DE20121965U1 - Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle - Google Patents

Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle Download PDF

Info

Publication number
DE20121965U1
DE20121965U1 DE20121965U DE20121965U DE20121965U1 DE 20121965 U1 DE20121965 U1 DE 20121965U1 DE 20121965 U DE20121965 U DE 20121965U DE 20121965 U DE20121965 U DE 20121965U DE 20121965 U1 DE20121965 U1 DE 20121965U1
Authority
DE
Germany
Prior art keywords
dna
sequences
seq
genes
oligomer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
DE20121965U
Other languages
German (de)
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10019058A external-priority patent/DE10019058A1/en
Priority claimed from DE10032529A external-priority patent/DE10032529A1/en
Application filed by Epigenomics AG filed Critical Epigenomics AG
Priority to DE20121965U priority Critical patent/DE20121965U1/en
Priority claimed from EP01927895A external-priority patent/EP1272670A2/en
Publication of DE20121965U1 publication Critical patent/DE20121965U1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

A nucleic acid, (I), comprising a sequence of 18 bases, of a segment of chemically pretreated DNA (CP DNA) of genes associated with cell cycle having a sequence taken from 424 sequences (Ss) and sequences complementary to (Ss), is new. Independent claims are also included for the following: (1) an oligomer (II), particularly an oligonucleotide or peptide nucleic acid (PNA)-oligomer, comprising a base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a CP DNA of genes associated with the cell cycle having a sequence from (Ss); (2) a set of (II), comprising at least two (II); (3) use of a set of oligomer probes (III) for detecting the cytosine methylation state and/or single nucleotide polymorphisms (SNPs) in CP DNA; (4) manufacturing an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of CP DNA, where at least a (II) is coupled to a solid phase; (5) an arrangement of different oligomers (array), obtained by the method (4); (6) ascertaining (M1) genetic and/or epigenetic parameters for the diagnosis and/or therapy of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, comprising: (a) converting cytosine bases which are unmethylated at the 5-position (in a genomic DNA sample) to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior, by chemical treatment; (b) amplifying fragments of the chemically pretreated DNA using sets of (II) as primers and a polymerase, the amplifies carrying a detectable label; (c) hybridizing the amplificate to a set of (II) or else to a DNA-and/or PNA-array; and (d) detecting the hybridized amplifies; and (7) a kit (IV) comprising a bisulfite (= disulfite, hydrogen sulfite) reagent as well as DNA- and/or PNA-oligomers. ACTIVITY : Anti-HIV; neuroprotective; immunosuppressive; antitumor; cytostatic; antiarthritic; antiarteriosclerotic. MECHANISM OF ACTION : Cytosine methylation regulator. No example is given.

Description

Gebiet der ErfindungField of the Invention

Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms.According to the methodological developments levels of observation well studied in molecular biology in recent years are the genes themselves, the translation of these genes in RNA and the resulting proteins. When in In the course of the development of an individual which gene is switched on and how to activate and inhibit certain genes in certain Cells and tissues are controlled with the extent and character of methylation the genes or the genome can be correlated. In this respect, pathogenic conditions express themselves in one changed Methylation patterns of individual genes or the genome.

Die vorliegende Erfindung betrifft Nukleinsäuren, Oligonukleotide, PNA-Oligomere und ein Verfahren zur Diagnose und/oder der Therapie von Erkrankungen, die mit den genetischen und/oder epigenetischen Parametern von Genen, die mit DNA Addukten assoziiert sind und insbesondere deren Methylierungsstatus in Zusammenhang stehen.The present invention relates to nucleic acids, Oligonucleotides, PNA oligomers and a method for diagnosis and / or the therapy of diseases with genetic and / or epigenetic parameters of genes associated with DNA adducts are related and especially their methylation status stand.

Stand der TechnikState of the art

Die hauptsächlichen Umweltursachen von Krebs schließen chemische Verbindungen und Strahlung ein. Einige Karzinogene führen durch die Bindung mit genomischer DNA, wobei Addukte gebildet werden, zur Onkogenese. Beispiele von solchen Verbindungen schließen Ethenobasen und polycyklische aromatische Kohlenwasserstoffe ein. Von die Bildung von solchen Addukten wird geglaubt, daß sie eine Hauptquelle der DNA-Beschädigung ist. Karzinogen-DNA Addukte können eine große Vielzahl von Läsionen und oxidativen Schaden an DNA Sequenzen verursachen. Von Mutationen wird auch gedacht, daß sie auftreten, wenn eine DNA Polymerase während der Replikation auf einen Karzinogen-DNA Addukt trifft. Im Prinzip könnte die Mutations-Komplexität an entweder einer Ansammlung von verschiedenen Addukten liegen, die jede eine einzelne Art von Mutation induzieren, oder einem einzelnen Addukt liegen, das verschiedene Arten von Mutationen induziert. Die Akkumulation von Addukten kann daher zu erhöhter Mutagenizität und neoplastischem Fortschreiten führen. Wei terhin ist die Bildung von DNA Addukten essentiell für die Wirkung von vielen Antikrebsmitteln, zum Beispiel Mitoxantron und Treosulphan.The main environmental causes of Close cancer chemical compounds and radiation. Some carcinogens do binding with genomic DNA, forming adducts, for oncogenesis. Examples of such compounds include ethenobases and polycyclic aromatic hydrocarbons. From education such adducts are believed to be a major source of DNA damage. Carcinogen-DNA adducts can a big Variety of lesions and cause oxidative damage to DNA sequences. Of mutations is also thought to be occur when a DNA polymerase is replicating to a Carcinogen-DNA adduct hits. In principle, the mutation complexity could be either a collection of different adducts, each one induce single type of mutation, or a single adduct that induces different types of mutations. The accumulation of adducts can therefore increase too mutagenicity and neoplastic progression. Education continues of DNA adducts essential for the effect of many anti-cancer drugs, for example mitoxantrone and treosulphan.

Die bei der Entfernung von DNA Addukt-induziertem Schaden beteiligten Systeme schließen Komponenten der DNA Reparaturmechanismen ein. Jede Zelle hält mehrere komplexe Verfahren bereit, um sowohl Einzelbasen als auch strukturelle Fehlpaarungen zu behandeln. Verbreitete Reparaturwege für Doppelstrangbrüche sind auf homologer Rekombination basierte Mechanismen. Ein anderer herkömmlicher Mechanismus für die Doppelstrang-DNA Bruchreparatur ist die nicht-homologe End-Zusammenfügung. Die Mechanismen der Doppelstrang-Bruchreparatur, und die mit ihnen assoziierten Erkrankungen wurden von Khanna und Jackson „DNA double-strand breaks: signalling, repair and the cancer connection." Nature Genetics 2001 Mar;27(3):247-254 zusammenfassend beschrieben.The adduct-induced in the removal of DNA Damaged systems include components of DNA repair mechanisms on. Every cell stops several complex procedures ready to both single bases as well treat structural mismatches. Common repair routes for double strand breaks Mechanisms based on homologous recombination. Another conventional one Mechanism for double stranded DNA break repair is the non-homologous end assembly. The Mechanisms of double-strand break repair, and those associated with them Diseases were identified by Khanna and Jackson "DNA double-strand breaks: signaling, repair and the cancer connection. "Nature Genetics 2001 Mar; 27 (3): 247-254 described in summary.

Kleine Basen-Fehlpaarungen werden im allgemeinen durch Basen-Exzisions-Reparaturmechanismen entfernt, wobei diese spezifische Glycosylasen umfassen, die Ba entfernen, gefolgt von Polymerasen und Ligasen, die den durch die Exzision zurückgelassenen Spalt auffüllen. Die Nucleotidexzisions-Reparatur (NER) entfernt eine große Vielzahl von Läsionen, die UV-induzierte Läsionen, sperrige chemische Addukte, mehrere Formen von Basen-Fehlpaarungen und einige Formen von oxidativer Beschädigung umfassen. Verschiedene Variationen dieses Weges existieren, wie zum Beispiel die globale Genom Nucleotidexzisions-Reparatur und die Transkriptions-gekoppelte Nucleotidexzisions-Reparatur. Der verallgemeinerte NER-Prozess schließt die Wirkung von mindestens 30 Proteinen in einem Mechanismus ein, der die Schadensidentifizierung, lokale Entwindung der DNA Helix, die Exzision des beschädigten Teils von DNA, die Synthese eines neuen Stranges und die anschließende Ligation einschließt.Small base mismatches will occur generally removed by base excision repair mechanisms, whereby these include specific glycosylases that remove Ba followed of polymerases and ligases that are left behind by the excision Fill in the gap. Nucleotide Excision Repair (NER) removes a wide variety of lesions, the UV-induced lesions, bulky chemical adducts, multiple forms of base mismatches and include some forms of oxidative damage. Different variations this route exists, such as global genome nucleotide excision repair and transcription-coupled nucleotide excision repair. The generalized NER process excludes the effect of at least 30 proteins in a mechanism that identifies damage, local unwinding of the DNA helix, excision of the damaged part of DNA, the synthesis of a new strand and the subsequent ligation includes.

Die bei der DNA Addukt-Reparatur beteiligten Reparaturenzyme und -Proteine stellen daher Ziele für neue Verfahren der Diagnose und Behandlung von Krebs dar. Dies ist besonders relevant bei Krebsarten, in denen augenblickliche Therapien unerwünschte Nebenwirkungen haben können oder dabei versagen, eine effektive Behandlung zu Verfügung zu stellen. Herkömmliche Verfahren, wie zum Beispiel die Chemotherapie, die mit ihren massiven Nebenwirkungen manchmal zu nicht akzeptabler Morbidität führt oder zum Tod des Patienten führen. In der Praxis begrenzen die unerwünschten Nebenwirkungen, die mit Krebstherapien assoziiert sind, häufig die Behandlung, die einem Patienten helfen könnte.The DNA adduct repair Repair enzymes and proteins involved therefore set targets for new processes the diagnosis and treatment of cancer. This is particularly relevant for cancers where current therapies have undesirable side effects can have or fail to provide effective treatment put. conventional Procedures, such as chemotherapy, with their massive Side effects sometimes lead to unacceptable morbidity or lead to the death of the patient. In practice, the undesirable side effects limit that associated with cancer therapies, often the treatment that one Could help patients.

Eine globale Analyse des Status der DNA Reparaturmechanismen würde eine Basis für die Entwicklung von geeigneten und spezifischen Therapien für Erkrankungen, die mit der DNA Reparatur assoziiert sind, zur Verfügung stellen. Der augenblickliche Stand der Technik ist so, daß die Analyse auf eine genspezifische Weise basierend auf den Ergebnissen der Genexpression, z.B. der DNA Microarray-Analyse der mRNA Expression oder Proteomanalyse durchgeführt werden kann. Der nächste Schritt wäre es dann, auf die kausalen Faktoren zu schauen, die in früheren Phasen in den regulatorischen Mechanismen beteiligt sind, die die DNA Reparatur kontrollieren. DNA Methylierung stellt ein neues Niveau von epigenetischer Information zur Verfügung, bei der man das Genom analysiert.A global analysis of the status of DNA repair mechanisms would provide a basis for the development of suitable and specific therapies for diseases associated with DNA repair. The current state of the art is such that the analysis can be carried out in a gene-specific manner based on the results of the gene expression, for example the DNA microarray analysis of the mRNA expression or proteome analysis. The next step would then be to look at the causal factors involved in earlier phases in the regulatory mechanisms that DNA Check repair. DNA methylation provides a new level of epigenetic information by analyzing the genome.

5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryontischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR-Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.5-methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. she plays for example a role in the regulation of transcription, in genetic imprinting and tumorigenesis. The identification of 5-methylcytosine as a component of genetic information therefore of considerable interest. However, 5-methylcytosine positions cannot be sequenced can be identified because 5-methylcytosine has the same base pairing behavior has like cytosine. About that In addition, the PCR information amplifies the epigenetic information, which carry the 5-methylcytosine, completely lost.

Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, daß Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch „normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15;24(24):5064-6). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr kleinen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren.A relatively new one and now most frequently method used to examine DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, the after subsequent alkaline hydrolysis is converted into uracil, which in its Base pairing behavior corresponds to the thymidine. 5-methylcytosine however, is not modified under these conditions. So that will the original DNA converted so that methyl cytosine, which originally not distinguished from cytosine by its hybridization behavior can now be through "normal" molecular biological Techniques as the only remaining cytosine, for example by amplification and hybridization or sequencing can be detected. All of these techniques are based on base pairing, which is now full is exploited. The state of the art in terms of sensitivity concerns, is defined by a method which the DNA to be examined in an agarose matrix includes, thereby the diffusion and renaturation of the DNA (bisulfite only reacts on single-stranded DNA) prevented and all precipitation and cleaning steps replaced by rapid dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15; 24 (24): 5064-6). With this method you can individual cells are examined, what is the potential of the method illustrated. However, so far only individual regions up to about 3000 base pairs in length examined, a global study of cells for thousands of possible Methylation analysis is not possible. However, it can also this method does not produce very small fragments from small sample amounts reliable analyze. Despite diffusion protection, these pass through the matrix lost.

Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Übersichtsartikel entnommen werden: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.An overview of the other known ones Possibilities, Detecting 5-methylcytosine can be found in the following review article are taken from: Rein, T., DePamphilis, M.L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.

Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z.B. Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr;5(2):94-8) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifiziert und entweder komplett sequenziert (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov;17(3):275-6) oder einzelne Cytosin-Positionen durch eine „Primer-Extension-Reaktion" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15;25(12):2529-31, WO 95/00669) oder einen Enzymschnitt (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15;25(12):2532-4) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99/28498).The bisulfite technique is so far with a few exceptions (e.g. Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5 (2): 94-8) only in applied to research. But short, specific pieces always become one known gene amplified after a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov; 17 (3): 275-6) or single cytosine positions a "primer extension reaction" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15; 25 (12): 2529-31, WO 95/00669) or an enzyme section (Xiong Z, Laird PW.COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15; 25 (12): 2532-4) demonstrated. Detection by hybridization is also described (Olek et al., WO 99/28498).

Weitere Publikationen, die sich mit der Anwendung der Bisulfit-Technik zum Methylierungsnachweis bei einzelnen Genen befassen, sind: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar;6(3):387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19;157(1-2):261-4; WO 97/46705, WO 95/15373 und WO 97/45560.Other publications dealing with the use of the bisulfite technique for methylation detection individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioassays. 1994 Jun; 16 (6): 431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi / Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar; 6 (3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25; 22 (4): 695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5 'region of the pS2 gene and its expression in human breast cancer cell lines. Genes. 1995 May 19; 157 (1-2): 261-4; WO 97/46705, WO 95/15373 and WO 97/45560.

Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) und der dort zitierten Literatur entnehmen.An overview of the state of the art in the oligomer array production can be from a special edition of Nature Genetics published in January 1999 (Nature Genetics Supplement, Volume 21, January 1999) and the one there Take cited literature.

Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoreszenzmarkierte Sonden verwendet worden. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'-OH der jeweiligen Sonde. Die Detektion der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.For the scanning of an immobilized DNA array is often fluorescence-labeled Probes have been used. It is particularly suitable for fluorescent labels the simple attachment of Cy3 and Cy5 dyes to the 5'-OH of the respective Probe. The fluorescence of the hybridized probes is detected for example about a confocal microscope. The dyes are Cy3 and Cy5, among many other, commercially available.

Matrix-assistierte Laser Desorptions/Ionisations-Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15;60(20):2299-301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere.Matrix-assisted laser desorption / ionization mass spectrometry (MALDI-TOF) is very quiet viable development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60 (20): 2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is vaporized by a short laser pulse and the analyte molecule is thus transported unfragmented into the gas phase. The ionization of the analyte is achieved by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones.

MALDI-TOF Spektrometrie eignet sich ausgezeichnet zur Analyse von Peptiden und Proteinen. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. In der MALDI-TOF Spektrometrie spielt die Wahl der Matrix eine eminent wichtige Rolle. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrizes gefunden worden, die eine sehr feine Kristallisation ergeben. Für DNA gibt es zwar mittlerweile einige ansprechende Matrizes, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, daß sie einem Peptid ähnlicher wird. Phosphorothioatnukleinsäuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25;23(8):1367-73). Die Kopplung eines „charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. Ein weiterer Vorteil von „charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren.MALDI-TOF spectrometry is suitable excellent for the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and future trends. 1995, 1; 147-57). Sensitivity to nucleic acids about 100 times worse than for Peptides and decreases disproportionately with increasing fragment size. For nucleic acids that a often negatively charged backbone have, the ionization process is through the matrix much more inefficient. In MALDI-TOF spectrometry the choice of matrix plays an eminently important role. For desorption some very powerful matrices have been found from peptides, which result in a very fine crystallization. For DNA there is now some appealing matrices, but this made the difference in sensitivity not decreased. The difference in sensitivity can be reduced by chemically modifying the DNA so that it Peptide becomes more similar. Phosphorothioate nucleic acids, where the ordinary Backbone phosphates are substituted by thiophosphates, can be replaced by simple Converting alkylation chemistry into a charge-neutral DNA (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25; 23 (8): 1367-73). The coupling of a “charge tags "to this modified DNA results in an increase in sensitivity by the same Amount as for Peptides is found. Another advantage of "charge tagging" is the increased stability of the analysis against contamination, the detection of unmodified substrates greatly complicate.

Genomische DNA wird durch Standardmethoden aus DNA von Zell-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.Genomic DNA is made by standard methods obtained from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.

Beschreibungdescription

Es ist die Aufgabe der vorliegenden Erfindung, die chemisch modifizierte DNA von Genen zur Verfügung zu stellen, die mit DNA Addukten assoziiert sind, sowie Oligonukleotide und/oder PNA-Oligomere zur Detektion von Cytosin-Methylierungen sowie ein Verfahren bereitzustellen, welches sich zur Diagnose und/oder der Therapie von genetischen und epigenetischen Parametern von Genen, die mit DNA Addukten assoziiert sind, besonders eignet. Der Erfindung liegt die Erkenntnis zugrunde, daß genetische und epigenetische Parameter und insbesondere die Cytosin-Methylierungsmuster von Genen, die mit DNA Addukten assoziiert sind, zur Diagnose und/oder der Therapie von mit DNA Addukten assoziierten Erkrankungen besonders eignen.It is the task of the present Invention that available chemically modified DNA from genes sites associated with DNA adducts and oligonucleotides and / or PNA oligomers for the detection of cytosine methylations and to provide a method which is suitable for diagnosis and / or Therapy of genetic and epigenetic parameters of genes, which are associated with DNA adducts are particularly suitable. The invention is based on the knowledge that genetic and epigenetic Parameters and especially the cytosine methylation patterns of genes, associated with DNA adducts for diagnosis and / or the Therapy of diseases associated with DNA adducts especially suitable.

Diese Aufgabe wird erfindungsgemäß durch das zur Verfügung stellen einer Nukleinsäure, die eine mindestens 18 Basen lange Sequenz der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen gemäß Tabelle 1 und dazu komplementären Sequenzen enthält, ge löst. In der Tabelle sind nach den aufgelisteten Gen-Bezeichnungen die jeweiligen Datenbanknummern (Zugangsnummern) angegeben, die die dazugehörigen Gensequenzen als einmalig definieren. GenBank am National Institute of Health wurde als die zu Grunde liegende Datenbank unter der Internet Adresse http://www.ncbi.nlm.nih.gov verwendet.This object is achieved according to the invention that available make a nucleic acid, which is an at least 18 base long sequence of chemically pretreated DNA from genes associated with DNA adducts according to a the Seq. ID No. 1 to Seq. ID No. 36 and sequences complementary thereto and / or Oligonucleotide and / or the chemically pretreated DNA of genes according to the table 1 and complementary to it Contains sequences solved. The following are the gene names listed in the table respective database numbers (access numbers) specified that the associated Define gene sequences as unique. GenBank at the National Institute of Health was considered the underlying database on the Internet Address used http://www.ncbi.nlm.nih.gov.

Die chemisch modifizierte Nukleinsäure konnte bisher nicht in Zusammenhang mit der Ermittlung von genetischen und epigenetische Parametern gebracht werden.The chemically modified nucleic acid could so far not in connection with the identification of genetic and epigenetic parameters are brought.

Die Aufgabe der vorliegenden Erfindung wird weiterhin durch ein Oligonukleotid oder Oligomer zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter DNA, umfassend mindestens eine Basensequenz mit einer Länge von mindestens 13 Nukleotiden gelöst, die an eine chemisch vorbehandelte DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene hybridisiert. Die erfindungsgemäßen Oligomersonden stellen wichtige und effektive Werkzeuge dar, welche die Ermittlung der genetischen und epigenetischen Parameter von Genen, die mit DNA Addukten assoziiert sind, erst ermöglichen. Bevorzugterweise umfaßt die Basensequenz der Oligomere mindestens ein CpG Dinukleotid. Die Sonden können auch in Form einer PNA (Peptide Nucleic Acid) vorliegen, die besonders bevorzugte Paarungseigenschaften aufweist. Besonders bevorzugt sind erfindungsgemäße Oligonukleotide, bei denen das Cytosin des CpG Dinukleotids das 5. – 9. Nukleotid vom 5'-Ende des 13-mers ist, im Falle von PNA-Oligomeren ist es bevorzugt, daß das Cytosin des CpG Dinukleotids das 4. – 6. Nukleotid vom 5'-Ende des 9-mers ist.The object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, comprising at least one base sequence with a length of at least 13 nucleotides, which is linked to a chemically pretreated DNA of genes which are associated with DNA adducts are according to one of the Seq. ID No. 1 to Seq. ID No. 36 and sequences complementary thereto and / or oligonucleotide and / or the chemically pretreated DNA of genes which are associated with DNA adducts hybridized according to one of the sequences of the genes listed in Table 1. The oligomer probes according to the invention represent important and effective tools which make it possible to determine the genetic and epigenetic parameters of genes which are associated with DNA adducts. The base sequence of the oligomers preferably comprises at least one CpG dinucleotide. The probes can also be in the form of a PNA (Peptide Nucleic Acid), which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the invention in which the cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5 'end of the 13-mer, in the case of PNA oligomers it is preferred that the cytosine of the CpG dinucleotide is the 4th - 6th nucleotide from the 5 'end of the 9-mer is.

Die erfindungsgemäßen Oligomere werden normalerweise in sogenannten Sets eingesetzt, die für jedes der CpG Dinukleotide eine der Sequenzen der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 und dazu komplementären Sequenzen aufgelisteten Gene mindestens ein Oligomer umfassen. Bevorzugt ist ein Set, das für jedes der CpG Dinukleotide aus einer der Seq ID No. 1 bis Seq ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid-und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 und dazu komplementären Sequenzen aufgelisteten Gene mindestens ein Oligomer umfaßt.The oligomers of the invention are normally used in so-called sets for each of the CpG dinucleotides one of the sequences of Seq. ID No. 1 to Seq. ID No. 36 and more complementary sequences and / or oligonucleotide and / or the chemically pretreated DNA of genes associated with DNA adducts according to a the sequences of the sequences listed in Table 1 and complementary thereto Genes include at least one oligomer. Preferred is a set that for each the CpG dinucleotides from one of the Seq ID No. 1 to Seq ID No. 36 and complementary to it Sequences and / or oligonucleotide and / or the chemically pretreated DNA from genes associated with DNA adducts according to a the sequences of the sequences in Table 1 and complementary thereto genes listed comprises at least one oligomer.

Darüber hinaus stellt die Erfindung ein Set von mindestens zwei Oligonukleotiden zur Verfügung, die als sogenannte „Primer-Oligonukleotide" zur Amplifikation von DNA-Sequenzen einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene und dazu komplementären Sequenzen oder Abschnitten davon eingesetzt werden können.The invention also provides a set of at least two oligonucleotides is available that are available as so-called "primer oligonucleotides" for amplification of DNA sequences from one of the Seq. ID No. 1 to Seq. ID No. 36 and complementary to this Sequences and / or oligonucleotide and / or the chemically pretreated DNA from genes associated with DNA adducts according to a the sequences of the genes listed in Table 1 and sequences complementary thereto or sections thereof can be used.

Im Falle der erfindungsgemäßen Sets von Oligonukleotiden ist es bevorzugt, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist.In the case of the sets according to the invention of oligonucleotides it is preferred that at least one oligonucleotide is bound to a solid phase.

Die vorliegende Erfindung betrifft weiterhin einen Satz von mindestens 10 n (Oligonukleotiden und/oder PNA-Oligomeren), die zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter genomischer DNA (Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene und dazu komplementären Sequenzen) dienen. Mit diesen Sonden ist die Diagnose und/oder Therapie von genetischen und epigenetischen Parametern von Genen möglich, die mit DNA Addukten assoziiert sind. Das Set von Oligomeren kann auch zur Detektion von Single Nucleotide Polymorphismen (SNPs) in der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene und dazu komplementären Sequenzen verwendet werden.The present invention relates to furthermore a set of at least 10 n (oligonucleotides and / or PNA oligomers) used to detect the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No. 1 to Seq. ID No. 36 and complementary Sequences and / or the chemically pretreated DNA of genes that associated with DNA adducts according to one of the sequences of the in Genes listed in Table 1 and sequences complementary thereto) are used. With These probes are the diagnosis and / or therapy of genetic and epigenetic parameters of genes possible with DNA adducts are associated. The set of oligomers can also be used for detection of single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA from genes associated with DNA adducts according to a the Seq. ID No. 1 to Seq. ID No. 36 and complementary sequences and / or oligonucleotide and / or the chemically pretreated DNA of genes associated with DNA adducts according to a the sequences of the genes listed in Table 1 and sequences complementary thereto be used.

Erfindungsgemäß ist es bevorzugt, daß eine von der Erfindung zur Verfügung gestellte Anordnung aus unterschiedlichen Oligonukleotiden und/oder PNA-Oligomeren (ein sogenanntes "Array") ebenfalls an eine Festphase gebunden vorliegt. Dieses Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen kann dadurch gekennzeichnet sein, daß es auf der Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet ist. Bevorzugterweise besteht die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold. Möglich sind jedoch auch Nitrocellulose sowie Kunststoffe wie zum Beispiel Nylon, die in Form von Kugeln oder auch als Harz-Matrizes vorliegen können.According to the invention, it is preferred that one of of the invention posed arrangement of different oligonucleotides and / or PNA oligomers (a so-called "array") also attached to a solid phase is bound. This array of different oligonucleotide and / or PNA oligomer sequences can be characterized in that that it on the solid phase in the form of a rectangular or hexagonal Grid is arranged. The solid phase surface preferably consists of Silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, Silver or gold. Possible but are also nitrocellulose and plastics such as Nylon, which can be in the form of spheres or as resin matrices.

Ein weiterer Gegenstand der Erfindung ist daher ein Verfahren zur Herstellung eines auf einem Trägermaterial fixierten Arrays zur Analyse in Zusammenhang mit DNA Addukten assoziierten Erkrankungen, bei dem mindestens ein Oligomer gemäß der Erfindung an eine feste Phase gekoppelt wird. Verfahren zur Herstellung von solchen Arrays sind zum Beispiel aus der US 5,744,305 mittels Festphasenchemie und photolabilen Schutzgruppen bekannt.The invention therefore furthermore relates to a method for producing an array fixed on a carrier material for analysis in connection with diseases associated with DNA adducts, in which at least one oligomer according to the invention is coupled to a solid phase. Methods for producing such arrays are, for example, from US Pat US 5,744,305 known by solid-phase chemistry and photolabile protecting groups.

Ein weiterer Gegenstand der Erfindung betrifft einen DNA-Chip zur Analyse in Zusammenhang mit DNA Addukten assoziierten Erkrankungen, der mindestens eine Nukleinsäure gemäß der vorliegenden Erfindung umfaßt. DNA-Chips sind zum Beispiel aus der US 5,837,832 bekannt. The invention further relates to a DNA chip for analysis in connection with diseases associated with DNA adducts, which comprises at least one nucleic acid according to the present invention. DNA chips are, for example, from the US 5,837,832 known.

Gegenstand der vorliegenden Erfindung ist zudem ein Kit, das zum Beispiel aus einer Bisulfit enthaltenden Reagenz, einem Satz von Primeroligonukleotiden umfassend mindestens zwei Oligonukleotide, deren Sequenzen jeweils mindestens einen 18 Basenpaaren langen Abschnitt der im Anhang aufgeführten Basensequenzen (Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene und dazu komplementären Sequenzen), Oligonukleotiden und/oder PNA-Oligomeren sowie einer Anleitung zur Durchführung und Auswertung des beschriebenen Verfahrens bestehen kann. Ein Kit im Sinne der Erfindung kann jedoch auch nur Teile der vorgenannten Bestandteile enthalten.Object of the present invention is also a kit that, for example, contains a bisulfite Reagent, comprising at least one set of primer oligonucleotides two oligonucleotides, the sequences of which each have at least one 18th Base pair long section of the base sequences listed in the appendix (Seq. ID No. 1 to Seq. ID No. 36 and sequences complementary thereto and / or oligonucleotide and / or the chemically pretreated DNA of genes associated with DNA adducts according to one of the Sequences of the genes listed in Table 1 and complementary sequences), Oligonucleotides and / or PNA oligomers and instructions for execution and evaluation of the described method can exist. A kit Within the meaning of the invention, however, only parts of the aforementioned can also be used Components included.

Die Erfindung stellt weiterhin ein Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von Genen, die mit DNA Addukten assoziiert sind durch Analyse von Cytosin-Methylierungen und Single Nucleotide Polymorphismen zur Verfügung, das folgende Schritte umfaßt:The invention continues Procedure for the determination of genetic and / or epigenetic parameters of genes associated with DNA adducts by analysis of Cytosine methylations and single nucleotide polymorphisms for available that includes the following steps:

In einem ersten Verfahrensschritt wird eine genomische DNA-Probe derart chemisch behandelt, daß an der 5'-Position unmethylierte Cytosinbasen in Uracil, Thymin oder eine andere vom Hybridisierungsverhalten her dem Cytosin unähnliche Base umgewandelt werden. Dies wird im folgenden unter „chemischer Vorbehandlung" verstanden.In a first process step, a genomic DNA sample is chemically treated in such a way that at the 5'-position unmethylated cytosine bases are converted into uracil, thymine or another base which is not similar to the cytosine in terms of hybridization behavior. This is described below under “chemical preparation action "understood.

Die zu analysierende genomische DNA wird bevorzugt aus den üblichen Quellen für DNA erhalten, wie Zellen oder Zellbestandteilen, zum Beispiel Zelllinien, Biopsine, Blut, Sputum, Stuhl, Urin, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin eingebettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger oder Kombinationen davon.The genomic DNA to be analyzed is preferred from the usual Sources for Get DNA, like cells or cell components, for example cell lines, Biopsins, blood, sputum, stool, urine, brain spinal fluid, tissue embedded in paraffin, for example tissue from eyes, Intestine, kidney, brain, heart, prostate, lung, breast or liver, histological slides or combinations thereof.

Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bisulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse angewendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil oder eine andere vom Basenpaarungsverhalten her dem Cytosin unähnliche Base führt.For this purpose, the one described above is preferred Treatment of genomic DNA with bisulfite (hydrogen sulfite, disulfite) and then alkaline hydrolysis applied, which does not lead to a conversion methylated cytosine nucleobases in uracil or another of Base pairing behavior leads to base that is not similar to cytosine.

Aus dieser chemisch vorbehandelten genomischen DNA werden Fragmente unter Verwendung von Sätzen von erfindungsgemäßen Primer-Oligonukleotiden und einer bevorzugterweise hitzestabilen Polymerase amplifiziert. Aus statistischen und praktikablen Erwägungen werden bevorzugterweise mehr als zehn unterschiedliche Fragmente amplifiziert, die 100 – 2000 Basenpaare lang sind. Die Amplifikation von mehreren DNA-Abschnitten kann simultan in ein und demselben Reaktionsgefäß durchgeführt werden. Üblicherweise wird die Amplifikation mittels der Polymerasekettenreaktion (PCR) durchgeführt.From this chemically pretreated genomic DNA are fragments using sets of primer oligonucleotides according to the invention and a preferably heat-stable polymerase is amplified. Statistical and practical considerations are preferred amplified more than ten different fragments, the 100 - 2000 base pairs are long. The amplification of several DNA sections can be carried out simultaneously be carried out in one and the same reaction vessel. Usually the amplification was carried out by means of the polymerase chain reaction (PCR).

In einer bevorzugten Ausführungsform des Verfahrens umfaßt der Satz von Primer-Oligonukleotiden mindestens zwei Oligonukleotide, deren Sequenzen jeweils revers komplementär oder identisch zu einem mindestens 18 Basenpaare langen Abschnitt der im Anhang (Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind gemäß einer der Sequenzen der in Tabelle 1 aufgelisteten Gene und dazu komplementären Sequenzen) aufgelisteten Basensequenzen sind. Die Primer-Oligonukleotide sind vorzugsweise dadurch gekennzeichnet, daß sie kein CpG Dinukleotid enthalten.In a preferred embodiment of the procedure includes the set of primer oligonucleotides at least two oligonucleotides, the sequences of which are reversely complementary or identical to a section of at least 18 base pairs long in the Appendix (Seq. ID No. 1 to Seq. ID No. 36 and sequences complementary thereto and / or oligonucleotide and / or the chemically pretreated DNA of genes associated with DNA adducts according to a the sequences of the genes listed in Table 1 and sequences complementary thereto) are base sequences listed. The primer oligonucleotides are preferably characterized in that it is not a CpG dinucleotide contain.

Erfindungsgemäß bevorzugt ist es, daß bei der Amplifikation mindestens ein Primer-Oligonukleotid an eine Festphase gebunden ist. Die unterschiedlichen Oligonukleotid und/oder PNA-Oligomersequenzen können auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sein, wobei die Festphasenoberfläche bevorzugt aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht, wobei auch andere Materialien, wie Nitrocellulose oder Kunststoffe verwendet werden können.According to the invention it is preferred that the Amplification at least one primer oligonucleotide bound to a solid phase is. The different oligonucleotide and / or PNA oligomer sequences can on a flat solid phase in the form of a rectangular or hexagonal Grid may be arranged, the solid phase surface being preferred made of silicon, glass, polystyrene, aluminum, steel, iron, copper, Nickel, silver or gold, but other materials, such as nitrocellulose or plastics can be used.

Die mittels der Amplifikation erhaltenen Fragmente können eine direkt oder indirekt nachweisbare Markierung tragen. Bevorzugt sind Markierungen in Form von Fluoreszenzmarkierungen, Radionukliden oder ablösbaren Molekülfragmenten mit typischer Masse, die in einem Massenspektrometer nachgewiesen werden können, wobei bevorzugt ist, dass die erzeugten Fragmente zur besseren Detektierbarkeit im Massenspektrometer eine einzelne positive oder negative Nettoladung aufweisen. Der Nachweis kann mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchgeführt und visualisiert werden.The ones obtained by amplification Fragments can bear a directly or indirectly detectable marking. Prefers are labels in the form of fluorescent labels, radionuclides or removable molecular fragments with typical mass, detected in a mass spectrometer can be it is preferred that the fragments generated for better detectability a single positive or negative net charge in the mass spectrometer exhibit. The detection can be done using matrix assisted laser desorption / ionization Mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI) carried out and be visualized.

Die im zweiten Verfahrensschritt erhaltenen Amplifikate werden anschließend an einen Satz von Oligonukleotiden und/oder PNA- Sonden der oder an ein Array hybridisiert. Die Hybridisierung erfolgt dabei auf die unten angegebene Art und Weise. Der bei der Hybridisierung verwendete Satz besteht bevorzugterweise aus mindestens 10 Oligonukleotid oder PNA-Oligomer Sonden. Die Amplifikate dienen dabei als Sonden, die an vorher an einer Festphase gebundene Oligonukleotide hybridisieren. Die nicht hybridisierten Fragmente werden anschließend entfernt. Die besagten Oligonukleotide umfassen mindestens eine Basensequenz mit einer Länge von 13 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 5. bis 9. Nukleotid vom 5'-Ende des 13-mers aus betrachtet. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden. Die besagten PNA-Oligomere umfassen mindestens eine Basensequenz mit einer Länge von 9 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 4. bis 6. Nukleotid vom 5'-Ende des 9-mers aus gesehen. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden.The second step amplificates obtained are then attached to a set of oligonucleotides and / or PNA probes which hybridize or to an array. The hybridization is done in the manner given below. The one at the Hybridization set preferably consists of at least 10 oligonucleotide or PNA oligomer Probes. The amplificates serve as probes that were previously used hybridize oligonucleotides bound to a solid phase. They don't hybridized fragments are then removed. The said Oligonucleotides comprise at least one base sequence with one length of 13 nucleotides that are reverse complementary or identical to a section of those listed in the appendix Is base sequences containing at least one CpG dinucleotide. The CpG dinucleotide cytosine is the 5th to 9th nucleotide viewed from the 5 'end of the 13-mer. For each CpG dinucleotide is an oligonucleotide. The said PNA oligomers comprise at least one base sequence with a length of 9 nucleotides that are reverse complementary or identical to a section of those listed in the appendix Is base sequences containing at least one CpG dinucleotide. The CpG dinucleotide cytosine is the 4th to 6th nucleotide from the 5 'end of the 9-mer seen from. For each CpG dinucleotide has an oligonucleotide present.

Im vierten Verfahrensschritt entfernt man die nicht hybridisierten Amplifikate.Removed in the fourth step the non-hybridized amplificates.

Im letzten Verfahrensschritt detektiert man die hybridisierten Amplifikate. Dabei ist bevorzugt, daß an den Amplifikaten angebrachte Markierungen an jeder Position der Festphase, an der sich eine Oligonukleotidsequenz befindet, identifizierbar sind.Detected in the last step the hybridized amplificates. It is preferred that the Markings placed at each position of the solid phase, at which an oligonucleotide sequence is located, can be identified are.

Erfindungsgemäß bevorzugt ist es, daß die Markierungen der Amplifikate Fluoreszenzmarkierungen, Radionuklide oder ablösbare Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden können. Der Nachweis der Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer ist bevorzugt, wobei man die Detektion mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchführen und visualisieren kann.It is preferred according to the invention that the markings of the amplicons fluorescent labels, radionuclides or removable molecular fragments with typical mass, are detected in a mass spectrometer can be. The detection of the amplificates, fragments of the amplificates or to complementary to the amplificates Probes in the mass spectrometer is preferred, taking the detection using matrix-assisted laser desorption / ionization mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI) and can visualize.

Zur besseren Detektierbarkeit im Massenspektrometer können die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen. Bevorzugt wird das vorgenannte Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von Genen, die mit DNA Addukten assoziiert sind, verwendet.For better detectability in the mass spectrometer, the fragments generated can be a single one have positive or negative net charge. The aforementioned method is preferably used to determine genetic and / or epigenetic parameters of genes which are associated with DNA adducts.

Die Oligomere gemäß der vorliegenden Erfindung oder Arrays davon, sowie ein Kit gemäß der vorliegenden Erfindung sind für die Verwendung zur Diagnose und/oder Therapie von Erkrankungen, die mit DNA Addukten assoziiert sind, durch Analyse von Methylierungsmustern von Genen, die mit DNA Addukten assoziiert sind, vorgesehen. Gemäß der vorliegenden Erfindung wird das Verfahren bevorzugterweise für die Diagnose und/oder Therapie von wichtigen genetischen und/oder epigenetische Parametern innerhalb von Genen, die mit DNA Addukten assoziiert sind.The oligomers according to the present invention or arrays thereof, and a kit according to the present invention are for the use for diagnosis and / or therapy of diseases, that are associated with DNA adducts by analyzing methylation patterns of genes associated with DNA adducts. According to the present The method is preferably invented for diagnosis and / or therapy of important genetic and / or epigenetic parameters within of genes associated with DNA adducts.

Das Verfahren gemäß der vorliegenden. Erfindung wird zum Beispiel für die Diagnose und/oder Therapie von soliden Tumoren und Krebs verwendet.The method according to the present. invention is for example for used the diagnosis and / or therapy of solid tumors and cancer.

Die erfindungsgemäßen Nukleinsäuren der vorliegenden Erfindung der Seq ID No. 1 bis Seq ID No. 36 und dazu komplementären Sequenzen und/oder Oligonukleotid- und/oder Sequenzen einer chemisch vorbehandelten DNA von Genen gemäß Tabelle 1 und dazu komplementären Sequenzen können für die Diagnose und/oder Therapie von genetischen und/oder epigenetischen Parametern von Genen, die mit DNA Addukten assoziiert sind, verwendet werden.The nucleic acids of the invention present invention of Seq ID No. 1 to Seq ID No. 36 and more complementary Sequences and / or oligonucleotide and / or sequences of a chemical pretreated DNA from genes according to table 1 and complementary to it Sequences can for the Diagnosis and / or therapy of genetic and / or epigenetic Parameters of genes associated with DNA adducts are used become.

Die vorliegende Erfindung betrifft weiterhin ein Verfahren zur Herstellung eines Diagnostikums und/oder Therapeutikums für die Diagnose und/oder Therapie von Krankheiten, die mit DNA Addukten assoziiert sind, durch Analyse von Methylierungsmustern von Genen, die mit DNA Addukten assoziiert sind, wobei das Diagnostikum und/oder Therapeutikum dadurch gekennzeichnet ist, das es mindestens eine Nukleinsäure gemäß der Erfindung, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen enthält.The present invention relates to furthermore a method for producing a diagnostic agent and / or Therapeutic for the diagnosis and / or therapy of diseases with DNA adducts are associated, by analyzing methylation patterns of genes, which are associated with DNA adducts, the diagnostic and / or Therapeutic is characterized in that there is at least one Nucleic acid according to the invention, optionally together with suitable additives and auxiliary substances contains.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Diagnostikum und/oder Therapeutikum für Krankheiten, die mit DNA Addukten assoziiert sind, durch Analyse von Methylierungsmustern von Genen, die mit DNA Addukten assoziiert sind, wobei das Diagnostikum und/oder Therapeutikum dadurch gekennzeichnet ist, das es mindestens eine Nukleinsäure gemäß der Erfindung, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen enthält.Another subject of the present The invention relates to a diagnostic and / or therapeutic agent for diseases, that are associated with DNA adducts by analyzing methylation patterns of genes associated with DNA adducts, the diagnostic and / or therapeutic agent is characterized in that it is at least a nucleic acid according to the invention, optionally together with suitable additives and auxiliary substances contains.

Die vorliegende Erfindung betrifft weiterhin die Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, bei dem die mittels der Erfindung erhaltenen bedeutenden genetischen und/oder epigenetischen Parameter innerhalb von Genen, die mit DNA Addukten assoziiert sind mit einem anderen Satz genetischen und/oder epigenetischen Parameter verglichen werden können und die so erhaltenen Unterschiede als Basis für eine Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen dienen.The present invention relates to continue to diagnose and / or predict adverse events for patients or individuals in which the significant obtained by the invention genetic and / or epigenetic parameters within genes, DNA adducts associated with a different set of genetic and / or epigenetic parameters can be compared and the differences thus obtained as the basis for a diagnosis and / or prognosis adverse events for Serve patients or individuals.

Unter dem Begriff "Hybridisierung" im Sinne der vorliegenden Erfindung ist eine Bindung unter Ausbildung einer Duplex-Struktur eines Oligonukleotids an eine vollständig komplementäre Sequenz im Sinne der Watson-Crick Basenpaarungen in der Proben DNA zu verstehen. To be understood by "stringent hybridization conditions" are those conditions in which a hybridization is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable.Under the term "hybridization" in the sense of the present Invention is a bond forming a duplex structure of an oligonucleotide to a completely complementary sequence to be understood in the sense of the Watson-Crick base pairings in the sample DNA. To be understood by "stringent hybridization conditions "are those conditions in which a hybridization is carried out at 60 ° C in 2.5 x SSC buffer, followed by several washing steps at 37 ° C in a low buffer concentration, and remains stable.

Mit dem Begriff "funktionelle Varianten" sind alle DNA-Sequenzen bezeichnet, die komplementär zu einer DNA-Sequenz sind, die unter stringenten Bedingungen mit der Referenzsequenz hybridisieren und eine zu dem entsprechenden erfindungsgemäßen Polypeptid ähnliche Aktivität aufweisen.With the term "functional variants" are all DNA sequences designated, the complementary to a DNA sequence that is under stringent conditions hybridize the reference sequence and one to the corresponding one similar polypeptide according to the invention activity exhibit.

"Genetische Parameter" im Sinne dieser Erfindung sind Mutationen und Polymorphismen von Genen, die mit DNA Addukten assoziiert sind und zu deren Regulation weiterhin erforderlicher Sequenzen. Insbesondere sind als Mutationen Insertionen, Deletionen, Punktmutationen, Inversionen und Polymorphismen und besonders bevorzugt SNPs (Single Nucleotide Polymorphisms) zu bezeichnen."Genetic Parameters "in the sense of this invention are mutations and polymorphisms of genes that are associated with DNA adducts and continue to regulate them required sequences. In particular, inserts as mutations are Deletions, point mutations, inversions and polymorphisms and particularly preferred to designate SNPs (single nucleotide polymorphisms).

"Epigenetische Parameter" im Sinne dieser Erfindung sind insbesondere Cytosin-Methylierungen und weitere chemische Modifikationen von DNA-Basen von Genen, die mit DNA Addukten assoziiert sind und zu deren Regulation weiterhin erforderliche Sequenzen. Weitere epigenetische Parameter sind beispielsweise die Acetylierung von Histonen, die jedoch mit dem beschriebenen Verfahren nicht direkt analysiert werden kann, sondern wiederum mit der DNA-Methylierung korreliert."Epigenetic Parameters "in the sense This invention is particularly cytosine methylation and other chemical Modifications of DNA bases from genes associated with DNA adducts are and sequences required for their regulation. Other epigenetic parameters include acetylation of histones, but not directly using the described method can be analyzed, but again with DNA methylation correlated.

Die vorliegende Erfindung soll nun im folgenden anhand der Sequenzen und Beispiele unter Bezug auf die beigefügte Figur weiter verdeutlicht werden, ohne hierauf eingeschränkt zu werden.The present invention is now intended in the following with reference to the sequences and examples the enclosed Figure can be clarified further without being limited to this.

11

1 zeigte die Hybridisierung von Fluoreszenz-markierten Amplifikaten an ein Oberflächen–gebundenes Oligonukleotid. Probe I stammt von einer pilocytischen Astrocytom Tumorprobe und Probe II stammt von einer Oligodendrogliom Grad II Tumorprobe. Die Fluoreszenz an einem Punkt zeigt die Hybridisierung des Amplifikats an. Die Hybridisierung an ein CG Oligonukleotid zeigt an, daß die Methylierung an der Cytosin-Position analysiert wird, die Hybridisierung an ein TG Oligonukleotid zeigt an, daß keine Methylierung an der Cytosin-Position analysiert wird. Es kann gesehen werden, daß Probe II ein höheres Ausmaß an Methylierung aufweist, als Probe I an Position 134. 1 showed the hybridization of fluorescence-labeled amplificates to a surface-bound oligonucleotide. sample I comes from a pilocytic astrocytoma tumor sample and sample II comes from an oligodendroglioma degree II Tumor sample. The fluorescence at one point indicates the hybridization of the amplificate. Hybridization to a CG oligonucleotide indicates that methylation at the cytosine position is being analyzed, hybridization to a TG oligonucleotide indicates that no methylation at the cytosine position is being analyzed. It can be seen that sample II a higher level of methylation as sample I at position 134.

Seq ID No. 1 bis Seq ID No. 36 Sequenzen, die ungerade Sequenznummern haben (z.B., Seq. ID No. 1, 3, 5,...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit DNA Addukten assoziiert sind. Sequenzen, die gerade Sequenznummern aufweisen (z.B., Seq. ID No. 2, 4, 6,...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit DNA Addukten assoziiert sind, die komplementär zu den voranstehenden Sequenzen sind (z.B., die komplementäre Sequenz zu Seq. ID No. 1 ist Seq. ID No. 2, die komplementäre Sequenz zu Seq. ID No. 3 ist Seq. ID No. 4, usw.).Seq ID No. 1 to Seq ID No. 36 sequences, which have odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, ...) show sequences of chemically pretreated genomic in each case DNAs from various genes associated with DNA adducts. Sequences that have even sequence numbers (e.g., Seq. ID No. 2, 4, 6, ...) show sequences of the chemically pretreated in each case genomic DNAs from various genes associated with DNA adducts are complementary to the above sequences are (e.g., the complementary sequence to Seq. ID No. 1 is Seq. ID No. 2, the complementary sequence to Seq. ID No. 3 is Seq. ID No. 4, etc.).

Seq. ID No. 37 bis Seq. ID No. 40 zeigen spezifische Oligonukleotid-Sequenzen, wie in Beispiel 1 verwendet.Seq. ID No. 37 to Seq. ID No. 40 show specific oligonucleotide sequences as used in Example 1.

Das folgende Beispiel betrifft ein Fragment eines Gens, das mit DNA Addukten assoziiert ist, in diesem Fall O6-Methylguanin-DNA-methyltransferase, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of a gene associated with DNA adducts in this case O6-methylguanine-DNA-methyltransferase, in which a specific CG position is analyzed for its methylation status.

Beispiel 1: Methylierungsanalyse in dem mit DNA Addukten assoziierten Gen O6-Methylguanin-DNA-methyltransferaseExample 1: Methylation analysis in the gene O6-methylguanine-DNA-methyltransferase associated with DNA adducts

Das folgende Beispiel betrifft ein Fragment des Gens O6-Methylguanin-DNAmethyltransferase, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of the gene O6-methylguanine-DNAmethyltransferase, wherein one specific CG position analyzed for its methylation status becomes.

Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The first step is a genomic Sequence using bisulfite (hydrogen sulfite, disulfite) treated in such a way that everyone not be changed at the 5-position of the base methylated cytosine so that a different base arises with regard to the base pairing behavior, while the cytosines methylated in the 5-position remain unchanged.

Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Die chemisch umgewandelte DNA (Seq. ID No. 159) dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wäßrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA bei alkalischem pH-Wert durchgeführt (10-30 Min, 90-100°C). Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens O6-Methylguanin-DNAmethyltransferase analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden AAGGTTTTAGGGAAGAGTGT (Seq. ID No. 37) und ACTCCCAATACCTCACAATA (Seq. ID No. 38) ein definiertes Fragment der Länge 222 bp amplifiziert. Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise TAAGGATACGAGTTATAT (Seq. ID No. 39), wobei sich das nachzuweisende Cytosin an Position 134 des Amplifikats befindet.If bisulfite is used for the reaction, so there is an addition to the unmethylated cytosine bases. Also have to a denaturing reagent or solvent and a radical scavenger must be present. A subsequent one leads to alkaline hydrolysis then to convert unmethylated cytosine nucleobases to Uracil. The chemically converted DNA (Seq. ID No. 159) then serves to detect methylated cytosines. In the second step dilute the treated DNA sample with water or an aqueous solution. Prefers will then desulfonation of the DNA was carried out at alkaline pH (10-30 min, 90-100 ° C). In the third Step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. In the present case, cytosines of the gene O6-methylguanine-DNAmethyltransferase analyzed. To do this, use the specific primer oligonucleotides AAGGTTTTAGGGAAGAGTGT (Seq. ID No. 37) and ACTCCCAATACCTCACAATA (Seq. ID No. 38) amplified a defined fragment of length 222 bp. This The amplificate serves as a sample that was previously on a solid phase bound oligonucleotide to form a duplex structure hybridizes, for example TAAGGATACGAGTTATAT (Seq. ID No. 39), with the cytosine to be detected at position 134 of the amplificate located.

Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.Evidence of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides, the for the amplification was used. Only if treated in the bisulfite DNA has a methylated cytosine at this point it leads to a hybridization reaction of the amplified DNA with the Oligonucleotide. Thus the methylation status of each to be examined via the hybridization product can be derived.

Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz TAAGGATATGAGTTATAT (Seq. ID No. 40). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist. Das Verfahren wurde an Zellproben von 2 Patienten durchgeführt, wobei Probe I von einer pilocytischen Astrocytom Tumorprobe und Probe II von einer Oligodendrogliom Grad II Tumorprobe stammte.To check the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide that was previously bound to a solid phase. This oligonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, except for the position in question. At the position to be analyzed, the oligonucleotide comprises a thymine base, in contrast to a cytosine base, ie the sequence TAAGGATATGAGTTATAT (Seq. ID No. 40). The hybridization reaction therefore only takes place if an unmethylated cytosine is present at the positions to be analyzed. The procedure was performed on cell samples from 2 patients, with sample I from a pilocytic astrocytoma tumor sample and sample II from an oligodendroglioma degree II Tumor sample came from.

Aus den Ergebnissen (1) kann gesehen werden, daß Probe II ein höheres Ausmaß an Methylierung aufweist, als Probe I an Position 134.From the results ( 1 ) can be seen that sample II has a higher level of methylation than sample I at position 134.

Beispiel 2: Diagnose von mit DNA Addukten assoziierten ErkrankungenExample 2: Diagnosing diseases associated with DNA adducts

Um einen Bezug der Methylierungsmuster zu einer der mit DNA Addukten assoziierten Erkrankungen herzustellen, bedarf es zunächst der Untersuchung der DNA-Methylierungsmuster einer Gruppe von erkrankten und einer Gruppe von gesunden Personen. Diese Untersuchungen werden zum Beispiel analog dem Beispiel 1 durchgeführt. Die so erhaltenen Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. Dies kann durch Bestimmung einzelner CpG Methylierungsraten erfolgen, wie dies z. B. durch Sequenzieren relativ ungenau oder aber durch eine Methylierungs-sensitive „Primer-Extension-Reaktion" sehr genau möglich ist. Auch gleichzeitige Analyse des gesamten Methylierungsstatus ist möglich, und die Muster können z.B. mittels Clustering-Analysen, die z.B. durch einen Rechner durchgeführt werden können, verglichen werden.In order to establish a relationship between the methylation pattern and one of the diseases associated with DNA adducts, it is first necessary to examine the DNA methylation pattern of a group of sick and a group of healthy people. These tests are carried out, for example, analogously to Example 1. The results obtained in this way are stored in a database and the CpG Di identified nucleotides that are methylated differently between the two groups. This can be done by determining individual CpG methylation rates. B. by sequencing relatively imprecise or by a methylation-sensitive "primer extension reaction" is possible very precisely. Simultaneous analysis of the entire methylation status is also possible, and the patterns can be carried out, for example, by means of clustering analyzes, for example carried out by a computer can be compared.

Nachfolgend ist es möglich, untersuchte Patienten einer bestimmten Therapiegruppe zuzuordnen und diese Patienten gezielt mit einer individualisierten Therapie zu behandeln.Below it is possible to be examined Assign patients to a specific therapy group and these patients targeted treatment with individualized therapy.

Beispiel 2 kann zum Beispiel für Krebs und solide Tumore durchgeführt werden:Example 2 can be for example for cancer and solid tumors performed become:

Tabelle 1Table 1

Auflistung von bevorzugten Genen gemäß der vorliegenden Erfindung, die mit DNA Addukten assoziiert sind.List of preferred genes according to the present Invention associated with DNA adducts.

Figure 00170001
Figure 00170001

Diagramme 1 diagrams 1

1 zeigte die Hybridisierung von Fluoreszenz-markierten Amplifikaten an ein Oberflächen–gebundenes Oligonukleotid. Probe I stammt von einer pilocytischen Astrocytom Tumorprobe und Probe II stammt von einer Oligodendrogliom Grad II Tumorprobe. Die Fluoreszenz an einem Punkt zeigt die Hybridisierung des Amplifikats an. Die Hybridisierung an ein CG Oligonukleotid zeigt an, daß die Methylierung an der Cytosin-Position analysiert wird, die Hybridisierung an ein TG Oligonukleotid zeigt an, daß keine Methylierung an der Cytosin-Position analysiert wird. Es kann gesehen werden, daß Probe II ein höheres Ausmaß an Methylierung aufweist, als Probe I an Position 134. 1 showed the hybridization of fluorescence-labeled amplificates to a surface-bound oligonucleotide. sample I comes from a pilocytic astrocytoma tumor sample and sample II comes from an oligodendroglioma degree II Tumor sample. The fluorescence at one point indicates the hybridization of the amplificate. Hybridization to a CG oligonucleotide indicates that methylation at the cytosine position is being analyzed, hybridization to a TG oligonucleotide indicates that no methylation at the cytosine position is being analyzed. It can be seen that sample II has a higher level of methylation than sample I at position 134.

Claims (14)

Nukleinsäure der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind, umfassend einen mindestens 18 Basen langen Sequenzabschnitt gemäß einer der Sequenzen ausgewählt aus der Gruppe von Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementärer Sequenzen.nucleic acid the chemically pretreated DNA of genes with DNA adducts are associated, comprising an at least 18 base long sequence section according to one of the sequences selected from the group of Seq. ID No. 1 to Seq. ID No. 36 and complementary sequences. Nukleinsäure der chemisch vorbehandelten DNA von Genen, die mit DNA Addukten assoziiert sind, umfassend einen mindestens 18 Basen langen Sequenzabschnitt gemäß einer der Sequenzen gemäß einem der Gene MGMT (NM_002412) und RFC4 (NM_002916) und dazu komplementärer Sequenzen.nucleic acid the chemically pretreated DNA of genes with DNA adducts are associated, comprising an at least 18 base long sequence section according to one of the sequences according to one of the MGMT (NM_002412) and RFC4 (NM_002916) genes and sequences complementary thereto. Oligomer, insbesondere Oligonukleotid oder Peptide Nucleic Acid (PNA)-Oligomer, wobei das Oligomer in jedem Fall mindestens eine Basensequenz mit einer Länge von mindestens 9 Nukleotiden umfaßt, die an eine chemisch vorbehandelte DNA von Genen gemäß einer der Seq. ID No. 1 bis Seq. ID No. 36 nach Anspruch 1 oder eine chemisch vorbehandelte DNA von Genen nach Anspruch 2 und dazu komplementären Sequenzen hybridisiert oder dazu identisch ist.Oligomer, especially oligonucleotide or peptide nucleic acid (PNA) oligomer, the oligomer in each case at least one Base sequence with a length of at least 9 nucleotides that are chemically pretreated to one DNA from genes according to a the Seq. ID No. 1 to Seq. ID No. 36 according to claim 1 or a chemical pretreated DNA of genes according to claim 2 and sequences complementary thereto hybridized or identical to it. Oligomer nach Anspruch 3, wobei die Basensequenz mindestens ein CpG Dinukleotid umfaßt.The oligomer of claim 3, wherein the base sequence is at least comprises a CpG dinucleotide. Oligomer nach Anspruch 3, dadurch gekennzeichnet, daß sich das Cytosin des CpG Dinukleotids in etwa im mittleren Drittel des Oligomers befindet.Oligomer according to claim 3, characterized in that the Cytosine of the CpG dinucleotide in approximately the middle third of the oligomer located. Satz von Oligomeren, umfassend mindestens zwei Oligomere nach einem der Ansprüche 3 bis 5.Set of oligomers comprising at least two oligomers after one of the claims 3 to 5. Satz von Oligomeren nach Anspruch 6, umfassend Oligomere zur Detektion des Methylierungszustandes aller CpG Dinukleotide von einer der Sequenzen gemäß einer der Seq. ID No. 1 bis Seq. ID No. 36 nach Anspruch 1 oder einer chemisch vorbehandelten DNA von Genen nach Anspruch 2 und dazu komplementärer Sequenzen.A set of oligomers according to claim 6, comprising oligomers for Detection of the methylation state of all CpG dinucleotides from one of the sequences according to one the Seq. ID No. 1 to Seq. ID No. 36 according to claim 1 or one chemically pretreated DNA of genes according to claim 2 and sequences complementary thereto. Satz von mindestens zwei Oligonukleotiden nach Anspruch 3, die als Primer-Oligonukleotide zur Amplifikation von DNA-Sequenzen einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementären Sequenzen oder einer chemisch vorbehandelten DNA von Genen nach Anspruch 2 und dazu komplementären Sequenzen oder Abschnitten davon eingesetzt werden können.Set of at least two oligonucleotides according to claim 3, which are used as primer oligonucleotides for amp lification of DNA sequences of one of the Seq. ID No. 1 to Seq. ID No. 36 and sequences complementary thereto or a chemically pretreated DNA of genes according to claim 2 and sequences or sections thereof complementary thereto. Satz von Oligonukleotiden nach Anspruch 8, dadurch gekennzeichnet, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist.Set of oligonucleotides according to claim 8, characterized in that that at least an oligonucleotide is bound to a solid phase. Auf einem Trägermaterial fixierten Anordnung von unterschiedlichen Oligomeren (Array) zur Analyse von in Zusammenhang mit dem Methylierungszustand der CpG Dinukleotide einer der Seq. ID No. 1 bis Seq. ID No. 36 und dazu komplementärer Sequenzen und/oder einer chemisch vorbehandelten DNA von Genen nach Anspruch 2 stehenden Erkrankungen, bei dem mindestens ein Oligomer nach einem der Ansprüche 3 bis 5 an eine feste Phase gekoppelt vorliegt.On a carrier material fixed arrangement of different oligomers (array) for Analysis of CpG related to the methylation state Dinucleotides one of the Seq. ID No. 1 to Seq. ID No. 36 and more complementary Sequences and / or a chemically pretreated DNA from genes Claim 2 diseases, in which at least one oligomer according to one of the claims 3 to 5 is coupled to a fixed phase. Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen nach Anspruch 10, dadurch gekennzeichnet, daß diese auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sind.Array of different oligonucleotide and / or PNA oligomer sequences according to claim 10, characterized in that this on a flat solid phase arranged in the form of a rectangular or hexagonal grid are. Array nach einem der Ansprüche 10 oder 11, dadurch gekennzeichnet, daß die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold zusammengesetzt ist.Array according to one of the claims 10 or 11, characterized in that the solid phase surface Silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, Silver or gold is composed. DNA- und/oder PNA-Array zur Analyse von in Zusammenhang mit dem Methylierungszustand von Genen stehenden Erkrankungen, der mindestens eine Nukleinsäure nach einem der voranstehenden Ansprüche umfaßt.DNA and / or PNA array for analysis related to the methylation state of genes related diseases, the minimum a nucleic acid according to one of the preceding claims. Kit, umfassend ein Bisulfit (= Disulfit, Hydrogensulfit) Reagenz sowie Oligonukleotide und/oder PNA-Oligomere nach einem der Ansprüche 3 bis 5.Kit comprising a bisulfite (= disulfite, hydrogen sulfite) reagent as well as oligonucleotides and / or PNA oligomers according to one of claims 3 to 5th
DE20121965U 2000-04-06 2001-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle Expired - Lifetime DE20121965U1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE20121965U DE20121965U1 (en) 2000-04-06 2001-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
DE10019058A DE10019058A1 (en) 2000-04-06 2000-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10019058.8 2000-04-06
DE10019173.8 2000-04-07
DE10019173 2000-04-07
DE10032529.7 2000-06-30
DE10032529A DE10032529A1 (en) 2000-06-30 2000-06-30 Diagnosis of major genetic parameters within the Major Histocompatibility Complex (MHC)
DE10043826.1 2000-09-01
DE10043826 2000-09-01
EP01927895A EP1272670A2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna adducts
DE20121965U DE20121965U1 (en) 2000-04-06 2001-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle

Publications (1)

Publication Number Publication Date
DE20121965U1 true DE20121965U1 (en) 2003-12-24

Family

ID=30119358

Family Applications (1)

Application Number Title Priority Date Filing Date
DE20121965U Expired - Lifetime DE20121965U1 (en) 2000-04-06 2001-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle

Country Status (1)

Country Link
DE (1) DE20121965U1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1693468A1 (en) 2005-02-16 2006-08-23 Epigenomics AG Method for determining the methylation pattern of a polynucleic acid
US7932027B2 (en) 2005-02-16 2011-04-26 Epigenomics Ag Method for determining the methylation pattern of a polynucleic acid
EP2481810A1 (en) 2005-04-15 2012-08-01 Epigenomics AG A method for providing DNA fragments derived from a remote sample

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1693468A1 (en) 2005-02-16 2006-08-23 Epigenomics AG Method for determining the methylation pattern of a polynucleic acid
US7932027B2 (en) 2005-02-16 2011-04-26 Epigenomics Ag Method for determining the methylation pattern of a polynucleic acid
EP2481810A1 (en) 2005-04-15 2012-08-01 Epigenomics AG A method for providing DNA fragments derived from a remote sample
US10731215B2 (en) 2005-04-15 2020-08-04 Epigenomics Ag Method for determining the presence or absence of methylation in a sample

Similar Documents

Publication Publication Date Title
DE60126593T2 (en) DIAGNOSIS OF DISEASES ASSOCIATED WITH APOPTOSIS BY MEANS OF DETERMINATION OF THE METHYLATION STATE OF APOPTOSIS-ASSOCIATED GENES
DE10151055B4 (en) Method for detecting cytosine methylation in CpG islands
WO2002000928A2 (en) Diagnosis of diseases associated with the immune system by determining cytosine methylation
DE10132212B4 (en) Method for the detection of cytosine methylation by comparative analysis of the single strands of amplicons
DE10154317B4 (en) Method for the detection of cytosine methylations in immobilized DNA samples
DE10161625A1 (en) Methods and nucleic acids for the analysis of a pulmonary cell division disorder
DE10128508A1 (en) Methods and nucleic acids for the differentiation of prostate tumors
DE20121960U1 (en) New nucleic acid derived from chemically treated metastasis genes, useful for diagnosis of cancers by analysis of cytosine methylation, also for treatment
DE10061338A1 (en) Diagnosis of diseases associated with angiogenesis
WO2002036814A2 (en) Diagnosis of diseases associated with cdk4 by determining the methylation state of the cdk4
EP1339873B1 (en) Diagnosis of diseases associated with the human c-mos gene
DE10037769A1 (en) Diagnosis of diseases associated with CD24
DE10128509A1 (en) Methods and nucleic acids for the differentiation of prostate and kidney carcinomas
DE20121965U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE20121964U1 (en) New nucleic acid, useful for diagnosis and therapy of metabolic disease, solid tumor and cancers, comprises segment of chemically modified genomic sequences of genes associated with metabolism
DE20121974U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
EP1432827B1 (en) Method for detecting dna methylation using labelled s-adenosylmethionine analogs
DE20121961U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE20121967U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE20121969U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE20121968U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10230692A1 (en) Methods and nucleic acids for the analysis of methylation patterns within the DD3 gene
DE20121979U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE20121963U1 (en) Nucleic acids for the diagnosis of diseases associated with developmental genes
DE20121973U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle

Legal Events

Date Code Title Description
R207 Utility model specification

Effective date: 20040205

R150 Term of protection extended to 6 years

Effective date: 20040107

R151 Term of protection extended to 8 years

Effective date: 20070630

R152 Term of protection extended to 10 years

Effective date: 20090520

R071 Expiry of right