EP1294951A2 - Diagnosis of diseases associated with the immune system - Google Patents
Diagnosis of diseases associated with the immune systemInfo
- Publication number
- EP1294951A2 EP1294951A2 EP01967115A EP01967115A EP1294951A2 EP 1294951 A2 EP1294951 A2 EP 1294951A2 EP 01967115 A EP01967115 A EP 01967115A EP 01967115 A EP01967115 A EP 01967115A EP 1294951 A2 EP1294951 A2 EP 1294951A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- dna
- seq
- immune system
- genes
- sequences
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2523/00—Reactions characterised by treatment of reaction samples
- C12Q2523/10—Characterised by chemical treatment
- C12Q2523/125—Bisulfite(s)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to nucleic acids, oligonucleotides, PNA oligomers and a method for the diagnosis and / or therapy of diseases which are related to the genetic and / or epigenetic parameters of genes associated with the immune system and in particular their methylation status.
- the immune system recognizes microorganisms (bacteria, viruses, fungi) that have entered the body and makes them harmless.
- the so-called non-specific, humoral defense system is generally directed against invading pathogens and tries to kill them regardless of the type of pathogen and the triggering disease.
- the second system is the specific, cellular defense system. It works much more specifically against pathogens by forming antibodies according to the structure of the respective pathogen, with the help of which the disease is overcome. Certain pathogens are recognized when they reappear and eliminated more quickly; in some cases the organism is immune for life.
- Immune diseases do not only refer to diseases that are caused by pathogens and that a healthy immune system can usually successfully combat. In many chronic diseases such as rheumatism or asthma, a so-called immunodeficiency is significantly involved in the disease process. Last but not least, stress and other psychological stresses have a negative impact on the immune system. Diseases that are caused by incorrect or overreactions of an intact immune system are called allergies, such as. B. Asthma (Kuo ML, Huang JL, Yeh KW, Li PS, Hsieh KH. Evaluation of Thl / Th2 ratio and cytokine production profile during acute exacerbation and convalescence in asthmatic children. Ann Allergy Asthma Immunol.
- autoimmune diseases such as B. Artheriosklerose (Gordon PA, George J, Khamashta MA, Harats D, Hughes G, Shoenfeld Y. Atherosclerosis and autoimmunity. Lupus. 2001; 10 (4): 249-52), systemic lupus erythematosus (Lorenz HM , Herrmann M, Winkler T, Gaipl U, Kalden JR. Role of apoptosis in autoimmunity. Apoptosis.
- Type I Diabetes mellitus (Not T, Tommasini A, Tonini G, Buratti E , Pocecco M, Tortul C, Valussi M, Crichiutti G, Berti I, Trevisiol C, Azzoni E, Neri E, Torre G, Martelossi S, Soban M, Lenhardt A, Cattin L, Ventura A. Undiagnosed celiac disease and risk of autoimmune disorders in subjects with Type I diabetes mellitus. Dia- betologia. 2001 Feb; 44 (2): 151-5). Also between the immune system and cancers such as anemia (Bron D, Meuleman N, Mascaux C. Biological basis of anemia. Semin Oncol.
- pancreatic cancer Shiura T, Tsutsumi S , Hosouchi Y, Kojima T, Kon Y, Yonezu M, Kuwano H. Clinical significance of soluble form of HLA class I molecule in Japanese patients with pancreatic cancer. Hum Immunol. 2001 Jun; 62 (6): 615-9), chronic myeloid leukemia (Jahagirdar BN, Miller JS, Shet A, Versaillie CM. Novel therapies for chronic myelogenous leukemia. Exp Hematol. 2001 May; 29 (5): 543-56), acute lymphoblastic leukemia (Velders MP, ter Horst SA , KITA WM.
- Cancer cells show changed properties compared to normal body cells and often also form other proteins that play a crucial role in the recognition of 'self' and 'foreign' in the immune system. They are presented in the body to the T-killer cells, bound to MHC molecules on the outside of cells. The T-killer cells control whether the peptides come from normal proteins. If a peptide is not from a normal, When the body's own protein is cut out, the T cells initiate the destruction of the cell, which displays the modified or foreign peptide.
- Alzheimer's disease Smits HA, van Beelen AJ, de Vos NM, Rijsmus A, van der Bruggen T, Verhoef J, van Muiswinkel FL, Nottet HS.Activation of human macrophages by amyloid - beta is attenuated by astrocytes J Immunol. 2001 Jun l; 166 (ll): 6869-76), acquired immune deficiency syndrome (Aids) (McGrath KM, Hoffman NG, Resch W, Nelson JA, Swanstrom R. Using HIV-1 sequence variability to explore virus biology. Virus Res.
- progressive focal epilpsy Panomareva EN, Khmara ME, Nedz'ved 'MK, Drakina SA, Kolomiets AG, Protas II [The clinical characteristics of progressive focal epilepsy with a herpetic etiology].
- Lik Sprava. 2000 Jul-Aug; (5): 106-10 primarily sclerosing cholangitis 1: Bo X, Broome U, Remberger M, Sumitran-Holgersson S. Tumor necrosis factor alpha impairs function of liver derived T lymphocytes and natural killer cells in patients with primary sclerosing cholangitis. Good.
- Neurofibromatosis (Gerosa PL, Spinelli M, Giussani G, Vai C, Fontana A, Canepari C. Neurofibromatosis (NF1) and neuroleprosy: immunoreaction against pathologic Schwann-cells. Physiopathoge - netic observations.Minerva Med. 2001 A ⁇ r; 92 (2): 89-97).
- Treatment methods for immune diseases focus primarily on allergies, autoimmune diseases and the development of vaccines in order to have stronger immune responses against pathogenic organisms and cancer (Driver AM, Bazan JF, Papathanasiou P, Nelms KA, Goodnow CC. A genomic view of immunology. Narure. 2001 Feb 15; 409 (6822): 836-8).
- 5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. In addition, in the case of a PCR amplification, the epigenetic information which the 5-methylcytosines carry is completely lost.
- a relatively new and the most frequently used method for the investigation of DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, which is converted into uracil after alkaline hydrolysis, which corresponds to the thymidine in its base pairing behavior.
- 5-methylcytosine is not modified under these conditions.
- the original DNA is thus converted in such a way that methylcytosine, which originally cannot be distinguished from the cytosine by its hybridization behavior, can now be detected by "normal" molecular biological techniques as the only remaining cytosine, for example by amplification and hybridization or sequencing.
- the bisulfite technique has so far been used with a few exceptions (e.g. Zeschnigk M, Lieh C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5 (2): 94-8) used only in research. However, short, specific pieces of a known gene are always amplified after bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet.
- Genomic sequencing indicates a correlation between DNA hypomethylation in the 5 'region of the pS2 gene and its expression in human breast cancer cell lines. Genes. 1995 May 19; 157 (1-2): 261-4; WO 97/46705, WO 95/15373 and WO 97/45560.
- Fluorescence-labeled probes have been used in many cases for scanning an immobilized DNA array.
- the simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the respective probe is particularly suitable for fluorescent labels.
- the fluorescence of the hybridized probes is detected, for example, using a confocal microscope.
- the dyes Cy3 and Cy5, among many others, are commercially available.
- Matrix-assisted laser desorption / ionization mass spectrometry is one very powerful development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60 (20): 2299-301).
- An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse and the analyte molecule is thus transported unfragmented into the gas phase. The ionization of the analyte is achieved by collisions with matrix molecules.
- An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones.
- MALDI-TOF spectrometry is ideal for the analysis of peptides and proteins.
- the analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57).
- the sensitivity for nucleic acids is about 100 times worse than for peptides and decreases disproportionately with increasing fragment size. For nucleic acids that have a backbone that is often negatively charged, the ionization process through the matrix is much more inefficient.
- MALDI-TOF spectrometry the choice of the matrix plays an eminently important role.
- Genonic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
- the present invention is intended to provide oligonucleotides and / or PNA oligomers for the detection of cytosine methylations and a method which is particularly suitable for the diagnosis and / or therapy of genetic and epigenetic parameters of genes associated with the immune system.
- the invention is based on the finding that cytosine methylation patterns in particular are particularly suitable for the diagnosis and / or therapy of diseases associated with the immune system.
- the invention is based on the knowledge that genetic and epigenetic parameters and in particular the cytosine methylation pattern of genes associated with the immune system are particularly suitable for the diagnosis and / or therapy of diseases associated with the immune system.
- this object is achieved by a nucleic acid comprising an at least 18 base long sequence section of the chemically pretreated DNA of genes associated with the immune system according to one of the Seq. ID No.l to Seq. ID No.2420 and their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1 solved.
- the database numbers accession numbers
- GenBank was used as the underlying database, the Internet address of which is http://www.ncbi.nlm.nih.gov.
- the chemically modified nucleic acid has so far not been associated with the determination of genetic and epigenetic parameters.
- the object of the present invention is further achieved by an oligonucleotide or Oligomer for the detection of the cytosine methylation state in chemically pretreated DNA, comprising at least one base sequence with a length of at least 13 nucleotides dissolved, which is linked to a chemically pretreated DNA of genes associated with the immune system according to one of the Seq. ID No.l to Seq. ID No.2420 and hybridized to their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1.
- the oligomer probes according to the invention represent important and effective tools which make it possible to determine the genetic and epigenetic parameters of genes associated with the immune system.
- the base sequence of the oligomers preferably comprises at least one CpG dinucleotide.
- the probes can also be in the form of a PNA (Peptide Nucleic Acid), which has particularly preferred pairing properties.
- PNA Peptide Nucleic Acid
- Particularly preferred are oligonucleotides according to the invention, in which the cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5 'end of the 13 mer, in the case of PNA oligomers it is preferred that the cytosine of the CpG dinucleotide is the 4th - 6. Nucleotide from the 5 'end of the 9 mer.
- the oligomers according to the invention are normally used in so-called sets which contain one of the sequences of Seq for each of the CpG dinucleotides.
- ID No.l to Seq. ID No.2420 and to their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1 comprise at least one oligomer.
- a set is preferred which comprises at least one oligomer for each of the CpG dinucleotides from one of Seq ID No. 1 to Seq ID No.2420 and to their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1.
- the invention provides a set of at least two oligonucleotides which, as so-called primer oligonucleotides, for the amplification of DNA sequences of one of the Seq. ID No.l to Seq. ID No.2420 and their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1 or sections thereof can be used.
- At least one oligonucleotide is bound to a solid phase.
- the present invention further relates to a set of at least 10 n (Oligonucleotides and / or PNA oligomers), which are used to detect the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No. 1 to Seq. ID No.2420 and their complementary sequences and / or oligonucleotide and / or PNA -Oligomers according to Table 1) are used. With these probes the diagnosis and / or therapy of genetic and epigenetic parameters of genes associated with the immune system is possible.
- the set of oligomers can also be used to detect single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with the immune system according to one of the Seq. ID No.l to Seq. ID No.2420 and their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1 can be used.
- SNPs single nucleotide polymorphis
- an arrangement made of different oligonucleotides and / or PNA oligomers (a so-called "array") provided by the invention is also bound to a solid phase.
- This array of different oligonucleotide and / or PNA oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal grid.
- the solid phase surface preferably consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
- nitrocellulose and plastics such as nylon are also possible, which can be in the form of spheres or as resin matrices.
- the invention therefore furthermore relates to a method for producing an array fixed on a carrier material for analysis in connection with diseases associated with the immune system, in which at least one oligomer according to the invention is coupled to a solid phase.
- Methods for producing such arrays are known, for example, from US Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protective groups.
- the invention further relates to a DNA chip for analysis in connection with diseases associated with the immune system, which comprises at least one nucleic acid according to the present invention.
- DNA chips are known, for example, from US Pat. No. 5,837,832.
- the present invention also relates to a kit which, for example, consists of a reagent containing bisulfite, a set of primer oligonucleotides comprising at least two oligonucleotides, the sequences of which each have at least an 18 base pair section of the base sequences listed in the appendix (Seq. ID No.
- a kit in the sense of the invention can also contain only parts of the aforementioned components.
- the invention furthermore provides a method for determining genetic and / or epigenetic parameters of genes associated with the immune system by analyzing cytosine methylations and single nucleotide polymorphisms, which comprises the following steps:
- a genomic DNA sample is chemically treated in such a way that at the 5 'position unmethylated cytosine bases are converted into uracil, thymine or another base which is unlike cytosine in terms of hybridization behavior. This is understood below as chemical pretreatment.
- the genomic DNA to be analyzed is preferably obtained from the usual sources for DNA, such as cells or cell components, for example cell lines, biopsins, blood, sputum, stool, urine, brain-spinal fluid, tissue embedded in paraffin, for example tissue from eyes, Gut, kidney, brain, heart, prostate, lung, chest or liver, histological slides or combinations thereof.
- sources for DNA such as cells or cell components, for example cell lines, biopsins, blood, sputum, stool, urine, brain-spinal fluid, tissue embedded in paraffin, for example tissue from eyes, Gut, kidney, brain, heart, prostate, lung, chest or liver, histological slides or combinations thereof.
- the treatment of genomic DNA with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which leads to a conversion of unmethylated cytosine nucleobases into uracil or another base which is unlike the cytosine in base pairing behavior, is preferably used for this purpose.
- Fragments are made from this chemically pretreated genomic DNA using sets of primer oligonucleotides according to the invention and one preferably heat-stable polymerase amplified. For statistical and practical considerations, more than ten different fragments that are 100-2000 base pairs long are preferably amplified.
- the amplification of several DNA sections can be carried out simultaneously in one and the same reaction vessel. The amplification is usually carried out by means of the polymerase chain reaction (PCR).
- the set of primer oligonucleotides comprises at least two oligonucleotides, the sequences of which are each reversely complementary or identical to a section of at least 18 base pairs in length in the appendix (Seq. ID No. 1 to Seq. ID No.2420 and their complementary ones Sequences and / or oligonucleotide and / or PNA oligomers are base sequences listed in Table 1).
- the primer oligonucleotides are preferably characterized in that they contain no CpG dinucleotide.
- At least one primer oligonucleotide is bound to a solid phase during the amplification.
- the different oligonucleotides and / or PNA oligomer sequences can be arranged on a flat solid phase in the form of a rectangular or hexagonal grid, the solid phase surface preferably consisting of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold, other materials such as nitrocellulose or plastics can also be used.
- the fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Markings in the form of fluorescent markings, radionuclides or detachable molecular fragments with typical mass, which can be detected in a mass spectrometer, are preferred, it being preferred that the fragments produced have a single positive or negative net charge for better detectability in the mass spectrometer.
- the detection can be carried out and visualized using matrix assisted laser desorption / ionization mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI).
- the amplificates obtained in the second process step are then added to a sentence of oligonucleotides and / or PNA probes which hybridize or to an array.
- the hybridization is carried out in the manner given below.
- the set used in the hybridization preferably consists of at least 10 oligonucleotide or PNA oligomer probes.
- the amplificates serve as probes that hybridize to oligonucleotides previously bound to a solid phase. The non-hybridized fragments are then removed.
- Said oligonucleotides comprise at least one base sequence with a length of 13 nucleotides, which is reverse complementary or identical to a section of the base sequences listed in the appendix, which contains at least one CpG dinucleotide.
- the cytosine of the CpG dinucleotide is the 5th to 9th nucleotide viewed from the 5 'end of the 13 mer.
- Said PNA oligomers comprise at least one base sequence with a length of 9 nucleotides, which is reverse complementary or identical to a section of the base sequences listed in the appendix, which contains at least one CpG dinucleotide.
- the cytosine of the CpG dinucleotide is the 4th to 6th nucleotide as seen from the 5 'end of the 9 mer.
- the non-hybridized amplificates are removed.
- the hybridized amplificates are detected. It is preferred that labels attached to the amplificates can be identified at any position on the solid phase at which an oligonucleotide sequence is located.
- the labels of the amplified products are fluorescent labels, radionuclides or detachable molecular fragments with a typical mass, which can be detected in a mass spectrometer.
- the detection of the amplified products, fragments of the amplified products or probes complementary to the amplified products in the mass spectrometer is preferred, the detection using matrix assisted laser desorption / ionization mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI) can be carried out and visualized.
- MALDI matrix assisted laser desorption / ionization mass spectrometry
- ESI electrospray mass spectrometry
- the fragments generated can have a single positive or negative net charge for better detectability in the mass spectrometer.
- the oligomers or arrays thereof according to the invention and a kit according to the invention are to be used for the diagnosis and / or therapy of diseases associated with the immune system by analyzing methylation patterns of genes associated with the immune system. According to the invention, the use of the method for diagnosis and / or therapy of important genetic and / or epigenetic parameters within genes associated with the immune system is preferred.
- the method according to the invention is used, for example, to diagnose and / or treat eye diseases, proliferative retinopathy, neovascular glaucoma, solid tumors, tissue inflammation, rheumatic arthritis, diabetic retinopathy, macular degeneration due to neovascularization, psoriasis, artheriosclerosis, inflammatory bowel disease, intestinal disorders, ulcerative bowel disease and cancer.
- nucleic acids of Seq. ID No.l to Seq. ID No.2420 and their complementary sequences and / or oligonucleotide and / or PNA oligomers according to Table 1 can be used for the diagnosis and / or therapy of genetic and / or epigenetic parameters of genes associated with the immune system.
- the present invention further relates to a method for producing a diagnostic and / or therapeutic for the diagnosis and / or therapy of diseases associated with the immune system by analyzing methylation patterns of genes associated with the immune system, the diagnostic and / or therapeutic being characterized in that at least one nucleic acid, according to the present invention, optionally used together with suitable additives and auxiliaries for its production.
- the present invention further relates to a diagnostic and / or therapeutic agent for diseases associated with the immune system by analyzing methylation patterns of genes associated with the immune system, which comprises at least one nucleic acid according to the invention, optionally together with suitable additives and auxiliaries.
- the present invention further relates to the diagnosis and / or prognosis of adverse events for patients or individuals, in which the significant genetic and / or epigenetic parameters obtained by the invention are compared within genes associated with the immune system with another set of genetic and / or epigenetic parameters and the differences thus obtained serve as the basis for a diagnosis and / or prognosis of adverse events for patients or individuals.
- hybridization in the sense of the present invention is to be understood as binding to form a duplex structure of an oligonucleotide to a completely complementary sequence in the sense of the Watson-Crick base pairings in the sample DNA.
- Stringent hybridization conditions are to be understood as those conditions in which hybridization takes place at 60 ° C. in 2.5 ⁇ SSC buffer, followed by several washing steps at 37 ° C. in a lower buffer concentration and remains stable.
- the term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, which hybridize with the reference sequence under stringent conditions and which have an activity similar to the corresponding polypeptide according to the invention.
- Genetic parameters in the sense of this invention are mutations and polymorphisms of genes associated with the immune system and sequences that are still required for its regulation.
- insertions, deletions, point mutations, inversions and polymorphisms and particularly preferably SNPs (single nucleotide polymorphisms) are to be referred to as mutations.
- Polymorphisms can also be insertions, deletions or inversions.
- Epigenetic parameters in the sense of this invention are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with the immune system and sequences further necessary for their regulation. Further epigenetic parameters are, for example, the acetylation of histones, which, however, cannot be analyzed directly with the method described, but again correlated with DNA methylation.
- Sequences with odd sequence numbers each show different sequences of the chemically pretreated genomic DNAs from genes associated with the immune system.
- Sequences with even sequence numbers eg Seq. ID No. 2, 4, 6, ...) each show the sequences that are complementary to the different sequences (eg the sequence that is complementary to Seq. ID No. 1 is Seq. ID No.2 , to Seq. ID No.3 the complementary sequence Seq. ID No.4 etc.) of the chemically pretreated genomic DNAs of genes associated with the immune system.
- Seq ID No. 2421 to Seq ID No. 2424 show sequences of oligonucleotides contained in the
- Example 1 Performance of the methylation analysis in the gene associated with the immune system ESR1 (estrogen receptor)
- the following example relates to a fragment of the ESR1 gene in which a specific CG position is to be examined for methylation.
- a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a way that all of the cytosines that are not methylated at the 5-position of the base are changed in such a way that a base which is different with regard to the base pairing behavior is formed, while the base in the 5-position methylated cytosines remain unchanged.
- bisulfite is used in the concentration range for the reaction, an addition takes place on the unmethylated cytosine bases.
- a denaturing reagent or solvent and a radical scavenger must be present. Subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases into uracil.
- This converted DNA is used to detect methylated cytosines. Diluted in the second process step the treated DNA sample with water or an aqueous solution. Desulfonation of the DNA is then preferably carried out.
- the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase.
- cytosines of the ESR1 gene are examined.
- the specific primer oligonucleotides AGGGGGAATTAAATAGAAAGAG SEQ ID NO: 2421
- CAATAAAACCATCCCAAATACT (SEQ ID NO: 2422) amplified a defined fragment with a length of 662 bp.
- This amplificate serves as a sample which hybridizes to an oligonucleotide previously bound to a solid phase to form a duplex structure, for example TTTAATTTCGGGTTGTGT (SEQ ID NO: 2423) for detection of a methylated state and TTTAATTTTGGGTTGTGT (SEQ ID NO: 2424) for detection of not -methylated state, where the cytosine to be detected is at position 527 of the amplificate.
- the detection of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification.
- a hybridization reaction of the amplified DNA with the oligonucleotide occurs only if a methylated cytosine was present at this point in the bisulfite-treated DNA.
- the methylation status of the respective cytosine to be examined thus decides on the hybridization product.
- FIG. 1 a non-methylated status is shown for the oligomers in Figure A and a partially methylated status for the oligomers in Figure B.
- methylation pattern In order to relate the methylation pattern to one of the diseases associated with the immune system, it is first necessary to examine the DNA methylation pattern of a group of sick and a group of healthy patients. These tests are carried out, for example, analogously to Example 1. The results thus obtained are stored in a database and the CpG dinucleotides, which are methylated differently between the two groups, by z. B. identified probes. Simultaneous analysis of the entire methylation status is also possible, and the patterns can e.g. by means of clustering analyzes, e.g. can be carried out by a computer.
- Example 2 can be carried out, for example, for the following diseases: asthma, atherosclerosis, anemia, pancreatic carcinoma, acute myeloid leukemia, Alzheimer's disease, AIDS, epilepsy, neurofibromatosis.
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE20121966U DE20121966U1 (en) | 2000-06-30 | 2001-07-02 | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE10032529A DE10032529A1 (en) | 2000-06-30 | 2000-06-30 | Diagnosis of major genetic parameters within the Major Histocompatibility Complex (MHC) |
DE10032529 | 2000-06-30 | ||
DE10043826 | 2000-09-01 | ||
DE10043826 | 2000-09-01 | ||
PCT/EP2001/007537 WO2002000928A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with the immune system by determining cytosine methylation |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1294951A2 true EP1294951A2 (en) | 2003-03-26 |
Family
ID=26006285
Family Applications (9)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01953995A Withdrawn EP1294947A2 (en) | 2000-06-30 | 2001-06-29 | Method and nucleic acids for pharmacogenomic methylation analysis |
EP01969326A Withdrawn EP1297185A2 (en) | 2000-06-30 | 2001-06-29 | Diagnosis of diseases associated with signal transduction |
EP01955325A Withdrawn EP1297182A2 (en) | 2000-06-30 | 2001-06-29 | Diagnosis of diseases associated with cell signalling |
EP06002091A Withdrawn EP1676927A3 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with development by means of assessing their methylation status |
EP01967115A Withdrawn EP1294951A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with the immune system |
EP01967116A Withdrawn EP1355932A2 (en) | 2000-06-30 | 2001-07-02 | Method and nucleic acids for the differentiation of astrocytoma, oligoastrocytoma and oligodendroglioma tumor cells |
EP01962814A Withdrawn EP1356099A2 (en) | 2000-06-30 | 2001-07-02 | Method and nucleic acids for the analysis of astrocytomas |
EP01962813A Ceased EP1294950A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with development genes |
EP01957909A Withdrawn EP1294948A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of behavioural disorders, neurological disorders and cancer |
Family Applications Before (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01953995A Withdrawn EP1294947A2 (en) | 2000-06-30 | 2001-06-29 | Method and nucleic acids for pharmacogenomic methylation analysis |
EP01969326A Withdrawn EP1297185A2 (en) | 2000-06-30 | 2001-06-29 | Diagnosis of diseases associated with signal transduction |
EP01955325A Withdrawn EP1297182A2 (en) | 2000-06-30 | 2001-06-29 | Diagnosis of diseases associated with cell signalling |
EP06002091A Withdrawn EP1676927A3 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with development by means of assessing their methylation status |
Family Applications After (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01967116A Withdrawn EP1355932A2 (en) | 2000-06-30 | 2001-07-02 | Method and nucleic acids for the differentiation of astrocytoma, oligoastrocytoma and oligodendroglioma tumor cells |
EP01962814A Withdrawn EP1356099A2 (en) | 2000-06-30 | 2001-07-02 | Method and nucleic acids for the analysis of astrocytomas |
EP01962813A Ceased EP1294950A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of diseases associated with development genes |
EP01957909A Withdrawn EP1294948A2 (en) | 2000-06-30 | 2001-07-02 | Diagnosis of behavioural disorders, neurological disorders and cancer |
Country Status (5)
Country | Link |
---|---|
US (5) | US20040023230A1 (en) |
EP (9) | EP1294947A2 (en) |
JP (1) | JP2004501666A (en) |
AU (8) | AU2001276371A1 (en) |
WO (8) | WO2002000926A2 (en) |
Families Citing this family (108)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8003386B1 (en) | 1997-01-14 | 2011-08-23 | Human Genome Sciences, Inc. | Tumor necrosis factor receptors 6α and 6β |
US7285267B2 (en) | 1997-01-14 | 2007-10-23 | Human Genome Sciences, Inc. | Tumor necrosis factor receptors 6α & 6β |
US6818404B2 (en) | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
US7611869B2 (en) * | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
US7955794B2 (en) | 2000-09-21 | 2011-06-07 | Illumina, Inc. | Multiplex nucleic acid reactions |
US8076063B2 (en) * | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
EP1274866A2 (en) | 2000-04-06 | 2003-01-15 | Epigenomics AG | Diagnosis of diseases associated with metastasis |
AU2001281311A1 (en) * | 2000-07-10 | 2002-01-21 | Epigenx Pharmaceutical, Inc. | Detecting methylated cytosine in polynucleotides |
JP2002034575A (en) * | 2000-07-28 | 2002-02-05 | Shiseido Co Ltd | Human type ii 5 alpha-reductase promoter gene and its use |
DE10054974A1 (en) * | 2000-11-06 | 2002-06-06 | Epigenomics Ag | Diagnosis of diseases associated with Cdk4 |
DE10061338A1 (en) * | 2000-12-06 | 2002-06-20 | Epigenomics Ag | Diagnosis of diseases associated with angiogenesis |
US6756200B2 (en) * | 2001-01-26 | 2004-06-29 | The Johns Hopkins University School Of Medicine | Aberrantly methylated genes as markers of breast malignancy |
EP1410304A2 (en) * | 2001-03-26 | 2004-04-21 | Epigenomics AG | Method for epigenetic feature selection |
WO2002083921A2 (en) | 2001-04-10 | 2002-10-24 | Agensys, Inc. | Nuleic acids and corresponding proteins useful in the detection and treatment of various cancers |
US7235358B2 (en) | 2001-06-08 | 2007-06-26 | Expression Diagnostics, Inc. | Methods and compositions for diagnosing and monitoring transplant rejection |
DE10128508A1 (en) | 2001-06-14 | 2003-02-06 | Epigenomics Ag | Methods and nucleic acids for the differentiation of prostate tumors |
WO2003031932A2 (en) | 2001-10-05 | 2003-04-17 | Case Western Reserve University | Methods and compositions for detecting colon cancers |
US20110151438A9 (en) | 2001-11-19 | 2011-06-23 | Affymetrix, Inc. | Methods of Analysis of Methylation |
EP1468104A4 (en) * | 2002-01-18 | 2006-02-01 | Genzyme Corp | Methods for fetal dna detection and allele quantitation |
EP1470254A2 (en) * | 2002-01-30 | 2004-10-27 | Epigenomics AG | Method for the analysis of cytosine methylation patterns |
EP1340818A1 (en) * | 2002-02-27 | 2003-09-03 | Epigenomics AG | Method and nucleic acids for the analysis of a colon cell proliferative disorder |
WO2003076593A2 (en) * | 2002-03-07 | 2003-09-18 | The Johns Hopkins University School Of Medicine | Genomic screen for epigenetically silenced genes associated with cancer |
AU2003247880B2 (en) * | 2002-07-03 | 2010-09-02 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7807803B2 (en) | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7605138B2 (en) * | 2002-07-03 | 2009-10-20 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US20040053880A1 (en) | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US20040029128A1 (en) * | 2002-08-08 | 2004-02-12 | Epigenomics, Inc. | Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene |
CA2500255A1 (en) | 2002-10-01 | 2004-04-29 | Epigenomics Ag | Method and nucleic acids for the treatment of breast cell proliferative disorders |
WO2004050915A1 (en) * | 2002-12-02 | 2004-06-17 | Solexa Limited | Determination of methylation of nucleic acid sequences |
AU2003303963A1 (en) * | 2002-12-20 | 2004-10-25 | Bioseek, Inc. | Drug target |
ITRM20030149A1 (en) | 2003-04-02 | 2004-10-03 | Giuliani Spa | ANTISENSE OLIGONUCLEOTIDES (ODN) FOR SMAD7 AND THEIR USE IN THE MEDICAL FIELD |
US20050009059A1 (en) * | 2003-05-07 | 2005-01-13 | Affymetrix, Inc. | Analysis of methylation status using oligonucleotide arrays |
US7403568B2 (en) | 2003-08-13 | 2008-07-22 | Apple Inc. | Pre-processing method and system for data reduction of video sequences and bit rate reduction of compressed video sequences using temporal filtering |
US7430335B2 (en) | 2003-08-13 | 2008-09-30 | Apple Inc | Pre-processing method and system for data reduction of video sequences and bit rate reduction of compressed video sequences using spatial filtering |
US8062849B2 (en) | 2003-10-28 | 2011-11-22 | The Johns Hopkins University | Quantitative multiplex methylation-specific PCR |
EP3269826B1 (en) * | 2003-12-01 | 2020-03-11 | Epigenomics AG | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders |
EP1561821B1 (en) | 2003-12-11 | 2011-02-16 | Epigenomics AG | Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients |
EP2471921A1 (en) * | 2004-05-28 | 2012-07-04 | Asuragen, Inc. | Methods and compositions involving microRNA |
EP1769086A2 (en) * | 2004-07-18 | 2007-04-04 | Epigenomics AG | Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders |
US20080171318A1 (en) * | 2004-09-30 | 2008-07-17 | Epigenomics Ag | Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders |
EP2302054B1 (en) | 2004-11-12 | 2014-07-16 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
US20060134650A1 (en) * | 2004-12-21 | 2006-06-22 | Illumina, Inc. | Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis |
WO2006088978A1 (en) | 2005-02-16 | 2006-08-24 | Epigenomics, Inc. | Method for determining the methylation pattern of a polynucleic acid |
EP1748080A3 (en) * | 2005-03-11 | 2007-04-11 | Epiontis GmbH | Specific DNAs for epigenetic characterisation of cells and tissues |
EP1863924A2 (en) | 2005-03-11 | 2007-12-12 | Epiontis GmbH | Specific dnas for epigenetic characterisation of cells and tissues |
SI1871912T1 (en) | 2005-04-15 | 2012-06-29 | Epigenomics Ag | Method for determining DNA methylation in blood or urine samples |
WO2006111586A2 (en) * | 2005-04-20 | 2006-10-26 | Proyecto De Biomedicina Cima, S.L. | Method for the in vitro determination of the degree of methylation of the line-1 promoter |
US20060292585A1 (en) * | 2005-06-24 | 2006-12-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
WO2007003397A2 (en) * | 2005-07-01 | 2007-01-11 | Epigenomics Ag | Method and nucleic acids for the improved treatment of cancers |
WO2007032748A1 (en) * | 2005-09-15 | 2007-03-22 | Agency For Science, Technology & Research | Method for detecting dna methylation |
EP1951911A2 (en) * | 2005-11-08 | 2008-08-06 | Euclid Diagnostics LLC | Materials and methods for assaying for methylation of cpg islands associated with genes in the evaluation of cancer |
US20070161006A1 (en) * | 2006-01-10 | 2007-07-12 | Vita Genomics, Inc. | Single nucleotide polymorphisms in protein-tyrosine phosphatase receptor-type delta for the diagnosis of susceptibility to infection and asthma |
WO2007095032A2 (en) * | 2006-02-09 | 2007-08-23 | Novartis Ag | Mutations and polymorphisms of ptk2b |
US20070238115A1 (en) * | 2006-02-27 | 2007-10-11 | Dwinell Michael B | Method of Diagnosing and Treating Colon Cancer |
US7901882B2 (en) | 2006-03-31 | 2011-03-08 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US8084734B2 (en) * | 2006-05-26 | 2011-12-27 | The George Washington University | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
EP2024515B1 (en) * | 2006-05-31 | 2012-08-22 | Orion Genomics, LLC | Gene methylation in cancer diagnosis |
ES2546182T3 (en) * | 2006-07-21 | 2015-09-21 | Epigenomics Ag | Methods and kits for methylation analysis in colorectal cell proliferative disorders |
WO2008036765A2 (en) * | 2006-09-19 | 2008-03-27 | Asuragen, Inc. | Micrornas differentially expressed in pancreatic diseases and uses thereof |
CN101622350A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | miR-126 regulated genes and pathways as targets for therapeutic intervention |
GB0625321D0 (en) * | 2006-12-19 | 2007-01-24 | Univ Surrey | Cancer biomarker |
ES2733069T3 (en) | 2007-01-18 | 2019-11-27 | Molecor Tecnologia Sl | System for the manufacture of integrated sockets in plastic pipes of biaxial orientation |
US20090170085A1 (en) | 2007-02-02 | 2009-07-02 | Orion Genomics Llc | Gene Methylation in Head and Neck Cancer Diagnosis |
WO2008096146A1 (en) * | 2007-02-07 | 2008-08-14 | Solexa Limited | Preparation of templates for methylation analysis |
US20090131354A1 (en) * | 2007-05-22 | 2009-05-21 | Bader Andreas G | miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
US8361714B2 (en) | 2007-09-14 | 2013-01-29 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
US20090186015A1 (en) * | 2007-10-18 | 2009-07-23 | Latham Gary J | Micrornas differentially expressed in lung diseases and uses thereof |
WO2009070805A2 (en) | 2007-12-01 | 2009-06-04 | Asuragen, Inc. | Mir-124 regulated genes and pathways as targets for therapeutic intervention |
WO2009108917A2 (en) * | 2008-02-29 | 2009-09-03 | Oncomethylome Sciences, S.A. | Markers for improved detection of breast cancer |
WO2009111643A2 (en) * | 2008-03-06 | 2009-09-11 | Asuragen, Inc. | Microrna markers for recurrence of colorectal cancer |
WO2009137807A2 (en) | 2008-05-08 | 2009-11-12 | Asuragen, Inc. | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
US8541207B2 (en) * | 2008-10-22 | 2013-09-24 | Illumina, Inc. | Preservation of information related to genomic DNA methylation |
US8110796B2 (en) | 2009-01-17 | 2012-02-07 | The George Washington University | Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays |
WO2010091296A2 (en) * | 2009-02-06 | 2010-08-12 | The Regents Of The University Of California | Emx2 in cancer diagnosis and prognosis |
US9490113B2 (en) * | 2009-04-07 | 2016-11-08 | The George Washington University | Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry |
AU2010258757A1 (en) * | 2009-06-09 | 2012-01-12 | Banner Sun Health Research Institute | Method and system to detect, diagnose, and monitor the progression of Alzheimer's disease |
CA2777906A1 (en) * | 2009-10-28 | 2011-05-05 | Signature Diagnostics Ag | Method for the prognosis of ovarian carcinoma |
US9394570B2 (en) * | 2010-04-21 | 2016-07-19 | The Chinese University Of Hong Kong | Marker for colon cancer and method for detecting colon cancer |
EP2614952B1 (en) | 2010-09-06 | 2016-03-30 | Molecor Tecnologia, S.L. | Device and method for producing the mouths of biaxially oriented plastic tubes with integrated sealing gaskets |
JP6049623B2 (en) * | 2010-10-22 | 2016-12-21 | カッパーアールエヌエー,インコーポレイテッド | Treatment of IDUA-related diseases by inhibition of natural antisense transcripts to α-L-iduronidase (IDUA) |
WO2012162139A1 (en) | 2011-05-20 | 2012-11-29 | The Regents Of The University Of California | Method to estimate age of individual based on epigenetic markers in biological sample |
NZ621638A (en) * | 2011-08-25 | 2016-03-31 | Clinical Genomics Pty Ltd | Dna methylation in colorectal and breast cancer diagnostic methods |
WO2013040251A2 (en) | 2011-09-13 | 2013-03-21 | Asurgen, Inc. | Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease |
US9127317B2 (en) | 2012-03-02 | 2015-09-08 | Winthrop-University Hospital | Method for using probe based PCR detection to measure the levels of circulating demethylated β cell derived DNA as a measure of β cell loss in diabetes |
US10865446B2 (en) | 2012-11-02 | 2020-12-15 | The Johns Hopkins University | DNA methylation biomarkers of post-partum depression risk |
ES2712798T3 (en) | 2013-03-14 | 2019-05-14 | Exact Sciences Dev Co Llc | Detection of neoplasms |
ES2527724B1 (en) * | 2013-05-29 | 2015-11-10 | Fundación Para La Investigación Biomédica Del Hospital Universitario La Paz | METHOD FOR PREACHING THE RESPONSE TO THE TREATMENT WITH RADIOTHERAPY COMBINED WITH CISPLATINO-BASED CHEMOTHERAPY |
EP4234722A3 (en) | 2014-03-31 | 2023-09-20 | Mayo Foundation for Medical Education and Research | Detecting colorectal neoplasm |
US9840742B2 (en) * | 2014-06-16 | 2017-12-12 | JBS Science Inc. | Detection of hepatitis B virus (HBV) DNA and methylated HBV DNA in urine of patients with HBV-associated hepatocellular carcinoma |
US10184154B2 (en) | 2014-09-26 | 2019-01-22 | Mayo Foundation For Medical Education And Research | Detecting cholangiocarcinoma |
US10030272B2 (en) | 2015-02-27 | 2018-07-24 | Mayo Foundation For Medical Education And Research | Detecting gastrointestinal neoplasms |
US20180230539A1 (en) * | 2015-07-21 | 2018-08-16 | Indiana University Research And Technology Corporation | Cell-free methylated and unmethylated dna in diseases resulting from abnormalities in blood glucose levels |
KR20180081042A (en) | 2015-08-31 | 2018-07-13 | 메이오 파운데이션 포 메디칼 에쥬케이션 앤드 리써치 | A method for detecting gastric neoplasia |
US10370726B2 (en) | 2016-04-14 | 2019-08-06 | Mayo Foundation For Medical Education And Research | Detecting colorectal neoplasia |
CN116024334A (en) | 2016-04-14 | 2023-04-28 | 梅约医学教育与研究基金会 | Application of detection DMR reagent in screening IPMN-HGD, panIN-3 or PDAC and kit |
CN105734152B (en) * | 2016-04-20 | 2019-02-26 | 苏州吉诺瑞生物科技有限公司 | Detect the primer pair and its application of the expression of people SRPK2 gene |
EP3507298B1 (en) * | 2016-09-02 | 2023-08-30 | Mayo Foundation for Medical Education and Research | Detecting hepatocellular carcinoma |
US20190284636A1 (en) * | 2016-10-26 | 2019-09-19 | Brown University | A method to measure myeloid suppressor cells for diagnosis and prognosis of cancer |
US10934592B2 (en) | 2017-02-28 | 2021-03-02 | Mayo Foundation For Medical Education And Research | Detecting prostate cancer |
WO2019108626A1 (en) | 2017-11-30 | 2019-06-06 | Mayo Foundation For Medical Education And Research | Detecting breast cancer |
WO2019105090A1 (en) * | 2017-12-01 | 2019-06-06 | 博尔诚(北京)科技有限公司 | Composition for detecting esophageal cancer and use thereof |
CN108977457B (en) * | 2018-08-31 | 2021-04-02 | 长江大学 | Preparation method of finless eel antibacterial peptide |
SG11202107670TA (en) | 2019-01-18 | 2021-08-30 | Univ California | Dna methylation measurement for mammals based on conserved loci |
DE102020111423B4 (en) | 2020-04-27 | 2022-03-03 | Precision For Medicine Gmbh | MYH11/NDE1 region as an epigenetic marker for the identification of endothelial progenitor cells (EPCs) |
BR112022026509A2 (en) * | 2020-06-23 | 2023-03-07 | Univ Colorado Regents | METHODS TO DIAGNOSE RESPIRATORY PATHOGENS AND PREDICT OUTCOMES RELATED TO COVID-19 |
EP4196611A1 (en) | 2020-08-15 | 2023-06-21 | Regeneron Pharmaceuticals, Inc. | Treatment of obesity in subjects having variant nucleic acid molecules encoding calcitonin receptor (calcr) |
WO2023175019A1 (en) | 2022-03-15 | 2023-09-21 | Genknowme S.A. | Method determining the difference between the biological age and the chronological age of a subject |
Family Cites Families (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US5744101A (en) * | 1989-06-07 | 1998-04-28 | Affymax Technologies N.V. | Photolabile nucleoside protecting groups |
US5843654A (en) * | 1992-12-07 | 1998-12-01 | Third Wave Technologies, Inc. | Rapid detection of mutations in the p53 gene |
US5837832A (en) * | 1993-06-25 | 1998-11-17 | Affymetrix, Inc. | Arrays of nucleic acid probes on biological chips |
DE69433180T2 (en) * | 1993-10-26 | 2004-06-24 | Affymetrix, Inc., Santa Clara | FIELDS OF NUCLEIC ACID PROBE ON ORGANIC CHIPS |
US5804407A (en) * | 1993-11-04 | 1998-09-08 | University Technologies International, Inc. | Method of expressing genes in mammalian cells |
US5756668A (en) * | 1994-11-15 | 1998-05-26 | The Johns Hopkins University School Of Medicine | Hypermethylated in cancer polypeptide, HIC-1 |
US6017704A (en) * | 1996-06-03 | 2000-01-25 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
WO1998056952A1 (en) * | 1997-06-09 | 1998-12-17 | University Of Southern California | A cancer diagnostic method based upon dna methylation differences |
US6342350B1 (en) * | 1997-09-05 | 2002-01-29 | The General Hospital Corporation | Alpha-2-macroglobulin diagnostic test |
DE19754482A1 (en) * | 1997-11-27 | 1999-07-01 | Epigenomics Gmbh | Process for making complex DNA methylation fingerprints |
WO1999029898A2 (en) * | 1997-12-05 | 1999-06-17 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry |
DE19905082C1 (en) * | 1999-01-29 | 2000-05-18 | Epigenomics Gmbh | Identification of methylation patterns of cytosine in genome DNA comprises chemical treatment to produce different base pairing behavior between cytosine and 5-methylcytosine |
EP1283905A2 (en) * | 2000-03-15 | 2003-02-19 | Epigenomics AG | Diagnosis of diseases associated with the cell cycle |
EP1274866A2 (en) * | 2000-04-06 | 2003-01-15 | Epigenomics AG | Diagnosis of diseases associated with metastasis |
DE10128508A1 (en) * | 2001-06-14 | 2003-02-06 | Epigenomics Ag | Methods and nucleic acids for the differentiation of prostate tumors |
WO2003004696A2 (en) * | 2001-07-02 | 2003-01-16 | Epigenomics Ag | A distributed system for epigenetic based prediction of complex phenotypes |
-
2001
- 2001-06-29 EP EP01953995A patent/EP1294947A2/en not_active Withdrawn
- 2001-06-29 EP EP01969326A patent/EP1297185A2/en not_active Withdrawn
- 2001-06-29 WO PCT/EP2001/007472 patent/WO2002000926A2/en not_active Application Discontinuation
- 2001-06-29 AU AU2001276371A patent/AU2001276371A1/en not_active Abandoned
- 2001-06-29 JP JP2002507050A patent/JP2004501666A/en not_active Withdrawn
- 2001-06-29 US US10/257,166 patent/US20040023230A1/en not_active Abandoned
- 2001-06-29 WO PCT/EP2001/007471 patent/WO2002002807A2/en not_active Application Discontinuation
- 2001-06-29 AU AU2001289617A patent/AU2001289617A1/en not_active Abandoned
- 2001-06-29 EP EP01955325A patent/EP1297182A2/en not_active Withdrawn
- 2001-06-29 AU AU2001277521A patent/AU2001277521A1/en not_active Abandoned
- 2001-06-29 WO PCT/EP2001/007470 patent/WO2002002806A2/en not_active Application Discontinuation
- 2001-07-02 AU AU2001279707A patent/AU2001279707A1/en not_active Abandoned
- 2001-07-02 US US10/311,455 patent/US20030143606A1/en not_active Abandoned
- 2001-07-02 WO PCT/EP2001/007540 patent/WO2002002809A2/en not_active Application Discontinuation
- 2001-07-02 WO PCT/EP2001/007537 patent/WO2002000928A2/en active Application Filing
- 2001-07-02 WO PCT/EP2001/007538 patent/WO2002002808A2/en active Application Filing
- 2001-07-02 EP EP06002091A patent/EP1676927A3/en not_active Withdrawn
- 2001-07-02 WO PCT/EP2001/007536 patent/WO2002000927A2/en active Application Filing
- 2001-07-02 AU AU2001287575A patent/AU2001287575A1/en not_active Abandoned
- 2001-07-02 EP EP01967115A patent/EP1294951A2/en not_active Withdrawn
- 2001-07-02 AU AU2001283915A patent/AU2001283915A1/en not_active Abandoned
- 2001-07-02 AU AU2001287576A patent/AU2001287576A1/en not_active Abandoned
- 2001-07-02 EP EP01967116A patent/EP1355932A2/en not_active Withdrawn
- 2001-07-02 WO PCT/EP2001/007539 patent/WO2002000705A2/en not_active Application Discontinuation
- 2001-07-02 EP EP01962814A patent/EP1356099A2/en not_active Withdrawn
- 2001-07-02 EP EP01962813A patent/EP1294950A2/en not_active Ceased
- 2001-07-02 EP EP01957909A patent/EP1294948A2/en not_active Withdrawn
- 2001-07-02 US US10/311,506 patent/US20080145839A1/en not_active Abandoned
- 2001-07-02 AU AU2001283916A patent/AU2001283916A1/en not_active Abandoned
- 2001-07-02 US US10/311,507 patent/US20040115630A1/en not_active Abandoned
-
2007
- 2007-08-07 US US11/835,336 patent/US20080026396A1/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO0200928A3 * |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1294951A2 (en) | Diagnosis of diseases associated with the immune system | |
DE60126593T2 (en) | DIAGNOSIS OF DISEASES ASSOCIATED WITH APOPTOSIS BY MEANS OF DETERMINATION OF THE METHYLATION STATE OF APOPTOSIS-ASSOCIATED GENES | |
WO2002018631A2 (en) | Diagnosis of illnesses or predisposition to certain illnesses | |
DE10154317B4 (en) | Method for the detection of cytosine methylations in immobilized DNA samples | |
DE10132212B4 (en) | Method for the detection of cytosine methylation by comparative analysis of the single strands of amplicons | |
DE10161625A1 (en) | Methods and nucleic acids for the analysis of a pulmonary cell division disorder | |
DE20121960U1 (en) | New nucleic acid derived from chemically treated metastasis genes, useful for diagnosis of cancers by analysis of cytosine methylation, also for treatment | |
DE10128508A1 (en) | Methods and nucleic acids for the differentiation of prostate tumors | |
DE10061338A1 (en) | Diagnosis of diseases associated with angiogenesis | |
WO2002036814A2 (en) | Diagnosis of diseases associated with cdk4 by determining the methylation state of the cdk4 | |
EP1339873B1 (en) | Diagnosis of diseases associated with the human c-mos gene | |
DE10037769A1 (en) | Diagnosis of diseases associated with CD24 | |
DE10128509A1 (en) | Methods and nucleic acids for the differentiation of prostate and kidney carcinomas | |
DE20121968U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121965U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121979U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121964U1 (en) | New nucleic acid, useful for diagnosis and therapy of metabolic disease, solid tumor and cancers, comprises segment of chemically modified genomic sequences of genes associated with metabolism | |
DE20121961U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121977U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121973U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE10230692A1 (en) | Methods and nucleic acids for the analysis of methylation patterns within the DD3 gene | |
DE20121969U1 (en) | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle | |
DE20121963U1 (en) | Nucleic acids for the diagnosis of diseases associated with developmental genes | |
DE10255104A1 (en) | Methods and nucleic acids for the analysis of proliferative diseases of breast cells | |
WO2003031648A2 (en) | Method for detecting dna methylation using labelled s-adenosylmethionine analogs |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20021015 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
17Q | First examination report despatched |
Effective date: 20050110 |
|
APBN | Date of receipt of notice of appeal recorded |
Free format text: ORIGINAL CODE: EPIDOSNNOA2E |
|
APBR | Date of receipt of statement of grounds of appeal recorded |
Free format text: ORIGINAL CODE: EPIDOSNNOA3E |
|
APAF | Appeal reference modified |
Free format text: ORIGINAL CODE: EPIDOSCREFNE |
|
APBT | Appeal procedure closed |
Free format text: ORIGINAL CODE: EPIDOSNNOA9E |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20080201 |