence that is, or is intended to be, detectably labeled.
- probe also “nucleic acid probe” or “hybridization probe” refers to the isolated nucleic acid that is, or is intended to be, bound to the substrate.
- target refers to a nucleic acid intended to be bound to a probe by sequence complementarity.
- nucleic acid comprising SEQ ID NO:X refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO:X, or (ii) a sequence complementary to SEQ ID NO:X.
- the choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.
- high stringency conditions are defined for solution phase hybridization as aqueous hybridization (i.e. , free of formamide) in 6X SSC (where 20X SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65°C for 20 minutes. It will be appreciated that hybridization at 65°C will occur at different rates depending on a number of factors (discussed infra), including the length and percent identity of the sequences which are hybridizing.
- standard "high stringency conditions” are defined as hybridization in 50% formamide, 5X SSC, 0.2 ⁇ g/ ⁇ l poly(dA), 0.2 ⁇ g/ ⁇ l human cotl DNA, and 0.5% SDS, in a humid oven at 42°C overnight, followed by successive washes of the microarray in IX SSC, 0.2% SDS at 55°C for 5 minutes, and then 0. IX SSC, 0.2% SDS, at 55°C for 20 minutes.
- “moderate stringency conditions” suitable for cross-hybridization to mRNA encoding structurally- and functionally-related proteins, are defined to be the same as those for high stringency conditions but with reduction in temperature for hybridization and washing to room temperature (approximately 25°C).
- protein As used herein, the terms “protein,” “polypeptide,” and “peptide” are used interchangeably to refer to a naturally-occurring or synthetic polymer of amino acids, irrespective of length, where amino acids here include naturally- occurring amino acids, naturally-occurring amino acid structural variants, and synthetic non-naturally occurring analogs that are capable of participating in peptide bonds.
- the terms “protein”, “polypeptide”, and “peptide” explicitly permit post- translational and post-synthetic modifications, such as N- or C-terminal amino acid cleavage reactions and glycosylation.
- oligopeptide herein denotes a protein, polypeptide, or peptide having 25 or fewer amino acid residues.
- a protein, polypeptide, peptide or oligopeptide is considered “isolated” when it is encoded by an isolated polynucleotide; when it exists in a purity not found in nature, where purity can be adjudged with respect to the presence of other cellular material; and/or when it includes amino acid analogs or derivatives not found in nature or linkages other than standard peptide bonds.
- isolated does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described has been physically removed from its native environment.
- a protein, polypeptide, peptide or oligopeptide is considered “purified” herein when it is present at a concentration of at least 65% (e.g., at least 75%, 85% or 95%), as measured on a mass basis with respect to total protein in a composition. It is considered “substantially purified” when the concentration is at least 85%.
- orthologs are separate occurrences of the same gene in different species of organisms. The separate occurrences have similar or identical amino acid sequences, where the degree of sequence similarity depends in part on the evolutionary distance of the species from a common ancestor having the same gene.
- paralogs indicates separate occurrences of a gene in one species of organism.
- the separate occurrences have similar or identical amino acid sequences, where the degree of sequence similarity depends in part on the evolutionary distance of these separate occurrences from the gene duplication event giving rise to the occurrences.
- homologs also “homologues” encompasses “orthologs” and “paralogs.”
- homologous amino acid sequences include those amino acid sequences which contain conservative amino acid substitutions and which polypeptides have substantially the same binding and/or activity.
- a homologous amino acid sequence does not, however, include the amino acid sequence encoding other known Ig superfamily members. Homology (percent identity) can be determined by, for example, the GAP program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison WI), using the default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 2:482-489 (1981), which is incorporated herein by reference in its entirety).
- antibody refers to a full antibody (consisting of two heavy chains and two light chains) or a fragment thereof.
- fragments include, but are not limited to, those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation, and those produced recombinantly, so long as the fragment remains capable of specific binding to an antigen.
- fragments include Fab, Fab', F(ab') 2 , and single chain Fv (scFv) fragments.
- antibody antibodies that have been modified in sequence, but remain capable of specific binding to an antigen.
- modified antibodies are interspecies chimeric and humanized antibodies; antibody fusions; and heteromeric antibody complexes, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies (see, e.g., Marasco (ed.), Intracellular Antibodies: Research and Disease Applications. Springer- Verlag New York, Inc. (1998) (ISBN: 3540641513), the disclosure of which is incorporated herein by reference in its entirety).
- Specific binding refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment.
- “specific binding” discriminates over adventitious binding in a reaction by at least two-fold, more typically by at least 10-fold, often at least 100-fold.
- the affinity or avidity of a specific binding reaction is at least about 10 "7 M (e.g., at least about 10 "8 M or 10 "9 M).
- region is meant a physically contiguous portion of the primary structure of a biomolecule.
- a region is defined by a contiguous portion of the amino acid sequence of that protein.
- domain refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be co-extensive with regions or portions thereof; domains may also include distinct, non-contiguous regions of a biomolecule. Examples of GP286 protein domains include, but are not limited to, an extracellular domain (i.e., N-terminal), a transmembrane domain, and a cytoplasmic domain (i.e., C-terminal). The extracellular domain can be further subdivided into, e.g., an Ig domain and a signal sequence domain.
- the term "compound” means any molecule, including, but not limited to, small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.
- Standard reference works setting forth the general principles of immunology known to those of skill in the art include: Harlow and Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990); Harlow and Lane, Antibodies: A Laboratory Manual, 2d Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1999); Roitt et al., IMMUNOLOGY, 3d Ed., Mosby-Year Book Europe Limited, London (1993).
- the invention provides isolated polynucleotides that encode the entirety of the GP286 protein.
- the "full-length" polynucleotides of the present invention can be used, inter alia, to express full length GP286 protein.
- the full-length polynucleotides can also be used as nucleic acid probes; used as probes, the isolated polynucleotides of these embodiments will hybridize to gp286.
- the invention provides an isolated polynucleotide comprising (i) the nucleotide sequence of SEQ ID NOs:l, 13 or 14, (ii) a degenerate variant of the nucleotide sequence of SEQ ID NOs:l, 13 or 14, or (iii) the complement of (i) or (ii).
- SEQ ID NOs: 1 and 14 present an entire cDNA sequence of gp286 and gp286a, respectively, including the 5' untranslated (UT) region and 3' UT region.
- SEQ ID NO.T3 presents the genomic DNA sequence of gp286, including the 5' and 3' non-transcribed regions.
- the invention provides an isolated polynucleotide comprising (i) the nucleotide sequence of SEQ TD NOs:3, 4, 5, 16, 18, 20, 22, 24, 26, 28, 30 or 32, (ii) a degenerate variant of the nucleotide sequence of SEQ ID NO:3, or (iii) the complement (i) or (ii).
- SEQ ID NO:3 presents an RT-PCR fragment of gp286 amplified from human thymus mRNA using CR2-037 (SEQ TD NO:7) and CR2-038 (SEQ ID NO: 8) primers;
- SEQ ID NO:4 represents a 5' RACE product resulting from the amplification of human thymus cDNA using the CR2-146 primer (SEQ ID NO: 9) and the AP-1 primer (SEQ ID NO: 11);
- SEQ ID NO:5 represents a 3' RACE product resulting from amplification of human thymus cDNA with the CR2-148 primer (SEQ ID NO: 10) and the AP-1 primer;
- SEQ ID NO.T6 represents the nucleic acid sequence encoding the extracellular potion of GP286;
- SEQ ID NO: 18 represents the nucleic acid sequence encoding the extracellular portion of GP286a;
- SEQ ID NO:20 represents the nucleic acid sequence encoding the Ig
- the invention provides an isolated polynucleotide comprising (i) a nucleotide sequence that encodes a polypeptide with the amino acid sequence of SEQ ID NOs: 2 or 15, or (ii) the complement of a nucleotide sequence that encodes a polypeptide with the amino acid sequence of SEQ ID Nos:2 or 15.
- SEQ ID NO:2 provides the amino acid sequence of GP286 encoded by the cDNA of SEQ ID NO: 1.
- SEQ ID NO: 15 provides the amino acid sequence of GP286a encoded by the cDNA of SEQ ID NO: 14.
- the invention provides an isolated polynucleotide having a nucleotide sequence that (i) encodes a polypeptide having the sequence of SEQ ED NOs:2 or 15, (ii) encodes a polypeptide having the sequence of SEQ ID NOs:2 or 15 with conservative amino acid substitutions, or (iii) that is the complement of (i) or (ii). Nucleic Acid Encoding Portions of GP286
- the invention provides isolated polynucleotides that encode select portions of gp286. As will be further discussed herein below, these nucleic acid molecules can be used, inter alia, to express specific portions of the GP286. These nucleic acid molecules can also be used, inter alia, as region-specific nucleic acid probes.
- the isolated polynucleotide encodes, or the complement of which encodes, a polypeptide having, in at least one copy, the Ig domain characteristic of the N-terminal extracellular portion of GP286.
- the extracellular Ig domain (SEQ ID NO:21) is encoded by nucleotides 119-354 of the gp286 cDNA sequence of SEQ TD NOT (see Fig. 1) and nucleotides 118-353 of SEQ ID NO: 14 (see Fig. 2).
- the isolated polynucleotides also encode a signal secretion sequence that will mediate transport of the encoded polypeptides through a membrane.
- the gp286 signal secretion sequence is encoded by nucleotides 26-76 of the gp286 cDNA sequence of SEQ ID NOT (amino acids 1-17 of SEQ ID NO:2; see Fig. 1) and by nucleotides 10-75 of the gp286a cDNA sequence of SEQ ID NO: 14 (amino acids 1-22 of SEQ ID NO: 15; see Fig. 2). More preferably, the signal secretion sequence of the isolated polynucleotide of the invention is from gp286.
- the above preferred isolated polynucleotides may optionally encode a transmembrane domain, if insertion of the encoded polypeptides into a membrane is so desired.
- the transmembrane domain may be encoded by gp286 or gp286a (see below) or may be encoded by a heterologous gene encoding a transmembrane domain of a heterologous membrane-associated protein.
- the above preferred isolated polynucleotides may further comprise an intracellular C-terminal domain if specific signaling reactions are desired in response to GP286 binding interactions.
- the intracellular domain may be encoded by gp286 or gp286a (see below), or may be encoded by a heterologous gene encoding an intracellular domain of a heterologous membrane- associated protein.
- polynucleotides of the invention are those that encode, or the complements of which encode, a polypeptide having the transmembrane domain of GP286.
- the GP286 transmembrane domain is encoded by nucleotides 443-505 of the gp286 cDNA sequence of SEQ ID NO: 1 (see Fig. 1) and by nucleotides 442-504 of the gp286a cDNA sequence of SEQ ID NO: 14 (see Fig. 2).
- SEQ ID NO:33 represents the amino acid sequence of the transmembrane domain of GP286 encoded by SEQ ID NO:32.
- nucleic acids above- described are those that encode, or the complements of which encode, a polypeptide having a (C-terminal) intracellular domain of GP286.
- the intracellular domain of GP286 is encoded by nucleotides 506-583 of the gp286 cDNA sequence of SEQ ID NOT (see Fig. 1).
- the intracellular domain of GP286a is encoded by nucleotides 505-843 of the gp286a cDNA sequence of SEQ ID NO: 14 (see Fig. 2).
- SEQ ID NO: 23 represents the amino acid sequence of the intracellular domain of GP286 encoded by SEQ ID NO:22, while SEQ ID NO:25 represents the amino acid sequence of the intracellular domain of GP286a encoded by SEQ ID NO:24. The most significant difference between GP286 and GP286a is in the
- GP286 has a cytoplasmic tail of about 26 amino acids
- GP286a has a cytoplasmic tail of about 113 amino acids.
- GP286a has three tyrosine residues in the cytoplasmic tail that are potential sites of protein phosphorylation. This finding strongly suggests that GP286a can be phosphorylated, and thus is likely to play an important role in signal transduction in T cells. GP286 is also likely a receptor, but is unlikely to be phosphorylated.
- the extracellular portion of the protein comprising the Ig domain, may receive a signal from an extracellular molecule, and the signal is transmitted through the cytoplasmic domain to elicit a response, e.g., a growth or differentiation response, in T cells.
- Preferred isolated polynucleotides of the invention is represented by SEQ ID NO:3.
- SEQ ID NO: 3 spans part of exons 2 and 3, which exons are identical for both gp286 and gp286a. See Example 3.
- splice variant-specific polynucleotide may be one that includes only sequences from one splice variant and not the other.
- Other splice variant-specific polynucleotides include those that can be used to exploit, e.g., a size difference between the different splice variants.
- splice variant-specific polynucleotides include those represented by the 3' 25 nucleotides of SEQ ID NO:22 (g ⁇ 286) and by the 3' 286 nucleotides of SEQ TD NO:24 (gp286a), although others are also disclosed herein.
- the invention provides isolated polynucleotides that hybridize to various of the gp286 nucleic acids of the present invention.
- These "cross-hybridizing nucleic acids” can be used, inter alia, as probes for, and to drive expression of, proteins that are related to gp286 of the present invention as further isoforms, homologs, paralogs, or orthologs.
- the invention provides an isolated polynucleotide comprising a sequence that hybridizes under high stringency conditions to a probe the nucleotide sequence of which comprises SEQ ID NO: 3, the complement of SEQ ID NO:3, or a fragment thereof having at least 17 nucleic acid units thereof.
- Nucleic Acids Particularly preferred among the above-described nucleic acids are those that are expressed, or the complements of which are expressed, in tissues of the immune system. Also particularly preferred among the above-described nucleic acids are those that encode, or the complements of which encode, a polypeptide having a gp286 biological activity, as described supra. Nucleic Acid Fragments
- the invention provides fragments of various of the isolated polynucleotides of the present invention which prove useful, inter alia, as region-specific nucleic acid probes, as amplification primers, to express specific portions of the GP286, either alone or as elements of a fusion protein and to direct expression or synthesis of epitopic or immunogenic protein fragments.
- the invention provides an isolated polynucleotide comprising at least 17 nucleotides, 18 nucleotides, 20 nucleotides, 24 nucleotides, or 25 nucleotides of contiguous nucleic acid sequence selected from SEQ ID NOs: 1 or 14, wherein the isolated polynucleotide is no more than about 100 kb in length, typically no more than about 75 kb in length, more typically no more than about 50 kb in length. Often, the isolated polynucleotides of these embodiments are no more than about 25 kb in length, often no more than about 15 kb in length, and frequently no more than about 10 kb in length. Even more preferably, the isolated polynucleotides are no more than 5000 base pairs, often no more than 1000 base pairs, 500 base pairs, 100 base pairs or 50 base pairs.
- the invention provides an isolated nucleic acid comprising a nucleotide sequence that (i) encodes a polypeptide having the sequence of at least eight contiguous amino acids of either SEQ TD NOs:2 or 15, (ii) encodes a polypeptide having the sequence of at least eight contiguous amino acids of either SEQ ID NOs:2 or 15 with conservative amino acid substitutions, or (iii) is the complement of (i) or (ii), wherein the isolated nucleic acid is no more than about 100 kb in length, typically no more than about 75 kb in length, more typically no more than about 50 kb in length.
- the isolated nucleic acids of these embodiments are no more than about 25 kb in length, often no more than about 15 kb in length, and frequently no more than about 10 kb in length. Even more preferably, the isolated polynucleotides are no more than 5000 base pairs, often no more than 1000 base pairs, 500 base pairs, 100 base pairs or 50 base pairs.
- the invention further provides genome-derived single exon probes having portions of no more than one exon of the gp286 gene.
- Single exon probes have particular utility in identifying and characterizing splice variants. In particular, such single exon probes are useful for identifying and discriminating the expression of distinct isoforms of gp286.
- the invention provides an isolated nucleic acid comprising a nucleotide sequence selected from one of the following exon-specific portions of SEQ ID NOs: 1, 13 or 14; or the complement of SEQ ID NOs:l, 13 or 14, wherein the portion comprises at least 17 contiguous nucleotides, 18 contiguous nucleotides, 20 contiguous nucleotides, 24 contiguous nucleotides, 25 contiguous nucleotides, or 50 contiguous nucleotides of any one of the portions of SEQ ID NOs:l, 13 or 14, or their complement:
- the present invention provides genome-derived isolated polynucleotides which include nucleic acid sequence elements that control transcription of the gp286 gene.
- nucleic acids can be used, inter alia, to drive expression of heterologous coding regions in recombinant constructs, thus conferring upon such heterologous coding regions the expression pattern of the native gp286 gene.
- nucleic acids can also be used, conversely, to target heterologous transcription control elements to the gp286 genomic locus, altering the expression pattern of the gp286 gene itself.
- the invention provides an isolated polynucleotide comprising nucleotides 1-10500 of SEQ ID NO: 13; nucleotides 1-159 of SEQ ID NO: 13; nucleotides 1-170 of SEQ ID NO: 13; nucleotides 159-10500 of SEQ ID NO: 13; nucleotides 170-10500 of SEQ ID NO:13; nucleotides 4209-10500 of SEQ ID NO:13; nucleotides 7738-10500 of SEQ ID NO: 13; nucleotides 7874-10500 of SEQ ID NO: 13 or nucleotides 9669- 10500 of SEQ ID NO: 13; or the complements of such sequences, wherein the isolated nucleic acid is no more than about 100 kb in length, typically no more than about 75 kb in length, more typically no more than about 50 kb in length.
- the isolated nucleic acids of these embodiments are no more than about 25 kb in length, often no more than about 15 kb in length, and frequently no more than about 10 kb in length. Even more preferably, the isolated polynucleotides are no more than 5000 base pairs, often no more than 1000 base pairs, 500 base pairs, 100 base pairs or 50 base pairs.
- the invention provides an isolated polynucleotide comprising at least 17, 18, 20, 24, or 25 nucleotides of nucleotides 1-10500 of SEQ ID NO: 13; nucleotides 1-159 of SEQ ID NO: 13; nucleotides 1- 170 of SEQ TD NO: 13; nucleotides 159-10500 of SEQ ID NO: 13; nucleotides 170- 10500 of SEQ ID NO: 13; nucleotides 4209-10500 of SEQ TD NO: 13; nucleotides 7738-10500 of SEQ ID NO: 13; nucleotides 7874-10500 of SEQ ID NO: 13 or nucleotides 9669-10500 of SEQ TD NO: 13; or the complements of such sequences, wherein the isolated nucleic acid is no more than about 100 kb in length, typically no more than about 75 kb in length, more typically no more than about 50 kb in length.
- the isolated nucleic acids of these embodiments are no more than about 25 kb in length, often no more than about 15 kb in length, and frequently no more than about 10 kb in length. Even more preferably, the isolated polynucleotides are no more than 5000 base pairs, often no more than 1000 base pairs, 500 base pairs, 100 base pairs or 50 base pairs.
- Each of the isolated polynucleotides comprising nucleotides 1-10500 of SEQ ID NO:13; nucleotides 1-159 of SEQ ID NO:13; nucleotides 1-170 of SEQ ID NO: 13; nucleotides 159-10500 of SEQ ID NO:13; nucleotides 170-10500 of SEQ ID NO:13; nucleotides 4209-10500 of SEQ TD NO:13; nucleotides 7738- 10500 of SEQ ID NO: 13; nucleotides 7874-10500 of SEQ ID NO: 13 or nucleotides 9669-10500 of SEQ ID NO: 13; comprises transcription control sequences that mediate developmental and tissue specific expression and regulation of the gp286 gene. Such transcription control sequences will be useful for conferring such developmental and tissue specific expression patterns on heterologous nucleic acid sequences operatively linked thereto.
- nucleic acid sequences specifically given herein are set forth as sequences of deoxyribonucleotides. It is intended, however, that the given sequences be interpreted as would be appropriate to the polynucleotide composition: for example, if the isolated nucleic acid is composed of RNA the given sequence intends ribonucleotides, with uridine substituted for thymidine. Polymorphisms such as single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes.
- SNPs single nucleotide polymorphisms
- SNPs More than 1.4 million SNPs have already identified in the human genome, International Human Genome Sequencing Consortium, Nature 409:860-921 (2001) - and the sequence determined from one individual of a species may differ from other allelic forms present within the population. Additionally, small deletions and insertions, rather than single nucleotide polymorphisms, are not uncommon in the general population, and often do not alter the function of the protein.
- the present invention not only provides isolated polynucleotides identical in sequence to those described with particularity herein (e.g., SEQ ID Nos: 1 and 14), but also to provide isolated polynucleotides that are allelic variants of those particularly described nucleic acid sequences.
- the invention provides homologs (e.g., paralogs and orthologs) of gp286 that are at least about 65% identical in sequence to those described with particularity herein, typically at least about 70%, 75%, 80%, 85%, or 90% identical in sequence to those described with particularity herein, usefully at least about 91%, 92%, 93%, 94%), or 95% identical in sequence to those described with particularity herein, more usefully at least about 96%, 97%, 98%, or 99% identical in sequence to those described with particularity herein, and, most conservatively, at least about 99.5%, 99.6%, 99.7%, 99.8% and 99.9% identical in sequence to those described with particularity herein.
- sequence variants can be naturally occurring or can result from human intervention, as by random or directed mutagenesis.
- percent identity of two nucleic acid sequences is determined using the procedure of Tatiana et al, "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250 (1999), which procedure is effectuated by the computer program BLAST 2 SEQUENCES, available online at: http://www.ncbi.nlm.nih.gov/Blas ⁇ l2seq ⁇ 12.html.
- the BLASTN module of BLAST 2 SEQUENCES is used with default values of (i) reward for a match: 1; (ii) penalty for a mismatch: -2; (iii) open gap 5 and extension gap 2 penalties; (iv) gap X_dropoff 50 expect 10 word size 11 filter, and both sequences are entered in their entireties.
- the isolated polynucleotides of the present invention being useful for expression of GP286 proteins and protein fragments, the present invention thus provide isolated polynucleotides that encode GP286 proteins and portions thereof not only identical in sequence to those described with particularity herein, but degenerate variants thereof as well.
- the genetic code is degenerate and codon choice for optimal expression varies from species to species.
- amino acid substitutions occur frequently among natural allelic variants, with conservative substitutions often occasioning only de minimis change in protein function.
- the present invention provides polynucleotides not only identical in sequence to those described with particularity herein, but also those that encode GP286 and portions thereof, having conservative amino acid substitutions or moderately conservative amino acid substitutions.
- a conservative replacement is any change having a positive value in the PAM250 log-likelihood matrix reproduced herein below (see Gonnet et al, Science 256(5062): 1443-5 (1992)):
- a "moderately conservative" replacement is any change having a nonnegative value in the PAM250 log-likelihood matrix reproduced herein above.
- amino acid residues that are conserved among the GP286 proteins of various species or among the Ig family members are not altered (except by conservative substitution) during genetic engineering. For instance, the cysteine residues for maintaining an Ig domain of GP286 should be conserved.
- polynucleotides can also be characterized using a functional test, the ability of the two polynucleotides to base-pair to one another at defined hybridization stringencies.
- the invention thus provides isolated polynucleotides not only identical in sequence to those described with particularity herein, but also to provide isolated polynucleotides ("cross-hybridizing nucleic acids") that hybridize under high stringency conditions (as defined herein) to all or to a portion of various of the isolated gp286 polynucleotides of the present invention (“reference nucleic acids").
- Such cross-hybridizing nucleic acids are useful, inter alia, as probes for, and to drive expression of, proteins related to the proteins of the present invention such as alternative splice variants and homologs (e.g., orthologs and paralogs).
- orthologs are those from other primate species, such as chimpanzee, rhesus macaque monkey, baboon, orangutan, and gorilla; from rodents, such as rats, mice, guinea pigs; from lagomorphs, such as rabbits, and from domestic livestock, such as cow, pig, sheep, horse, goat.
- the hybridizing portion of the reference nucleic acid is typically at least 15 nucleotides in length, and often at least 17 , 20, 25, 30, 35, 40 or 50 nucleotides (nt) in length.
- Cross-hybridizing nucleic acids that hybridize to a larger portion of the reference nucleic acid - for example, to a portion of at least 50 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 450 nt, 500 nt or more, up to and including the entire length of the reference nucleic acid, are also useful.
- the hybridizing portion of the cross-hybridizing nucleic acid is at least 75% identical in sequence to at least a portion of the reference nucleic acid.
- the hybridizing portion of the cross-hybridizing nucleic acid is at least 80%, often at least 85%, 86%, 87%, 88%, 89% or even at least 90% identical in sequence to at least a portion of the reference nucleic acid.
- the hybridizing portion of the cross-hybridizing nucleic acid will be at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical in sequence to at least a portion of the reference nucleic acid sequence.
- the hybridizing portion of the cross- hybridizing nucleic acid will be at least 99.5% identical in sequence to at least a portion of the reference nucleic acid.
- fragments of various of the isolated polynucleotides or nucleic acids of the present invention are here intended isolated polynucleotides or nucleic acids, however obtained, that have a nucleotide sequence identical to a portion of the reference nucleic acid sequence, which portion is at least 17 nucleotides and less than the entirety of the reference nucleic acid.
- an oligonucleotide of 17 nucleotides is of sufficient length as to occur at random less frequently than once in the three gigabases of the human genome, and thus to provide a nucleic acid probe that can uniquely identify the reference sequence in a nucleic acid mixture of mammalian genomic complexity.
- nucleic acid probes of the invention can be used to detect RNA transcripts or genomic sequences encoding homologs or identical proteins.
- the probe may comprise a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
- Such probes can be used as a part of diagnostic kit for identifying cells or tissues (i) that mis-express a GP286 protein (e.g., aberrant splicing, abnormal mRNA levels), or (ii) that harbor a mutation in the gp286 gene, such as a deletion, an insertion, or a point mutation.
- diagnostic kits preferably include labeled reagents and instructional inserts for their use.
- the isolated polynucleotides of the invention can also be used as primers in PCR, primer extension and the like.
- the polynucleotides can be, e.g., at least 6 nucleotides (e.g., at least 1, 8, 9, or 10) in length.
- the primers can hybridize to an exonic sequence of a gp286 gene, for, e.g., amplification of a gp286 mRNA or cDNA.
- the primers can hybridize to an intronic sequence or an upstream or downstream regulatory sequence of a gp286 gene, to utilize non-transcribed, e.g., regulatory portions of the genomic structure of a gp286 gene.
- the nucleic acid primers of the present invention can also be used, for example, to prime single base extension (SBE) for SNP detection (see, e.g., U.S. Pat. No. 6,004,744, the disclosure of which is incorporated herein by reference in its entirety).
- SBE single base extension
- Isothermal amplification approaches, such as rolling circle amplification are also now well-described. See, e.g., Schweitzer et al, Curr. Opin. Biotechnol 12(l):21-7 (2001); U.S. Patent Nos. 5,854,033 and 5,714,320 and international patent publications WO 97/19193 and WO 00/15779, the disclosures of which are incorporated herein by reference in their entireties.
- Rolling circle amplification can be combined with other techniques to facilitate SNP detection. See, e.g., Lizardi et al, Nature Genet. 19(3):225-32 (1998).
- nucleic acid fragments that encode at least 6 contiguous amino acids are useful in directing the expression or the synthesis of peptides that have utility in mapping the epitopes of the protein encoded by the reference nucleic acid. See, e.g., Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984); and U.S. Pat. Nos. 4,708,871 and 5,595,915.
- nucleic acid fragments that encode at least 8 contiguous amino acids are useful in directing the expression or the synthesis of peptides that have utility as immunogens. See, e.g., Lerner, "Tapping the immunological repertoire to produce antibodies of predetermined specificity," Nature 299:592-596 (1982); Shinnick et al., Annu. Rev. Microbiol. 37:425-46 (1983); Sutcliffe et al., Science 219:660-6 (1983).
- the nucleic acid fragment of the present invention is thus at least 17 nucleotides in length, typically at least 18 nucleotides in length, and often at least 24, 25, 30, 35, 40, or 45 nucleotides (nt) in length.
- nt nucleotides
- larger fragments having at least 50 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 450 nt, 500 nt or more are also useful, and at times preferred, as will be appreciated by the skilled worker.
- the present invention further provides isolated genome-derived polynucleotides or nucleic acids that include portions of the gp286 gene.
- the invention particularly provides genome-derived single exon probes, which comprise at least part of an exon ("reference exon") and can hybridize detectably under high stringency conditions to transcript-derived nucleic acids that include the reference exon.
- the single exon probe will not, however, hybridize detectably under high stringency conditions to nucleic acids that lack the reference exon but include one or more exons that are found adjacent to the reference exon in the genome.
- the present invention also provides isolated genome-derived polynucleotides or nucleic acids which include nucleic acid sequence elements that control transcription of the gp286 gene. Transcription control sequences include, e.g., promoters, enhancers, operators, terminators, silencers, and the like.
- Transcription control sequences include, e.g., promoters, enhancers, operators, terminators, silencers, and the like.
- the isolated polynucleotides and nucleic acids of the present invention can usefully include one or more modified bases (see below) and/or one or more modified or altered internucleoside bonds, which often provide nuclease- resistance. See Hartmann et al.
- the antisense nucleic acid molecules (and enzymatic nucleic acids targeted by antisense) of the invention can be used in a therapeutic setting. These molecules can be expressed from an expression vector that contains an operably linked transcription regulatory sequence, the activity of which can be determined by the cell type into which the vector is introduced.
- an operably linked transcription regulatory sequence the activity of which can be determined by the cell type into which the vector is introduced.
- An antisense nucleic acid of the invention may be a ribozyme.
- Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- ribozymes can be used to catalytically cleave gp286 mRNA transcripts to thereby inhibit translation of gp286 mRNA.
- a ribozyme having specificity for a gp286-encoding nucleic acid can be designed based upon the nucleotide sequence of a gp286 polynucleotide disclosed herein (i.e., SEQ ID NOs: 1, 13 or 14).
- Oligonucleotide mimetics of gp286, such as peptide nucleic acids (PNA), can be used in therapeutic and diagnostic applications. See, e.g., Hyrup et al. (1996) Bioorg. Med. Chem. Lett. 4:5-23.
- PNA compounds the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
- PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
- PNAs of gp286 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases; or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; and Perry-O'Keefe, supra).
- PNAs of gp286 can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art (see infra).
- Oligonucleotide of the invention may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier.
- oligonucleotides can be modified with hybridization triggered cleavage agents or intercalating agents.
- the oligonucleotide may be conjugated to another molecule, e.g., a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc. (see infra).
- another molecule e.g., a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc. (see infra).
- nucleic acid compositions found in nature e.g., non-native bases, altered internucleoside linkages, post-synthesis modification — can be present throughout the length of the gp286 polynucleotide or can usefully be localized to discrete portions thereof.
- chimeric nucleic acids can be synthesized that have discrete DNA and RNA domains and demonstrated utility for targeted gene repair, as further described in U.S. Pat. Nos. 5,760,012 and 5,731,181, the disclosures of which are incorporated herein by reference in their entireties.
- Chimeric nucleic acids comprising both DNA and PNA have been demonstrated to have utility in modified PCR reactions. See Misra et al, Biochem. 37: 1917-1925 (1998); see also Finn et al, Nucl. Acids Res. 24: 3357-3363 (1996), incorporated herein by reference.
- Polynucleotides and nucleic acids of the present invention can also usefully be bound to a substrate.
- the substrate can porous or solid, planar or non- planar, unitary or distributed; the bond can be covalent or noncovalent. Bound to a substrate, nucleic acids of the present invention can be used as probes in their unlabeled state.
- the nucleic acids of the present invention can usefully be bound to a porous substrate, commonly a membrane, typically comprising nitrocellulose, nylon, or positively-charged derivatized nylon; so attached, the nucleic acids of the present invention can be used to detect gp286 nucleic acids present within a labeled nucleic acid sample, either a sample of genomic nucleic acids or a sample of transcript-derived nucleic acids, e.g. by reverse dot blot.
- the nucleic acids of the present invention can also usefully be bound to a solid substrate, such as glass, although other solid materials, such as amorphous silicon, crystalline silicon, or plastics, can also be used.
- the nucleic acids of the present invention can be attached covalently to a surface of the support substrate or applied to a derivatized surface in a chaotropic agent that facilitates denaturation and adherence by presumed noncovalent interactions, or some combination thereof.
- the nucleic acids of the present invention can be bound to a substrate to which a plurality of other nucleic acids are concurrently bound, hybridization to each of the plurality of bound nucleic acids being separately detectable.
- these substrate-bound collections are typically denominated macroarrays; at higher density, typically on a solid support, such as glass, these substrate bound collections of plural nucleic acids are colloquially termed microarrays.
- microarray includes arrays of all densities. The invention thus provides microarrays that include the nucleic acids of the present invention.
- the isolated nucleic acids of the present invention can be used as hybridization probes to detect, characterize, and quantify gp286 nucleic acids in, and isolate gp286 nucleic acids from, both genomic and transcript-derived nucleic acid samples.
- probes When free in solution, such probes are typically, but not invariably, detectably labeled; bound to a substrate, as in a microarray, such probes are typically, but not invariably unlabeled.
- the isolated nucleic acids of the present invention can be used as probes to detect and characterize gross alterations in the gp286 genomic locus, such as deletions, insertions, translocations, and duplications of the gp286 genomic locus through fluorescence in situ hybridization (FISH) to chromosome spreads.
- FISH fluorescence in situ hybridization
- the isolated nucleic acids of the present invention can be used as probes to assess smaller genomic alterations using, e.g., Southern blot detection of restriction fragment length polymorphisms.
- the isolated nucleic acids of the present invention can be used as probes to isolate genomic clones that include the nucleic acids of the present invention, which thereafter can be restriction mapped and sequenced to identify deletions, insertions, translocations, and substitutions (single nucleotide polymorphisms, SNPs) at the sequence level.
- the isolated nucleic acids of the present invention can be also be used as probes to detect, characterize, and quantify gp286 nucleic acids in, and isolate gp286 nucleic acids from, transcript-derived nucleic acid samples.
- the isolated nucleic acids of the present invention can be used as hybridization probes to detect, characterize by length, and quantify gp286 mRNA by northern blot of total or poly-A + - selected RNA samples.
- the isolated nucleic acids of the present invention can also be used as hybridization probes to detect, characterize by location, and quantify gp286 message by in situ hybridization to tissue sections (see, e.g., Schwarchzacher et al, In Situ Hybridization, Springer- Verlag New York (2000) (ISBN: 0387915966), the disclosure of which is incorporated herein by reference in its entirety).
- the isolated nucleic acids of the present invention can be used as hybridization probes to measure the representation of gp286 clones in a cDNA library.
- the isolated nucleic acids of the present invention can be used as hybridization probes to isolate gp286 nucleic acids from cDNA libraries, permitting sequence level characterization of gp286 RNA messages, including identification of deletions, insertions, truncations — including deletions, insertions, and truncations of exons in alternatively spliced forms — and single nucleotide polymorphisms.
- the nucleic acids of the present invention can also be used to detect and quantify gp286 nucleic acids in transcript-derived samples to measure expression of the gp286 gene.
- Measurement of gp286 expression has particular utility in diagnostic assays for conditions, disorders and diseases associated with abnormal gp286 expression, particularly in T cells, where gp286 is normally expressed, as well as in tissues where it may be mis- expressed, as further described in the Examples herein below.
- each gp286 nucleic acid probe whether labeled, substrate-bound, or both — is thus currently available for use as a tool for measuring the level of gp286 expression in immune and other tissues, in which expression has already been confirmed.
- the gp286 nucleic acid probes of the present invention are also useful for determining levels of T cell infiltration into tissues. This may be particularly useful in determining whether a tissue is inflamed, in which case T cells will infiltrate the tissue, or in other disease states in which T cell infiltration occurs.
- One having ordinary skill in the art may compare the level of gp286 mRNA in a normal tissue to that of a sample tissue suspected of being inflamed or diseased, wherein a determination that the gp286 mRNA level is higher in the sample tissue would be indicative of T cell infiltration and therefore of inflammation or other disease state.
- the nucleic acid probes of the present invention are useful in constructing microarrays; the microarrays, in turn, are products of manufacture that are useful for measuring and for surveying gene expression in, for example, drug discovery and target validation programs.
- each gp286 nucleic acid probe makes the microarray specifically useful for detecting that portion of the gp286 gene included within the probe, thus imparting upon the microarray device the ability to detect a signal where, absent such probe, it would have reported no signal.
- WO 99/58720 incorporated herein by reference in its entirety, provides methods for quantifying the relatedness of a first and second gene expression profile and for ordering the relatedness of a plurality of gene expression profiles, without regard to the identity or function of the genes whose expression is used in the calculation.
- genome-derived single exon probes and genome-derived single exon probe microarrays of the invention have the additional utility of permitting high-throughput detection of splice variants of the nucleic acids of the present invention.
- Polynucleotides of the present invention inserted into nucleic acid constructs such as vectors which flank the polynucleotide insert with a promoter can be used to drive in vitro expression of RNA complementary to either strand of the nucleic acid of the present invention.
- the RNA can be used as a single-stranded probe, in cDNA-mRNA subtraction, or for in vitro translation.
- Those polynucleotides which encode GP286 protein or portions thereof can further be used to express the GP286 proteins or protein fragments, either alone, or as part of fusion proteins. Expression can be from genomic or transcript-derived polynucleotides of the present invention.
- expression will typically be effected in eukaryotic, typically mammalian, cells capable of splicing introns from the initial RNA transcript.
- Expression can be driven from episomal vectors or from genomic DNA integrated into a host cell chromosome.
- expression can be effected in a wide variety of prokaryotic or eukaryotic cells.
- the protein, protein fragment, or protein fusion can thereafter be isolated, to be used as a standard in immunoassays specific for the proteins, or protein isoforms, of the present invention; to be used as a therapeutic agent, e.g., to be administered as passive replacement therapy in individuals deficient in the proteins of the present invention; to be administered as a vaccine; to be used for in vitro production of specific antibody, the antibody thereafter to be used, e.g., as an analytical reagent for detection and quantitation of the proteins of the present invention or to be used as an immunotherapeutic agent.
- the isolated polynucleotides and nucleic acids of the present invention can also be used to drive in vivo expression of the proteins of the present invention.
- In vivo expression can be driven from a vector — typically a viral vector, often a vector based upon a replication incompetent lentivirus, retrovirus, adenovirus, or adeno-associated virus (AAV) — for purpose of gene therapy.
- In vivo expression can be driven from expression control signals endogenous or exogenous (e.g., from a vector) to the nucleic acid.
- isolated gp286 polynucleotides of the invention can be microinjected into male or female pronuclei, or can be integrated into embryonic stem (ES) cells to create transgenic non-human animals capable of producing the proteins of the present invention.
- ES embryonic stem
- Genomic nucleic acids of the present invention can also be used to target homologous recombination to a gp286 locus in a subject. See, e.g., U.S. Patent Nos. 6,187,305; 6,204,061; 5,631,153; 5,627,059; 5,487,992; 5,464,764; 5,614,396; 5,527,695 and 6,063,630; and Kmiec et al (eds.), Gene Targeting Protocols, Vol. 133, Humana Press (2000) (ISBN: 0896033600); Joyner (ed.), Gene Targeting: A Practical Approach. Oxford University Press, Inc.
- homologous recombination can be used to alter the expression of GP286, both for purpose of in vitro production of GP286 protein from human cells, and for purposes of gene therapy. See, e.g., U.S. Pat. Nos. 5,981,214, 6,048,524; 5,272,071; the disclosures of which are incorporated herein by reference in their entireties. Fragments of the polynucleotides of the present invention smaller than those typically used for homologous recombination can also be used for targeted gene correction or alteration, possibly by cellular mechanisms different from those engaged during homologous recombination. See, e.g., U.S. Pat. Nos.
- Polynucleotides of the present invention can be obtained by using the labeled probes of the present invention to probe nucleic acid samples, such as genomic libraries, cDNA libraries, and mRNA samples, by standard techniques.
- Polynucleotides of the present invention can also be obtained by amplification, using the nucleic acid primers of the present invention, as further demonstrated in Example 1, herein below. Polynucleotides of the present invention, especially if fewer than about 100 nucleotide, can also be synthesized chemically, typically by solid phase synthesis using commercially available automated synthesizers.
- the present invention provides nucleic acid constructs, such as vectors, that comprise one or more of the isolated polynucleotides of the invention, and host cells into which such vectors have been introduced.
- the vectors can be used for propagating the polynucleotides of the present invention in host cells (cloning vectors), for shuttling the polynucleotides of the present invention between host cells derived from disparate organisms (shuttle vectors), for inserting the polynucleotides of the present invention into host cell chromosomes (insertion vectors), for expressing sense or antisense RNA transcripts of the polynucleotides of the present invention in vitro or within a host cell, and for expressing polypeptides encoded by the polynucleotides of the present invention, alone or as fusions to heterologous polypeptides (expression vectors).
- Vectors of the present invention will often be suitable for several such uses.
- Vectors are by now well-known in the art, and are described, inter alia, in Jones et al (eds.), Vectors: Cloning Applications : Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd 1998 (ISBN: 047196266X); Jones et al. (eds.), Vectors: Expression Systems : Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd, 1998 (ISBN: 0471962678); Gacesa et al, Vectors: Essential Data.
- vectors are available commercially. Use of existing vectors and modifications are well within the skill in the art.
- vectors are derived from virus, plasmid, prokaryotic or eukaryotic chromosomal elements, or some combination thereof, and include at least one origin of replication, at least one site for insertion of heterologous nucleic acid, typically in the form of a polylinker with multiple, tightly clustered, single cutting restriction sites, and at least one selectable marker, although some integrative vectors will lack an origin that is functional in the host to be chromosomally modified, and some vectors will lack selectable markers.
- Vectors of the invention will further include at least one isolated polynucleotide nucleic acid of the invention inserted into the vector in at least one location.
- the origin of replication and selectable markers are chosen based upon the desired host cell or host cells; the host cells, in turn, are selected based upon the desired application.
- prokaryotic cells typically E. coli
- E. coli are typically chosen for cloning, i.e., for amplification of polynucleotide sequences in a host cell.
- vector replication is predicated on the replication strategies of coliform- infecting phage — such as phage lambda, Ml 3, T7, T3 and PI — or on the replication origin of autonomously replicating episomes, notably the ColEl plasmid and later derivatives, including pBR322 and the pUC series plasmids.
- selectable markers are, analogously, chosen for selectivity in gram negative bacteria: e.g., typical markers confer resistance to antibiotics, such as ampicillin, tetracycline, chloramphenicol, kanamycin, streptomycin, zeocin; auxotrophic markers can also be used.
- yeast cells typically S. cerevisiae
- yeast cells are chosen, inter alia, for eukaryotic genetic studies, for identification of interacting protein components, e.g. through use of a two-hybrid system, and for protein expression.
- Vectors of the present invention for use in yeast will typically, but not invariably, contain an origin of replication suitable for use in yeast and a selectable marker that is functional in yeast.
- suitable yeast vectors include integrative Yip vectors, replicating episomal YEp vectors containing centromere sequences, CEN, and autonomously replicating sequences, ARS.
- YACs are based on yeast linear plasmids, denoted YLp, containing homologous or heterologous DNA sequences that function as telomeres (TEL) in vivo, as well as containing yeast ARS (origins of replication) and CEN (centromeres) segments.
- TEL telomeres
- CEN centromeres
- Selectable markers in yeast vectors include a variety of auxotrophic markers, the most common of which are (in Saccharomyces cerevisiae) URA3, HIS3, LEU2, TRPl and LYS2, which complement specific auxotrophic mutations, such as ura3-52, his3-Dl, Ieu2-Dl, trpl-Dl and lys2-201.
- the URA3 and LYS2 yeast genes further permit negative selection based on specific inhibitors, 5-fluoro-orotic acid (FOA) and ⁇ -aminoadipic acid ( ⁇ AA), respectively, that prevent growth of the prototrophic strains but allows growth of the ura3 and lys2 mutants, respectively.
- zeocin Other selectable markers confer resistance to, e.g., zeocin.
- Insect cells are often chosen for high efficiency protein expression.
- the host cells are from Spodoptera frugiperda — e.g., Sf9 and Sf21 cell lines, and expresSFTM cells (Protein Sciences Corp., Meriden, CT, USA) — the vector replicative strategy is typically based upon the baculovirus life cycle.
- baculovirus transfer vectors are used to replace the wild-type AcMNPV polyhedrin gene with a heterologous gene of interest. Sequences that flank the polyhedrin gene in the wild-type genome are positioned 5' and 3' of the expression cassette on the transfer vectors. Following cotransfection with AcMNPV DNA, a homologous recombination event occurs between these sequences resulting in a recombinant virus carrying the gene of interest and the polyhedrin or plO promoter.
- Selection can be based upon visual screening for lacZ fusion activity.
- Mammalian cells are often chosen for expression of proteins intended as pharmaceutical agents, and are also chosen as host cells for screening of potential agonist and antagonists of a protein or a physiological pathway.
- Vectors intended for autonomous extrachromosomal replication in mammalian cells will typically include a viral origin, such as the S V40 origin (for replication in cell lines expressing the large T-antigen, such as COS1 and COS7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use, e.g., in 293-EBNA cells, which constitutively express the EBV EBNA-1 gene product and adenovirus El A).
- a viral origin such as the S V40 origin (for replication in cell lines expressing the large T-antigen, such as COS1 and COS7 cells), the papillomavirus origin, or the EBV origin for long term episomal replication (for use, e.g., in 293-EBNA cells, which constitutively express the EBV
- Vectors intended for integration, and thus replication as part of the mammalian chromosome can, but need not, include an origin of replication functional in mammalian cells, such as the SV40 origin.
- Vectors based upon viruses, such as lentiviruses, adenovirus, adeno-associated virus, vaccinia virus, and various mammalian retroviruses will typically replicate according to the viral replicative strategy.
- Selectable markers for use in mammalian cells include resistance to neomycin (G418), blasticidin, hygromycin and to zeocin, and selection based upon the purine salvage pathway using HAT medium.
- Plant cells can also be used for expression, with the vector replicon typically derived from a plant virus (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) and selectable markers chosen for suitability in plants.
- a plant virus e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV
- selectable markers chosen for suitability in plants.
- the invention further provides artificial chromosomes — BACs, YACs, and HACs — that comprise gp286 nucleic acids, often genomic nucleic acids.
- BACs, YACs, and HACs that comprise gp286 nucleic acids, often genomic nucleic acids.
- Expression vectors of the invention which will drive expression of polypeptides from the inserted heterologous nucleic acid will often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive and regulate transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination, splicing signals and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences.
- Other transcription control sequences include, e.g., operators, silencers, and the like. Use of such expression control elements, including those that confer inducible expression, and developmental or tissue-regulated expression are well-known in the art.
- Tissue-specific regulatory elements capable of expressing GP286 in the immune system may be particularly useful and are known in the art, e.g., native immunoglobulin promoters and native T cell receptor promoters. Developmentally- regulated promoters may also be selected, including but not limited to the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the ⁇ - fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546). A huge variety of inducible promoters are known and may be selected based on the particular application. Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization. Many such tags are known and available.
- Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags.
- Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as luciferase or those that have a green fluorescent protein (GFP)-like chromophore, fusions to the IgG Fc region or other immunoglobulin type constant domains, and fusions for use in two hybrid selection systems.
- GFP green fluorescent protein
- Vectors designed for phage display, yeast display, and mammalian display for example, target recombinant proteins using an N-terminal cell surface targeting signal and a C-terminal transmembrane anchoring domain.
- a wide variety of vectors now exist that fuse proteins encoded by heterologous nucleic acids to the chromophore of the substrate-independent, intrinsically fluorescent green fluorescent protein from Aequorea victoria ("GFP") and its many color-shifted and/or stabilized variants.
- GFP Aequorea victoria
- Fc region to increase serum half-life of protein pharmaceutical products through interaction with the FcRn receptor also denominated the FcRp receptor and the Brambell receptor, FcRb
- FcRn receptor also denominated the FcRp receptor and the Brambell receptor, FcRb
- Stable expression is readily achieved by integration into the host cell genome of vectors (preferably having selectable markers), followed by selection for integrants.
- Vectors of the invention will also often include elements that permit in vitro transcription of RNA from the inserted heterologous nucleic acid.
- Such vectors typically include a phage promoter, such as that from T7, T3, or SP6, flanking the nucleic acid insert. Often two different such promoters flank the inserted nucleic acid, permitting separate in vitro production of both sense and antisense strands.
- the present invention further includes host cells ⁇ either prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells) ⁇ comprising the nucleic acid constructs such as vectors of the present invention, either present episomally within the cell or integrated, in whole or in part, into the host cell chromosome.
- host cells either prokaryotic (bacteria) or eukaryotic (e.g., yeast, insect, plant and animal cells) ⁇ comprising the nucleic acid constructs such as vectors of the present invention, either present episomally within the cell or integrated, in whole or in part, into the host cell chromosome.
- a host cell strain may be chosen for its ability to process the expressed protein in the desired fashion.
- post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation, and it is an aspect of the present invention to provide GP286 proteins with such post-translational modifications.
- host cells include bacterial cells, such as E. coli, Caulobacter crescentus, Streptomyces species, and Salmonella typhimurium; yeast cells, such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Pichia methanolica; insect cell lines, such as those from Spodoptera frugiperda — e.g., Sf9 and Sf21 cell lines, and expresSF cells (Protein Sciences Corp., Meriden, CT, USA) — Drosophila S2 cells, and Trichoplusia ni High Five® Cells (Invitrogen, Carlsbad, CA USA); and mammalian cells.
- Typical mammalian cells include COS1 and
- COS7 cells Chinese hamster ovary (CHO) cells, NTH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, HeLa, MDCK, HEK293, WI38, murine ES cell lines (e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ), K562, Jurkat cells, and BW5147.
- murine ES cell lines e.g., from strains 129/SV, C57/BL6, DBA-1, 129/SVJ
- K562 Jurkat cells
- BW5147 BW5147.
- T cell lines preferably human T cell lines, e.g., MOLT-4.
- ATCC American Type Culture Collection
- NIGMS National Institute of General medical Sciences
- the present invention provides GP286 proteins and various fragments thereof suitable for use as antigens (e.g., for epitope mapping), for use as immunogens (e.g., for raising antibodies or as vaccines), and for use in therapeutic compositions. Also provided are fusions of GP286 polypeptides and fragments to heterologous polypeptides, and conjugates of the proteins, fragments, and fusions of the present invention to other moieties (e.g., to carrier proteins, to fluorophores).
- the invention provides an isolated GP286 polypeptide comprising the amino acid sequence encoded by a full-length gp286 cDNA (SEQ ID NOs: 1 and 14), or a degenerate variant.
- the invention also provides an isolated GP286 polypeptide having the amino acid sequence encoded by a full-length gp286 cDNA (SEQ ID NOs: 1 and 14), optionally having one or more conservative amino acid substitutions.
- the invention also provides an isolated GP286 polypeptide comprising the amino acid sequence encoded by a polynucleotide sequence that hybridizes under high stringency conditions to a probe having part or all of the nucleotide sequence of a g ⁇ 286 cDNA (SEQ ID NOs: 1 and 14).
- an isolated GP286 polypeptide encoded by a stringently cross-hybridizing polynucleotide of the invention will have at least one biological activity of GP286.
- the invention provides an isolated GP286 polypeptide comprising the GP286 amino acid sequence of either SEQ ID NOs:2 or 15, optionally having one or more conservative amino acid substitutions. Also provided is an isolated GP286 polypeptide having the amino acid sequence encoded by the full-length GP286 polypeptide sequence of either SEQ ID NOs:2 or 15, optionally having one or more conservative amino acid substitutions.
- the invention further provides fragments of each of the above- described isolated polypeptides, particularly fragments having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entirety of the sequence given in either SEQ ID NOs:2 or 15.
- the invention also provides an isolated GP286 polypeptide comprising all or a portion of the N-terminal extracellular domain of GP286. (See FIGs. 1 and 2 and SEQ ID NOs:2 and 15 for GP286 domains and sequences).
- Preferred polypeptides are those having the amino acid sequences of SEQ ID NO: 21, which is the Ig-like domain of GP286, and SEQ ID NO: 27, which is the extracellular domain of GP286 without the amino acids N-terminal of the Ig-like domain.
- the isolated GP286 polypeptide comprises the entire extracellular domain of GP286 and lacks a functional GP286 transmembrane domain.
- Preferred polypeptides are those having the amino acid sequences of SEQ ID NOs: 17 and 19, which are the extracellular portions of GP286 and GP286a, respectively.
- the isolated GP286 polypeptide consists of part or all of the GP286 extracellular domain fused to a heterologous protein domain.
- an isolated GP286 polypeptide comprising a GP286 fragment selected from the group consisting of the transmembrane domain of GP286 and the C-terminal cytoplasmic region of GP286.
- Preferred polypeptides are those having the amino acid sequences of SEQ ID NO: 33, which is the transmembrane domain of GP286; SEQ ID NO: 23, which is the intracellular domain of GP286; and SEQ ID NO: 25; which is the intracellular domain of GP286a.
- the isolated GP286 polypeptide consists of part or all of the GP286 cytoplasmic or transmembrane domains fused to a heterologous protein domain.
- the GP286 fragments of the invention may be continuous portions of the native GP286 protein. However, it will be appreciated that knowledge of the GP286 gene and protein sequences as provided herein permits recombining of various domains that are not contiguous in the native GP286 protein.
- the invention also provides polypeptides comprising select portions of GP286 and related proteins.
- these protein fragments especially when coupled to heterologous protein fragments, can be used, for example, to target agents to particular cell types through protein- protein interaction; to inhibit protein-protein interactions between Ig domain containing proteins; for competitive binding assays; and to raise fragment-specific GP286 antibodies.
- the protein fragment comprises, in at least one copy, the Ig domain characteristic of the N-terminal extracellular portion of GP286.
- the extracellular Ig domain is encoded by amino acids 32-110 of the GP286 amino acid sequence of SEQ ED NO:2 (see Fig. 1) and amino acids 37-115 of the GP286a amino acid sequence of SEQ ID NO: 15 (see Fig. 2).
- the protein fragment contains an N-terminal signal secretion sequence that will mediate transport of the polypeptide through a membrane.
- the GP286 signal secretion sequence is encoded by amino acids 1-17 of the GP286 amino acid sequence of SEQ TD NO:2 (see Fig. 1) and by amino acids 1-22 of the GP286a amino acid sequence of SEQ ID NO: 15 (see Fig. 2).
- the signal sequence may be from a heterologous protein, preferably the signal secretion sequence of the protein fragment is from GP286.
- the above preferred protein fragments may optionally include a transmembrane domain, if insertion of the polypeptide into a membrane is so- desired.
- the transmembrane domain may be a GP286 domain (see below) or may be encoded by a heterologous gene encoding a transmembrane domain of a heterologous membrane-associated protein. If so desired, the above preferred protein fragments may further comprise an intracellular C-terminal domain if specific signaling reactions are desired in response to GP286 binding interactions.
- the intracellular domain may be derived from GP286 or GP286a (see below) or may be encoded by a heterologous gene encoding an intracellular domain of a heterologous membrane-associated protein.
- the protein fragments of the invention are those that comprise the transmembrane domain of GP286.
- the GP286 transmembrane domain is encoded by amino acids 140-160 of the GP286 amino acid sequence of SEQ ID NO:2 (see Fig. 1) and by amino acids 145-165 of the GP286a amino acid sequence of SEQ ID NO: 15 (see Fig. 2).
- Yet other preferred embodiments of the above-described protein fragments have a (C-terminal) intracellular domain of GP286.
- one intracellular domain of GP286 is encoded by amino acids 161-186 of the GP286 amino acid sequence of SEQ ID NO:2 (see Fig. 1) and by amino acids 166-278 of the GP286a amino acid sequence of SEQ ED NO: 15 (see Fig. 2). It is believed that these different intracellular domain forms are produced by alternative splicing.
- the invention further provides proteins that differ in sequence from those described with particularity in the above-referenced sequence identifiers (SEQ TD NOs:), whether by way of insertion or deletion, by way of conservative or moderately conservative substitutions, as hybridization related proteins, or as cross-hybridizing proteins, with those that substantially retain a GP286 activity preferred.
- the invention further provides fusions of the polypeptides, proteins and protein fragments herein described to heterologous polypeptides.
- the various protein embodiments of the present invention can be used, inter alia, to elicit antibodies that bind to a variety of epitopes of the GP286 protein.
- FIGs. 1 and 2 present the predicted amino acid sequences encoded by the gp286 cDNA clone (SEQ ID NO:2) and the gp286a cDNA clone (SEQ ID NO: 14). Unless otherwise indicated, amino acid sequences of the proteins of the present invention were determined as a predicted translation from a nucleic acid sequence. Accordingly, any amino acid sequence presented herein may contain errors due to errors in the nucleic acid sequence, as described in detail above.
- SNPs single nucleotide polymorphisms
- the present invention provides GP286 polypeptides not only identical in sequence to those described with particularity herein, but also isolated proteins at least about 80% identical in sequence to those described with particularity herein, typically at least about 85%, 90%, 91%, 92%, 93%, 94%, or 95% identical in sequence to those described with particularity herein, usefully at least about 96%, 97%, 98%, or 99% identical in sequence to those described with particularity herein, and, most conservatively, at least about 99.5%, 99.6%, 99.7%>, 99.8% and 99.9% identical in sequence to those described with particularity herein.
- sequence variants can be naturally occurring or can result from human intervention by way of random or directed mutagenesis.
- percent identity of two amino acid sequences is determined using the procedure of Tatiana et al, "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250 (1999), which procedure is effectuated by the computer program Blast 2 SEQUENCES, available online at: http://www.ncbi.nlm.nih.gov/Blast/bl2seq/bl2.html, To assess percent identity of amino acid sequences, the BlastP module of Blast 2 SEQUENCES is used with default values of (i) BLOSUM62 matrix, Henikoff et al, Proc. Natl. Acad.
- the present invention provides proteins not only identical in sequence to those described with particularity herein, but also isolated proteins having the sequence of GP286 proteins, or portions thereof, with conservative amino acid substitutions. Also provided are isolated proteins having the sequence of GP286 proteins, and portions thereof, with moderately conservative amino acid substitutions.
- the hybridization related proteins can be alternative isoforms, homologs, paralogs, and orthologs of the GP286 protein of the present invention.
- Particularly useful orthologs are those from other primate species, such as chimpanzee, rhesus macaque monkey, baboon, orangutan, and gorilla; from rodents, such as rats, mice, guinea pigs; from lagomorphs, such as rabbits, and from domestic livestock, such as cow, pig, sheep, horse, goat.
- proteins can also be characterized using a second functional test, the ability of a first protein to inhibit competitively the binding of a second protein to an antibody. It is, therefore, another aspect of the present invention to provide isolated proteins not only identical in sequence to those described with particularity herein, but also to provide isolated proteins (“cross- reactive proteins") that competitively inhibit the binding of antibodies to all or to a portion of various of the isolated GP286 proteins of the present invention ("reference proteins"). Such competitive inhibition can readily be determined using immunoassays well known in the art.
- proteins of the present invention that differ in amino acid sequence from those described with particularity herein — including those that have deletions and insertions causing up to 10% non-identity, those having conservative or moderately conservative substitutions, hybridization related proteins, and cross- reactive proteins — those that substantially retain one or more GP286 activities are preferred (see supra).
- Residues that are tolerant of change while retaining function can be identified by altering the protein at known residues using methods known in the art, such as alanine scanning mutagenesis, Cunningham et al, Science 244(4908): 1081-5 (1989); transposon linker scanning mutagenesis, Chen et al, Gene 263 (1-2): 39-48 (2001); combinations of homolog- and alanine-scanning mutagenesis, Jin et al, J. Mol. Biol. 226(3):851-65 (1992); combinatorial alanine scanning, Weiss et al, Proc. Natl. Acad. Sci USA 97(16):8950-4 (2000), followed by functional assay.
- Transposon linker scanning kits are available commercially (New England Biolabs, Beverly, MA, USA, catalog, no. E7-102S; EZ::TNTM In-Frame Linker Insertion Kit, catalogue no. EZI04KN, Epicentre Technologies Corporation, Madison, WI, USA).
- the isolated proteins of the present invention can readily be used as specific immunogens to raise antibodies that specifically recognize GP286 proteins, their isoforms, homologs, paralogs, and/or orthologs.
- the antibodies can be used, inter alia, specifically to assay for the GP286 proteins of the present invention — e.g. by ELISA for detection of protein fluid samples, such as serum, by immunohistochemistry or laser scanning cytometry, for detection of protein in tissue samples, or by flow cytometry, for detection of intracellular protein in cell suspensions — for specific antibody- mediated isolation and/or purification of GP286 proteins, as for example by immunoprecipitation, and for use as specific agonists or antagonists of GP286 action.
- the antibodies can be used to identify human T cells, which is useful in medical applications and in forensic science.
- the antibodies may also be used to isolate human T cells, e.g., by FACS, which is useful for treating T cells in vitro and for subsequent reinfusion into a patient.
- the antibodies may be conjugated to toxins or may be engineered to form fusion proteins comprising a toxin, which can be used to mark and kill aberrant T cells in a patient.
- the isolated proteins of the present invention are also immediately available for use-as specific standards in assays used to determine the concentration and/or amount specifically of the GP286 proteins of the present invention.
- ELISA kits for detection and quantitation of protein analytes typically include isolated and purified protein of known concentration for use as a measurement standard (e.g., the human interferon- ⁇ OptEIA kit, catalog no. 555142, Pharmingen, San Diego, CA, USA includes human recombinant gamma interferon, baculovirus produced).
- the isolated proteins of the present invention are also immediately available for use as specific biomolecule capture probes for surface-enhanced laser desorption ionization (SELDI) detection of protein-protein interactions, WO 98/59362; WO 98/59360; WO 98/59361; and Merchant et al, Electrophoresis 21(6): 1164-77 (2000), the disclosures of which are incorporated herein by reference in their entireties.
- the isolated proteins of the present invention are also immediately available for use as specific biomolecule capture probes on BIACORE surface plasmon resonance probes. See Weinberger et al, Pharmacogenomics 1(4):395-416 (2000); Malmqvist, Biochem. Soc. Trans. 27(2):335-40 (1999).
- the polypeptides of the instant invention may be conjugated to a toxin, or engineered to form a fusion protein with a toxin.
- the GP286-toxin may be used to bind to and kill GP286-binding cells.
- the polypeptides of the instant invention may also be conjugated to a detectable label or engineered to form a fusion protein with a detectable label.
- the GP286-label may be used to bind to and detect GP286-binding cells.
- the isolated proteins of the present invention are also useful as a therapeutic supplement in patients diagnosed to have a specific deficiency in GP286 production or activity.
- the extracellular domain, or the portion thereof that is active in binding to another cell or to an extracellular matrix protein may be administered to a patient to compete for binding of the cell surface GP286 to the other cell or extracellular matrix protein.
- the extracellular domain or portion thereof is part of a fusion protein that increases serum half-life, e.g., all or a portion of an IgG heavy chain (see below).
- the invention also provides fragments of various of the proteins of the present invention.
- the protein fragments are useful as antigenic and immunogenic fragments of GP286.
- fragments of a protein is here intended isolated proteins (equally, polypeptides, peptides, oligopeptides), however obtained, that have an amino acid sequence identical to a portion of the reference amino acid sequence, which portion is at least 6 amino acids and less than the entirety of the reference nucleic acid. As so defined, “fragments” need not be obtained by physical fragmentation of the reference protein, although such provenance is not thereby precluded.
- Fragments of at least 6 contiguous amino acids are useful in mapping B cell and T cell epitopes of the reference protein. See, e.g., Geysen et al, "Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid," Proc. Natl. Acad. Sci. USA 81:3998-4002 (1984) and U.S. Pat. Nos. 4,708,871 and 5,595,915, the disclosures of which are incorporated herein by reference in their entireties. Because the fragment need not itself be immunogenic, part of an immunodominant epitope, nor even recognized by native antibody, to be useful in such epitope mapping, all fragments of at least 6 amino acids of the proteins of the present invention have utility in such a study.
- Fragments of at least eight contiguous amino acids, often at least fifteen contiguous amino acids, have utility as immunogens for raising antibodies that recognize the proteins of the present invention. See, e.g., Lerner, "Tapping the immunological repertoire to produce antibodies of predetermined specificity," Nature 299:592-596 (1982); Shinnick et al, "Synthetic peptide immunogens as vaccines," ⁇ 4 «r ⁇ . Rev. Microbiol 37:425-46 (1983); Sutcliffe et al, "Antibodies that react with predetermined sites on proteins," Science 219:660-6 (1983), the disclosures of which are incorporated herein by reference in their entireties.
- Fragments of at least 8, 9, 10 or 12 contiguous amino acids are also useful as competitive inhibitors of binding of the entire protein, or a portion thereof, to antibodies (as in epitope mapping), and to natural binding partners, such as subunits in a multimeric complex or to receptors or ligands of the subject protein; this competitive inhibition permits identification and separation of molecules that bind specifically to the protein of interest, U.S. Pat. Nos. 5,539,084 and 5,783,674, inco ⁇ orated herein by reference in their entireties.
- the protein, or protein fragment, of the present invention is thus at least 6 amino acids in length, typically at least 8, 9, 10 or 12 amino acids in length, and often at least 15 amino acids in length. Often, the protein or the present invention, or fragment thereof, is at least 20, 25, 30, 35, or 50 amino acids or more in length. Larger fragments having at least 75, 100, 150 or more amino acids are also useful, and at times preferred.
- the present invention further provides fusions of each of the GP286 proteins and protein fragments of the present invention to heterologous polypeptides.
- fusion is here intended that the protein or protein fragment of the present invention is linearly contiguous to the heterologous polypeptide in a peptide-bonded polymer of amino acids or amino acid analogues; by "heterologous polypeptide” is here intended a polypeptide that does not naturally occur in contiguity with the protein or protein fragment of the present invention.
- the fusion can consist entirely of a plurality of fragments of the GP286 protein in altered arrangement; in such case, any of the GP286 fragments can be considered heterologous to the other GP286 fragments in the fusion protein. More typically, however, the heterologous polypeptide is not drawn from the GP286 protein itself.
- the fusion proteins of the present invention will include at least one fragment of the protein of the present invention, which fragment is at least 6, typically at least 8, often at least 15, and usefully at least 16, 17, 18, 19, or 20 amino acids long.
- the fragment of the protein of the present to be included in the fusion can usefully be at least 25, 50, 75, 100, or 150 arnino acids long. Fusions that include the entirety of the proteins of the present invention have particular utility.
- the heterologous polypeptide included within the fusion protein of the present invention is at least 6 amino acids in length, often at least 8 amino acids in length, and preferably, at least 15, 20, and 25 amino acids in length. Fusions that include larger polypeptides, such as the IgG Fc region, and even entire proteins (such as luciferase or GFP chromophore-containing proteins), have particular utility.
- heterologous polypeptides included in the fusion proteins of the present invention usefully include those designed to facilitate purification and/or visualization of recombinantly-expressed proteins.
- purification tags can also be incorporated into fusions that are chemically synthesized, chemical synthesis typically provides sufficient purity that further purification by HPLC suffices; however, visualization tags as above described retain their utility even when the protein is produced by chemical synthesis, and when so included render the fusion proteins of the present invention useful as directly detectable markers of GP286 presence.
- heterologous polypeptides to be included in the fusion proteins of the present invention can usefully include those that facilitate secretion of recombinantly expressed proteins — into the periplasmic space or extracellular milieu for prokaryotic hosts, into the culture medium for eukaryotic cells — through incorporation of secretion signals and/or leader sequences.
- Other useful protein fusions of the present invention include those that permit use of the protein of the present invention as bait in a yeast two-hybrid system. See Bartel et al. (eds.), The Yeast Two-Hybrid System, Oxford University Press (1997) (ISBN: 0195109384); Zhu et al, Yeast Hybrid Technologies. Eaton Publishing, (2000) (ISBN 1-881299-15-5); Fields et al, Trends Genet. 10(8):286-92 (1994); Mendelsohn et al, Curr. Opin. Biotechnol 5(5):482-6 (1994); Luban et al, Curr. Opin.
- proteins and protein fragments of the present invention can also usefully be fused to protein toxins, such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins of the present invention.
- protein toxins such as Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, ricin, or other biologically deleterious moieties in order to effect specific ablation of cells that bind or take up the proteins of the present invention.
- the isolated proteins, protein fragments, and protein fusions of the present invention can be composed of natural amino acids linked by native peptide bonds, or can contain any or all of nonnatural amino acid analogues, nonnative bonds, and post-synthetic (post translational) modifications, either throughout the length of the protein or localized to one or more portions thereof.
- nonnatural amino acid analogues e.g. , for epitope mapping
- post-synthetic (post translational) modifications either throughout the length of the protein or localized to one or more portions thereof.
- the range of such nonnatural analogues, nonnative inter- residue bonds, or post-synthesis modifications will be limited to those that permit binding of the peptide to antibodies.
- the range of such nonnatural analogues, nonnative inter-residue bonds, or post-synthesis modifications will be limited to those that do not interfere with the immunogenicity of the protein.
- the isolated protein is used as a therapeutic agent, such as a vaccine or for replacement therapy, the range of such changes will be limited to those that do not confer toxicity upon the isolated protein.
- Techniques for incorporating non-natural amino acids during solid phase chemical synthesis or by recombinant methods are well established in the art. Procedures are described, inter alia, in Chan et al. (eds.), Fmoc Solid Phase Peptide Synthesis: A Practical Approach (Practical Approach Series), Oxford Univ.
- D-enantiomers of natural amino acids can readily be incorporated during chemical peptide synthesis: peptides assembled from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers can also be used to confer specific three dimensional conformations on the peptide.
- amino acid analogues commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine, a non-hydrolyzable analog of phosphotyrosine (Kole et al, Biochem. Biophys. Res. Com. 209:817-821 (1995)), and various halogenated phenylalanine derivatives.
- Amino acid analogues having detectable labels are also usefully incorporated during synthesis to provide a labeled polypeptide.
- Biotin for example can be added using biotinoyl ⁇ (9-fluorenylmethoxycarbonyl)-L-lysine (FMOC biocytin) (Molecular Probes, Eugene, OR, USA). (Biotin can also be added enzymatically by incorporation into a fusion protein of a E.
- the FMOC and tBOC derivatives of dabcyl-L-lysine can be used to incorporate the dabcyl chromophore at selected sites in the peptide sequence during synthesis.
- the aminonaphthalene derivative EDANS the most common fluorophore for pairing with the dabcyl quencher in fluorescence resonance energy transfer (FRET) systems, can be introduced during automated synthesis of peptides by using EDANS-FMOC-L-glutamic acid or the corresponding tBOC derivative (both from Molecular Probes, Inc., Eugene, OR, USA).
- Tetramethylrhodamine fluorophores can be incorporated during automated FMOC synthesis of peptides using (FMOC)-TMR-L-lysine (Molecular Probes, Inc. Eugene, OR, USA).
- Non-natural residues can also be added biosynthetically by engineering a suppressor tRNA, typically one that recognizes the UAG stop codon, by chemical aminoacylation with the desired unnatural amino acid and. Conventional site-directed mutagenesis is used to introduce the chosen stop codon UAG at the site of interest in the protein gene.
- the isolated GP286 proteins, protein fragments and fusion proteins of the present invention can also include non-native inter-residue bonds, including bonds that lead to circular and branched forms.
- the isolated GP286 proteins and protein fragments of the present invention can also include post-translational and post-synthetic modifications, either throughout the length of the protein or localized to one or more portions thereof.
- the isolated proteins, fragments, and fusion proteins of the present invention when produced by recombinant expression in eukaryotic cells, will typically include N-linked and/or O-linked glycosylation, the pattern of which will reflect both the availability of glycosylation sites on the protein sequence and the identity of the host cell. Further modification of glycosylation pattern can be performed enzymatically.
- recombinant polypeptides of the invention may also include an initial modified methionine residue, in some cases resulting from host-mediated processes.
- post-synthetic modification can be performed before deprotection and cleavage from the resin or after deprotection and cleavage. Modification before deprotection and cleavage of the synthesized protein often allows greater control, e.g. by allowing targeting of the modifying moiety to the N-terminus of a resin-bound synthetic peptide.
- Useful post-synthetic (and post-translational) modifications include conjugation to detectable labels, such as fluorophores.
- Kits are available commercially that permit conjugation of proteins to a variety of amine-reactive or thiol-reactive fluorophores: Molecular Probes, Inc. (Eugene, OR, USA), e.g., offers kits for conjugating proteins to Alexa Fluor 350, Alexa Fluor 430, Fluorescein-EX, Alexa Fluor 488, Oregon Green 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, and Texas Red-X.
- Alexa Fluor® 350 Alexa Fluor® 488, Alexa Fluor® 532, Alexa
- Fluor® 546, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (monoclonal antibody labeling kits), BODEPY dyes, Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, rhodamine 6G, rhodamine green, rhodamine red, tetramethylrhodamine, Texas Red.
- the polypeptides of the present invention can also be conjugated to fluorophores, other proteins, and other macromolecules, using bifunctional linking reagents.
- Common homobifunctional reagents include, e.g., APG, AEDP, BASED, BMB, BMDB, BMH, BMOE, BM[PEO]3, BM[PEO]4, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP (Lomant's Reagent), DSS, DST, DTBP, DTME, DTSSP, EGS, HBVS, Sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS (all available from Pierce, Rockford, EL, USA); common heterobifunctional cross-linkers include ABH, AMAS, ANB-NOS, APDP, ASBA, BMP A, BMPH, BMPS, EDC, EMCA, EMCH, EMCS, KMUA, KMUH, GMBS, LC-SMCC, LC-SPDP, MBS, M2C2H, MPBH, MS
- the proteins, protein fragments, and protein fusions of the present invention can be conjugated, using such cross-linking reagents, to fluorophores that are not amine- or thiol-reactive.
- Other labels that usefully can be conjugated to the proteins, protein fragments, and fusion proteins of the present invention include radioactive labels, echosonographic contrast reagents, and MRI contrast agents.
- the proteins, protein fragments, and protein fusions of the present invention can also usefully be conjugated using cross-linking agents to carrier proteins, such as KLH, bovine thyroglobulin, and even bovine serum albumin (BSA), to increase immunogenicity for raising anti-GP286 antibodies.
- carrier proteins such as KLH, bovine thyroglobulin, and even bovine serum albumin (BSA)
- the GP286 proteins, protein fragments, and protein fusions of the present invention can also usefully be conjugated to polyethylene glycol (PEG); PEGylation increases the serum half life of proteins administered intravenously for replacement therapy. Delgado etal, Crit. Rev. Ther. Drug Carrier Syst. 9(3-4):249-304 (1992); Scott et al, Curr. Pharm. Des. 4(6):423-38 (1998); DeSantis et al, Curr. Opin. Biotechnol. 10(4):324-30 (1999), incorporated herein by reference in their entireties.
- PEG polyethylene glycol
- PEG monomers can be attached to the protein directly or through a linker, with PEGylation using PEG monomers activated with tresyl chloride (2,2,2-trifluoroethanesulphonyl chloride) permitting direct attachment under mild conditions.
- the isolated GP286 proteins of the present invention can be produced by recombinant expression, typically using the expression vectors of the present invention as above-described or, especially if fewer than about 100 amino acids, optionally by chemical synthesis (typically, solid phase synthesis), and, on occasion, by in vitro translation. Production of the isolated proteins of the present invention can optionally be followed by purification. Purification of recombinantly expressed proteins is now well within the skill in the art.
- purification tags have been fused through use of an expression vector that appends such tag
- purification can be effected, at least in part, by means appropriate to the tag, such as use of immobilized metal affinity chromatography for polyhistidine tags.
- Other techniques common in the art include ammonium sulfate fractionation, immuno-precipitation, fast protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC), and preparative gel electrophoresis.
- FPLC fast protein liquid chromatography
- HPLC high performance liquid chromatography
- Purification of chemically-synthesized peptides can readily be effected, e.g. , by HPLC. Accordingly, it is an aspect of the present invention to provide the isolated GP286 proteins of the present invention in pure or substantially pure form.
- a purified protein of the present invention is an isolated protein, as above described, that is present at a concentration of at least 95%, as measured on a mass basis (w/w) with respect to total protein in a composition. Such purities can often be obtained during chemical synthesis without further purification, as, e.g., by HPLC. Purified proteins of the present invention can be present at a concentration (measured on a mass basis with respect to total protein in a composition) of 96%, 97%), 98%, and even 99%. The proteins of the present invention can even be present at levels of 99.5%, 99.6%, and even 99.7%, 99.8%, or even 99.9% following purification, as by HPLC.
- isolated proteins of the present invention are used as therapeutic agents — such as vaccines, or for replacement therapy — the isolated proteins of the present invention are also useful at lower purity.
- partially purified proteins of the present invention can be used as immunogens to raise antibodies in laboratory animals.
- the present invention provides the isolated proteins of the present invention in substantially purified form.
- a "substantially purified protein” of the present invention is an isolated protein, as above described, present at a concentration of at least 70%, measured on a mass basis with respect to total protein in a composition.
- the substantially purified protein is present at a concentration, measured on a mass basis with respect to total protein in a composition, of at least 75%, 80%, or even at least 85%, 90%, 91°/o, 92%, 93%, 94%, 94.5% or even at least 94.9%.
- the purified and substantially purified proteins of the present invention are in compositions that lack detectable ampholytes, acrylamide monomers, bis-acrylamide monomers, and polyacrylamide.
- the GP286 proteins, fragments, and fusions of the present invention can usefully be attached to a substrate.
- the substrate can porous, substantially nonporous (such as plastic), or solid; planar or non-planar; the bond can be covalent or noncovalent.
- Porous substrates commonly membranes, typically comprise nitrocellulose, polyvinylidene fluoride (PVDF), or cationically derivatized, hydrophilic PVDF; so bound, the proteins, fragments, and fusions of the present invention can be used to detect and quantify antibodies, e.g. in serum, that bind specifically to the immobilized protein of the present invention.
- Proteins, fragments, and fusions of the present invention when bound to substantially nonporous substrates, such as plastics, may be used to detect and quantify antibodies, e.g. in serum, that bind specifically to the immobilized protein of the present invention.
- the proteins, fragments, and fusions of the present invention can also be attached to a substrate suitable for use as a surface enhanced laser desorption ionization source; so attached, the protein, fragment, or fusion of the present invention is useful for binding and then detecting secondary proteins that bind with sufficient affinity or avidity to the surface-bound protein to indicate biologic interaction therebetween.
- proteins, fragments, and fusions of the present invention can also be attached to a substrate suitable for use in surface plasmon resonance detection. So attached, the protein, fragment, or fusion of the present invention is useful for binding and then detecting secondary proteins that bind with sufficient affinity or avidity to the surface-bound protein to indicate significant biological interaction between the two.
- the invention provides antibodies, including fragments and derivatives thereof, that bind specifically to GP286 proteins and protein fragments of the invention, or that bind to one or more of the proteins and protein fragments encoded by the isolated GP286 nucleic acids of the invention.
- the antibodies can be specific for linear epitopes, discontinuous epitopes, or conformational epitopes of such proteins or protein fragments, either as present on the protein in its native conformation or, in some cases, as present on the proteins as denatured, as, e.g., by solubilization in SDS.
- the invention also provides antibodies, including fragments and derivatives thereof, the binding of which can be competitively inhibited by one or more of the GP286 proteins and protein fragments of the present invention, or by one or more of the proteins and protein fragments encoded by the isolated gp286 polynucleotides of the present invention.
- the invention provides antibodies, both polyclonal and monoclonal, and fragments and derivatives thereof, that bind specifically to a polypeptide having an amino acid sequence in SEQ ID NO:2, i.e., a full length gp286 protein.
- Such antibodies are useful in a variety of in vitro immunoassays, such as Western blotting and ELISA. Such antibodies are also useful in isolating and purifying GP286 proteins, including related cross-reactive proteins, by immuno- precipitation, immunoaffinity chromatography, or magnetic bead-mediated purification. Such methods are well-known in the art. Anti-GP286 antibodies are also useful for identifying T cells, marking and killing T cells and detectably labeling T cells (see above).
- the invention provides antibodies, both polyclonal and monoclonal, and fragments and derivatives thereof, the specific binding of which can be competitively inhibited by the isolated proteins and polypeptides of the present invention.
- the invention further provides the above- described antibodies detectably labeled, and in yet other embodiments, provides the above-described antibodies attached to a substrate.
- the term “antibody” refers to a polypeptide, at least a portion of which is encoded by at least one immunoglobulin gene, which can bind specifically to a first molecular species, and to fragments or derivatives thereof that remain capable of such specific binding.
- bind specifically and “specific binding” is here intended the ability of the antibody to bind to a first molecular species in preference to binding to other molecular species with which the antibody and first molecular species are admixed.
- An antibody is said specifically to "recognize” a first molecular species when it can bind specifically to that first molecular species.
- the degree to which an antibody can discriminate as among molecular species in a mixture will depend, in part, upon the conformational relatedness of the species in the mixture; typically, the antibodies of the present invention will discriminate over adventitious binding to non-GP286 proteins by at least two-fold, more typically by at least 5-fold, typically by more than 10-fold, 25-fold, 50-fold, 75-fold, and often by more than 100-fold, and on occasion by more than 500-fold or 1000-fold.
- the antibody of the present invention is sufficiently specific when it can be used to determine the presence of the protein of the present invention in samples derived from human pancreatic and neural tissues.
- the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) of the present invention for a GP286 protein or protein fragment of the present invention will be at least about 1 x 10 "6 molar (M), typically at least about 5 x 10 '7 M, usefully at least about 1 x 10 "7 M, with affinities and avidities of at least 1 x 10 -8 M, 5 x 10 "9 M, and 1 x 10 "10 M proving especially useful.
- the antibodies of the present invention can be naturally-occurring forms, such as IgG, IgM, IgD, IgE, and Ig from any mammalian species.
- Human antibodies can, but will infrequently, be drawn directly from human donors or human cells. In such case, antibodies to the proteins of the present invention will typically have resulted from fortuitous immunization, such as autoimmune immunization, with the protein or protein fragments of the present invention. Such antibodies will typically, but will not invariably, be polyclonal.
- Human antibodies are more frequently obtained using transgenic animals that express human immunoglobulin genes, which transgenic animals can be affirmatively immunized with a GP286 protein immunogen of the present invention.
- Human Ig-transgenic mice capable of producing human antibodies and methods of producing human antibodies therefrom upon specific immunization are well known in the art. See, e.g., in U.S. Patent Nos.
- Human antibodies are particularly useful, and often preferred, when the antibodies of the present invention are to be administered to human beings as in vivo diagnostic or therapeutic agents, since recipient immune response to the administered antibody will often be substantially less than that occasioned by administration of an antibody derived from another species, such as mouse.
- IgG, IgM, IgD, IgE and IgA antibodies of the present invention are also usefully obtained from other mammalian species, including rodents — typically mouse, but also rat, guinea pig, and hamster — lagomorphs, typically rabbits, and also larger mammals, such as sheep, goats, cows, and horses.
- transgenic human-antibody-producing non-human mammals fortuitous immunization is not required, and the non-human mammal is typically affirmatively immunized, according to standard immunization protocols, with the protein or protein fragment of the present invention.
- fragments of eight or more contiguous amino acids of the proteins of the present invention can be used effectively as immunogens when conjugated to a carrier, typically a protein such as bovine thyroglobulin, keyhole limpet hemocyanin, or bovine serum albumin, conveniently using a bifunctional linker such as those described elsewhere above, which discussion is inco ⁇ orated by reference here.
- a carrier typically a protein such as bovine thyroglobulin, keyhole limpet hemocyanin, or bovine serum albumin, conveniently using a bifunctional linker such as those described elsewhere above, which discussion is inco ⁇ orated by reference here.
- Immunogenicity can also be conferred by fusion of the proteins and protein fragments of the present invention to other moieties.
- Peptides of the present invention can, for example, be produced by solid phase synthesis on a branched polylysine core matrix; these multiple antigenic peptides (MAPs) provide high purity, increased avidity, accurate chemical definition and improved safety in vaccine development.
- MAPs multiple antigenic peptides
- Antibodies from nonhuman mammals can be polyclonal or monoclonal, with polyclonal antibodies having certain advantages in immuno- histochemical detection of the proteins of the present invention and monoclonal antibodies having advantages in identifying and distinguishing particular epitopes of the proteins of the present invention.
- the antibodies of the present invention can be produced using any art-accepted technique.
- Such techniques are well known in the art, Coligan et al (eds.), Current Protocols in Immunology. John Wiley & Sons, Inc. (2001) (ISBN: 0-471-52276-7); Zola, Monoclonal Antibodies : Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives (Basics: From Background to BenchV Springer Verlag (2000) (ISBN: 0387915907); Howard et al. (eds.), Basic Methods in Antibody Production and Characterization.
- Recombinant expression in host cells is particularly useful when fragments or derivatives of the antibodies of the present invention are desired.
- Host cells for recombinant antibody production either whole antibodies, antibody fragments, or antibody derivatives — can be prokaryotic or eukaryotic.
- Prokaryotic hosts are particularly useful for producing phage displayed antibodies of the present invention.
- the technology of phage-displayed antibodies, in which antibody variable region fragments are fused, for example, to the gene III protein (pin) or gene VIII protein (pVffl) for display on the surface of filamentous phage, such as M13, is by now well-established, Sidhu, Curr. Opin. Biotechnol. ll(6):610-6 (2000); Griffiths et al, Curr. Opin. Biotechnol.
- phage-displayed antibody fragments are scFv fragments or Fab fragments; when desired, full length antibodies can be produced by cloning the variable regions from the displaying phage into a complete antibody and expressing the full length antibody in a further prokaryotic or a eukaryotic host cell.
- Eukaryotic cells are also useful for expression of the antibodies, antibody fragments, and antibody derivatives of the present invention.
- antibody fragments of the present invention can be produced in Pichia pastoris, Takahashi et al, Biosci. Biotechnol Biochem. 64(10):2138-44 (2000); Freyre et al. , J. Biotechnol. 76(2-3): 157-63 (2000); Fischer et al , Biotechnol Appl
- Antibodies, including antibody fragments and derivatives, of the invention can also be produced in insect cells, Li et al, Protein Expr. Purif. 21(l):121-8 (2001); Ailor et al, Biotechnol Bioeng 58(2-3): 196-203 (1998); Hsu etal, Biotechnol Prog. 13(1):96-104 (1997); Edelman etal, Immunology 91(l):13-9 (1997); andNesbit et al, J. Immunol. Methods. 151(l-2):201-8 (1992), the disclosures of which are inco ⁇ orated herein by reference in their entireties.
- Antibodies and fragments and derivatives thereof of the present invention may also be produced in plant cells, Giddings et al, Nature Biotechnol. 18(11): 1151-5 (2000); Gavilondo et al, Biotechniques 29(1): 128-38 (2000); Fischer et al, J. Biol. Regul Homeost. Agents 14(2):83-92 (2000); Fischer et al, Biotechnol Appl. Biochem. 30 (Pt 2): 113-6 (1999); Fischer et al, Biol. Chem. 380(7-8):825-39 (1999); Russell, Curr. Top. Microbiol. Immunol.
- Mammalian cells useful for recombinant expression of antibodies, antibody fragments, and antibody derivatives of the present invention include CHO cells, COS cells, 293 cells, and myeloma cells. Verma et al, J. Immunol Methods 216(1-2): 165-81 (1998), review and compare bacterial, yeast, insect and mammalian expression systems for expression of antibodies. Antibodies of the present invention may also be prepared by cell free translation, as further described in Merk et al, J. Biochem. (Tokyo).
- the invention further provides antibody fragments that bind specifically to one or more of the GP286 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated gp286 polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
- the present invention thus provides antibody derivatives that bind specifically to one or more of the GP286 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated nucleic acids of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
- Such useful derivatives are chimeric, primatized, and humanized antibodies; such derivatives are less immunogenic in human beings, and thus more suitable for in vivo administration, than are unmodified antibodies from non-human mammalian species.
- Chimeric antibodies typically include heavy and/or light chain variable regions (including both CDR and framework residues) of immunoglobulins of one species, typically mouse, fused to constant regions of another species, typically human. See, e.g., U.S. Pat. No. 5,807,715; Morrison et al, Proc. Natl. Acad. Sci WS4.81(21):6851-5 (1984); Sharon et al, Nature 309(5966):364-7 (1984); Takeda et al, Nature 314(6010):452-4 (1985), the disclosures of which are incorporated herein by reference in their entireties.
- Primatized and humanized antibodies typically include heavy and/or light chain CDRs from a murine antibody grafted into a non-human primate or human antibody V region framework, usually further comprising a human constant region, Riechmann et al, Nature 332(6162):323-7 (1988); Co et al, Nature 351(6326):501-2 (1991); U.S. Pat. Nos. 6,054,297; 5,821,337; 5,770,196; 5,766,886; 5,821,123; 5,869,619; 6,180,377; 6,013,256; 5,693,761; and 6,180,370, the disclosures of which are incorporated herein by reference in their entireties.
- Other useful antibody derivatives of the invention include heteromeric antibody complexes and antibody fusions, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies.
- the antibodies of the present invention can usefully be labeled. It is, therefore, another aspect of the present invention to provide labeled antibodies that bind specifically to one or more of the proteins and protein fragments of the present invention, to one or more of the GP286 proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
- the label can usefully be an enzyme that catalyzes production and local deposition of a detectable product. Enzymes typically conjugated to antibodies to permit their immunohistochemical visualization are well known, and include alkaline phosphatase, ⁇ -galacto-sidase, glucose oxidase, horseradish peroxidase (HRP), and urease.
- the antibodies of the invention can also be labeled using colloidal gold. A multitude of typical substrates for production and deposition of visually detectable products, luminescent and fluorescent labels, are also well known and need not be further described.
- the antibodies of the present invention when used, e.g., for flow cytometric detection, for fluorescent activated cell sorting (FACS), for scanning laser cytometric detection, or for fluorescent immunoassay, they can usefully be labeled with fluorophores.
- fluorophores There are a wide variety of fluorophore labels that can usefully be attached to the antibodies of the present invention. Many are available, e.g., from Molecular Probes, Inc., Eugene, OR, USA.
- the antibodies of the present invention can usefully be labeled with biotin.
- the antibodies of the present invention When the antibodies of the present invention are used, e.g., for Western blotting applications, they can usefully be labeled with radioisotopes, such as 33 P, 32 P, 35 S, 3 H, and 125 I.
- the label when the antibodies of the present invention are used for radioimmunotherapy, the label can usefully be 228 Th, 227 Ac, 225 Ac, 223 Ra, 213 Bi, 212 Pb, 212 Bi, 211 At, 203 Pb, 194 Os, 188 Re, 186 Re, 153 Sm, 149 Tb, 13 T, 12 T, n ⁇ In, 105 Rh, 99m Tc, 97 Ru, 90 Y, 90 Sr, 88 Y, 72 Se, 67 Cu, or 47 Sc.
- Radiolabeled anti-GP286 antibodies may be used to specifically target and kill T cells in a patient in need thereof.
- the antibodies of the present invention when the antibodies of the present invention are to be used for in vivo
- MRI contrast agents such as gadolinium diethylenetriaminepentaacetic acid (DTP A), Lauffer et al, Radiology 207(2):529-38 (1998), or by radioisotopic labeling.
- DTP A gadolinium diethylenetriaminepentaacetic acid
- Lauffer et al Radiology 207(2):529-38 (1998)
- radioisotopic labeling As would be understood by the skilled artisan, use of any of the labels described above is not restricted to the application as for which they were mentioned.
- the antibodies of the present invention can also be conjugated to biologically deleterious moieties, such as toxins, in order to target the toxin's ablative action to cells that display and/or express the proteins of the present invention.
- toxin-conjugated anti-GP286 antibodies may be used to bind to and kill T cells in a patient in need thereof.
- the antibody in such immunotoxins is conjugated to Pseudomonas exotoxin A, diphtheria toxin, shiga toxin A, anthrax toxin lethal factor, or ricin.
- Pseudomonas exotoxin A diphtheria toxin
- shiga toxin A anthrax toxin lethal factor
- ricin a complex regional regulator
- the antibodies of the present invention can usefully be attached to a substrate.
- the invention thus provides antibodies that bind specifically to one or more of the GP286 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, attached to a substrate.
- Substrates can be porous or nonporous, planar or nonplanar.
- the antibodies of the present invention can usefully be conjugated to filtration media, such as NHS-activated Sepharose or CNBr-activated Sepharose for purposes of immunoaffinity chromatography.
- the antibodies of the present invention can also usefully be attached to paramagnetic microspheres, typically by biotin-streptavidin interaction, which microsphere can then be used for isolation of cells that express or display the proteins of the present invention.
- the antibodies of the present invention can usefully be attached to the surface of a microtiter plate for ELISA.
- the antibodies of the present invention can be produced in prokaryotic and eukaryotic cells.
- the invention thus also provides cells that express the antibodies of the present invention, including hybridoma cells, B cells, plasma cells, and host cells recombinantly modified to express the antibodies of the present invention.
- the present invention also provides aptamers evolved to bind specifically to one or more of the GP286 proteins and protein fragments of the present invention, to one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention, or the binding of which can be competitively inhibited by one or more of the proteins and protein fragments of the present invention or one or more of the proteins and protein fragments encoded by the isolated polynucleotides of the present invention.
- GP286 is a new member of the immunoglobulin (Ig) superfamily expressed on T cells. Expression in other tissues and organs is likely due to T cell infiltration of other tissues. GP286, an integral cell surface membrane protein, has one signature Ig domain in its extracellular portion, which is known in other family members to mediate cell-cell recognition and adhesion reactions. As a member of the Ig superfamily, GP286 is likely important for mediating cell-cell recognition, binding and adhesion functions in the immune system, particularly in T cells.
- Ig immunoglobulin
- compositions comprising nucleic acids, proteins, and antibodies of the present invention, as well as mimetics, agonists, antagonists, or modulators of GP286 activity, may be administered as pharmaceutical agents for the treatment (i.e., the amelioration of) of disorders, conditions or diseases associated with mis-expression of GP286 or to overcome abnormal expression or activities of other components which participate in GP286 related molecular and cellular recognition pathways.
- GP286 expression is expressed in T cells, it is anticipated that GP286 mis-expression may be associated with immune disorders or diseases, and/or with congenital defects in immune development or function.
- T-cell mediated diseases include, without limitation, transplantation disorders, autoimmune disease, cancer, multiple sclerosis, graft versus host disease and Kawasaki syndrome.
- autoimmune disease include rheumatoid arthritis, systemic lupus erythematosus, psoriasis, Sjogren's Syndrome, thyroiditis, Graves' disease, pulmonary fibrosis, bronchiolitis obliterans, hemolytic anemia and Wegener's granulomatosis.
- cancer include leukemia and lymphoma, including, without limitation, acute and chronic myelogenous leukemia and multiple myeloma.
- Other immune disorders include immunodeficiency, e.g., ADDS.
- GP286 modulators including GP286 antisense reagents, GP286 ligands and anti-GP286 antibodies, to treat individuals having or at risk of developing such diseases is an aspect of the invention.
- a composition of the invention typically contains from about 0.1 to 90% by weight (such as 1 to 20% or 1 to 10%) of a therapeutic agent of the invention in a pharmaceutically accepted carrier.
- Solid formulations of the compositions for oral administration can contain suitable carriers or excipients, such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium chloride, or alginic acid Disintegrators that can be used include, without limitation, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid.
- Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone(PovidoneTM), hydroxypropyl methylcellulose, sucrose, starch and ethylcellulose.
- Lubricants that can be used include magnesium stearates, stearic acid, silicone fluid, talc, waxes, oils, and colloidal silica.
- Liquid formulations of the compositions for oral administration prepared in water or other aqueous vehicles can contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone, and polyvinyl alcohol.
- the liquid formulations can also include solutions, emulsions, syrups and elixirs containing, together with the active compound(s), wetting agents, sweeteners, and coloring and flavoring agents.
- Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.
- Injectable formulations of the compositions can contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like).
- water soluble versions of the compounds can be administered by the drip method, whereby a pharmaceutical formulation containing the antifungal agent and a physiologically acceptable excipient is infused.
- Physiologically acceptable excipients can include, for example, 5%> dextrose, 0.9% saline, Ringer's solution or other suitable excipients.
- Intramuscular preparations e.g., a sterile formulation of a suitable soluble salt form of the compounds
- a pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5% glucose solution.
- a suitable insoluble form of the compound can be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, such as an ester of a long chain fatty acid (e.g., ethyl oleate).
- a topical semi-solid ointment formulation typically contains a concentration of the active ingredient from about 1 to 20%, e.g., 5 to 10%, in a carrier such as a pharmaceutical cream base.
- a carrier such as a pharmaceutical cream base.
- formulations for topical use include drops, tinctures, lotions, creams, solutions, and ointments containing the active ingredient and various supports and vehicles.
- the optimal percentage of the therapeutic agent in each pharmaceutical formulation varies according to the formulation itself and the therapeutic effect desired in the specific pathologies and correlated therapeutic regimens.
- Inhalation and transdermal formulations can also readily be prepared.
- Pharmaceutical formulation is a well-established art, and is further described in Gennaro (ed.), Remington: The Science and Practice of Pharmacy. 20 th ed., Lippincott, Williams & Wilkins (2000) (ISBN: 0683306472); Ansel et al, Pharmaceutical Dosage Forms and Drug Delivery Systems. 7 th ed., Lippincott Williams & Wilkins Publishers (1999) (ISBN: 0683305727); and Kibbe (ed.), Handbook of Pharmaceutical Excipients American Pharmaceutical Association, 3 rd ed. (2000) (ISBN: 091733096X), the disclosures of which are inco ⁇ orated herein by reference in their entireties. Conventional methods, known to those of ordinary skill in the art of medicine, can be used to administer the pharmaceutical formulation(s) to the patient.
- the pharmaceutical formulation will be administered to the patient by applying to the skin of the patient a transdermal patch containing the pharmaceutical formulation, and leaving the patch in contact with the patient's skin (generally for 1 to 5 hours per patch).
- Other transdermal routes of administration e.g., through use of a topically applied cream, ointment, or the like
- the pharmaceutical formulation(s) can also be administered via other conventional routes (e.g., enteral, subcutaneous, intrapulmonary, transmucosal, intraperitoneal, intrauterine, sublingual, intrathecal, or intramuscular routes) by using standard methods.
- the pharmaceutical formulations can be administered to the patient via injectable depot routes of administration such as by using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods.
- the therapeutic protein or antibody agent typically is administered at a daily dosage of 0.01 mg to 30 mg kg of body weight of the patient (e.g., lmg/kg to 5 mg/kg).
- the pharmaceutical formulation can be administered in multiple doses per day, if desired, to achieve the total desired daily dose.
- the effectiveness of the method of treatment can be assessed by monitoring the patient for known signs or symptoms of a disorder.
- the pharmaceutical compositions of the invention may be included in a container, package or dispenser alone or as part of a kit with labels and instructions for administration.
- the invention provides transgenic cells and non- human organisms comprising gp286 nucleic acids, and transgenic cells and non- human organisms with targeted disruption of the endogenous ortholog of the human gp286 gene.
- the cells can be embryonic stem cells or somatic cells.
- the transgenic non-human organisms can be chimeric, non-chimeric heterozygotes, and non- chimeric homozygotes.
- the gp286 may be splice variant gp286 or gp286a.
- Host cells of the invention may be used to produce non-human transgenic animals.
- a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which gp286 nucleotide sequences have been introduced.
- Such a host cell may be used to create non-human transgenic animals in which exogenous gp286 sequences have been introduced into their genome or used to alter or replace related endogenous gp286 sequences in the animal.
- transgenic animal is a non-human animal, preferably a mammal, more preferably a cow, goat, sheep or rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene.
- transgenic animals include non-human primates, dogs, chickens, amphibians, etc.
- transgenic animal is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and that remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
- a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous gp286 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
- the non-human transgenic animals of the invention will be useful for studying the function and/or activity of gp286 and for identifying and/or evaluating modulators of gp286 activity. They will also be useful in methods for producing a GP286 protein or polypeptides fragment, i.e., in which the protein is produced in the mammary gland of a non-human mammal.
- a transgenic animal of the invention can be created by introducing gp286-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
- a polynucleotide comprising human gp286 DNA sequences of SEQ TD NOT, SEQ ID NO: 13, or SEQ ID NO: 14 may be introduced as a transgene into the genome of a non-human animal.
- a non-human homolog of the human gp286 gene such as a mouse gp286 gene, isolated by hybridization to an isolated polynucleotide of the invention, may be used as a transgene.
- Heterologous transcription control sequence sequences, intronic sequences, polyadenylation signals and the like may also be operatively linked with the transgene to increase the efficiency or otherwise regulate the expression (e.g., in a developmental or tissue specific manner) the transgene in the recipient host animal.
- a transgenic founder animal can be identified based upon the presence of the gp286 transgene in its genome and/or expression of gp286 mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding gp286 can further be bred to other transgenic animals carrying other transgenes.
- a vector is prepared which contains at least a portion of a gp286 gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the gp286 gene.
- the gp286 gene can be a human gene (e.g., SEQ ID NOs:l, 13 or 14), but more preferably, is a non-human homolog of a human gp286 gene.
- a mouse homolog of the human gp286 gene of SEQ TD NOs: 1, 13 or 14 can be used to construct a homologous recombination vector suitable for altering an endogenous gp286 gene in the mouse genome.
- the vector is designed such that, upon homologous recombination, the endogenous gp286 gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).
- the vector can be designed such that, upon homologous recombination, the endogenous gp286 gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous GP286 protein).
- the altered portion of the gp286 gene is flanked at its 5' and 3' ends by additional nucleic acid of the gp286 gene to allow for homologous recombination to occur between the exogenous gp286 gene carried by the vector and an endogenous gp286 gene in an embryonic stem cell.
- the additional flanking gp286 nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene.
- several kilobases of flanking DNA are included in the vector. See e.g., Thomas et al. (1987) Cell 51:503 for an exemplary description of homologous recombination vectors.
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced g ⁇ 286 gene has homologously recombined with the endogenous gp286 gene are selected (see e.g., Li et al. (1992) Cell 69:915). The selected cells are then injected into a blastocyst of an animal
- a mouse to form aggregation chimeras.
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
- Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.
- Clones of the non-human transgenic animals described herein can also be produced according to the methods described, e.g., in Wilmut et al. (1997) Nature 385:810-813.
- a cell e.g., a somatic cell
- the quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
- the reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal.
- the offspring borne of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated.
- Regulated expression of transgenes in vivo may be accomplished using controllable recombination systems, such as the cre/loxP recombinase system (see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236) and the FLP recombinase system(O' Gorman et al. (1991) Science 251:1351-1355. If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Transgenic animals containing both elements of the system can be obtained, e.g., by mating two transgenic animals, each containing either the transgene encoding the selected protein or the transgene encoding a recombinase.
- a Antisense Many of the isolated polynucleotides of the invention are antisense polynucleotides that recognize and hybridize to gp286 polynucleotides. Full-length and fragment antisense polynucleotides are provided. Fragment antisense molecules of the invention include (i) those that specifically recognize and hybridize to gp286 RNA (as determined by sequence comparison of DNA encoding GP286 to DNA encoding other known molecules). Identification of sequences unique to GP286 encoding polynucleotides can be deduced through use of any publicly available sequence database, and/or through use of commercially available sequence comparison programs.
- Antisense polynucleotides are particularly relevant to regulating expression of GP286 by those cells expressing gp286 mRNA e g-, Tcells.
- Antisense oligonucleotides, or fragments of a nucleotide sequence set forth in SEQ ID NOs: 1, 13 or 14, or sequences complementary or homologous thereto, derived from the nucleotide sequences encoding GP286 are useful as diagnostic tools for probing gene expression in various tissues. For example, tissue can be probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiography techniques to investigate native expression of this enzyme or pathological conditions relating thereto.
- antisense nucleic acid molecules are provided that comprise a sequence complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides or an entire gp286 coding strand, or to only a portion thereof. Nucleic acid molecules encoding fragments, homologs, derivatives and analogs of a GP286 protein of SEQ ED NOs:2 or 15, antisense nucleic acids complementary to a GP286 nucleic acid sequence of SEQ ID
- Antisense nucleic acid molecules of the invention may be antisense to a "coding region" or non-coding regions of the coding strand of a nucleotide sequence encoding GP286.
- the term "coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., a protein coding region of human GP286 corresponds to the coding region SEQ ID NOsT or 14).
- Antisense oligonucleotides are preferably directed to a regulatory region of a nucleotide sequence of SEQ ED NOsT, 13 or 14, or mRNA corresponding thereto, including, but not limited to, the initiation codon, TATA box, enhancer sequences, and the like.
- the antisense nucleic acid molecule can be complementary to the entire coding or non-coding region of gp286, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of gp286 mRNA.
- the antisense oligonucleotide can be complementary to the region surrounding the translation start site of gp286 mRNA.
- An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
- Antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art.
- an antisense nucleic acid e.g., an antisense oligonucleotide
- an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
- the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
- the antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a GP286 protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation.
- Suppression of gp286 expression at either the transcriptional or translational level is useful to generate cellular or animal models for diseases/conditions characterized by aberrant gp286 expression.
- Suppression of gp286 expression is also useful to inhibit aberrant T cell adhesion to other cells or to extracellular matrices.
- the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix.
- Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention.
- the antisense oligonucleotides may be further modified by adding poly-L-lysine, transferrin, polylysine, or cholesterol moieties at their 5' end.
- antisense nucleic acid molecules of the invention includes direct injection at a tissue site.
- antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
- antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens.
- the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
- the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule.
- An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids Res 15: 6625-6641).
- the antisense nucleic acid molecule can also comprise a 2'-O-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res 15: 6131-6148) or a chimeric RNA -DNA analogue (Inoue et al. (1987) FEBS Lett 215: 327-330).
- an antisense nucleic acid of the invention is part of a gp286 specific ribozyme (or, as modified, a "nucleozyme”).
- Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- ribozymes (such as hammerhead, hai ⁇ in, Group I intron ribozymes, and the like) can be used to catalytically cleave gp286 mRNA transcripts to thereby inhibit translation of gp286 mRNA.
- a ribozyme having specificity for a gp286-encoding nucleic acid can be designed based upon the nucleotide sequence of a gp286 polynucleotide disclosed herein (SEQ ID NOsT, 13 or 14). See, e.g., U.S. Patent Nos. 5,116,742; 5,334,711; 5,652,094; and 6,204,027, incorporated herein by reference in their entireties.
- a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GP286-encoding mRNA.
- a GP286-encoding mRNA See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742.
- gp286 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., (1993) Science 261:1411-1418.
- Expression of the gp286 gene may be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gp286 (e.g., the gp286 promoter and/or enhancers) to form triple helical structures that prevent transcription of the gp286 gene in target cells.
- nucleotide sequences complementary to the regulatory region of the gp286 e.g., the gp286 promoter and/or enhancers
- both the sugar and the internucleoside linkage are replaced with novel groups, such as peptide nucleic acids (PNA).
- PNA peptide nucleic acids
- the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, in particular by repeating N-(2-aminoethyl) glycine units linked by amide bonds.
- Nucleobases are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone, typically by methylene carbonyl linkages.
- PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols as described in Hyrup et al., supra; and Perry-Q'Keefe et al., Proc. Natl. Acad. Sci. USA 93: 14670-675 (1996).
- PNAs of gp286 can be used in therapeutic and diagnostic applications.
- PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
- PNAs of gp286 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases; or as probes or primers for DNA sequence and hybridization (Hyrup et al., supra; and Perry-O'Keefe, supra).
- PNAs of gp286 can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
- PNA-DNA chimeras of gp286 can be generated that may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
- PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, supra).
- the synthesis of PNA-DNA chimeras can be performed as described in Hyrup., supra and Finn et al., Nuc. Acids Res. 24:3357-63 (1996).
- a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry, and modified nucleoside analogs, e.g., 5'-(4-methoxytrityl) amino-5'-deoxy-thymidine phosphoramidite, can be used between the PNA and the 5' end of DNA (Mag et al, Nuc. Acids Res. 17:5973-88 (1989)). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, supra). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment. See, Petersen et al, Bioorg. Med. Chem. Lett. 5:1119-11124 (1975).
- the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemaitre et al, Proc. Natl. Acad. Sci. USA 84:648-652 (1987); PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134).
- peptides e.g., for targeting host cell receptors in vivo
- agents facilitating transport across the cell membrane see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA 86:6553-6556 (1989); Lemaitre et al, Proc. Natl. Acad. Sci. USA
- oligonucleotides can be modified with hybridization triggered cleavage agents (See, e.g., Krol et al, BioTechniques 6:958-976 (1988)), or intercalating agents (See, e.g., Zon, Pharm. Res. 5: 539-549 (1988)).
- the oligonucleotide may be conjugated to another molecule, e.g., a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc.
- PNA chemistry and applications are reviewed, inter alia, in Ray et al, FASEB J.
- the isolated polynucleotides of the present invention can be used as nucleic acid probes to assess the levels of gp286 mRNA in tissues in which it is normally expressed (e.g., immune system tissues, particularly in T cells), and in tissues in which it is not normally expressed at significant levels, if such abnormal tissue mis-expression is suspected.
- tissues in which it is normally expressed e.g., immune system tissues, particularly in T cells
- tissues in which it is not normally expressed at significant levels if such abnormal tissue mis-expression is suspected.
- the present invention thus provides a method for detecting the presence of a gp286 polynucleotide in a biological sample (e.g., a cell extract, fluid or tissue sample derived from a patient) by contacting the sample with an isolated polynucleotide of the invention which is capable of specifically detecting by hybridization gp286 polynucleotide sequences.
- a biological sample e.g., a cell extract, fluid or tissue sample derived from a patient
- an isolated polynucleotide of the invention which is capable of specifically detecting by hybridization gp286 polynucleotide sequences.
- This method is useful, e.g., for determining whether a non-immune tissue has been infiltrated with T cells, which may be indicative of inflammation and/or disease.
- the method comprises the steps of contacting the sample with an the isolated nucleic acid under high stringency hybridization conditions and detecting hybridization of the isolated polynucleotide to a nucleic acid in the sample, wherein the occurrence of said hybridization indicates the presence of a gp286-encoding sequence in the sample.
- the present invention also provides a diagnostic assay for identifying the presence or absence of a genetic lesion or mutation characterized by at least one of: (i) aberrant modification or mutation of a gene encoding a GP286 protein; (ii) mis-regulation of a gene encoding a GP286 protein; and (iii) aberrant post- translational modification of a GP286 protein, wherein a wild-type form of the gene encodes a protein with a GP286 biological activity.
- the present invention further provides a method of identifying a homolog of a human gp286 gene, comprising the step of hybridizing a nucleic acid library with a nucleic acid probe comprising SEQ ID NOs: 1, 13 or 14, or a portion thereof having at least 17 nucleotides, under high stringency hybridization conditions; and determining whether the nucleic acid probe hybridizes to a nucleic acid sequence in the library. If the nucleic acid sequence in the library hybridizes under such selected conditions, it is a homolog of a human gp286 gene.
- Antibodies of the present invention can be used to assess the expression levels of GP286 proteins in tissues in which it is normally expressed (e.g., immune system tissues), and in tissues in which it is not normally expressed, if such abnormal tissue mis-expression is suspected.
- the present invention thus provides a method for detecting the presence of a GP286 protein or its activity in a biological sample (e.g., a cell extract, fluid or tissue sample derived from a patient) by contacting the sample with an agent capable of detecting an indicator of the presence of GP286 protein or its activity.
- the agent is an antibody specific for at least one epitope of GP286 protein.
- the antibody is specific for one or the other splice variant ⁇ GP286 or GP286a.
- the invention provides a method for determining whether a GP286 protein is present in a sample, comprising the step of contacting the sample with an antibody having at least one GP286 epitope and detecting specific binding of the antibody to ah antigen, which indicates the presence of a
- GP286 protein in the sample is useful for, e.g., determining whether a non-immune tissue has been infiltrated by T cells, which may be indicative of inflammation or other disease state.
- gp286 isolated polynucleotides, proteins and GP286 specific antibodies of the invention will be useful in methods for diagnosing a variety of disorders and disease conditions associated with aberrant gp286 expression.
- the invention thus provides a method for diagnosing a disease condition in a subject, comprising the steps of comparing the amount or activity of a GP286 protein in a tissue sample from the subject to the amount or activity of the GP286 polypeptide in a control sample (e.g., an equivalent one derived from a healthy subject), wherein a significant difference in the amount or activity of the GP286 polypeptide in the tissue sample relative to the amount or activity of the GP286 polypeptide in the control sample indicates that the subject has a disease condition.
- a control sample e.g., an equivalent one derived from a healthy subject
- the amount or activity of a GP286 protein in a tissue sample is assessed by competitive binding assays using a GP286 polypeptides or fragment of the invention, or by an immunoassay using a GP286 specific antibody of the invention.
- the method is used to diagnose a disease condition relating to the pancreas or to the nervous system.
- the methods comprise the step of comparing the amount of a gp286 mRNA in a test tissue sample from the subject to the amount of gp286 mRNA in a control sample, wherein a significant difference in the amount of the mRNA in the test sample relative to the amount in the control sample indicates that the subject has a disease condition.
- the amount of gp286 mRNA in a tissue sample is assessed by hybridization using an isolated gp286 polynucleotide or nucleic acid fragment of the invention.
- the method is used to diagnose a disease condition relating to the immune system, particularly to one involving T cells.
- a further aspect of the invention is a computer readable means for storing the gp286 nucleic acid and amino acid sequences of the instant invention.
- the invention provides a computer readable means for storing SEQ TD NOS: 1-33 as described herein, as the complete set of sequences or in any combination.
- the records of the computer readable means can be accessed for reading and display and for interface with a computer system for the application of programs allowing for the location of data upon a query for data meeting certain criteria, the comparison of sequences, the alignment or ordering of sequences meeting a set of criteria, and the like.
- the nucleic acid and amino acid sequences of the invention are particularly useful as components in databases useful for search analyses as well as in sequence analysis algorithms.
- nucleic acid sequences of the invention and “amino acid sequences of the invention” mean any detectable chemical or physical characteristic of a polynucleotide or polypeptide of the invention that is or may be reduced to or stored in a computer readable form. These include, without limitation, chromatographic scan data or peak data, photographic data or scan data therefrom, and mass spectrographic data.
- a computer readable medium may comprise one or more of the following: a nucleic acid sequence comprising a sequence of a nucleic acid sequence of the invention; an amino acid sequence comprising an amino acid sequence of the invention; a set of nucleic acid sequences wherein at least one of said sequences comprises the sequence of a nucleic acid sequence of the invention; a set of amino acid sequences wherein at least one of said sequences comprises the sequence of an amino acid sequence of the invention; a data set representing a nucleic acid sequence comprising the sequence of one or more nucleic acid sequences of the invention; a data set representing a nucleic acid sequence encoding an amino acid sequence comprising the sequence of an amino acid sequence of the invention; a set of nucleic acid sequences wherein at least one of said sequences comprises the sequence of a nucleic acid sequence of the invention; a set of amino acid sequences wherein at least one of said sequences comprises the sequence of an amino acid sequence of the invention; a set of amino acid sequences wherein at least one of
- the computer readable medium can be any composition of matter used to store information or data, including, for example, commercially available floppy disks, tapes, hard drives, compact disks, and video disks.
- the invention provides a diagnostic assay for identifying a homolog of a human gp286 gene, comprising the step of screening a nucleic acid database with a query sequence consisting of SEQ ID NOsT, 13 or 14, or a portion thereof having 300 or more nucleotides, wherein a nucleic acid sequence in said database that is at least 65%> but less than 100% identical to SEQ ED NOsT, 13 or 14, or said portion thereof, if found, is a homolog of a human gp286 gene.
- sequence analysis includes, for example, methods of sequence homology analysis, such as identity and similarity analysis, RNA structure analysis, sequence assembly, cladistic analysis, sequence motif analysis, open reading frame determination, nucleic acid base calling, and sequencing chromatogram peak analysis.
- a computer-based method for performing nucleic acid homology identification. This method comprises the steps of providing a nucleic acid sequence comprising the sequence of a nucleic acid of the invention in a computer readable medium; and comparing said nucleic acid sequence to at least one nucleic acid or amino acid sequence to identify homology.
- a computer-based method for performing amino acid homology identification, said method comprising the steps of: providing an amino acid sequence comprising the sequence of a polypeptide of the invention in a computer readable medium; and comparing said amino acid sequence to at least one nucleic acid or an amino acid sequence to identify homology.
- a computer based method is still further provided for assembly of overlapping nucleic acid sequences into a single nucleic acid sequence, said method comprising the steps of: providing a first nucleic acid sequence comprising the sequence of a nucleic acid of the invention in a computer readable medium; and screening for at least one overlapping region between said first nucleic acid sequence and a second nucleic acid sequence.
- RT-PCR and fragments were gel-purified prior to cloning.
- the fragments were separated by agarose gel electrophoresis by standard methods. DNA fragments were excised from the agarose gel and purified from the gel using QIAEX resin according to the manufacturer's specifications (Qiagen, Valencia, CA). The gel-purified fragments were cloned into plasmid vectors and then the plasmids were used to transform competent TOP 10 E. coli host cells. Plasmids produced by the host cells were isolated by a standard alkaline lysis miniprep procedure (Qiagen, Valencia, CA). Sequencing was executed by a standard dideoxy termination method (Applied Biosystems, Foster City, CA).
- Gene prediction programs were used to identify novel genes in high throughput genomic sequence data deposited in GenBank.
- High throughput genomic sequence data from GenBank were analyzed using the gene prediction programs GENSCAN (Burge and Karlin, 1997, J. Mol Biol. 268:78-94, incorporated herein by refe/ence in its entirety) and GENEMARKHMM (Lukashin and Borodovsky, 1998, Nuc. Acids Res. 26: 1107-1115, incorporated herein by reference in its entirety), the use of which is familiar to those skilled in the art.
- the GenBank data entries were downloaded to a local server, individual sequence contigs were separated according to the annotation provided with the sequence entries, and GENSCAN and GENEMARK were used to predict genes.
- the GENSCAN and GENEMARKHMM parameters used were the default parameters included with the programs (Burge and Karlin, 1997; Lukashin and Borodovsky, 1998). Those genes for which both gene prediction programs yielded similar results were further analyzed. Specifically, the gene sequences were translated to protein and the protein sequences were used as queries in BLAST analyses of the Genpept and Swissprot protein sequence databases.
- the BLAST algorithm which stands for Basic Local Alignment
- HSPs high scoring sequence pair
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension for the word hits in each direction are halted when: 1) the cumulative alignment score falls off by the quantity X from its maximum achieved value; 2) the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or 3) the end of either sequence is reached.
- the Blast algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
- BLAST Altschul et al, Proc. Natl. Acad. Sci. USA, 1993, 90, 5873-5787, which is incorporated herein by reference
- Gapped BLAST perform a statistical analysis of the similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- a nucleic acid is considered similar to a GP286 gene or cDNA if the smallest sum probability in comparison of the test nucleic acid to a GP286 nucleic acid is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- GP286 was identified in contig 49 of a B AC with the GenBank accession number AC008616, which was deposited on August 3, 1999.
- the genscan prediction for this gene was in the reverse orientation and included the following exons: exon 1 (initial exon), 53332 - 53287; exon 2, 49292 - 48933; exon 3, 45763 - 45722; exon 4, 45627 - 45514; exon 5 (terminal exon), 45368 - 45334.
- exon 1 initial exon
- exon 2 initial exon
- exon 3 45763 - 45722
- exon 4 terminal exon
- the full-length sequence was obtained by performing Rapid Amplification of cDNA Ends (RACE) using the Marathon-Ready RACE kit
- Marathon-Ready cDNA is a double stranded cDNA synthesized from human tissue mRNA and ligated to a standard set of adapters (Clontech, Palo Alto). All RACE reactions used the adapter primer AP-1, 5*-CCATCCTAATACGACTCACTATAGGGC-3' (SEQ ID NO: 11) provided with the kit. The 5' RACE for GP286 used AP-1 together with CR2-146,
- the thermal cycling conditions were as follows: 94°C for 1 minute, one cycle of 94°C for 15 seconds, 72°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 71°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 70°C for 15 seconds, 68°C for 15 seconds; one cycle of 94°C for 15 seconds, 69°C for 15 seconds, 68°C for 15 seconds; 35 cycles of 94°C for 15 seconds and 68°C for 30 seconds; and 68°C for 10 minutes.
- RT-PCR was used to confirm that the predicted gene was expressed and to initiate the cloning process that would determine the true (rather than the predicted) gene structure.
- 5' - CTTGCGATCCGGTTTCTGTTC - 3' were used as amplification primers on template multipe tissue cDNA panels (Clontech, Palo Alto) according to the manufacturer's specifications.
- the multiple tissue panels provided double-stranded human cDNA as templates for PCR, and included the following tissues: bone marrow, peripheral blood leukocytes, liver, lymph node, spleen, thymus, and tonsil.
- Thermal cycler conditions for the RT-PCR were: 94°C for 1 minute, followed by 35 cycles of 94°C for 15 seconds, 60°C for 15 seconds, 72°C for 15 seconds, followed by 2 minutes at 72°C.
- gp286 is detectable in a number of non-immune tissues, gp286 was much more highly expressed in immune tissues than non-immune tissues. It is believed that gp286 is observed in non-immune tissues due to the presence of infiltrating T cells in those tissues or organs.
- CR2-038 was used as a seed sequence to obtain the rest of the cDNA sequence for GP286.
- Rapid Amplification of cDNA Ends was used to determine the remainder of the cDNA sequence encoded by GP286.
- the primer was CR2-146 (5' - TGTTGCCCTCAGCCTCCTCCAACTCA - 3') (SEQ TD NO: 9) and the template was cDNA synthesized from human thymus tissue (see Example 3).
- the primer was CR2-148 (5' - ACCCCACACAGAACAGAAACCGGATCG - 3') (SEQ ED NO: 10) and the template was cDNA synthesized from human spleen tissue.
- the 5' RACE yielded a fragment of 450 base pairs. This fragment was gel purified, cloned, and sequenced (SEQ ID NO:4). The sequence of the fragment overlapped with the original PCR product and extended the cDNA sequence at the 5' end to the start codon and into * the 5' un-translated region (UTR). The 3' RACE product was 550 bp in length and extended through the stop codon and into the 3' UTR. This fragment was gel purified, cloned, and sequenced (SEQ TD NO: 5).
- a Northern blot was purchased from Clontech (Cat. No. 7790-1) which contained RNA from human cell lines of various origins, including: HL-60 (promyelocytic leukemia); HeLa (cervical adenocarcinoma) ; K-562 (chronic myelogenous leukemia); MOLT-4 (lymphoblastic leukemia); Raji (Burkitt's lymphoma); SW480 (colorectal adenocarcinoma) A549 (lung carcinoma); and G-361 (melanoma).
- the blot was probed with a 232 bp fragment of gp286 (SEQ ID NO:3).
- the probe was prepared from 50 ng of cDNA labeled by a random-primed method (Feinberg and Vogelstein, 1983, A method of labeling DNA restriction fragments to high specific activity. Anal Biochem. 132:6-13).
- Hybridization was carried out at 68°C for 1 hour in ExpressHybTM solution (Clontech, Cat. No. 8015-1) followed by washing with 2X SSC/0.05% SDS at room temperature and two washes with 0.1X SSC/0.1% SDS at 50°C.
- a band of approximately 1.35 kb is observed in the T cell derived cell line, MOLT-4.
- gp286a has three tyrosine residues in the cytoplasmic tail that are potential sites of protein phosphorylation. Phosphorylation is an important mode of signal transduction, and it is likely that gp286a acts as a receptor.
- the extracellular portion of the protein, with the Ig domain may receive a signal from an extracellular molecule and the signal is transmitted through the cytoplasmic domain to elicit a growth response in T cells.
- Subcloning of the gp286 genomic locus may be accomplished by PCR from a genomic library, or directly from genomic DNA. For example, two microliters of a human genomic library ( ⁇ 10 8 PFU/ml) (Clontech) are added to 6 ml of an overnight culture of K802 cells (Clontech), and then distributed as 250 ml aliquots into each of 24 microtubes. The microtubes are incubated at 37°C for 15 min. Seven milliliters of 0.8% agarose is added to each tube, mixed, then poured onto LB agar + 10 mM MgSO 4 plates and incubated overnight at 37°C.
- SM phage buffer 0.1 M NaCl, 8.1 mM MgSO 4 «7H 2 O, 50 mM Tris-Cl (pH 7.5), 0.01%) gelatin
- SM phage buffer 0.1 M NaCl, 8.1 mM MgSO 4 «7H 2 O, 50 mM Tris-Cl (pH 7.5), 0.01%) gelatin
- a drop of chloroform is added and the tube is placed in a 37°C shaker for 15 min, then centrifuged for 20 min at 4000 rpm (Sorvall RT6000 table top centrifuge) and the supernatant stored at 4°C as a stock solution.
- PCR may be then performed in 20 ml containing 8.8 ml H 2 O, 4 ml
- 5X RAPID-LOAD BUFFER (Origene), 2 ml 1 OX PCR BUFFER II (Perkin Elmer), 2 ml 25 mM MgCl 2 , 0.8 ml 10 mM dNTP, 0.12 ml of a primer comprising at least a portion of the sequence of the 5' end of the gp286 polynucleotide of SEQ ID NOT or SEQ ED NO: 14 (1 mg/ml), 0.12 ml of a primer comprising at least a portion of the sequence that is complementary to the 3' end of the gp286 polynucleotide of SEQ ID NOT (1 mg/ml), 0.2 ml AMPLITAQ GOLD polymerase (Perkin Elmer) and 2 ml of phage solution from each of the 24 tubes.
- the PCR reaction involves 1 cycle at 80°C for 20 min, 95°C for 10 min, then 22 cycles at 95°C for 30 sec, 72°C for 4 min decreasing TC each cycle, 68°C for 2 min, followed by 30 cycles at 95°C for 30 sec, 55°C for 30 sec, 68°C for 60 sec.
- the reaction is loaded onto a 2% agarose gel.
- the series of dilutions and subdividions of the plate is continued until a single plaque is isolated that gives a positive PCR band.
- 10 ml phage supernatant is added to 100 ml SM and 200 ml of K802 cells per plate with a total of 8 plates set up. The plates are incubated overnight at 37°C. Eight milliliters of SM is added to each plate, and the top agarose is scraped off with a microscope slide and collected in a centrifuge tube.
- the sequences for primers may be derived from the sequences given herein.
- PCR is performed in a 50 ⁇ l reaction containing 33 ⁇ l H 2 O, 5 ⁇ l 10X TT buffer (140 mM ammonium sulfate, 0.1 % gelatin, 0.6 M Tris-tricine pH 8.4), 5 ⁇ l 15 mM MgS0 4 , 2 ⁇ l 10 mM dNTP, 4 ⁇ l genomic phage DNA (0.1 ⁇ g/ml), 0.3 ⁇ l of a primer comprising at least a portion of the 5' most coding sequence of the gp286 polynucleotide of SEQ ED NOT (1 ⁇ g/ml), 0.3 ⁇ l of a primer comprising a sequence that is complementary to at least a portion of the 3' most coding sequence of the gp286 polynucleotide of SEQ ED NO: 1 (1 ⁇ g/ml), 0.4 ⁇ l HIGH FIDELITY Taq polyme
- the PCR product is loaded onto a 2% agarose gel
- the DNA band of expected size is excised from the gel, placed in GENELUTE AGAROSE spin column (Supelco) and spun for 10 min at maximum speed.
- the eluted DNA is ethanol-precipitated and resuspended in 12 ⁇ l H 2 O for ligation.
- the PCR primer sequences may be derived from the sequences provided herein.
- the ligation reaction uses solutions from the TOPO TA Cloning Kit (Invitrogen). The reaction proceeds in a solution containing 4 ⁇ l of PCR product and 1 ⁇ l of pCRII-TOPO vector at room temperature for 5 min. The reaction is terminated by the addition of 1 ⁇ l of 6X TOPO Cloning Stop Solution. The ligation product is then placed on ice. Two microliters of the ligation reaction is used to transform ONE-SHOT TOP10 cells (Invitrogen). Briefly, the ligation reaction is mixed with the cells and placed on ice for 30 min. The cells are then heat-shocked for 30 seconds at 42°C and placed on ice for two minutes. Next, 250 ⁇ l of SOC is added to the cells, which are incubated at 37°C with shaking for one hour and then plated onto ampicillin plates.
- Plasmid DNA is purified from the culture using the CONCERT RAPID PLASMID MINTPREP SYSTEM (GibcoBRL) and the insert of the plasmid DNA is then sequenced.
- the gp286 genomic phage DNA may be sequenced using the ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems), which uses the advanced capillary electrophoresis technology and the ABI PRISM BIGDYE Terminator Cycle Sequencing Ready Reaction Kit.
- the cycle-sequencing reaction may contain 14 ml of H 2 0, 16 ml of BIGDYE Terminator mix, 7 ml genomic phage DNA (0.1 mg/ml), and 3 ml primer (25 ng/ml).
- the reaction is performed in a Perkin-Elmer 9600 thermocycler at 95°C for 5 min, followed by 99 cycles of 95°C for 30 sec, 55°C for 20 sec, and 60°C for 4 min.
- the product is purified using a CENTRIFLEX gel filtration cartridge, dried under vacuum, and then dissolved in 16 ⁇ l of Template Suppression Reagent (PE Applied Biosystems). The samples are heated at 95°C for 5 min and then placed in the 310 Genetic Analyzer.
- Each cycle-sequencing reaction contains 6 ml of H 2 0, 8 ml of BIGDYE Terminator mix, 5 ml of miniprep DNA (0.1 mg/ml), and 1 ml of primer (25 ng/ml) and is performed in a Perkin-Elmer 9600 thermocycler with 25 cycles of 96°C for 10 sec, 50°C for 10 sec, and 60°C for 4 min.
- the product is purified using a CENTRIFLEX gel filtration cartridge, dried under vacuum, and then dissolved in 16 ⁇ l of Template Suppression Reagent. The samples are heated at 95°C for 5 min and then placed in the 310 Genetic Analyzer.
- Example 7 GP286 Expression in Tissue by Hybridization Analysis
- lymph nodes and/or spleen for example, rat tissue cryosections (20 ⁇ m thick) are prepared using a Reichert-Jung cryostat.
- blood samples may be prepared for in situ hybridization histochemistry by preparing blood smears, either with total blood or with lymphocyte, particularly T- lymphocyte, enriched fractions. Methods for preparing blood samples for in situ hybridization are well known in the art.
- Sections are thaw-mounted onto silanized, nuclease-free slides (CEL Associates, Inc., Houston, TX), and stored at -80°C. Sections are processed starting with post-fixation in cold 4% paraformaldehyde, rinsed in cold phosphate-buffered saline (PBS), acetylated using acetic anhydride in triethanolamine buffer, and dehydrated through a series of alcohol washes in 70%, 95%, and 100% alcohol at room temperature. Subsequently, sections are delipidated in chloroform, followed by rehydration through successive exposure to 100% and 95% alcohol at room temperature. Microscope slides containing processed cryosections are allowed to air dry prior to hybridization.
- PBS cold phosphate-buffered saline
- a gp286-specific probe may be generated using PCR and sequence information from SEQ ID NOT, SEQ ID NO: 13 or SEQ ID NO: 14. Following PCR amplification, the fragment is digested with restriction enzymes and cloned into pBluescript II cleaved with the same enzymes.
- a cloned gp286 fragment cloned in pBluescript II may be linearized with a suitable restriction enzyme, which provides a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase.
- a suitable restriction enzyme which provides a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase.
- a probe specific for the antisense strand of gp286 may also be readily prepared using the gp286 clone in pBluescript II by cleaving the recombinant plasmid with a suitable restriction enzyme to generate a linearized substrate for the production of labeled run-off cRNA transcripts using the T3 promoter and cognate polymerase. As discussed above, one may prepare splice variant-specific probes to determine expression of gp286 compared to gp286a in different cells and tissue types.
- the riboprobes may be labeled with [ 35 S]-UTP to yield a specific activity of about 0.40 x 10 6 cpm pmol for antisense riboprobes and about 0.65 x 10 6 cpm/pmol for sense-strand riboprobes.
- Each riboprobe may be subsequently denatured and added (2 pmol/ml) to hybridization buffer which contains 50% formamide, 10% dextran, 0.3 MNaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt' s Solution, and 10 mM dithiothreitol
- hybridization buffer which contains 50% formamide, 10% dextran, 0.3 MNaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt' s Solution, and 10 mM dithiothreitol
- Microscope slides containing sequential rat tissue cryosections, or blood smears may be independently exposed to 45 ⁇ l of hybridization solution per slide and silanized cover slips may be placed over the sections being exposed to hybridization solution. Sections are incubated overnight (e.g., 15-18 hours) at 52°C to allow hybridization to occur. Equivalent series of cryosections or blood s
- coverslips are washed off the slides in IX SSC, followed by RNase A treatment by exposing the slides to 20 ⁇ g ml RNase A in a buffer containing 10 mM Tris ⁇ Cl (pH 7.4), 0.5 M EDTA, and 0.5 M NaCl for 45 minutes at 37°C.
- the samples are then subjected to three high-stringency washes in 0.1 X SSC at 52°C for 20 minutes each.
- the samples are dehydrated by consecutive exposure to 70%, 95%, and 100% ammonium acetate in alcohol, followed by air drying and exposure to KODAK BIOMAX MR-1 film. After 13 days of exposure, the film is developed, and any significant hybridization signal is detected.
- Example 8 Northern Blot Analysis of gp286-RNA Northern blot hybridizations may be performed to examine the expression of gp286 mRNA.
- a clone containing at least a portion of the sequence of SEQ ED NO , SEQ ID NO: 14, or a complement thereto, may be used as a probe.
- Vector-specific primers are used in PCR to generate a hybridization probe fragment for 32 P -labeling. The PCR is performed as follows: (1) mix the following reagents:
- 1 ⁇ l lOmM dNTP e.g., Boehringer Mannheim catalogue no. 1 969 064
- 0.5 ⁇ l Taq polymerase such as Amersham Pharmacia Biotech catalogue no. 27-0799-62
- thermocylcer (2) perform PCR in a thermocylcer using the following program:
- the PCR product may be purified using QIAQUICK PCR Purification Kit (Qiagen catalogue no. 28104).
- the purified PCR fragment is labeled with 32 P-dCTP (Amersham Pharmacia Biotech catalogue no. AA0005/250) by random priming using "Ready-to-go DNA Labeling Beads" (Amersham Pharmacia Biotech cat. no. 27-9240-01).
- Hybridization is carried out on a human multi-tissue Northern blot from Clontech according to the manufacturer's protocol. After overnight exposure on a Molecular Dynamics PHOSPHOREVIAGER screen (cat. no. MD146-814), bands of about 1.35 kb are visualized.
- hybridization probe that detects both gp286 and gp286a mRNAs, or may use variant-specific hybridization probes that specifically hybridize to either gp286 or gp286a mRNAs.
- GP286 protein a GP286-encoding polynucleotide is expressed using recombinant techniques.
- the GP286-encoding sequence of SEQ ID NOs:2 or 15 is subcloned into the commercial expression vector pzeoSV2 (Invitrogen).
- the resultant expression construct is transfected into Chinese Hamster Ovary (CHO) cells using the transfection reagent FUGENE6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
- Other eukaryotic cell lines including human embryonic kidney (HEK 293) and COS cells, are suitable as well.
- GP286 Cells stably expressing GP286 are selected by growth in the presence of 100 ⁇ g/ml zeocin (Stratagene, LaJolla, CA).
- GP286 may be purified from the cells using standard chromatographic techniques.
- antisera are raised against one or more synthetic peptide sequences that correspond to portions of the GP286 amino acid sequence, and the antisera are used to affinity-purify GP286.
- the GP286 protein also may be expressed in-frame with a tag sequence (e.g., polyhistidine, haemagglutinin, or FLAG) to facilitate purification.
- tag sequence e.g., polyhistidine, haemagglutinin, or FLAG
- a plasmid bearing the relevant gp286 coding sequence is prepared, using vector pSecTag2A (Invitrogen).
- Vector pSecTag2A contains the murine IgK chain leader sequence for secretion, the c-myc epitope for detection of the recombinant protein with the anti-myc antibody, a C-terminal polyhistidine for purification with nickel chelate chromatography, and a Zeocin-resistant gene for selection of stable transfectants.
- the forward primer for amplification of this gp286 cDNA is determined by routine procedures and preferably contains a 5' extension of nucleotides to introduce the Hindlll cloning site and nucleotides matching the gp286 sequence.
- the reverse primer is also determined by routine procedures and preferably contains a 5' extension of nucleotides to introduce an Xhol restriction site for cloning and nucleotides corresponding to the reverse complement of the gp286 sequence.
- the PCR conditions are 55°C as the annealing temperature.
- the PCR product is gel purified and cloned into the Hindlll-Xhol sites of the vector.
- the DNA is purified using QIAGEN chromatography columns and transfected into 293 cells using the DOTAP transfection medium (Boehringer Mannheim). Transiently transfected cells are tested for expression at 24 hours after transfection, using Western blots probed with anti-His and anti-GP286 peptide antibodies.
- Permanently transfected cells are selected with Zeocin and propagated. Production of the recombinant protein is detected from both cells and media by Western blots probed with anti-His, anti-Myc or anti-GP286 peptide antibodies.
- a polynucleotide having a sequence of SEQ ED NOs: 1 or 14, or a polynucleotide encoding the amino acid sequence of SEQ ID NOs:2 or 15, for example can be cloned into vector p3-CI.
- This vector is a pUC18-derived plasmid that contains the HCMV (human cytomegalovirus) promoter-intron located upstream from the bGH (bovine growth hormone) polyadenylation sequence and a multiple cloning site.
- the plasmid contains the dhrf (dihydrofolate reductase) gene which provides selection in the presence of the drug methotrexane (MTX) for selection of stable transformants.
- HCMV human cytomegalovirus
- bGH bovine growth hormone
- the forward primer is determined by routine procedures and preferably contains a 5' extension which introduces an Xbal restriction site for cloning, followed by nucleotides which correspond to a nucleotide sequence of SEQ ED NOs: 1 or 14.
- the reverse primer is also determined by routine procedures and preferably contains 5'-extension of nucleotides which introduces a Sail cloning site followed by nucleotides which correspond to the reverse complement of a nucleotide sequence of SEQ ID NOs: 1 or 14.
- the PCR consists of an initial denaturation step of 5 min at 95°C; 30 cycles of 30 sec denaturation at 95°C, 30 sec annealing at 58°C and 30 sec extension at 72°C; and followed by 5 min extension at 72°C.
- the PCR product is gel purified and ligated into the Xbal and Sail sites of vector p3-CI. This construct is used to transform competent E. coli cells.
- the plasmid DNA is then purified from the E. coli culture with QIAGEN chromatography columns and transfected into COS7 cells using the LIPOFECTAMINE reagent from BRL in accordance with the manufacturer's specification. Forty-eight and 72 hours after transfection, the media and the cells are tested for recombinant protein expression.
- GP286 expressed from a COS cell culture can be purified by first concentrating the cell-growth media to about 10 mg protein/ml.
- the purification can be accomplished by, for example, chromatography.
- Purified GP286 is concentrated to 0.5 mg/ml in an AMICON concentrator fitted with a YM-10 membrane and stored at -80°C.
- GP286 in insect cells
- a polynucleotide having a sequence of SEQ ID NOsT or 14, or a polynucleotide encoding an amino acid sequence of SEQ ID NOs:2 or 15 is amplified by PCR.
- the forward primer is determined by routine procedures and preferably contains a 5' extension which adds the Ndel cloning site, followed by nucleotides which correspond to a nucleotide sequence of SEQ ED NOs: 1 or 14.
- the reverse primer is also determined by routine procedures and preferably contains a 5' extension which introduces the Kpnl cloning site, followed by nucleotides which correspond to the reverse complement of a nucleotide sequence of SEQ ID NOsT or 14.
- the PCR product is gel purified, digested with Ndel and Kpnl, and cloned into the corresponding sites of expression vector pAcHTL-A (Pharmingen, San Diego, CA).
- the pAcHTL vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV), and a 6XHis tag upstream from the multiple cloning site. Nucleic acid sequences encodmg a protein kinase site for phosphorylation and a thrombin site for excision of the recombinant protein precede the multiple cloning site.
- baculovirus vectors such as pAc373, pVL941 and pAcEVIl
- pAcHTL-A baculovirus vectors
- suitable vectors for the expression of GP286 polypeptides can be also used, provided that the vector construct includes appropriately located signals for transcription, translation, and trafficking, such as an in-frame AUG and a signal peptide, as required.
- Such vectors are described in, e.g., Luckow et al, Virology 170:31-39 (1989).
- the virus is grown and isolated using standard baculovirus expression methods, such as those described in Summers et al, A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
- pAcHLT-A containing the gp286 gene is introduced into baculovirus using the B ACULOGOLD transfection kit (Pharmingen).
- Individual virus isolates are analyzed for protein production by radiolabeling infected cells with 35 S-mefhionine at 24 hours post infection. Infected cells are harvested at 48 hours post infection, and the labeled proteins are visualized by SDS-PAGE. Viruses exhibiting high expression levels can be isolated and used for scaled up expression.
- a polynucleotide having the sequence of SEQ ID NO: 1 can be amplified by PCR using the methods described above for. baculovirus expression.
- the gp286 cDNA is cloned into vector pAcHLT-A (Pharmingen) for expression in Sf9 insect cells.
- the insert is cloned into the Ndel and Kpnl sites, after elimination of an internal Ndel site (using the same primers described above for expression in baculovirus).
- DNA is purified with QIAGEN chromatography columns and expressed in Sf9 cells. Preliminary Western blot experiments from non-purified plaques are tested for the presence of a recombinant protein of the expected size using a GP286-specific antibody. The results are confirmed after further purification and expression optimization in HiG5 cells.
- the interaction trap/two-hybrid library screening method can be used. This assay was first described in Fields et al, Nature 340:245 (1989). A protocol is published in Ausubel et al, SHORT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, NY (1999) and Ausubel, F. M. et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, fourth edition, Greene and Wiley-interscience, NY (1992). Kits are commercially available from, e.g., Clontech (MATCHMAKER Two-Hybrid System 3).
- a fusion of the nucleotide sequences encoding all or partial GP286 and the DNA-binding domain (DNA-BD) of yeast transcription factor GAL4 is constructed using an appropriate vector (i.e., pGBKT7). Preferably, fusions are produced for both GP286 and GP286a.
- a GAL4 active domain (AD) fusion library is constructed in a second plasmid (i.e., pGADT7) from cDNA of potential GP286-binding proteins.
- the DNA-BD/GP286 fusion construct is verified by sequencing, and tested for autonomous reporter gene activation and cell toxicity, both of which would prevent a successful two-hybrid analysis. Similar controls are performed with the AD/library fusion construct to ensure expression in host cells and lack of transcriptional activity.
- Yeast cells are transformed (ca. 105 transformants/mg of DNA) with both the GP286 and library fusion plasmids according to standard procedure (Ausubel, et al, supra). In vivo binding of DNA-BD/GP286 with AD/library proteins results in transcription of specific yeast plasmid reporter genes (i.e., lacZ, HIS3, ADE2, LEU2). Yeast cells are plated on nutrient-deficient media to screen for expression of reporter genes.
- Colonies are dually assayed for b-galactosidase activity upon growth in Xgal (5-bromo-4-chloro-3-indolyl-b-D- galactoside) supplemented media (filter assay for ⁇ -galactosidase activity is described in Breeden et al, Cold Spring Harb. Symp. Quant. Biol, 50:643 (1985).
- Positive AD-library plasmids are rescued from transformants and reintroduced into the original yeast strain as well as other strains containing unrelated DNA-BD fusion proteins to confirm specific GP286/library protein interactions. Insert DNA is sequenced to verify the presence of an open reading frame fused to GAL4 AD and to determine the identity of the GP286-binding protein.
- Standard techniques are employed to generate polyclonal or monoclonal antibodies to GP286, and to generate useful antigen-binding fragments thereof or variants thereof, including "humanized” variants and fully human antibodies.
- Such protocols can be found, for example, in Ausubel et al, 1992 and 1999, supra, Harlow et al. (Eds.), ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1990) and Harlow et al. (Eds.), ANTIBODIES, A LABORATORY MANUAL, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1999).
- recombinant GP286 polypeptides are used as antigen to generate the antibodies.
- one or more peptides having amino acid sequences corresponding to an immunogenic portion of GP286 are used as antigen.
- Peptides corresponding to extracellular portions of GP286, especially hydrophilic extracellular portions, are preferred.
- the antigen may be mixed with an adjuvant or linked to a hapten to increase antibody production.
- antibodies that are specific for the two splice variants, GP286 and GP286a are prepared by using splice-variant specific amino acid sequences, e.g., using those parts of the intracellular domains that have different amino acid sequences.
- recombinant GP286 or a synthetic fragment thereof is used to immunize a mouse to generate monoclonal antibodies, or to immunize a larger mammal, such as a rabbit, for polyclonal antibodies.
- the antibodies may be designed to be a "pan-specific" antibody that recognizes both splice variants, GP286 and GP286a, or may be an antibody that recognizes only one of the splice variants.
- peptides can be conjugated to keyhole limpet hemocyanin commercially available from ,e.g., Pierce.
- the antigen is emulsified with Freund's Complete Adjuvant and injected subcutaneously.
- GP286 antigen are emulsified with Freund's Incomplete Adjuvant and injected subcutaneously.
- a serum sample is taken from the immumzed mice and assayed by Western blot to confirm the presence of antibodies that immunoreact with GP286.
- Sera from the immunized animals may be used as polyclonal antisera or used to isolate polyclonal antibodies that recognize GP286.
- mice are sacrificed and their spleen removed for generation of monoclonal antibodies.
- the spleens are placed in 10 ml of serum-free RPMI 1640, and single cell suspensions are formed by grinding the spleens in serum-free RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 ⁇ g/ml streptomycin (RPMI) (Gibco, Canada).
- the cell suspensions are filtered and washed by centrifugation and resuspended in serum-free RPMI.
- Thymocytes taken from three naive Balb/c mice are prepared in a similar manner and used as a feeder layer.
- NS-1 myeloma cells kept in log phase in RPMI with 10%> fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, are centrifuged and washed as well.
- FBS fetal bovine serum
- spleen cells from the immunized mice are combined with NS-1 cells and centrifuged, and the supernatant is aspirated.
- the cell pellet is dislodged by tapping the tube, and 2 ml of 37°C PEG 1500 (50% in 75 mM HEPES, pH 8.0) is stirred into the pellet, followed by the addition of serum-free RPMI. Thereafter, the cells are centrifuged, resuspended in RPMI containing 15% FBS, 100 ⁇ M sodium hypoxanthine, 0.4 ⁇ M aminopterin, 16 ⁇ M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer-Mannheim) and 1.5 x 10 6 thymocytes/ml, and plated into 10 flat-bottom 96-well tissue culture plates.
- GP286-neutralizing antibodies comprise one class of therapeutics useful as GP286 antagonists.
- Humanized and fully human antibodies have improved serum half-life and are less immunogenic in humans.
- the principles of antibody humanization have been described in the literature. For instance, to minimize potential binding to complement, a humanized and fully human antibodies are preferred to be of the IgG 4 subtype.
- variable domains of anti-GP286 antibodies can be cloned from the genomic DNA of an appropriate B-cell hybridoma or from cDNA derived from the hybridoma.
- the V region gene fragments are linked to exons encoding human antibody constant domains.
- the resultant construct is expressed in suitable mammalian host cells (e.g., myeloma or CHO cells).
- variable region gene fragments that encode antigen-binding complementarity determining regions (CDRs) of the non-human monoclonal antibody are cloned into human antibody sequences.
- CDRs complementarity determining regions
- the ⁇ -sheet framework of the human antibody surrounding the CDR3 region is also modified (i.e., "back-mutated") to more closely mirror the three dimensional structure of the antigen-binding site of the original monoclonal antibody.
- back-mutated modified
- the surface of a non-human monoclonal antibody of interest is humanized by altering selected surface residues of the non-human antibody, e.g., by site-directed mutagenesis, while retaining all of the interior and contacting residues of the non-human antibody.
- Anti-GP286 antibodies can be also generated by phage display techniques such as those described in Aujame et al, Human Antibodies 8(4):155-168 (1997); Hoogenboom, TIBTECH 15:62-70 (1997); and Rader et al, Curr. Opin. Biotechnol 8:503-508 (1997).
- phage display techniques such as those described in Aujame et al, Human Antibodies 8(4):155-168 (1997); Hoogenboom, TIBTECH 15:62-70 (1997); and Rader et al, Curr. Opin. Biotechnol 8:503-508 (1997).
- antibody variable regions in the form of Fab fragments or linked single chain Fv fragments are fused to the amino terminus of filamentous phage minor coat protein pffl. Expression of the fusion protein and incorporation thereof into the mature phage coat results in phage particles that present an antibody on their surface and contain the genetic material encoding the antibody.
- Human GP286-specific antibodies are generated in transgenic mice essentially as described in Bruggemann et al, Immunol. Today 17(8):391-97 (1996) and Bruggemann et al, Curr. Opin. Biotechnol. 8:455-58 (1997).
- Transgenic mice carrying human V-gene segments in germline configuration and that express these transgenes in their lymphoid tissue are immunized with a GP286 composition using conventional immunization protocols.
- Hybridomas are generated using B cells from the immunized mice using conventional protocols and screened to identify hybridomas secreting anti-GP286 human antibodies (e.g., as described above).
- Example 12 Assays to Identify Modulators of GP286 Activity
- the assays may be performed on only one of the splice variants of GP286, but in preferred embodiments, the assays are performed in parallel on both splice variants of GP286 ⁇ GP286 and GP286a.
- the modulators that can be identified by these assays are natural ligands of the receptor; synthetic analogs and derivatives of the natural ligands; antibodies and/or antibody-like compounds derived from natural antibodies or from antibody-like combinatorial libraries; and/or synthetic compounds identified by high-throughput screening of libraries; and the like.
- All modulators that bind GP286 are useful for identifying GP286 in tissue samples (e.g., for diagnostic purposes or therapeutic pmposes).
- Agonist and antagonist modulators are useful for up-regulating and down-regulating GP286 activity, respectively, so as to treat GP286-mediated diseases.
- the assays may be performed using single putative modulators, and/or may be performed using a known agonist in combination with candidate antagonists (or visa versa).
- cAMP cyclic adenosine monophosphate
- a protocol for such an assay using an Adenylyl Cyclase Activation FLASHPLATE Assay from NEN Life Science Products, is set forth below. Briefly, a GP286-encoding sequence is subcloned into an expression vector, such as pzeoSV2 (Invitrogen). CHO cells are transiently transfected with the resultant expression construct using known methods, such as the transfection protocol provided by Boehringer-Mannheim when supplying the FUGENE 6 transfection reagent. Transfected CHO cells are seeded into 96-well microplates from the FLASHPLATE assay kit, which are coated with solid scintillant to which antisera to cAMP have been bound.
- an expression vector such as pzeoSV2 (Invitrogen).
- a control For a control, some wells are seeded with untransfected CHO cells. Other wells in the plate receive various amounts of a cAMP standard solution for use in creating a standard curve. One or more test compounds are added to the cells in each well, with compound-free medium or buffer as control. After treatment, cAMP is allowed to accumulate in the cells for exactly 15 minutes at room temperature. The assay is terminated by the addition of lysis buffer containing [ 125 I]-cAMP, and the plate is counted using a Packard TOPCOUNT 96-well microplate scintillation counter. Unlabeled cAMP from the lysed cells or from standards and fixed amounts of [ 125 I]-cAMP compete for antibody bound to the plate.
- a standard curve is constructed, and cAMP values for the unknowns are obtained by interpolation. Changes in intracellular cAMP levels of cells in response to exposure to a test compound are indicative of GP286 modulating activity. Modulators that act as agonists of receptors which couple to the Gs subtype of G proteins will stimulate production of cAMP, leading to a measurable (e.g., 3-10) fold increase in cAMP levels. Agonists of receptors which couple to the Gi/o subtype of G proteins will inhibit forskolin-stimulated cAMP production, leading to a measurable decrease (e.g., 50-100%) in cAMP levels. Modulators that act as inverse agonists will reverse these effects at receptors that are either constitutively active or activated by known agonists.
- cells e.g., CHO cells
- a gp286 expression construct e.g., CHO cells
- apoaquorin will emit a measurable luminescence that is proportional to the amount of cytoplasmic free calcium. See generally, Cobbold, et al "Aequorin measurements of cytoplasmic free calcium," In: McCormack J.G. and Cobbold P.H., eds., CELLULAR CALCIUM: A PRACTICAL APPROACH. Oxford:IRL Press (1991); Stables et al, Anal. Biochem. 252:115-26 (1997); and Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth edition, Eugene OR (1996).
- a gp286 coding sequence is subcloned into pzeoSV2 (Invitrogen).
- CHO cells are transiently co-transfected with the resultant expression construct and a construct that encodes the photoprotein apoaquorin (Molecular Probes) using the transfection reagent FUGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
- the cells are cultured for 24 hours at 37°C in MEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin. Then the culture medium is changed to serum-free MEM containing 5 ⁇ M coelenterazine (Molecular Probes). Culturing is continued for two more hours at 37°C. Subsequently, the cells are detached from the plate using VERSEN (Gibco/BRL), washed, and resuspended at 2X10 5 cells/ml in serum-free MEM.
- MEM Gibco/BRL, Gaithersburg, MD
- VERSEN Gibco/BRL
- Dilutions of candidate GP286 modulator compounds are prepared in serum-free MEM and dispensed into wells of an opaque 96-well assay plate at 50 ⁇ l/well. The plate is then loaded onto an MLX microtiter plate luminometer (Dynex Technologies, Inc., Chantilly, VA). The instrument is programmed to dispense 50 ⁇ l cell suspensions into each well, one well at a time, and immediately read luminescence for 15 seconds. Dose-response curves for the candidate modulators are constructed using the area under the curve for each light signal peak. Data are analyzed with SLEDEWRITE, using the equation for a one-site ligand, and EC50 values are obtained.
- Modulators that act as agonists at receptors which couple to the Gq subtype of G proteins give an increase in luminescence of up to 100 fold.
- Modulators that act as inverse agonists will reverse this effect at receptors that are either constitutively active or activated by known agonists.
- the photoprotein luciferase provides another useful tool for identifying GP286 modulators.
- Cells e.g., CHO cells or COS7 cells
- a reporter construct which includes a gene for the luciferase protein downstream from a transcription factor binding site, such as the cAMP -response element (CRE), AP-1, or NF-kappa B.
- CRE cAMP -response element
- AP-1 NF-kappa B.
- NF-kappa B NF-kappa B.
- Luciferase activity may be quantitatively measured using, e.g., luciferase assay reagents that are available from Promega (Madison, WI).
- CHO cells are plated in 24-well culture plates at a density of 10 5 cells/well one day prior to transfection, and cultured at 37°C in MEM (Gibco/BRL) supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
- Cells are transiently co-transfected with a gp286 expression construct and a reporter construct containing the luciferase gene.
- the reporter plasmid constructs CRE-luciferase, AP-1 -luciferase and NF-kappaB-luciferase may be purchased from Stratagene (LaJolla, CA). Transfections are performed using the FUGENE 6 transfection reagent (Boehringer-Mannheim) according to the supplier's instructions. Cells transfected with the reporter construct alone are used as a control.
- the cells are washed once with PBS pre- warmed to 37°C. Serum-free MEM is then added to the cells either alone (control) or with one or more candidate modulators. The cells are then incubated at 37°C for five hours. Thereafter, the cells are washed once with ice-cold PBS and lysed by the addition of 100 ⁇ l of lysis buffer per well from the luciferase assay kit supplied by Promega.
- Differences in luminescence in the presence versus the absence of a candidate modulator compound are indicative of modulatory activity.
- Receptors that are either constitutively active or activated by agonists typically give a 3 -fold to 20-fold stimulation of luminescence compared to cells transfected with the reporter gene alone. Modulators that act as inverse agonists will reverse this effect.
- Changes in intracellular calcium levels are another recognized indicator of receptor activity, and such assays can be employed to screen for modulators of GP286 activity.
- CHO cells stably transfected with a gp286 expression vector are plated at a density of 4X10 4 cells/well in Packard black-walled, 96-well plates specially designed to discriminate fluorescence signals emanating from the various wells on the plate.
- D-PBS modified Dulbecco's PBS
- fetal bovine serum containing 36 mg/L pyruvate and 1 g/L glucose
- FLUO-3 AM, FLUO-4 AM, CALCIUM GREEN- 1 AM, or OREGON GREEN 488 BAPTA-1 AM each at a concentration of 4 ⁇ M.
- Plates are washed once with modified D-PBS without 1% fetal bovine serum and incubated for 10 minutes at 37°C to remove residual dye from the cellular membrane.
- a series of washes with modified D-PBS without 1% fetal bovine serum is performed immediately prior to activation of the calcium response.
- a calcium response is initiated by the addition of one or more candidate receptor agonist compounds, calcium ionophore A23187 (10 ⁇ M; positive control), or ATP (4 ⁇ M; positive control). Fluorescence is measured by Molecular Device's FLIPR with an argon laser (excitation at 488 nm). See, e.g., Kuntzweiler et al., Drug Dev. Res. 44(l) 4-20 (1998). The F-stop for the detector camera is set at 2.5 and the length of exposure is 0.4 milliseconds. Basal fluorescence of cells is measured for 20 seconds prior to addition of a candidate agonist, ATP, or A23187. The basal fluorescence level is subtracted from the response signal.
- the calcium signal is measured for approximately 200 seconds, taking readings every two seconds.
- Calcium ionophore A23187 and ATP typically increase the calcium signal about 200% above baseline levels.
- activated GP286s increase the calcium signal at least about 10-15% above baseline signal.
- a mitogenesis assay the ability of candidate modulators to induce or inhibit gp286-mediated cell division is determined. See, e.g., Lajiness et al, J. Pharmacol, and Exp. Therap. 267(3): 1573-1581 (1993).
- CHO cells stably expressing GP286 are seeded into 96-well plates at a density of 5000 cells/well and grown at 37°C in MEM with 10% fetal calf serum for 48 hours, at which time the cells are rinsed twice with serum-free MEM.
- MEM MEM containing a known mitogen
- 20 ⁇ l MEM containing varying concentrations of one or more test compounds diluted in serum-free medium As controls, some wells on each plate receive serum-free medium alone, and some receive medium containing 10% fetal bovine serum. Untransfected cells or cells transfected with vector alone also may serve as controls.
- A B x [CI (D + C)] + G
- A is the percent of serum stimulation
- B is the maximal effect minus baseline
- C is the EC50
- D is the concentration of the compound
- G is the maximal effect.
- Parameters B, C and G are determined by Simplex optimization.
- Agonists that bind to the receptor are expected to increase [ 3 H]-thymidine inco ⁇ oration into cells, showing up to 80% of the response to serum. Antagonists that bind to the receptor will inhibit the stimulation seen with a known agonist by up to 100%.
- G protein-coupled receptors signal through intracellular G proteins whose activities involve GTP binding and hydrolysis to yield bound GDP.
- [ 35 S]GTPgS in the presence and absence of candidate modulators provides another assay for modulator activity. See, e.g., Kowal et al, Neuropharmacology 37:179-187 (1998).
- cells stably transfected with a gp286 expression vector are grown in 10 cm tissue culture dishes to subconfluence, rinsed once with 5 ml of ice-cold Ca 2+ Mg 2+ -free phosphate-buffered saline, and scraped into 5 ml of the same buffer.
- Cells are pelleted by centrifugation (500 x g, 5 minutes), resuspended in TEE buffer (25 mM Tris, pH 7.5 , 5 mM EDTA, 5 mM EGTA), and frozen in liquid nitrogen. After thawing, the cells are homogenized using a Dounce homogenizer (1 ml TEE per plate of cells), and centrifuged at 1,000 x g for 5 minutes to remove nuclei and unbroken cells.
- the homogenate supernatant is centrifuged at 20,000 x g for 20 minutes to isolate the membrane fraction, and the membrane pellet is washed once with TEE and resuspended in binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM MgC12, 1 mM EDTA).
- binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM MgC12, 1 mM EDTA).
- the resuspended membranes can be frozen in liquid nitrogen and stored at -70°C until use.
- MAP kinase activity in cells expressing GP286 provides another assay to identify modulators of GP286 activity. See, e.g., Lajiness et al, J. Pharmacol. Exp. Therap. 267(3): 1573-1581 (1993) and Boulton et al, Cell 65:663-675 (1991).
- CHO cells stably transfected with gp286 are seeded into 6-well plates at a density of 7X10 4 cells/well 48 hours prior to the assay.
- the cells are cultured at 37°C in MEM medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
- the cells are serum-starved for 1-2 hours prior to the addition of stimulants.
- the cells are treated with medium alone or medium containing either a candidate agonist or 200 nM Phorbol ester- myristoyl acetate (i.e., PMA, a positive control), and the cells are incubated at 37°C for various amounts of time.
- PMA Phorbol ester- myristoyl acetate
- the plates are placed on ice, the medium is aspirated, and the cells are rinsed with 1 ml of ice-cold PBS containing 1 mM
- cell lysis buffer (12.5 mM MOPS, pH 7.3, 12.5 mM glycerophosphate, 7.5 mMMgCL,, 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM dithiothreitol, 10 ⁇ g/ml leupeptin, 10 ⁇ g/ml aprotinin, 2 ⁇ g/ml pepstatin A, and 1 ⁇ M okadaic acid) is added to the cells.
- the cells are scraped from the plates and homogenized by 10 passages through a 23 3/4 G needle, and the cytosol fraction is prepared by centrifugation at 20,000 x g for 15 minutes.
- the filter squares are washed in 4 changes of 1% H 3 PO 4 , and the squares are subjected to liquid scintillation spectroscopy to quantitate bound label.
- Equivalent cytosolic extracts are incubated without MAPK substrate peptide, and the bound labels from these samples are subtracted from the matched samples with the substrate peptide. The cytosolic extract from each well is used as a separate point. Protein concentrations are determined by a dye binding protein assay (Bio-Rad Laboratories). Agonist activation of the receptor is expected to result in up to a five-fold increase in MAPK enzyme activity. This increase is blocked by antagonists.
- GP286s may also potentiate arachidonic acid release in cells, providing yet another useful assay for modulators of GP286 activity. See, e.g., Kanterman et al, Molecular Pharmacology 39:364-369 (1991).
- CHO cells that are stably transfected with a GP286 expression vector are plated in 24- well plates at a density of 1.5X10 4 cells/well and grown in MEM medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin for 48 hours at 37°C before use.
- Cells of each well are labeled by incubation with [ 3 H]-arachidonic acid (Amersham Co ⁇ ., 210 Ci/mmol) at 0.5 ⁇ Ci/ml in 1 ml MEM supplemented with 10 mM HEPES, pH 7.5, and 0.5%) fatty-acid-free bovine serum albumin for 2 hours at 37°C.
- the cells are then washed twice with 1 ml of the same buffer.
- Candidate compounds are added in 1 ml of the same buffer, either alone or with 10 ⁇ M ATP, and the cells are incubated at 37°C for 30 minutes. Buffer alone and mock-transfected cells are used as controls.
- CHO cells transfected with a GP286 expression vector are seeded into 12 mm capsule cups (Molecular Devices Corp.) at 4X10 5 cells/cup in MEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 10 U/ml penicillin, and 10 ⁇ g/ml streptomycin. The cells are incubated in this medium at 37°C in 5% CO2 for 24 hours.
- Extracellular acidification rates are measured using a CYTOSENSOR MICROPHYSIOMETER (Molecular Devices Corp.).
- the capsule cups are loaded into the sensor chambers of the MICROPHYSIOMETER and the chambers are perfused with running buffer (bicarbonate-free MEM supplemented with 4 mM L-glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl) at a flow rate of 100 ⁇ l/min.
- running buffer bicarbonate-free MEM supplemented with 4 mM L-glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl
- Candidate agonists or other agents are diluted into the running buffer and perfused through a second fluid path. During each 60-second pump cycle, the pump is run for 38 seconds and is off for the remaining 22 seconds.
- the pH of the running buffer in the sensor chamber is recorded during the cycle from 43-58 seconds, and the pump is re-started at 60 seconds to start the next cycle.
- the rate of acidification of the running buffer during the recording time is calculated by the Cytosoft program. Changes in the rate of acidification are calculated by subtracting the baseline value (the average of 4 rate measurements immediately before addition of a modulator candidate) from the highest rate measurement obtained after addition of a modulator candidate.
- the selected instrument detects 61 mV/pH unit. Modulators that act as agonists of the receptor result in an increase in the rate of extracellular acidification compared to the rate in the absence of agonist. This response is blocked by modulators which act as antagonists of the receptor.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Neurology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Neurosurgery (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Endocrinology (AREA)
- Pain & Pain Management (AREA)
- Transplantation (AREA)
- Hospice & Palliative Care (AREA)
- Communicable Diseases (AREA)
- Tropical Medicine & Parasitology (AREA)
- Psychiatry (AREA)
- Urology & Nephrology (AREA)
- AIDS & HIV (AREA)
- Dermatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US21363000P | 2000-06-23 | 2000-06-23 | |
| US213630P | 2000-06-23 | ||
| US28381301P | 2001-04-13 | 2001-04-13 | |
| US283813P | 2001-04-13 | ||
| PCT/US2001/020038 WO2002000727A2 (en) | 2000-06-23 | 2001-06-22 | Gp286 nucleic acids and polypeptides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1297137A2 true EP1297137A2 (de) | 2003-04-02 |
Family
ID=26908248
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01952197A Withdrawn EP1297137A2 (de) | 2000-06-23 | 2001-06-22 | Gp286 nuklein saüre und polypeptide |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1297137A2 (de) |
| JP (1) | JP2004501630A (de) |
| AU (2) | AU2001272982B2 (de) |
| CA (1) | CA2412610A1 (de) |
| NZ (1) | NZ523477A (de) |
| WO (1) | WO2002000727A2 (de) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2769822C (en) * | 2009-08-13 | 2019-02-19 | The Johns Hopkins University | Methods of modulating immune function |
| US20220154170A1 (en) * | 2019-03-01 | 2022-05-19 | Fred Hutchinson Cancer Research Center | Protein residue mapping using a combination of deep mutational scanning and phage display high throughput sequencing |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU5583799A (en) * | 1998-08-25 | 2000-03-14 | Human Genome Sciences, Inc. | 49 human secreted proteins |
| US6670464B1 (en) * | 1998-11-17 | 2003-12-30 | Curagen Corporation | Nucleic acids containing single nucleotide polymorphisms and methods of use thereof |
| AU1631000A (en) * | 1998-11-19 | 2000-06-05 | Incyte Pharmaceuticals, Inc. | Immunoglobulin superfamily proteins |
| AU2001251199A1 (en) * | 2000-04-06 | 2001-10-23 | Genetics Institute, Llc. | Polynucleotides encoding novel secreted proteins |
| AU6531101A (en) * | 2000-06-02 | 2001-12-17 | Genentech Inc | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
-
2001
- 2001-06-22 AU AU2001272982A patent/AU2001272982B2/en not_active Ceased
- 2001-06-22 JP JP2002505849A patent/JP2004501630A/ja active Pending
- 2001-06-22 NZ NZ523477A patent/NZ523477A/en unknown
- 2001-06-22 EP EP01952197A patent/EP1297137A2/de not_active Withdrawn
- 2001-06-22 CA CA002412610A patent/CA2412610A1/en not_active Abandoned
- 2001-06-22 AU AU7298201A patent/AU7298201A/xx active Pending
- 2001-06-22 WO PCT/US2001/020038 patent/WO2002000727A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0200727A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002000727A2 (en) | 2002-01-03 |
| JP2004501630A (ja) | 2004-01-22 |
| NZ523477A (en) | 2004-11-26 |
| CA2412610A1 (en) | 2002-01-03 |
| AU7298201A (en) | 2002-01-08 |
| WO2002000727A3 (en) | 2003-01-03 |
| AU2001272982B2 (en) | 2006-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20030211517A1 (en) | Gp354 nucleic acids and polypeptides | |
| US6383779B1 (en) | Glycoprotein VI and uses thereof | |
| EP0952983A2 (de) | An dendritischen zellen assoziierte c-typ lectine, dectin-1 und dectin-2, zusammensetzungen und deren verwendungen | |
| WO2000052022A1 (en) | Secreted proteins and nucleic acids encoding them | |
| AU2001270058B2 (en) | GP354 nucleic acids and polypeptides | |
| US20030165495A1 (en) | Nucleic acids and polypeptides | |
| EP1290028A2 (de) | Für ein homologes des humanen, für mehrfachresistenz verantwortlichen, p-glykoproteins auf chromosom 7p15-21 kodierendes gen sowie verwendungen dafür | |
| AU2001270058A1 (en) | GP354 nucleic acids and polypeptides | |
| AU2001270058A2 (en) | GP354 nucleic acids and polypeptides | |
| AU2001272982B2 (en) | GP286 nucleic acids and polypeptides | |
| AU2002322331B2 (en) | Pancam nucleic acids and polypeptides | |
| AU2001272982A1 (en) | GP286 nucleic acids and polypeptides | |
| WO2000052039A2 (en) | Lectomedin materials and methods | |
| AU2002322331A1 (en) | Pancam nucleic acids and polypeptides | |
| NZ530696A (en) | Pancam nucleic acids and polypeptides | |
| WO1999045111A1 (en) | Lectomedin materials and methods | |
| JP2002112784A (ja) | 抗リン脂質抗体症候群治療用t細胞レセプター可変領域 | |
| JP2002529053A (ja) | Ldl関連タンパク質およびその使用 | |
| WO2001055179A2 (en) | Nucleic acids encoding polypeptides with homology to olfactory receptors | |
| JP2003527108A (ja) | ポリペプチドおよびポリペプチドをコードする核酸 | |
| WO2002026818A2 (en) | Human nedd-1 | |
| GB2380478A (en) | Human RALGDS-like protein 3 | |
| JP2003325185A (ja) | Itimモチーフを持つ新規な免疫機能抑制分子 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030123 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: BIOGEN IDEC MA INC. |
|
| 17Q | First examination report despatched |
Effective date: 20061002 |
|
| 17Q | First examination report despatched |
Effective date: 20061002 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20090409 |