EP1268764A2 - Method for obtaining nucleic acids from an environment sample - Google Patents

Method for obtaining nucleic acids from an environment sample

Info

Publication number
EP1268764A2
EP1268764A2 EP00985340A EP00985340A EP1268764A2 EP 1268764 A2 EP1268764 A2 EP 1268764A2 EP 00985340 A EP00985340 A EP 00985340A EP 00985340 A EP00985340 A EP 00985340A EP 1268764 A2 EP1268764 A2 EP 1268764A2
Authority
EP
European Patent Office
Prior art keywords
vector
characterized
dna
method
according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00985340A
Other languages
German (de)
French (fr)
Inventor
Maria Ball
Carmela Cappellano
Sophie Courtois
François FRANCOU
Asa Frostegard
Michel Guerineau
Pascale Jeannin
Jean-Luc Pernodet
Alain Raynal
Guennadi Sezonov
Pascal Simonet
Karine Tuphile
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharma SA
Original Assignee
Aventis Pharma SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to FR9915032 priority Critical
Priority to FR9915032A priority patent/FR2801609B1/en
Priority to US20980000P priority
Priority to US209800P priority
Application filed by Aventis Pharma SA filed Critical Aventis Pharma SA
Priority to PCT/FR2000/003311 priority patent/WO2001040497A2/en
Publication of EP1268764A2 publication Critical patent/EP1268764A2/en
Application status is Withdrawn legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor

Abstract

The invention concerns a method for preparing nucleic acids from an environment sample, more particularly a method for obtaining a library of nucleic acids from a sample. The invention also concerns nucleic acids of nucleic acid libraries obtained by said method their use in the synthesis of novel compounds, in particular novel compounds of therapeutic interest. The invent further concerns novel means used in the method for obtaining said nucleic acids, such as novel vectors and novel processes for preparing such vectors or recombinant host cells containing said nucleic acid. Finally, the invention concerns methods for detecting a nucleic acid of interest within a library of nucleic acids resulting from said method, and nucleic acids detected by said method and polypeptides encoded by said nucleic acids.

Description

A process for obtaining nucleic acids from a sample of the environment, nucleic acids thus obtained and their application to the synthesis of new compounds

The present invention relates to a method of preparing nucleic acids from an environmental sample, more particularly a method for obtaining a collection of nucleic acids from a sample. The invention also relates to nucleic acids or collections of nucleic acids obtained by the process and their application to the synthesis of novel compounds, including novel compounds of therapeutic interest.

The invention also relates to the new means used in the method of obtaining nucleic acid above, such as novel vectors and novel processes for preparing such vectors or recombinant host cells comprising an acid nucleic of the invention.

The invention further relates to methods for detecting a nucleic acid of interest in a collection of nucleic acids obtained according to the above method, as well as nucleic acid detected by such a method and the polypeptides encoded by such nucleic acids.

The invention also relates to nucleic acids obtained and detected according to the above processes, especially nucleic acids encoding an enzyme involved in the biosynthetic pathway for antibiotics such as β-lactams, aminoglycosides, nucleotides heterocyclic or polyketides as well as the enzyme encoded by such nucleic acids, polyketides produced through the expression of these nucleic acids and finally pharmaceutical compositions comprising a pharmacologically active amount of a polyketide produced through the expression of such nucleic acids.

Since the discovery of streptomycin production by actinomycetes, the search for new compounds of therapeutic interest, especially new antibiotics, resorted to increased screening methods metabolites produced by microorganisms ground. Such methods are mainly to isolate the organisms of the soil microorganisms to grow on nutrient media specially adapted and detecting a pharmacological activity in the products found in the culture supernatants or cell lysates having, where appropriate, been first one or more steps of separation and / or purification.

Thus, the methods of isolation and in vitro culture of organizations constituting the soil microbial allowed at today's date, characterize about 40,000 molecules, of which about half has biological activity.

Major products were characterized according to such methods of in vitro culture, such as antibiotics (penicillin, erythromycin, actinomycin, tetracycline, cephalosporin), anticancer, anti-cholesterol or of pesticides. The products of microbial therapeutic interest known today come mainly (about 70%) of the actinomycetes group and particularly the genus Streptomyces. However, other therapeutic compounds, such as teicoplanines, gentamicin and spinosines were isolated from micro kinds of organizations more difficult to grow as Micromonospora, Actinomadura, Actinoplanes, Nocardia, Streptosporangium, Kitasatosporia or Saccharomonospora .

But practice shows that the characterization of new natural products synthesized by organisms of the soil microflora has been limited, in part because the in vitro culture step usually leads to a selection of already known organisms previously.

The methods of separation and in vitro cultivation of soil organisms to identify new compounds of interest thus have many limitations.

In actinomycetes, for example, antibiotics rediscovery rates already known previously is about 99%. Indeed, in fluorescence microscopy techniques have a count greater than 10 10 bacteria cells in 1g soil, while only 0.1 to 1% of these bacteria can be isolated after seeding of culture media.

Using DNA reassociation kinetics techniques, it has been shown that between 12,000 and 18,000 bacterial species may be contained in 1g of soil, so that to date, only 5,000 non-eukaryotic organisms have been described while confused habitat.

Molecular ecology studies have amplify and clone many new 16S rDNA sequences of DNA from the environment. The results of these studies led to triple the number of bacterial divisions previously characterized.

At today's date, bacteria are divided into 40 divisions, some of them being formed by bacteria that can be grown. These results reflect the extent of microbial biodiversity remained untapped to date.

Recent studies have attempted to overcome the many obstacles to access to the biodiversity of soil microflora, including the in vitro culture step prior to the isolation and characterization of compounds of industrial interest, especially of therapeutic interest.

Methods have been developed that include a step of extracting DNA from soil organisms, if appropriate after prior isolation of organisms in soil samples. The DNA thus extracted after lysis of bacterial cells without prior culture step in vitro, is cloned into vectors used to transfect host organisms, in order to form DNA libraries from soil bacteria.

These recombinant clone banks are used to detect the presence of genes encoding compounds of therapeutic interest, or alternatively to detect the production of compounds of therapeutic interest by these recombinant clones.

However, direct access methods to the DNA of the soil microflora, described in the prior art have drawbacks in the implementation of each of the steps described above, likely to significantly affect quantity and quality of genetic material obtained and usable.

The prior art relating to each of the DNA library construction steps from soil samples is described in detail below, as well as the technical drawbacks identified by the applicant and have been overcome according to the present invention.

1. DNA extraction step from a soil sample.

1.1 direct DNA extraction from the environment.

This is essentially a process employing DNA extraction techniques performed directly on the sample in the environment, usually after prior in situ lysis of the sample bodies.

Such techniques have been carried out on samples from aquatic environments, either freshwater or marine. It includes a first step of pre-concentration of cells present freely or in particulate form, generally consisting of a filtration of large volumes of water on various filtration devices, for example conventional membrane filtration, tangential or rotational filtration or ultrafiltration . The pore size is between 0.22 and 0.45 mm and often requires a pre-filter in order to avoid blockages due to the treatment of large volumes.

In a second stage, the harvested cells are lysed directly on the filters in small volumes of solutions, enzyme treatment and / or chemical.

This technique is for example illustrated by the work of Stein et al. , 1996, Journal of Bacteriology, Vol.178 (3): 591-599 describes the cloning of genes coding for ribosomal DNA and a transcriptional elongation factor (EF 2) from the Archaebacteria marine plankton. direct extraction techniques of DNA from samples of soil or sediment have also been described, based on physical lysis protocols, chemical or enzymatic performed in situ. For example, U.S. Patent No. 5, 824.485 (Chromaxome

Corporation) discloses a chemical lysis of the bacteria directly on the sample by addition of hot lysis buffer based on guanidium isothiocyanate.

International Application No. WO 99 / 20,799 (WISCONSIN ALUMNI RESEARCH FOUNDATION) discloses a bacterial lysis step in situ using an extraction buffer containing protease and SDS.

Other techniques have also been used such as the achievement of several freeze-thaw cycles of the sample and then pressing the high pressure thawed sample. Were also used techniques lysis of the bacteria by means of a succession of steps sonication, heating by microwave and thermal shock (Picard et al. (1992).

However, direct DNA extraction techniques of the prior art described above have a very variable effectiveness of quantitative and qualitative point of view.

Thus, chemical or enzymatic treatments in situ in the sample have the disadvantage of not lyse certain classes of microorganisms due to the selective resistance of various micro-native organisms in the lysis step due to their heterogeneous morphology .

Thus, Gram-positive bacteria are resistant to a heat treatment in SDS detergent while almost all of the cells to Gram-negative are lysed. In addition, some of the direct extraction described above promote adsorption of nucleic acids extracted protocols on the mineral particles of the sample, thereby significantly reducing the quantity of DNA available.

Furthermore, although some protocols prior art disclose a mechanical processing step to lyse the micro-organisms collected sample, such mechanical disruption step is routinely carried out in liquid medium in an extraction buffer, which does not allow good homogenization of the starting sample in the form of fine particles allows maximum accessibility to the diversity of organisms present in the sample. Grinding tests were also carried out on raw soil sample with glass beads, but the amount of DNA extracted was low.

It has been observed according to the invention a first step of mechanical lysis in situ in the liquid medium had a negative effect on the amount of DNA may be extracted.

The amount of DNA used directly for cloning into recombinant vectors is also impacted by subsequent purification steps to extraction. In the prior art, the extracted DNA is then purified, for example by using polyvinylpolypyrrolidone, by precipitation in the presence of ammonium or potassium acetate, by centrifugation on a cesium chloride gradient, or chromatographic techniques, including hydroxyapatite medium on an ion exchange column or molecular sieving or by electrophoresis techniques on agarose gel.

DNA purification techniques previously described, especially when they are combined with the DNA extraction techniques of the above-mentioned environment, are likely to lead to a co-purification of DNA with inhibitory compounds from of the original sample that are difficult to remove.

The co-extraction of inhibitor compounds with DNA requires the multiplication of the number of purification steps which leads to significant losses of DNA initially extract and simultaneously reduces the diversity of the initially contained in the sample gene material, its quantity.

Another object of the invention was to overcome the drawbacks of prior purification protocols and to develop one step of DNA purification to maintain optimally the diversity of the DNA of the initial sample of one hand, and, quantitatively promote its obtaining, on the other.

In particular, the qualitative and quantitative improvements to the DNA purification are greatest when they use a combination of a direct method for extracting DNA of the invention and a subsequent purification process, as will be described below.

1.2. indirect DNA extraction from the environment.

Such techniques utilize a first separation step of the different organisms of the soil microorganisms of other starting sample components prior to the extraction of the actual DNA step. In the prior art, the prior separation of a microbial fraction of a soil sample usually comprises a physical dispersion of the sample by grinding it in a liquid medium, for example using devices of the type Waring Blender or a mortar. It has also been described chemical dispersions, for example on ion exchange resins or dispersions using nonspecific detergents such as sodium deoxycholate or polyethylene glycol. Whatever the mode dispersion, the solid sample must be suspended in water, phosphate buffer or saline.

Physical or chemical dispersion step may be followed by centrifugation on density gradient for separation of the cells contained in the sample and the particles of the latter, it being understood that the bacteria have densities less than those of most of soil particles.

Physical dispersion step may also be alternatively followed by a centrifugation step at low speed or a cell elutriation step.

The DNA can then be extracted from the cells separated by all lysis methods available and be purified by many methods, including purification methods described in the previous paragraph 1.1. In particular, the inclusion of the cells in agarose low melting point can be carried out in order to provide lysis. However, the methods described in the state of the known art of the applicant are not satisfactory due to the presence, in the fractions containing DNA extract, undesirable components of the starting sample having a significant influence on the quality and the amount of final DNA. The present invention proposes to solve the technical difficulties encountered in the processes of the prior art as described below.

2. Molecular characterization of the DNA extracted.

When one wishes to construct a DNA library from an environmental sample, especially from a soil sample, it is advantageous to check the quality and diversity of the source of DNA extracted and purified beforehand in its insertion into suitable vectors.

The objective of such a molecular characterization of the DNA is extracted and purified to obtain profiles representing the proportions of the different taxons present in this DNA sample. The molecular characterization of the DNA extracted and purified to determine whether artifacts were introduced during the implementation of the various stages of extraction and purification and, where appropriate, if the diversity of origin of the DNA extracted and purified is representative of the microbial diversity initially present in the sample, especially in the soil sample. To the applicant's knowledge, employed in the prior art for quantitative hybridization methods employing specific oligonucleotide probes of different bacterial groups, applied directly to the DNA extracted from the environment. Unfortunately, this approach is very sensitive and does not detect gender or taxonomic groups present in low abundance.

The prior art also describes quantitative PCR methods, such as the MPN-PCR or quantitative PCR by competition. However, these techniques have significant drawbacks.

Thus the MPN-PCR is a complex use because of the proliferation of dilutions and repeats making it unsuitable for a large number of samples or pairs of primers.

Moreover, quantitative PCR competition is a difficult implementation because of the need to build a specific competitor to the target DNA, which also does not cause bias or artifacts in the competition proper called. It is thus proposed according to the invention a method of prescreening a DNA library from an environmental sample that is both rapid, simple and reliable and enables to test the quality of DNA extracted previously and purified and thereby determine the interest to construct a library of clones prepared from this purified DNA of departure.

3. Vectors for cloning of the DNA extracted and purified from a sample of the environment.

Many vectors have been described in the prior art in order to clone DNA previously extracted from a sample of the environment.

Thus, as described in the international application No. WO 99 / 20,799 can be used viral vectors, phages, plasmids, phagemids, cosmids, phosmids, BAC type vectors (bacterial artificial chromosome) or the P1 bacteriophage, PAC type vectors (artificial chromosome based on the bacteriophage P1), vectors of the type YAC (yeast artificial chromosome), yeast plasmids or other vector capable of maintaining and expressing a stably genomic DNA.

Example 1 of the PCT application No. WO 99 / 20,799 describes the construction of a genomic DNA library cloned into a vector of the BAC type.

To the applicant's knowledge, no DNA library from an environmental sample had been effectively achieved with conjugative type vectors, one such technique is made for the first time accessible and reproducible by the man the art from the teaching of the present invention.

4. Cellular Hosts

In the prior art, many host cells have been described as being used to house the vectors containing the DNA inserts from the DNA extracted and purified from a sample of the environment.

Thus, the PCT Application No. WO 99/20799 cites many appropriate host cells, such as Escherichia coli, in particular the strain DH 10B or strain 294 (ATCC 31446, E. coli strain B, E. coli X 1776 (ATCC No. 31537), E.coli DH5 α and E. coli W3110

(ATCC No. 27325).

This PCT application also refers to other appropriate host cells such as Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, Serratia, Schigella or strains of Bacillus such as B. subtilis and β. licheniformis and bacteria of the genus

Pseudomonas, Streptomyces or Actinomyces.

U.S. Patent No. 5, 824.485 mentions in particular the strain Streptomyces lividans TK66 or yeast cells such as Saccharomyces pombe.

5. Characterization of genes of interest in DNA libraries from an environmental sample. The PCT application No. WO 99/20 799 discloses an identification of phenotype of different clones belonging to the DNA library of B.cereus, respectively a clone producing hemolysin, a clone hydrolyze esculin or a clone producing a orange pigment. mutagenesis techniques based on the use of a transposon coding for the enzyme pho A have subsequently led to the isolation of the mutated clones and characterize the sequences responsible for the observed phenotypes.

The article by Stein et al. (1996) cited above describes the use of primers specific for the ribosomal DNA in order to amplify the inserted DNA in the vectors harbored by some clones of a genomic DNA library of marine plankton Archaebacteria and identification more coding sequences in the DNA thus amplified.

The article of BORSCHERT S. et al., (1992) describes the screening of a genomic DNA of Bacillus subtilis bank using hybridizing primer pairs with the conserved regions of known peptide synthetases to identify one or more genes corresponding to the genome of Bacillus subtilis.

This technique allowed to detect a chromosomal DNA fragment of about 26 kb carrying part of the surfactin biosynthetic operon.

Section Kah-TONG S. et al. (1997) described the screening of a DNA library from soil using primers hybridizing to conserved sequences of the operon responsible for the biosynthetic pathway Type II polyketides and shows the identification within this DNA library of related sequences PKS-β gene. This article also describes the construction of hybrid expression cassettes in which the sequence of the PKS subunit-β, found naturally in the operon responsible for the biosynthesis of polyketides, has been replaced by different related sequences found in the bank of DNA.

Similarly, article HONG FU et al. (1995) describes the construction of expression cassettes containing different reading frames open operon responsible for the biosynthesis of polyketides, the different expression cassettes have been artificially constructed by combining the open reading frames that are not found together naturally in the genome of Streptomyces coelicolor. This article shows that the combination, in artificial expression cassettes, open reading frames from different bacterial strains allows production of polyketides with different structural characteristics and antibiotics smaller or larger vis-à-vis Bacillus subtilis activities and Bacillus cereus.

The polyketides are part of a large family of natural products of varying structure and having a variety of biological activities. Are part of polyketides such as tetracyclines and erythromycin (antibiotic), FK506 (immunosuppressive), doxorubicin (anticancer agent), monensin (coccidiostatic agent) and avermectin (antiparasitic agent).

These molecules are synthesized through multifunctional enzymes called polyketide synthases that catalyze condensation of repeated cycles between acyl thioesters (usually acetyl, propionyl, malonyl or methylmalonyl thioesters). Each condensation cycle results in the formation of a carbon-growing chain, a β-keto group can then undergo, if appropriate, one or more reducing steps series.

Given the significant clinical benefit of polyketides, their common mechanism of biosynthesis and the high degree of conservation observed between the groups of genes encoding polyketide synthases, it developed an increased interest in the development of new polyketides by genetic engineering.

New artificial polyketides have been produced by genetic engineering, such as A or méderrhodine dihydrogranatirhodine. The vast majority of new molecules of genetically engineered polyketides are very different from the structural point of view, natural corresponding polyketides.

From the state of the art, and it appears that there is a need to obtain novel polyketides interest and especially polyketides of therapeutic interest with particular over their natural counterparts, an increased level of antibiotic activity or a different antibiotic spectrum of activity, is wider than that of known polyketides, that is no selective contrary.

This need is, as will be described below, partly filled according to the present invention.

DISCLOSURE OF INVENTION

The invention relates firstly to a method for the construction of DNA libraries from an environmental sample, such a sample may be either an aquatic (marine or fresh water), a soil sample (layer surface of the soil, sediment or basement), or a sample of eukaryotic organisms containing an associated microflora, such as for example a sample derived from plants, insects or marine organisms and having an associated microflora.

The development of a method of constructing a sample of a DNA library of the environment, especially a soil sample, comprising critical stages, the implementation must necessarily be optimized for obtaining a DNA library whose content of nucleic acids of interest meets the initially set objectives.

A critical first step in the extraction and subsequent purification of nucleic acids originally contained in the sample, that is to say mainly nucleic acids contained in the various organizations component microflora of this sample.

The quality of the purification of the DNA extracted key influence on the result.

A second major step of a method of constructing a nucleic acid library from an environmental sample is the evaluation of the genetic diversity of nucleic acid extracted and purified. The development of a simple and reliable manufacturing step of pre-screening the DNA extracted and purified to ensure that it reflects, at least partially, to the phylogenetic diversity of the organisms present in the sample initially initially, makes it possible to determine the interest or not to use the original source of DNA extracted and purified for the construction of the nucleic acid library itself or, conversely, not to continue the construction of the library of nucleic acids due to excessive artifacts introduced during the extraction and purification of nucleic acids. It was further found according to the invention that the quality of the inserts introduced into the vectors to construct the library is decisive. It has thus been determined that the use of restriction enzymes to cleave the DNA extracted and purified from the environmental sample was likely to introduce artifacts or "bias" in the structure of the inserts obtained. Indeed, DNA extracted from soil or other environments, from the vast majority of non-culturable organisms, consists of molecules whose rate bases G and C is by definition unknown and more variable depending on the origin of these organizations.

A third critical step is the insertion of nucleic acid extracted and purified in vectors able to integrate nucleic acids of selected length, on the one hand, and, on the other hand, to allow the transfection or the integration into the genome in host cells determined and, if so, to enable expression in such host cells.

Constitute vectors of interest, vectors able to integrate nucleic acids of large size, that is to say greater than 100 kb in size when the objective is a cloning and identification of a. complete operon capable of directing a complete biosynthetic pathway for a compound of industrial interest, in particular a compound of pharmaceutical or agronomic interest.

DEFINITIONS

Within the meaning of the present invention, the term "nucleic acid", "polynucleotide" and "oligonucleotide" as well as DNA sequences, RNA sequences as hybrid RNA / DNA of more than 2 nucleotides, either in the single stranded or double stranded form. The term "library" or "collection" is used herein interchangeably with reference to a set of extracted nucleic acids and, if appropriate purified, from an environmental sample, a set of recombinant vectors, each of the recombinant vectors of the set comprising a nucleic acid from the set of extracted nucleic acids and, if appropriate purified above, as well as a set of recombinant host cells comprising one or more nucleic acids from the all extracted nucleic acids and, if appropriate, purified above, said nucleic acids being either carried by one or more recombinant vectors, either integrated into the genome of said recombinant host cells.

Designates "environmental sample" indifferently an aquatic sample, eg fresh or salt water, or land-based sample from the surface layer of soil, sediment or of subsurface soils (basement), as well as samples of eukaryotic organisms, if any multicellular plant, from marine organisms or insects and having an associated microflora, this microflora associated component organisms of interest .

The term "operon" according to the invention, a set of open reading frames whose transcription and / or translation is co-regulated by a single set of regulatory signals of transcription and / or translation. According to the invention, an operon may also comprise said transcriptional regulatory signals and / or translation.

By "metabolic pathway" for purposes of the invention or "biosynthetic pathway" refers to a set of anabolic or catabolic biochemical reactions carrying out the conversion of a first chemical species in a second chemical species.

For example, a biosynthetic pathway for an antibiotic consists of all biochemical reactions converting primary metabolites into antibiotic intermediates and then subsequently antibiotics. By regulatory sequence positioned "in phase" (English operably linked) with respect to a nucleotide sequence whose expression is desired, it is meant that the one or more transcriptional regulatory sequences are located, with respect to the nucleotide sequence interest whose expression is desired, so as to permit expression of said sequence of interest, the regulation of said expression being dependent on factors interacting with the regulatory nucleotide sequences.

According to another terminology, it is also possible that the nucleotide sequence of interest whose expression is sought is placed "under the control" of the regulatory nucleotide sequences of transcription.

The term "isolated" in the sense of the present invention refers to a biological material which has been removed from its original environment (the environment in which it is naturally located).

For example, a polynucleotide or a polypeptide present in the natural state in an organism (virus, bacterium, fungus, yeast, plant or animal) is not isolated. The same polypeptide separated from its natural environment or the same polynucleotide separated from the adjacent nucleic acids in which it is naturally inserted in the genome of the organism, is isolated.

Such a polynucleotide may be included in a vector and / or such a polynucleotide may be included in a composition and nevertheless remain in isolation, because the vector or the composition does not constitute its natural environment.

The term "purified" does not require that the material is present in a form of absolute purity, exclusive of the presence of other compounds. It is rather a relative definition.

Polypeptide or polynucleotide is in a purified state after purification of the starting material of at least one order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.

The "percentage identity" between two nucleotide or amino acid, as defined in the present invention may be determined by comparing two sequences aligned optimally, through a window of comparison. The part of the nucleotide or polypeptide sequence in the comparison window may thus comprise additions or deletions (for example "gaps") relative to the reference sequence (which does not comprise these additions or these deletions) so as to obtain an optimal alignment of the two sequences.

The percentage is calculated by determining the number of positions at which an identical nucleic acid base or amino acid residue is observed for the two sequences (nucleic or peptide) compared, and then by dividing the number of positions at which there is identity between the two bases or amino acid residues by the total number of positions in the comparison window and multiplying the result by 100 to yield the percentage of sequence identity.

Optimal alignment of sequences for comparison can be achieved by computer with the aid of known algorithms contained in the package from the company WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN.

As an illustration, the percentage sequence identity may be performed using the BLAST software (versions BLAST 1.4.9 of March 1996, BLAST 2.0.4. Of February 1998 and BLAST 2.0.6. Of September 1998 ), using exclusively the default parameters (SF AltschuI et al, J Mol Biol 1990 215:... 403-410, AltschuI SF et al, Nucleic Acids Res 1997 25:.. 3389-3402). Blast searches for sequences similar / homologous to a sequence "request" of reference, using the algorithm AltschuI et al. The request sequence and the databases used may be peptide or nucleic acid, any combination being possible.

Extraction and Purification of Nucleic Acids FROM A SAMPLE OF THE ENVIRONMENT.

1. Direct Extraction of nucleic acids

It has been shown according to the present invention, for obtaining a library of nucleic acids from organisms contained in a sample of the soil, it was important to create conditions in which, firstly, the various sample bodies are made available to subsequent stages of extraction of nucleic acids and, secondly, that the initial stage of the soil sample processing allows a maximum mechanical lysis of the nature of the sample bodies to make directly accessible nucleic acids of these organisms, mainly genomic and plasmid DNA, the buffers used for subsequent extraction steps. It has thus been shown according to the invention a maximum accessibility of nucleic acids from micro-organisms of a soil sample was achieved by a forced grinding and dry the predried soil sample to obtain microparticles. The Applicant has thus determined that the drying of the prior soil sample to any subsequent treatment causes a significant decrease in the cohesion of the raw soil sample and accordingly promotes its subsequent disintegration in the form of micro-particles, when a suitable milling treatment is carried out.

Surprisingly, the applicant has shown that micro-particles of dry soil samples gathered physicochemical properties favorable to the extraction of an optimal amount of nucleic acids which, in their nature, could be representative of the genetic diversity of organisms initially present in the original soil sample. It has been shown in particular that the method of direct extraction of nucleic acids according to the invention allows the extraction of DNA from few microorganisms, such as certain rare Streptomyces or sporulated microorganisms.

By "microparticles" of the soil sample for the purposes of the present invention is meant sample derived particles having an average size of about 50 microns, ie on average between 45 and 55 .mu.m /.

According to the invention, the microparticles are obtained from soil samples previously dried or dessiqués then ground until obtaining microparticles of average size between 2 .mu.m and 50 .mu.m, before resuspension in a medium buffer liquid microparticles obtained.

Such a medium liquid buffer may consist of a nucleic acid extraction buffer, in particular a conventional DNA extraction buffer well known to those skilled in the art.

Grinding the soil micro-particle sample has the dual function of mechanically lysing the majority of organisms present in the original soil sample and make accessible the unlysed bodies by mechanical processing to subsequent optional steps of lysis chemical and / or enzymatic.

Thus, a first object of the invention is a method of preparing a collection of nucleic acids from a soil sample containing organisms, said method comprising a first step (l- (a)) of obtaining micro-particles by grinding the predried soil sample or desiccated, then micro-particles suspended in a liquid buffer setting medium.

So Most preferably, the milling step is carried out using an agate ball device or tungsten or with the aid of a tungsten ring device. These devices are preferred because the hardness of materials such as agate or tungsten significantly facilitates obtaining micro-particles of the size specified above. For this reason, it is not preferentially select or be avoided, an appeal to a grinding device for glass beads, which proved much less effective. Drying or classification of the soil sample can be carried out by any method known to those skilled in the art. For example, the raw soil sample can be dried at room temperature for a period of 24 to 48 hours.

As indicated above, the liquid buffer medium may consist of an extraction medium of the DNA in the microparticles. quite preferably be used a designated TENP extraction buffer containing 50 mM tris respectively, 20 mM EDTA, 100 mM NaCl and 1% (w / v) of polyvinylpolypyrrolidone, pH 9.0. The method of preparing a collection of nucleic acids from a soil sample is further characterized in that the step of obtaining micro-particles by grinding the predried soil sample is desiccated or followed by l- step (b) extracting nucleic acids present in the microparticles.

It is established that the extraction of nucleic acids is accompanied by co-extraction of compounds and / or components of the unwanted soil requiring further purification of the extracted nucleic acids, such a subsequent purification step to be both sufficiently selective to allow removal of the compounds and / or components of the unwanted soil and a return sufficient to cause a small loss in amount of previously extracted DNA.

It has been shown according to the invention a DNA purification step extracts the micro-particles of the soil sample meeting the criteria for selectivity and efficiency, as defined above, comprises treatment of the extracted DNA by a combination of two successive chromatography steps, respectively a molecular sieve chromatography and anion exchange chromatography.

According to another feature of the above method, the step I- (b) extraction of nucleic acids is followed by l- step (c) purifying nucleic acids extracted using two chromatographic steps following:

- passing the solution containing the nucleic acids on a molecular sieve, followed by recovery of elution fractions enriched in nucleic acids;

- passage of the elution fractions enriched in nucleic acids on an anion exchange chromatographic medium, and then recovering the elution fractions containing the nucleic acids.

The nature and order of the above chromatographic steps are essential for good selectivity and an excellent yield of the DNA purification step previously extracted microparticles of the sample of previously dried soil or desiccated.

Very advantageously, the chromatographic medium of the type "molecular sieve" of the step of purification of nucleic acids above is a Sephacryl ® type chromatographic support

S400 HR or a chromatographic support with equivalent characteristics.

So Most preferably, the chromatographic support anion exchange used in the second step of purification of the extracted DNA is a media type Elutip ® d, or a chromatographic support with equivalent characteristics.

By combining l- steps (a) for obtaining micro-particles of the dry soil sample, l- (b) extracting nucleic acids present in the microparticles and l- (c) purification the chromatographic steps described above, it was possible according to the invention to extract DNA directly from the ground without prior purification of the cells of organisms contained originally in the sample, while avoiding the co-extraction of contaminants from soil such as, for example humic acids that is observed with the methods of the prior art.

Contaminants, such as humic acids severely affect the analysis and subsequent uses of the nucleic acids whose purification is desired.

According to the above method, it is also possible to access the nucleic acids contained in organisms that have not been lysed mechanically in the l- step (a) obtaining the sample of microparticles of soil, in order to obtain a substantially complete collection of the genetic diversity of nucleic acid initially present in the soil sample. Thus, the micro-particles of the soil sample can be subject to subsequent steps of chemical lysis treatment, enzymatic or physical, or a combination of chemical treatment, enzymatic or physical.

According to a first aspect, the method of preparing a collection of nucleic acids from a soil sample according to the invention may be further characterized in that the l- step (a) is followed by steps following:

• soil suspending treatment in a liquid medium by sonication buffer;

• extraction and recovery of nucleic acids.

Preferably, we will use, for processing by sonication, a microtip type device made of titanium, such as the device 600 W Vibracell Ultrasonic icator marketed by Bioblock or Cup Horn type sonicator.

In a most preferably, the sonicating step is conducted at a power of 15 W for a period of 7 to 10 min and comprises successive cycles of sonication, the actual sonication is carried out for 50% of the duration of each cycle.

According to a second aspect, the above method may be further characterized in that the l- step (a) is followed by the following steps:

• soil suspending treatment in a liquid medium by sonication buffer;

• incubating the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;

• addition of SDS before centrifugation and precipitation of nucleic acids;

• recovery of nucleic acid precipitates.

Preferably, the incubation step in the presence of lysozyme and achromopeptidase be carried out at a final concentration of 0.3 mg / ml of each of the two enzymes, preferably for 30 minutes at 37 ° C. Preferably, SDS is used at a final concentration of 1% and for an incubation time of 1 hour at 60 ° C before centrifugation and precipitation.

According to a third aspect, the method of preparing a collection of nucleic acids from a soil sample above is further characterized in that the l- step (a) is followed by the following steps:

- homogenizing the ground suspension with a step of violent mixing (vortex) followed by simple stirring step;

- freezing the homogeneous suspension followed by thawing;

- sonication by treating the suspension after thawing; - incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;

- addition of SDS before centrifugation and precipitation of nucleic acids;

- recovery of nucleic acids.

Preferably, the soil micro-particle suspensions were spun down and homogenized by gentle agitation on a circular rotating stirrer for a period of two hours before being frozen at -2O ° C. Preferably, the suspensions are again shaken violently by vortexing for 10 minutes, after thawing and prior to the sonication step.

It goes without saying that the nucleic acids extracted by the realization of the method of direct extraction methods of nucleic acids described above are preferably purified according to the purification step consists of a first passage over molecular sieves and then a subsequent pass elution fractions obtained at the end of the molecular sieve chromatography on a chromatographic support anion exchange. 2. Indirect Nucleic acid extraction

According to a second embodiment of the method of preparing a collection of nucleic acids from an environmental sample, according to the invention, said environmental sample undergoes a first treatment such as to enable separation of the organisms contained in the sample, another sample macroconstituents.

This second embodiment of the method of preparing a collection of nucleic acids according to the invention promotes the production of nucleic acids of large size, which are almost impossible to achieve according to the first embodiment of the method according to the invention described above, mechanical lysis step carried out for obtaining micro-particles also having to physically break effect of the nucleic acids of the soil sample or nucleic acids contained in the sample bodies ground.

Obtaining nucleic acid large has been sought by the applicant in order to isolate and characterize the nucleic acids comprising at least partially, all of the coding sequences belonging to the same operon capable of directing the biosynthesis a compound of industrial interest.

Most preferably, is obtained by implementing the second embodiment of the method of preparing a collection of nucleic acids from a soil sample according to the invention, nucleic acids having a size greater than 100 kb, preferably greater than 200, 250 or 300 kb, and most most preferred nucleic acid larger than 400, 500 or 600 kb.

This second embodiment of a method of preparing a collection of acids. Nucleic from an environmental sample according to the invention consists of a combination of four successive stages for obtaining the nucleic acids having the characteristics described above.

When the environmental sample is a soil sample, it has been shown according to the invention a first step of obtaining a suspension by dispersing the liquid medium soil sample favored accessibility organisms in the sample without causing significant mechanical cell lysis.

The first step of obtaining a dispersion of the soil sample above makes available the sample bodies to the external environment and also allows a partial dissociation of the sample bodies and macro components. It makes possible a subsequent separation of the organisms originally contained in the sample from other components thereof. When the environmental sample obtained for instance from plants, marine organisms or insects, pretreated by grinding is needed to make the bodies of the associated microflora accessible to subsequent process steps.

Thus, the present method comprises a step of separating the bodies of other inorganic and / or organic components previously obtained by centrifugation on a density gradient. The thus separated bodies are then subjected to a step of lysis and extraction of nucleic acids.

The step of centrifuging on a density gradient, surprisingly, possible to separate the cells of organisms of the soil particles in the sample suspension. It would indeed have been expected that a proportion of the cells are driven with macro-particles in the gradient phase. In addition, it had never been shown so far as centrifugation on a density gradient from a soil sample allowed to recover at the aqueous / gradient stage interface, a representative population of organisms diversity of organisms present in the initial sample, the fact that these organisms are of volume, density and form highly variable. It was reasonable to assume that they would be found either in the aqueous phase, the aqueous phase interface / density gradient and also within the density gradient itself.

Thus, those skilled in the art could expect that the bodies having lower densities or larger than the density of the density gradient used (density of the density gradient between 1, 2 and 1, 5 g / ml , preferably 1, 3 g / ml) could not be recovered, which would have the effect of introducing a bias in the representativeness of effectively separate bodies and, consequently, also in the diversity of the extracted nucleic acids.

Further, in a particular embodiment of the method, a step of spore germination, especially actinomycetes, is performed, which has the effect of significantly increasing the amount of DNA recovered actinomycetes. The last step consists of a step of purifying the nucleic acid thus extracted on a cesium chloride gradient.

Surprisingly, the nucleic acid purification on cesium chloride gradient allows substantial elimination or complete, of the substances composing the density gradient. This characteristic is decisive as regards the further use of purified nucleic acids because the density gradient is known as a potent enzyme inhibitor, able if necessary to inhibit the catalytic activity of the enzymes used to prepare the insertion acids nucleic extracted into vectors. According to this second embodiment, the method of preparing a collection of nucleic acids from an environmental sample containing organisms according to the invention comprises the following succession of steps:

(I) obtaining a suspension by dispersing the environmental sample in liquid medium followed by homogenization of the resulting suspension by gentle stirring;

(Ii) separating the bodies of the other mineral constituents or organic and of the homogeneous suspension obtained in step (i) by centrifugation on a density gradient;

(Iii) lysing the microorganisms separated in step (ii) nucleic acid extraction; (Iv) nucleic acid purification on a cesium chloride gradient.

Preferably, the suspension of the soil sample is obtained by dispersing the sample by grinding using a Waring Blender type device or a device with similar characteristics. So Most preferably, the sample suspension is obtained after three successive grindings of a duration of one minute each in a Waring Blender type device. Preferably, the ground sample is cooled in the ice between each of the grindings.

Preferably, the organisms are then separated from the soil particles by density centrifugation on a cushion like "Nycodenz" marketed by Nycomed Pharma AS Company. (Oslo, Norway). Preferred centrifugation conditions are 10.000g for 40 minutes at 4 ° C, preferably in a swinging bucket rotor of the type "rotor TST 28.38" marketed by the company KONTRON.

The ring bodies located, after centrifugation, the interphase of the aqueous upper phase and the lower phase Nycodenz was then removed and washed by centrifugation before recovery of the cell pellet in a appropriate buffer.

Step (iii) of lysis of the organisms separated in step (ii) described above can be carried out in any manner known to those skilled in the art. Advantageously, the cells are lysed in a solution

10 mM Tris-EDTA 100 mM pH 8.0 in the presence of lysozyme and achromopeptidase, preferably for one hour at 37 ° C.

The actual DNA extraction can be advantageously carried out by adding a lauryl sarcosyl solution (1% of the final weight of the solution) in the presence of proteinase K and incubating the final solution at 37 ° C for 30 minutes .

The nucleic acids extracted in step (iii) are then purified on a cesium chloride gradient. Preferably, the step of purification of nucleic acids on a cesium chloride gradient is carried out by centrifugation at 35,000 revolutions / minute for 36 hours, for example on a rotor of the type Kontron 65.13.

In a particular aspect of the method of preparing a collection of nucleic acids from a soil sample containing organisms according to the invention, said nucleic acids consist predominantly, if not exclusively, of DNA molecules.

According to another aspect, the nucleic acids can be recovered after inclusion bodies, separated on a density gradient in a block of agarose and lysis, for example chemical and / or enzymatic, organizations included in the block of agarose.

Another object of the invention consists of a collection of nucleic acids consisting of nucleic acids obtained in the step II- (iv) of the method of preparing a collection of nucleic acids according to the invention or obtained in step (c) or a subsequent step of the method of preparing a collection of nucleic acids according to the invention.

The invention is further relates to a nucleic acid characterized in that it is contained in a collection of nucleic acids as defined above.

In one aspect, such a nucleic acid constituting a collection of nucleic acids according to the invention is characterized in that it comprises a nucleotide sequence encoding at least one operon, or a part of an operon. So Most preferably, such operon encodes all or part of a metabolic pathway.

Example 9 describes the construction of a genomic DNA library from a strain of Streptomyces alboniger respectively and cloning in cosmids and pOS700l pOS700R shuttles. It has been shown according to the invention than in the DNA library carried in the vector integrative pOS700l nine clones contain nucleotide sequences belonging to the operon responsible for the biosynthetic pathway of puromycin. Similarly, it has been identified within the DNA library carried in the vector pOS replicative 700R twelve clones containing nucleotide sequences of the operon responsible for the biosynthetic pathway of puromycin.

In particular, some cosmids replicative and integrative banks produced have, after digestion with endonucleases ClaI and EcoRV restriction fragment of a size of 12 kb may contain all sequences of the operon responsible for the biosynthetic pathway puromycin.

Thus, in another aspect, a nucleic acid according to the invention contains, at least in part, the nucleotide sequences of the operon responsible for the biosynthetic pathway of the puromicyne.

Example 2 below describes the construction of a DNA library according to a method according to the present invention into a vector pBluescript SK 'from a soil contaminated with lindane.

The recombinant vectors were transfected into ύΕscherichia coli DH10B cells and transformed cells were grown in a suitable culture medium in the presence of lindane. A screening of the transformed cell clones of the bank showed that, out of 10,000 clones screened, 35 of them had a lindane degradation phenotype. The presence of linA gene in these clones was confirmed by PCR amplification with primers specific for the gene.

Thus, in another aspect, the invention also relates to a nucleic acid containing a nucleotide sequence of the metabolic pathway causing biodegradation of lindane. It is thus clearly demonstrated, as described above, a method of preparing a collection of nucleic acids from a soil sample containing organisms according to the invention and a method for preparing a collection of recombinant vectors containing the nucleic acids constituting the collection of the aforementioned nucleic acids was quite suitable for the isolation and characterization of nucleotide sequences included in an operon.

An additional demonstration of the ability of a method according to the invention in the identification of nucleotide coding sequences involved in a biosynthetic pathway regulated as an operon is further described later: these cloning and characterization of sequences encoding polyketide synthases involved in the pathway of biosynthesis of polyketides, which belong to a family of molecules, some representatives of major therapeutic interest, in particular antibiotic. The present invention therefore further relates to a nucleic acid constituting a collection of nucleic acids according to the invention, characterized in that it comprises the whole of a nucleotide sequence encoding a polypeptide.

According to a first aspect, a constitutive nucleic acid from a collection of nucleic acids according to the invention is of prokaryotic origin.

According to a second aspect, a constitutive nucleic acid from a collection of nucleic acids according to the invention originates from a bacterium or virus.

According to a third aspect, a nucleic acid constituting a collection of nucleic acids according to the invention is of eukaryotic origin.

In particular, such a nucleic acid is characterized in that it originates from a fungus, a yeast, a plant or animal.

MOLECULAR CHARACTERIZATION OF THE COLLECTION OF NUCLEIC ACID EXTRACTS FROM THE GROUND.

To overcome the many technical disadvantages of methods for characterizing DNA extracted banks and purified from a sample of the environment that have been described in the part of the description on the state of the art, the applicant has developed a simple and reliable method for qualitatively and semiquantitatively characterize the nucleic acids obtained following the method described above.

The method of the invention thus is to universally amplify a 700 bp fragment located within a DNA sequence of ribosomal type 16 S, and then hybridizing the amplified DNA with an oligonucleotide probe specific variable and finally, comparing the sample hybridization intensity relative to an external standard range or DNA sequence of known origin. Pre-amplification hybridization with the oligonucleotide probe used to quantify genera or scarce microorganism species. In addition, amplification universal primers allows, upon hybridization, using a large set of oligonucleotide probes.

Thus, the invention further provides a method of determining the diversity of nucleic acids contained in a collection of nucleic acids, and most preferably from a collection of nucleic acids from an environmental sample, preferably of a soil sample, said method comprising the steps of:

- contacting the nucleic acids of the collection of nucleic acids to be tested with a pair of oligonucleotide primers which hybridize to any DNA sequence ribosomal bacterial 16 S;

- producing at least three cycles of amplification;

- detection of amplified nucleic acids with an oligonucleotide probe or a plurality of oligonucleotide probes, each probe specifically hybridizing with a DNA sequence ribosomal 16 S common to a rule, an order, a subclass or a bacterial genus;

- where appropriate, comparing the results of the previous step of detecting with the detection results, by using the probe or the plurality of nucleic acid probes of known sequence constituting a reference range.

Preferably, a first pair of primers hybridizing to universally conserved regions of the ribosomal RNA gene 16 S is formed respectively FGPS 612 primers (SEQ ID NO: 12) and FGPS 669 (SEQ ID NO: 13).

A second embodiment of a couple of preferred primers according to the invention is constituted of the pair of universal primers 63 f (SEQ ID NO: 22) and 1387r (SEQ ID NO: 23).

According to a particular embodiment of a method of determining the diversity of nucleic acids of a collection of nucleic acids, the amplification step using a pair of universal primers can be performed on a collection of recombinant vectors in each of which is inserted a nucleic acid of the collection of nucleic acid in question, prior to the hybridization step with the specific oligonucleotide probes of a rule, of an order of a sub class or a particular bacterial genus.

Such a process of determining the diversity of nucleic acids contained in a collection is particularly applicable to collections of nucleic acids obtained according to the teaching of the present description.

Thus, Example 3 details a method of preparing a collection of nucleic acids from a soil sample containing organisms comprising an indirect step of extracting DNA by dispersing a sample of the soil prior to cell separation gradient of Nycodenz, cell lysis and DNA purification on a cesium chloride gradient.

The collection of nucleic acids thus obtained was used as such or as inserts in type cosmid vectors in an amplification method using universal primers rDNA aforementioned S 16, and then the DNA amplified were subjected to a detection step using oligonucleotide probes of sequences SEQ ID NO: 14 to SEQ ID NO: 21 which are shown in table 4.

The results show a method of preparing a collection of nucleic acids from a soil sample containing organisms according to the invention allows access to the DNA of more than 14% of the total soil microbial or 2 × 10 8 cell per gram of soil, while the total cultivable microflora represents just 2% of the total microbial population. To determine the phylogenetic diversity of a collection of nucleic acids prepared according to the invention, 47 sequence of the 16S rRNA gene were isolated and sequenced. These sequences correspond to nucleotide sequences SEQ ID No. 60 to SEQ ID NO: 106. Nucleic acids comprising the sequences SEQ ID No. 60 to SEQ ID NO: 106 are also part of the invention, as well as nucleic acids having at least 99%, preferably 99.5% or 99.8% identity in nucleic acids with the nucleic acids comprising the sequences SEQ ID No. 60 to SEQ ID NO: 106. such sequences may be used in particular as probes to screen clones of a DNA library and identifying those among clones of the library which contain such sequences, these sequences being suceptibles to be close to coding sequences of interest, such as sequences coding for enzymes involved in the biosynthetic pathway of antibiotic metabolites, for example polyketide.

Comparison of the 16S rRNA sequences from a DNA library produced according to the invention with the sequences listed in the data base RDP (Maidak BL, Cole JR, Parker CT, Garrity GM, Larsen N., Li B, TG Lilburn, McCaughey, MJ, GJ Olsen, R. Overbeek, Pramanik S. Schmidt TM, JM Tiedje, Woese CR (1999) "A new draft of the RDP (Ribosomal Database project)" Nucleic Acids Research Vol. 27: 171-173) were used to determine that the nucleic acids contained in a collection of nucleic acids according to the invention are derived from α-proteobacteria, of β-proteobacteria of δ-proteobacteria to γ-proteobacteria, of actinomycetes and a kind related to Acidobacterium. These results, presented in Table 7 as well as by the phylogenetic tree of Figure 7 reflect the diverse phylogenetic nucleic acids contained in a DNA library prepared according to the method of the invention.

CLONING VECTORS AND / OR EXPRESSION

Each of the nucleic acids contained in a collection of nucleic acids prepared according to the invention can be inserted into a cloning vector and / or expression.

For this purpose, all types known to the prior art vectors can be used, such as viral vectors, phages, plasmids, phagemids, cosmids, phosmids, BAC type vectors, bacteriophage P1 , BAC type vectors, YAC type vectors yeast plasmid or any other vector known to the state of the art by one skilled in the art.

advantageously will be used according to the invention to vectors for stable expression of nucleic acids of a DNA library. To this end, preferably such vectors include transcriptional regulatory sequences which are located in-phase ( "operably linked") with the genomic insert so as to allow the initiation and / or regulation of the expression of at least a portion of said DNA insert.

It follows from the above that the invention also relates to a method of preparing a collection of recombinant vectors characterized in that the nucleic acids obtained in step II- (iv) or l- step (c ) or any subsequent step of a method of preparing a collection of nucleic acids from a soil sample containing organisms according to the invention are inserted into a cloning vector and / or expression. Prior to their insertion into a cloning vector and / or expression, the constituent nucleic acids of a collection of nucleic acids according to the invention can be separated according to their size, for example by electrophoresis on a gel agarose, optionally after digestion with a restriction endonuclease. According to another aspect, the average size of the constituent nucleic acids of a collection of nucleic acids according to the invention can be made of substantially uniform size by the implementation of a physical disruption step prior to their insertion into the cloning vector and / or expression. Such physical or mechanical breaking step of the nucleic acids may consist of successive passages of the latter in solution in a metal channel of about 0.4 mm in diameter, for example the channel of a syringe needle having a such diameter.

The average size of nucleic acids can in this case be between 30 and 40 kb in length. The construction of the preferred vectors of the invention is shématisée in Figures 25 (cosmid intégrarif conjugative) and 26 (BAC integrative).

cloning vectors and / or expression may be preferably used for insertion of the nucleic acids contained in a collection or DNA library according to the invention include the vectors described in European Patent No. EP-0 350 341 and in U.S. patent No. 5,688,689, such vectors being especially suitable for processing of actinomycete strains. Such vectors contain in addition a DNA sequence of the insert, an attachment att sequence and a DNA sequence encoding an integrase (int sequence) functional in actinomycetes strains.

However, it was observed according to the invention that some cloning and / or expression had drawbacks that their theoretical and functional capacity was not achieved in practice.

Thus, it appeared that the integration system contained in the vectors of the state of the art, especially in the vectors described in European Patent No. EP 0 350 41 did not in fact a good integration of the library DNA insert into the bacterial chromosome.

Assuming that the functional deficits of integration of such vectors in the bacterial chromosome were due to a defect in the gene expression of integrase present in these vectors, the plaintiff initially sought to increase expression of the integrase gene by substituting the promoter of the initial transcription a transcriptional promoter capable of significantly increasing the number of transcripts of the integrase.

The results were disappointing and the integration function to the chromosome of these vectors has not been improved.

Surprisingly, it has been shown according to the invention that the difficulties of expression of integrase in this family integrative vectors was not located at the amount of transcript expression, but in terms of their stability .

In a second case, the applicant could show that the lack of stability of transcribed integrase was caused by deficiencies in the termination of transcription of the corresponding messenger RNA.

The applicant then inserted terminator site placed downstream of the sequence coding for the integrase of the vector so as to obtain an mRNA size determined. The insertion of an additional termination signal downstream of the nucleotide sequence encoding integrase vector allowed the obtaining of a family of integrative vectors of cosmid and BAC type.

Preferably, the site terminator is placed downstream of the attachment att site.

In addition, the applicant has developed new conjugative vectors and new replicative vectors and cosmid new conjugative vector BAC type which can advantageously be used for the insertion of nucleic acids constituting a collection of nucleic acids prepared by the process of the invention.

When the insertion of medium-sized DNA fragments is desired, use is preferably made of the cosmid vectors, capable of receiving inserts having a maximum size of about 50 kb.

Such cosmid vectors are most particularly suitable for the insertion of nucleic acids constituting a collection of nucleic acids obtained by the process of the invention comprising a first step of direct extraction of DNA by mechanical lysis of the organisms contained in the original soil sample.

When the insertion of nucleic acids of large size, in particular of nucleic acids of a size larger than 100 kb, or even greater than 200, 300, 400, 500 or 600 kb is desired, it will then use preferentially to BAC type vectors capable of receiving DNA inserts of this size. Such BAC type vectors are most particularly suitable for the insertion of nucleic acids constituting a collection of nucleic acids obtained by the process according to the invention wherein the first step consists of an indirect DNA extraction by prior separation of the organisms contained in the original soil sample and removal of macro-components of said soil sample.

In particular, the BAC type vectors are advantageously used for the insertion of nucleic acids of large container, at least partially, the nucleotide sequence of an operon.

Thus, the method of preparing a collection of recombinant vectors for cloning and / or expression according to the invention is further characterized in that the cloning vector and / or expression of the plasmid type.

In another aspect, such a method is characterized in that the cloning vector and / or expression is the cosmid.

In one aspect, it may be a cosmid replicative in E. coli and integrative in Streptomyces. A cosmid vector most preferred having such a definition is the pOS700l cosmid described in Example 3.

In yet another aspect, the cosmid vector is conjugative and integrative in Streptomyces.

Generally, conjugative vector type or type cosmid BAC which comprise nucleotide sequences in their pattern recognized by the cellular enzymatic machinery referred to as "origin of conjugation" are used whenever it is desired to avoid use of techniques heavy and somewhat automated processing. For example, transfection vectors initially housed by E. coli cells in Streptomyces cells typically requires a recombinant vector recovery stage in the cells of Esche chia coli, and preliminary purification step transformation protoplasts of Streptomyces. It is commonly accepted that transfection of a set of 1,000 clones in Escherichia coli Streptomyces requires obtaining about 8,000 clones for each clone of E. coli has a chance to be represented.

Conversely, a transfection step of conjugation of a vector hosted by E.coli to cells of Streptomyces requires the same number of clones of each of the microorganisms, the conjugation step occuring "clone to clone" and no further comprising the technical difficulties involved with the transfer of genetic material of step by protoplast transformation, for example in the presence of polyethylene glycol.

In order to optimize the DNA library construction in Streptomyces, it was developed according to the invention, novel conjugative vector cosmid and BAC type such as to enable maximum efficiency of the conjugation step. In particular, new conjugative vectors according to the invention were constructed by placing a selectable marker gene at the end of the vector DNA that is transferred to the recipient bacterium last. This improvement to the conjugative vectors of the prior art makes it possible to positively select the recipient bacteria having received all of the vector DNA and, consequently, the totality of the DNA insert of interest.

Conjugative and integrative in Streptomyces cosmid preferred according to the invention are cosmids pOSV303, pOSV306 pOSV307 and described in Example 5. According to another aspect, a method of preparing a collection of recombinant vectors according to the invention is carried implemented using a replicative cosmid both in E. coli and in Streptomyces. Such cosmid is advantageously cosmid pOS 700R described in Example 6. According to yet another aspect, the method above can be implemented with a cosmid replicative in E. coli and Streptomyces and conjugative in Streptomyces.

Such a replicative and conjugative cosmid can be obtained from a replicative cosmid accordance with the invention, by inserting a suitable origin of transfer, such as RK2, as described in Example 5 for the construction of the vector pOSV303.

According to another advantageous embodiment of the method of preparing a collection of recombinant vectors according to the invention, uses a cloning vector and / or BAC-type expression.

In one aspect, the vector of the BAC type is integrative and conjugative in Streptomyces.

So Most preferably, such a BAC vector integrative and conjugative in Streptomyces is the BAC vector vPos 403 described in Example 8, or the LAC PMBD-1 vectors PMBD-2, 3-PMBD, PMBD-4, PMBD-5 and PMBD-6 described in example 15.

The invention further relates to a recombinant vector characterized in that it is chosen from the following recombinant vectors: a) a vector comprising a nucleic acid constituting a collection of nucleic acids according to the invention; b) a vector as obtained by a method eliminating the need for the action of a restriction endonuclease on the DNA fragment to be inserted, as described above. In a most preferably, the invention also relates to a vector selected from the following vectors:

- cosmid pOS700l;

- cosmid pOSV303; - cosmid pOSV306;

- cosmid pOSV307;

- cosmid pOS700R;

- the BAC vector pOSV403;

- the BAC vector PMBD-1; - BAC PMBD-2 vector;

- the BAC vector PMBD-3;

- the BAC vector PMBD-4;

- the BAC vector PMBD-5;

- the BAC vector PMBD-6. The invention further relates to a collection of recombinant vectors as obtained according to any one of the processes according to the invention.

A method for preparing a recombinant cloning and / or expression according to the invention.

Conventional techniques of DNA insertion within a vector to prepare a cloning vector and / or recombinant expression typically use a first stage during which a restriction endonuclease is incubated with both DNA insert and vector with the receiver thus creating ends compatible with the DNA insert and the vector DNA enabling assembly of two DNA ligation prior to a final step for obtaining the recombinant vector.

However, such a conventional technique has significant drawbacks, especially when is sought insertion of nucleic acids in a large cloning and / or expression. Indeed, the prior action of a restriction enzyme on the DNA fragments to be inserted into a vector can substantially reduce the size of the DNA prior to its insertion into the vector. It goes without saying that a significant reduction of the size of the DNA prior to its insertion into a vector is a particularly unfavorable position When it desired cloning of large DNA fragments liable to contain all of the sequences coding and, where appropriate, also the regulatory sequences, of an operon whose expression is a complete biosynthetic pathway of a metabolite of industrial interest, especially a compound of therapeutic interest.

To overcome the disadvantages of prior art techniques, it has been developed according to the invention two methods of preparing a recombinant cloning and / or expression that do not require the use of a restriction endonuclease DNA prior to insert its introduction within the vector. Such methods are therefore quite suitable for the cloning of long DNA fragments may contain at least partially, all coding sequences and, if applicable, also the regulatory sequences, a complete operon responsible a biosynthetic pathway.

According to a first aspect, a method for preparing a recombinant cloning and / or expression according to the invention is characterized in that the insertion of a nucleic acid into the cloning vector and / or expression , comprises the following steps:

- open the cloning and / or expression in a selected cloning site, using an appropriate restriction endonuclease;

- adding a first homopolymeric nucleic acid to the free 3 'end of the open vector;

- adding a second homopolymeric nucleic acid, a complementary sequence to the first homopolymeric nucleic acid, to the free 3 'end of the nucleic acid to be inserted into the vector;

- assembling the vector nucleic acid and the nucleic acid by hybridization of the first and second nucleic acid homopolymeric sequences complementary to each other;

close the vector by ligation.

Such a process is described in Examples 10 and 13 below. Advantageously, the above method may have the following features, alone or in combination:

- the first nucleic acid is homopolymeric poly (A) or poly (T); - the second nucleic acid is homopolymeric poly (T) or poly (A).

So Most preferably, the homopolymeric nucleic acids have a length of between 25 and 100 nucleotide bases, preferably between 25 and 70 nucleotide bases. The method for preparing a recombinant cloning and / or expression described above is particularly suitable for DNA library construction in BAC type vectors. Thus, according to an advantageous embodiment of the process for preparing a recombinant vector described above, said method is further characterized in that the size of the nucleic acid to be inserted is at least 100 kb, and preferably of at least 200, 300, 400, 500 or 600 kb. Such a preparation process is therefore particularly suitable for the insertion of nucleic acids contained in a collection of nucleic acids obtained by the process of the invention.

To allow insertion of large DNA fragments into cloning vectors and / or expression, it has been developed according to the invention, a second method having eliminated any use of the action of a restriction endonuclease on the DNA to be inserted within the vector.

Such a method for preparing a recombinant cloning and / or expression according to the invention is characterized in that the step of inserting a nucleic acid into said cloning vector and / or expression comprises the following steps:

- creation of blunt ends on the ends of the nucleic acid of the collection by removal of the 3 'sequences outgoing and filling sequences protruding 5';

- opening of the cloning vector and / or expression in a selected cloning site using a suitable restriction endonuclease;

- adition complementary oligonucleotide adapters; - creation of blunt-ended at the ends of the vector nucleic acid by removal of the 3 'sequences outgoing and filling sequences protruding 5', then dephosphorylating the 5 'ends to prevent recircularization of the vector;

- insertion of the nucleic acid of the collection into the vector by ligation.

Preferably, elimination of sequences 3 'outgoing is carried out using an exonuclease, such as Klenow enzyme.

Preferably, the filling sequences protruding 5 'is carried out with polymerase, and so most preferably of T4 polymerase in the presence of the four nucleotide triphosphates.

A method for preparing a recombinant cloning and / or expression by removing the 3 'sequences outgoing and filling sequences protruding 5' as described above is particularly suitable for DNA library construction from type cosmid vectors.

Such a method for obtaining recombinant vectors is described in Example 12.

In a particular method of preparing a recombinant vector according to the invention, oligonucleotides comprising one or more rare restriction sites are added to the vector at the DNA cloning site to insert, according to the teaching of example 10. This addition oligonucleotides facilitates subsequent recovery inserts without dividing them.

HOST CELLS

Although any type of host cells can be used for transfection or transformation with a nucleic acid or a recombinant vector according the invention, especially a prokaryotic host cell or eukaryotic, preferably used host cells whose physiological characteristics, biochemical and genetics are well characterized, easily cultivated on a large scale and whose culture conditions for the production of metabolites are well known. Preferably, the receiving host cell a nucleic acid or a recombinant vector according to the invention is phylogenetically related content donor organisms initially in the environmental sample which nucleic acids originate. Entirely preferably, a host cell of the invention must have a similar use of codons, or at least close, donor organizations initially present in the sample of the environment, especially the soil sample. The size of the DNA fragments liable to the nucleotide sequences of interest sought may vary. Thus, enzymes encoded by genes of average size of 1 kb may be expressed from small inserts while the expression of secondary metabolites require maintenance in the host organism fragments of much larger size, e.g. 40 kb to over 100 kb, 200 kb, 300 kb, 400 kb and 600 kb.

Thus, host cells Eschenchia coli is a preferred choice for cloning large DNA fragments.

So Most preferably, use will be the use of strain designated Eschenchia coli DH10B and described by Shizuya et al; (1992) for which cloning protocols in BAC vectors have been optimized.

However, other Eschenchia coli strains can be advantageously used for construction of a DNA library of the invention, such as E. coli Sure strain, E.coli DH5 α, or E. coli 294 ( ATCC No. 31446).

In addition, the construction of a DNA library in E. coli cells transfected with recombinant vectors according to the invention is also possible, the expression of various genes of prokaryotes such as Bacillus, Thermotoga, Corynebacterium, Lactobacillus or Clostridium having been described in PCT application No. WO 99/20799.

Generally, host cells of E. coli can in all cases be transitory hosts in which recombinant vectors of the invention can be maintained with high efficiency, the genetic material that can be easily handled and archived and stably.

In order to express the highest levels of molecular diversity, other host cells may also be advantageously used, such as cells of Bacillus, Pseudomonas, Streptomyces, Myxococcus, Aspergillus nidulans or Neurospora crassa.

It has also been shown according to the present invention, that Streptomyces lividans cells may be used successfully and are complementary expression systems Eschenchia coli.

Streptomyces lividans is a model for studying the genetics of Streptomyces and was also used as a host heterologous expression of numerous secondary metabolites. Streptomyces lividans, has in common with other actinomycetes such as Streptomyces coelicolor, Streptomyces griseus, Streptomyces fradiae, and Streptomyces griseochromogenes, precursor molecules and control systems required for the expression of all or part of complex biosynthetic pathways, such as, for example polyketide biosynthetic pathway, or biosynthetic pathway non-ribosomal polypeptides representing classes of molecules of diverse structures.

Streptomyces lividans also present to accept the foreign DNA advantage with high conversion efficiencies.

Thus, the invention also relates to a recombinant host cell comprising a nucleic acid according to the invention constitutes a collection of nucleic acid prepared by a process according to the invention, or a recombinant host cell comprising a recombinant vector such defined above.

In one aspect, it may be a recombinant host cell of prokaryotic or eukaryotic origin. Advantageously, a recombinant cell of the invention is a bacterium, and most most preferably a bacterium selected from E. coli and Streptomyces.

According to another aspect, a recombinant host cell according to the invention is characterized in that it is a yeast or a filamentous fungus.

The invention also relates to a collection of recombinant host cells, each of the constituent host cell collection comprising a nucleic acid obtained from a collection of nucleic acids produced according to a method of preparing a collection of nucleic acids from a soil sample containing organisms as described above.

The invention also relates to a collection of recombinant host cells, each host cells constituting the collection comprising a recombinant vector according to the invention. Due to the large size of the inserts it is necessary to have maximum efficiency of transformation. For this purpose, a recipient strain of Streptomyces lividans expressing integrase constitutively pSAM2 to promote the site-specific integration of the vector is preferred. For this, the int gene under control of a strong promoter is integrated into the chromosome. The integrase overproduction does not induce excision phenomena (Raynal et al., 1998).

Producing a novel metabolite from the insert could be toxic to Streptomyces if the insert contains no genes for resistance to the antibiotic produced or if this gene is not expressed or not. The ability of different genes allowing Streptomyces ambofaciens to resist the antibiotic product that is studied (Gourmelen et al., 1998; Pernodet et al., 1999). Some of these genes encode type of ABC transporters capable of conferring a broad spectrum of resistance. These genes can be introduced and overexpressed in the host strain of Streptomyces lividans. Conversely, a strain hypersensitive to antibiotics can be used (Pernodet et al., 1996) to detect the bank in the presence of resistance genes. Indeed, in the antibiotic-producing microorganisms, these resistance genes are often associated with pathway genes of antibiotic biosynthesis. The selection of resistant clones can afford to simply perform an initial screening before the more complex testing for a new metabolite produced by the clone.

Isolation and Characterization NEW NUCLEOTIDE SEQUENCES ENCODING polyketide synthases.

According to the invention, a collection of recombinant host cells was obtained following transfection of host cells with a collection of recombinant vectors each containing a nucleic acid insert from a collection of nucleic acids prepared according to the method of the invention .

Specifically, the DNA fragments obtained according to the process of the invention wherein it is carried out an indirect step of extracting DNA from organisms contained in the soil sample were first cloned into the cosmid integrative pOS700l.

The step of insertion of the DNA fragments in the integrative cosmid pOS700l was performed according to the method of the invention wherein the tails of homopolymeric poly polynucleotides (A) and poly (T) has been added at the 3'end 'respectively of the nucleic acid of the vector and the DNA fragments to be inserted.

The thus constructed recombinant vectors were packaged into lambda phage heads and phages obtained were used to infect E. coli cells according to well known techniques of the art.

A library of about 5000 clones Eschenchia coli was obtained.

This clone library was screened with pairs of primers specific of a nucleotide sequence encoding an enzyme involved in the biosynthetic pathway for polyketide, the enzyme type I PKS, designated as β-ketoacyl synthase.

It is recalled here that the polyketides are a chemical class of great structural diversity including a large number of molecules of pharmaceutical interest such as tylosin, monensin, vermectine, erythromycin, doxorubicin or FK506.

Polyketides are synthesized by condensation of acetate molecules under the action of enzymes called polyketide synthases (PKSs). There are two types of polyketide synthases. The polyketide synthases type II are involved in general in the synthesis of polycyclic aromatic antibiotics and catalyze the condensation of acetate units iteratively.

The polyketide synthases of type I are involved in the synthesis of macrocyclic polyketide or macrolides and constitute modular multifunctional enzymes.

Given their therapeutic value, there is a need in the art to isolate and characterize novel polyketide synthases that can be used for the production of new pharmaceutical compounds, including new pharmaceutical compounds for antibiotic activity.

Screening the recombinant clone bank as described above using PCR primers selectively amplifying nucleotide sequences encoding polyketide synthases type I identified recombinant clones containing DNA inserts a sequence comprising nucleotide encoding novel polyketide synthases. The nucleotide sequences encoding these novel polyketide synthases are referenced as SEQ ID NO: 33 to SEQ ID No 44 and SEQ ID N ° 115 to SEQ ID N ° 120. Another object of the invention consists of a nucleic acid encoding a novel polyketide synthase I, characterized in that it comprises one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No 44 and SEQ ID NO: 115 to SEQ ID NO: 120.

Preferably, such a nucleic acid is in an isolated form and / or purified. The invention also relates to a recombinant vector comprising a polynucleotide comprising one of the sequences SEQ ID No. 34 to SEQ ID No 44 and SEQ ID N ° 115 to SEQ ID NO: 120

The invention also relates to a recombinant host cell comprising a nucleic acid selected from polynucleotides comprising one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No 44 and SEQ ID N ° 115 to SDEQ ID NO: 120 and as a recombinant host cell comprising a recombinant vector in which is inserted a polynucleotide comprising one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No 44 and SEQ ID N ° 115 to SEQ ID N ° 120.

Advantageously, the recombinant vectors containing a DNA insert encoding a novel polyketide synthase of type I according to the invention are cloning and expression vectors. Preferably, a recombinant host cell as described above is a bacterium, a yeast or a filamentous fungus.

The amino acid sequences for novel polyketide synthases from organisms contained in a soil sample was deduced from the nucleotide sequences SEQ ID No. 34 to SEQ ID NO: 44 AND SEQ ID NO: 115 to SEQ ID NO: 120 below above. These are polypeptides comprising any of amino acid sequences SEQ ID NO: 48 to SEQ ID NO: 59 and SEQ ID NO: 121-126.

The invention also relates to novel polyketide synthases comprising an amino acid sequence selected from the sequences SEQ ID No. 48 to SEQ ID NO: 59 and SEQ ID N ° 121 to SEQ ID N ° 126.

Is also part of the invention the nucleotide sequence SEQ ID No. 114 which comprises six open reading frames which encode respectively the polypeptides of sequences SEQ ID N ° 121 to SEQ ID N ° 126.

Is also part of the invention the nucleotide sequence SEQ ID No. 113 of the cosmid a26G1, which contains the complementary sequence of the sequence SEQ ID N ° 114. It was also extracted and amplified according to the invention of genomic DNA from pure bacterial strains, such as

Streptomyces coelicolor (ATCC No. 101478), Streptomyces ambofaciens

(NRRL No. 2420), Streptomyces lactamandurans (ATCC No. 27382), Streptomyces rimosus (ATCC No. 109610), Bacillus subtilis (ATCC

No. 6633) or Bacillus lichenifornis and Saccharopolyspora Erythrea.

PCR amplification of DNA from each of the bacterial strains described above was performed using the pairs of primers specific of the nucleic sequences of type of polyketide synthase I.

New polyketide synthases genes of bacterial type I have been able to be isolated and characterized. These are nucleic acid sequences of SEQ ID NO: 30 to SEQ ID NO: 32.

The invention therefore further relates to nucleotide sequences encoding novel polyketide synthases of type I chosen from polynucleotides comprising one of the nucleotide sequences SEQ ID NO: 30 to SEQ ID NO: 32.

also part of the invention recombinant vectors comprising the nucleotide sequences encoding novel polyketide synthases type I defined above.

The invention also relates to recombinant host cells characterized in that they contain a nucleic acid encoding a novel type I polyketide synthase comprising a nucleotide sequence chosen from the sequences SEQ ID NO: 30 to SEQ ID No. 32 as well as recombinant host cells comprising a recombinant vector as defined above.

The invention also relates to polypeptides encoded by sequences comprising the nucleic acid SEQ ID NO 30 to 32, and more specifically the polypeptides comprising amino acid sequences SEQ ID NO: 47 to SEQ ID NO: 50.

The invention further relates to a method for producing a polyketide synthase of type I according to the invention, said production method comprising the steps of: - obtaining a recombinant host cell comprising a nucleic acid encoding a polyketide synthase I type comprising a nucleotide sequence chosen from the sequences SEQ ID NO: 33 to SEQ ID No 44, SEQ ID NO: 30 to SEQ ID NO: 32 and SEQ ID N ° 115 to SEQ ID NO: 120;

- cultivation of recombinant host cells in a suitable culture medium;

- recovery and, where appropriate, purification of the type I polyketide synthase from the culture supernatant or the cell lysate.

New polyketide synthases type I obtained by the process described above may be characterized by binding to an immunoaffinity chromatography column on which antibodies recognizing these polyketide synthases have been previously immobilized.

The polyketide synthases of type I according to the invention, more particularly recombinant polyketide synthases described above may also be purified by liquid chromatographic techniques high performance (HPLC), such as for example reverse phase chromatography techniques chromatography or anion exchange or cation well known to those skilled in the art.

The polyketide synthases, recombinant or non-recombinant, according to the invention can be used for preparing antibodies.

According to another aspect, the invention therefore also relates to an antibody specifically recognizing a type I polyketide synthase according to the invention or a peptide fragment of such a polyketide synthase.

The antibodies according to the invention may be monoclonal or polyclonal. Monoclonal antibodies may be prepared from hybridoma cells using the technique described by Kohler and Milstein C. (1975), Nature, Vol.256: 495.

Polyclonal antibodies can be prepared by immunizing a mammal, in particular mice, rats or rabbits with a type I polyketide synthase according to the invention, where appropriate in the presence of an adjuvant compound of immunity, such as complete Freund's adjuvant, incomplete Freund's adjuvant, aluminum hydroxide or a compound of the family of muramyl peptides. Also constitute "antibody" in the sense of the present invention, antibody fragments such as Fab, Fab ', F (ab') 2, or fragments of single chain antibodies containing the variable part (scFv) described by Martineau et al. (1998) J. Mol. Biol Vol.28O (1). 117-127 or in US Patent 4,946,778, as well as humanized antibodies described by REINMANN KA et al. (1997), AIDS Res. Hmm. Retroviruses, vol.13 (11): 933-943 or by OJ LEGER et al. (1997), Hum. Antibodies, vol.8 (1): 3-16.

The antibody preparations according to the invention are particularly useful in qualitative or quantitative immunoassays for, or simply detect the presence of a type I polyketide synthase according to the invention or to quantify the amount of the polyketide synthase, for example in the culture supernatant or the cell lysate of a bacterial strain capable of producing such an enzyme. Another object of the invention is a method of detecting a type I polyketide synthase according to the invention or a peptide fragment of this enzyme, in a sample, said method comprising the steps of:

a) contacting an antibody according to the invention with the sample to be tested;

b) detecting the antigen / antibody complex formed optionally. The invention also relates to a kit or set for detecting a type I polyketide synthase according to the invention in a sample, comprising: a) an antibody according to the invention; b) optionally, reagents necessary for the detection of the antigen / antibody complex formed optionally.

An antibody directed against a type I polyketide synthase according to the invention may be labeled with an isotopic or non-isotopic detectable marker, according to methods well known to those skilled in the art.

Screening a DNA library according to the invention using a pair of primers which hybridize with target sequences whose presence is sought, such as sequences from the path of puromycin biosynthesis, sequences linA of the gene involved in the biodegradation of lindane or sequences encoding Type I polyketide synthases have been detailed above.

The invention therefore relates to a method of detecting a nucleic acid determined nucleotide sequence, or nucleotide sequence structurally related to a particular nucleotide sequence to a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- contacting the recombinant host cell collection with a pair of primers which hybridize with the determined nucleotide sequence or hybridizing with the nucleotide sequence structurally related to a nucleotide sequence determined;

- performing at least three cycles of amplification;

- detecting the amplified nucleic acid optionally.

For appropriate amplification conditions according to the desired target sequences, those skilled in the art may advantageously refer to the examples below.

According to another aspect, the invention also relates to a method of detecting a nucleic acid of specific nucleotide sequences, or nucleotide sequences structurally related to a particular nucleotide sequence to a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- contacting the collection of recombinant host cells with a probe hybridizing to the specific nucleotide sequence or hybridizes with a nucleotide sequence structurally related to the determined nucleotide sequence;

- detecting the hybrid possibly formed between the probe and nucleic acids contained in the vectors in the collection.

To perform screening of a DNA library according to the invention for detecting the presence of a nucleotide sequence encoding a polypeptide capable of degrading lindane, recombinant clones were detected interest by phenotype corresponding to their ability to degrade lindane. For this purpose, the clones isolated and / or sets of prepared clones of the DNA library were cultured in a culture medium in the presence of lindane and degradation of lindane was observed by the formation of a halo disorder in the immediate environment of the cells.

The invention also relates to a method for identifying the production of a compound of interest by one or more recombinant host cells in a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- culturing the recombinant host cells of the collection in a suitable culture medium; - detection of the compound of interest in the culture supernatant or in the cell lysate of one or more cultured recombinant cells.

The invention further relates to a method for selecting a recombinant host cell producing a compound of interest in a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- culturing the recombinant host cells of the collection in a suitable culture medium; - detection of the compound of interest in the culture supernatant or in the cell lysate of one or more recombinant host cells cultured;

- selection of recombinant host cells producing the compound of interest.

The invention further relates to a method for producing a compound of interest characterized in that it comprises the following steps:

- cultivating a recombinant host cell selected according to the method described above;

- recover and, if necessary, purifying the compound produced by said recombinant host cell.

The invention also relates to a compound of interest characterized in that it is obtained according to the above described method. A compound of interest according to the invention may consist of a polyketide produced by the expression of at least one nucleotide sequence comprising a sequence selected from the sequences SEQ ID NO 33-44, SEQ ID NO 30 to 32 and SEQ ID NO: 1 15 and SEQ ID N ° 120. The invention further concerns a composition comprising a polyketide produced through the expression of at least one nucleotide sequence comprising a sequence selected from the sequences SEQ ID NO: 33 to SEQ ID No 44, SEQ ID NO: 30 to SEQ ID N ° 32 and SEQ ID N ° 115 to SEQ ID N ° 120. A polyketide produced by the expression of at least one nucleotide sequence above is preferably the product of the activity of several coding sequences included in a functional operon whose translation products are the various enzymes required for synthesis of a polyketide, one of the above sequences being understood and expressed in said operon. Such operon comprising a nucleic acid sequence of the invention encoding a polyketide synthase can be constructed for example by Borchert teaching et al. (1992).

The invention is further relates to a pharmaceutical composition comprising a pharmacologically active amount of a polyketide according to the invention, optionally in association with a pharmaceutically compatible carrier.

Such pharmaceutical compositions are preferably adapted for administration, for example parenterally, of an amount of a polyketide synthesized by a Type I polyketide synthase according to the invention from de1μg / kg per day to 10 mg / kg day, preferably at least 0.01 mg / kg per day and most most preferably between 0.01 and 1 mg / kg per day.

The pharmaceutical compositions according to the invention may equally be administered orally, rectally, parenterally, intravenously, subcutaneously or intradermally.

The invention also relates to the use of a polyketide produced through the expression of a polyketide synthase of type I according to the invention for the manufacture of a medicament, especially a medicament for antibiotic activity.

The invention will be further illustrated, without being limited by the figures and examples below.

FIG 1 illustrates the diagram of the various lysis steps carried out according to protocols 1, 2, 3n 4a, 4b, 5a, and 5b described in Example 1.

Figure 2 illustrates a. agarose gel electrophoresis on 0.8% DNA extracted from 300 mg of the ground 3 (Cote St Andrew) after different lysis treatments (protocols 1 to 5, cf. Fig. 1). M: molecular weight marker of lambda phage

Figure 3 shows the proportion of different types of actinomycetes cultivated following treatments 1 to 5 (see Fig. 1). The number of cfu (colony forming unit) was determined on a selective medium for this group of bacteria. A total of 400 colonies was analyzed.

Figure 4 illustrates the. lambda phage DNA digested with Hind \\\ recovery added in soils at different concentrations before (G) or after (G *) grinding. T treatment (thermal shock) and S (sonication) are additional treatments lysis. Quantitation was performed by analysis phospho-imager after dot-blot hybridization. A sample of each soil was used for each concentration of added lambda. The characteristics of the soil are reproduced in Table 1. The samples corresponding to 10 to 15 micrograms of DNA added were not treated.

Figure 5 illustrates the PCR amplification of DNA extracted from soil 3 according to protocols 1, 2, 3, 5a and 5b. The FGPS FGPS primers 122 and 350 (Table 2) were used to target Streptosporangium spp. native. DNA extracts were used undiluted or diluted to 1/10 th and 1/100 th. M: molecular weight marker 123 bp (Gibco BRL), C: control without DNA amplification.

Figure 6 shows the amounts of DNA extracted after inoculation of spores (a) or mycelium (b) S. lividans OS48.3 inoculated into the soil at different concentrations. The amounts of added mycelium in the soil is the number of spores inoculated in the germination medium. About 50% of the spores germinated, the number of cells or genomes contained in the hyphae of germinated spores has not been determined. The amounts of spores and mycelia inoculated are not directly comparable. The extraction procedure was conducted according to the protocol 6 (see Materials and Methods section). The symbol ( ') indicates that the RNA was included in the extraction buffer. The target DNA was amplified by PCR with primers 516 and FGPS FGPS 517, the quantification was carried out by phosphorimager after hybridization by dot blot using the FGPS probe 518. A sample of each soil was used for each concentration of hyphae or spores. Soil characteristics are described in Table 1.

7 shows the phylogenetic tree obtained by the Neighbor Joining algorithm, positioning the 16S rDNA sequences contained in the soil DNA library, relative to cultured reference bacteria. Grayed :. the sequences derived from pools of library clones. Bootstrap values ​​are indicated at the nodes after resampling 100 repetitions. The scale bar indicates the number of substitutions per site. The sequences of the accession number in the GenBank database is shown in parentheses.

8 shows a diagram of the vector posint 1.

Figure 9 shows a diagram of pWED1 vector.

10 shows a diagram of the vector pWE15 (ATCC No. 37503).

11 shows a diagram of the vector pOS 700I.

Figure 12 shows a diagram of pOSV010 vector.

13 depicts the fragment containing a site "cos" pOSV010 inserted into the plasmid during the construction of the vector vPos 303.

Figure 14 shows a diagram of vPos 303 vector.

15 shows a diagram of the vector pE116.

16 shows a diagram of the vector pOS 700 R.

Figure 17 shows a diagram of vPos 001 vector.

Figure 18 shows the diagram of the vector vPos 002.

Figure 19 shows a diagram of vPos 014 vector.

Figure 20 shows a diagram of vector pBAC 11. Figure 21 shows a diagram of vector vPos 403.

Figure 22 shows the DNA electrophoresis gels of the bank after digestion with the enzymes BamHI and DraI positive clones of the library screened with the PKS-I oligonucleotides.

Figure 23 illustrates the production of puromycin by the recombinant S. lividans compared to the production of the wild strain S. alboniger.

Figure 24 illustrates the soil PKSs alignment with the active sites preserved other PKSs. References for each peptide are indicated. The beta-ketoacyl synthase domains were aligned using the PILEUP program of the GCG (Wisconsin Package Version 9.1, Genetics Computer Group, Madison, Wisc).

Figure 25 illustrates the construction of a cosmid integrative conjugative.

Figure 26 illustrates the construction of a BAC integrative conjugative.

Figure 27 illustrates the construction scheme for the vector vPos 308.

Figure 28 illustrates the construction scheme POSV306 vector.

29 illustrates the construction scheme pOSV307 vector.

Figure 30 illustrates the construction scheme for the PMBD-1 vector. Figure 31 shows a detailed map of PMBD-2 and a plasmid construction scheme for the PMBD-3 vector.

Figure 32 shows a detailed map of PMBD-4 plasmid.

Figure 33 illustrates the construction scheme for the plasmid PMBD-5 from plasmid PMBD-1.

Figure 34 illustrates the detailed map PBTP-3 vector.

Figure 35 illustrates the construction scheme of the vector PMBD-6 from PMBD-1 vector.

Figure 36 illustrates the map of cosmid a26G1 which the DNA insert contains open reading frames encoding several polyketide synthase.

Figure 37 is a diagram showing the DNA insert (+ strand) of cosmid a26G1, on which are positioned the different reading frames encoding several polyketide synthase.

EXAMPLES:

EXAMPLE 1: A process for preparing a collection of nucleic acids from a soil sample containing organisms, comprising a direct step of extracting DNA from the soil sample.

1. MATERIALS AND METHODS

1.1 SOIL: The characteristics of the six soils used in this study are listed in Table 1.

Clay content and organic matter ranges from 9-47%, respectively, and 1, 7 to 4.7%, pH from 4.3 to 5.8.

Soil samples were collected from the surface layer of 5 to 10 cm deep. All visible roots were removed and soils were stored at 4 ° C for a few days if necessary, after which they were dried for 24 hours at room temperature and sieved (average size 2 mm mesh) before being kept up to several months at 4 ° C.

1.2 BACTERIAL STRAINS AND CULTURE CONDITIONS:

Extracellular DNA and bacterial strains providing vegetative cells, spores or hyphae, used to inoculate soil samples, were selected so that their presence can be monitored specifically.

In order to obtain large amounts of extracellular DNA, the lysogenic E. coli strain Hfr 1192 P4X (metB) containing the phage lambda cI857 Sam7, was grown on Luria-Bertani (LB) medium for two hours at 3O ° C, then 30 minutes at 40 ° C, then 3 hours at 37 ° C. The lambda phage DNA was extracted according to the technique described by Sambrook J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor NY

The avirulent strain of Bacillus anthracis (Sterne 7700) was used as the inoculum of bacterial cells. Bacillus anthracis was multiplied on a culture broth of type "trypticase soy broth" (TSB) (Biomerieux, Lyon, France) for about 6 hours, ensuring that the DOβoo is kept below 0.6. These conditions allow the development of vegetative cells without spore formation (Patra et al, (1996), FEMS Immunol Medical Microbiology, vol.15.. 223-231.). Spores of Streptomyces lividans OS48.3 (CLERC- Bardin et al., Unpublished) were mechanically removed from the body of crops on a R2YE medium (HOPWOOD et al., (1985), Genetic Manipulation of Streptomyces, A Laboratory Manual . The John Innés Foundation, Norwich .United Kingdom). The hyphae of S. lividans OS48.3 were obtained from the pre-germinating spores, since it was expected that the use of short hyphae minimizes breakage and subsequent loss of DNA. Spores were suspended in TES buffer (Acid N-Tris [hydroxymethyl] methyl-2-aminoethanesulfonic acid; Sigma-Aldrich Chimie, France) (0.05M; pH 8) (Holben WE et al, (1988). APPL Approximately Microbiol Vol.54:... 703-711, and were then subjected to a heat shock (50 ° C for 10 minutes followed by cooling under a stream of cold water and added to an equal volume of medium pre-germination (yeast extract 1% casamino acids 1% CaCl 2 0.01 M). The solution was incubated at 37 ° C on a shaker. The percentage of germinated spores was estimated at approximately 50%, in agreement with results HOPWOOD et al. (1985). After centrifugation, the pellets were resuspended in TES buffer, added to 3% TSB medium, and incubated at 37 ° C until an OD 45 o 0.15 (Hopwood et al., (1985)). Streptomyces hygroscopicus SWN 736 and

Streptosporangium delicate AC1296 (Pushino Institute, Moscow) were grown using techniques described by HICKEY and Tresner (1952).

The DNA of spores and hyphae of S. lividans was extracted from pure cultures by lysis protocol 6 described below (except that no grinding was carried out), whereas spores of S. hygroscopicus and S. fragile were extracted by chemical / enzymatic lysis (Hintermann et al., 1981).

1.3 CHOICE OF EXTRACTION BUFFER: A TENP buffer (50 mM Tris, 20 mM EDTA, 100 mM NaCl, 1% w / polyvinylpolypyrrolidone theft developed by PICARD (1992) was used Similar buffers were subsequently used by d. other authors (Clegg et al., 1997; KUSKE et al., 1998; Zhou et al., 1996).

Tris and EDTA protect the DNA from the nuclease activity, NaCl provides a dispersing effect and PVPP absorbs humic acids and other phenolic compounds (Holben et al (1988). PICARD et al, (1992. ).

In this study, the extraction efficiency of this buffer was evaluated at different pH (6.0 to 10.0) using 20 different soils with a pH range of 5.8 to 8.3 and a content organic matter between 0.2 and 6.3%. These twenty floors (the other features are not shown) were used only in this experiment. The amount of DNA was determined colorimetrically as described by RICHARD (1974) and detailed below. 1.4 Lysis SITU PROTOCOL AND EXTRACTION OF DNA:

Several protocols using an increasing number of steps were tested to evaluate the effectiveness of different techniques to lyse microbes in situ soil. For these experiments, the native soil microflora has been targeted in six floors. Additional experiments were conducted to study the effects of lysis treatment of the released DNA, analyzing the quantity and quality of DNA recovered from a lambda phage DNA previously added to the soil.

Once an optimized protocol (designated protocol 6) has been developed, this protocol was used to quantify DNA from native Actinomycetes and DNA from Gram-positive bacteria inoculated into the selected soils. In all cases, the soil samples were dried and sieved as described above. After grinding, 0.5 ml of TENP buffer were added to 200 mg dry weight of soil except for Protocol 1 wherein the buffer was added to a unground ground).

For various lysis treatments (see below), soil suspensions were vortexed for ten minutes and centrifuged (4000 g for five minutes) after which an aliquot (25 .mu.l) of the supernatant was analyzed by gel electrophoresis (0.8% agarose).

Another aliquot of the supernatant representing a known volume, usually 350 .mu.l, was precipitated with isopropanol.

Five aliquots (representing DNA derived from 1 g of soil) were combined and resuspended in 100 .mu.l of sterile TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) before purification (protocol D, see below) and quantification, or by hybridization (Dot Blot) of the total DNA or by hybridization (Dot Blot) of PCR amplification products (see below).

The hybridization signals were quantified by imaging phosphorescence (technique "phospho-imaging" see below). 1.5 EVALUATION METHODS OF CELLULAR Lysis SITU:

The quality and quantity of the DNA extracted after lysis of an increasing number of processing steps (2-5b protocol) were compared with those of extracellular DNA obtained after washing the ground with an extraction buffer (protocol 1; see also Figure 1).

Protocol 1: No lysis treatment.

The TENP buffer was added to a non-crushed soil, a DNA extraction step was performed as described above.

Protocol 2. Crushing the ground followed by DNA extraction.

Two different types of devices have been used for grinding the floor.

In order to compare their effectiveness, 5g dry soil were ground for 30 seconds in a mill containing tungsten rings, or at various times up to 60 minutes in a soil mill containing a mortar and agate balls ( 20 mm in diameter).

The TENP buffer was then added and the DNA is extracted as described above.

The electrophoresis gel results showed that grinding 4O minutes using agate balls were necessary to obtain amounts of DNA extracts equivalent to those obtained after 30 seconds of grinding using tungsten rings.

The distribution of DNA fragment size is similar regardless of the method used.

Thus, these treatments were considered equivalent and one that will be used in the protocols described below will accordingly not specified.

In Protocols 3-5, the efficacy of several other higher lysis treatments ground grinding has been tested, either separately or in different combinations. Protocol 3:

This protocol is identical to protocol 2, except that it comprises a homogenization step using a mixer type Ultraturrax (Janker and Kunkel, IKA Labortechnik, Germany) set at half the maximum speed for 5 minutes .

PROTOCOLS 4a and 4b:

These protocols are the same in Protocol 3 except for an additional step of sonication.

Two types of sonicators devices were compared: a titanium microtip sonicator (Vibracell Ultrasonic icator 600W, Bioblock, lllkirch, France) (Protocol 4a) and a sonicator Cup Horn type (protocol 4b).

The microtip Vibracell producing ultrasound is in direct contact with the soil solution.

As regards the type Cup Horn device, the sol solution was stored in tubes that are placed in a water bath through which the ultrasounds pass.

Preliminary experiments were conducted to determine the optimum conditions for both sonicators (not shown).

The best compromise in terms of amount of DNA extracted and fragment length, consists of a sonication with titanium microtip and the Cup Horn type sonicator respectively for 7 and 10 minutes, by adjusting the power to 15 W and with to 50% of active cycles.

Protocols 5a and 5b:

After sonication with a titanium microtip or type Cup Horn device (4a and 4b respectively protocols) and lysozyme were added achromopeptidase, each enzyme at a final concentration of 0.3 mg / ml. The soil suspensions were incubated for 30 minutes at 37 ° C, whereupon lauryl sulfate to a final concentration of 1% was added, and then the suspensions were incubated for 1 hour at 60 ° C before centrifugation and precipitation as described above. In addition to the protocols described above, the effect of sonication

(Cup Horn, see protocol 4b) and thermal shock (30 seconds in three minutes followed by liquid nitrogen in boiling water, the treatment being repeated three times) to the lambda phage DNA digested with HindIII previously added to soil were examined (see below). Thermal shocks have been suggested in the prior art as a means of cell lysis in situ (Picard et al. (1992)) .. However, the fact that such treatment has a detrimental effect on free DNA (see results section) it was not included in the above described protocols.

OPTIMIZED PROTOCOL

After evaluation of the different treatments lysis, an optimized protocol has been defined, designated protocol 6. Protocol 6 is identical to the protocol 5b except that, before sonication, the soil suspensions are subjected to a treatment by Vortex then agitated by rotation a wheel for two hours before being frozen at - 20 ° C.

After thawing, the soil suspensions are vortexed for 10 minutes before sonication. Protocol 6 was used in the experiments in which the soil was seeded with bacterial cells as well as in experiments in which indigenous actinomycetes were quantified (see below).

1.6 COUNTING THE MICROSCOPE: The grinding efficiency of the ground as a method for lysing bacterial cells was examined microscopically.

dried subfloor 5 g were mixed in a Waring Blender type device with 50 ml of sterilized ultrapure water for 1, 5 minutes; simultaneously, 1g (dry weight) of crushed soil (Protocol 2) was suspended in 10 ml by stirring for 10 minutes. The soil suspensions were subjected to serial dilutions and acridine orange was added to a final concentration of 0.001%.

After 2 minutes, the suspensions were filtered through a membrane NUCLEOPORE brand type black 0.2 .mu.m. Each filter was rinsed with sterile water lysed, treated with 1 ml of isopropanol for 1 minute to fix the bacterial cells, and then rinsed again.

The bacterial cells were counted using a microscope has the epifluorescence Zeiss Universal guy with a 100x objective. For each of the soil types, three filters were counted, and at least 200 cells were counted on each filter.

1.7 COUNTING OF ACTINOMYCETE CULTIVATED AND TOTAL COLONY FORMING UNITS (CFU): The actinomycetes who survived the lysis treatments (protocols 1-5) were examined specifically with the ground 3 (Côte Saint André, see Table 1) .

After a 10-fold dilution of a yeast extract solution (6% w / v) and SDS (0.05%) to induce germination

(Hayakawa et al. (1988)), the soil suspensions were diluted in series in sterile water, incubated at 40 ° C for 20 minutes and plated on HV medium (Hayakawa et al., 1987).

The HV medium was supplemented with actidione (50 mg / l) and nystatin (50 mg / ml).

The actinomycetes colonies were counted after incubation for 15 days at 28 ° C.

In total, about 400 colonies were examined.

The identification was carried out on the basis of macro-and microscopic morphological characteristics and on the analysis of diaminopimelic acid content of the isolates (Shirling et al., 1966);

STANECK et al., 1974; WILLIAMS et al., 1993).

The total amount of culturable bacteria (total CFU) was also determined for each of the lysis procedures 1 to 5. The ground suspensions were serially diluted and plated in triplicate on Bennett agar medium (WAKSMAN et al., 1961) supplemented with nystatin and actidione (each 50 mg / l).

Each Petri dish was covered with a cellulose nitrate filter (Millipore) and incubated for three days at 28 ° C. After counting the colonies on the membranes, the filters were removed and the plates were further incubated for 7 days at 28 ° C then counted again.

1.8 RECOVERY OF DNA OF PHAGE LAMBDA ADDED TO SOILS: Lambda phage DNA was digested with HindIII, extracted with phenol-chloroform, precipitated and then resuspended in sterile ultrapure water according to standard protocols (Sambrook et al., 1989).

corresponding dilutions respectively 0, 2.5, 5, 7.5, 10 and 15 ug DNA / g of ground dry weight were prepared in volumes of 60 .mu.l. These DNA dilutions were added to 5 g of dry soil batches which were subsequently vigorously mixed by vortex for 5 minutes prior to grinding.

The lambda phage DNA was also added to the soil before grinding at concentrations corresponding to 0, 10 and 15 ug DNA / g of dry weight of soil.

After grinding, the extraction buffer is added and the DNA is extracted according to protocol 2 (see above).

1.9 SATURATION SITES ADSORPTION WITH RNA: To determine whether the saturation of nucleic acid adsorption sites on soil colloids could increase DNA recovery, the sandy loam (soil No. 4) and the clay soil (soil No. 5) were incubated with an RNA solution prior to further processing. Of commercial RNA from Saccharomyces cerevisiae

(BOHRINGER Mannheim, Meylan, France) was diluted in phosphate buffer (pH 7.1) and added to samples of dry ground and sieved (2 ml / g of soil) to final concentrations of 20, 50 and 100 mg of RNA / g dry weight of the soil. The tubes containing the soil suspensions were stirred by rotation for two hours at room temperature. After centrifugation, the ground pellets were dried in oven (50 ° C) overnight. The lambda phage DNA was then added to the soil (0, 20 or 50 mcg / g of dry weight of soil) to simulate the fate of released DNA after cell lysis.

The DNA was extracted according to the protocol # 2. It was later determined that an identical effect of RNA addition to the recovery of DNA could be achieved by adding RNA directly to the extraction buffer.

This simplified procedure was used for clay soil No. 5 in the experiments in which the microorganisms were inoculated in soil.

The RNA was then added to a concentration corresponding to 50 mg RNA / g of dry weight of soil.

1.10 QUALITATIVE AND QUANTITATIVE DETERMINATION OF EFFECTIVENESS OF EXTRACTION PROTOCOLS: The quality of DNA (no degradation) was estimated based on the size of the DNA fragments or the relative position of migration bands DNA after electrophoresis of an aliquot of a solution of DNA on an agarose gel at 0.8%.

The fluorescence intensity allowed a semi-quantitative estimation of extraction yields. Another aliquot was used for quantitative determination of DNA content by hybridization (dot blot) analysis and phospho-lmager. The stain on hybridization protocol described by Simonet et al. (1990).

The hybridization membranes (GeneScreen addition, Life Science Products, Boston, United States of America) were prehybridized for at least 2 hours in 20 ml of a solution containing 20 ml of 6 × SSC, 1 ml of solution Denhardt's, 1 ml of 10% SDS and 5 mg of salmon sperm DNA.

Hybridization was carried out overnight in the same solution in the presence of a probe previously labeled with two washes of the membranes in a buffer 2 x SSC for 5 minutes at room temperature, then a third wash in 2 x SSC buffer, 0.1% SDS and a fourth wash in 1 x SSC buffer, 0.1% SDS for 30 minutes at the hybridization temperature. Hybridization signals were quantified with an imaging system radioanalytical BIORAD (Molecular Analyst Software, BIORAD, Ivry S / Seine, France).

In order to quantify the total amount of DNA derived from the indigenous microflora, the different soils were extracted according to the protocols 1 to 5. The non-amplified DNA was applied to the membranes Dot blot and hybridized using the probe universal

FGPS431 (Table 2).

This probe which hybridises to positions 1392-1406 of the 16S rDNA gene of E. coli (Amann et al. (1995)) was labeled at its ends with a ATPα 32 P using T4 polynucleotide kinase (Boehringer Mannheim , Melan, France).

A calibration curve was prepared from DNA of E. coli DH5a. The conversion calculations to soil bacteria need a simplification, assuming that the average number of copies (rm) is 7, as for E. coli.

The lambda phage DNA digested with HindIII was used to quantify the recovery of extracellular DNA. Non-amplified from soil extracts, which the lambda phage DNA had been added, were hybridized with lambda phage DNA digested with HindIII marked randomly using the Klenow fragment (Boehringer Mannheim, Melan, France ).

The amounts of DNA were calculated by interpolation from a calibration curve prepared with purified DNA.

The total amount of DNA extracted from soil # 1, 2, 3, 4 and 6 according to the protocol # 2 (grinding) was also colorimetrically quantified using the technique described by RICHARD (1974).

Briefly, DNA was mixed with concentrated HClO 4

(Final concentration of HClO was 1, 5 N). Were mixed 2.5 volumes of this solution with 1, 5 volumes of DPA (diphenylamine, Sigma-Aldrich, France) and incubated the mixture at room temperature for 18 hours, prior to determining the OD at 600 nn. The soil DNA extracts were quantified relative to a standard curve produced by the DNA extracted from E. coli DH5a according to standard protocols (Sambrook et al., (1989)).

1.11 DEVELOPMENT OF TECHNICAL DNA QUANTIFICATION IN USING PCR AMPLIFICATION AND HYBRIDIZATION:

For amplification by PCR, the Taq DNA polymerase (Appligene Oncor, France) was used according to manufacturer's instructions. The PCR program used for all amplifications are as follows: initial denaturation for 3 minutes at 95 ° C, then 35 cycles consisting of 1 minute at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by a final extension at 72 ° C for 3 minutes.

The DNA isolated and purified from Streptosporangium fragile was used as a control at concentrations ranging from 100 fg to 100 ng.

In order to specifically amplify the DNA of this bacterial genus, were selected and FGPS350 FGPS122 primers (Table 2), complementary to a portion of the 16S rDNA after alignment of 16S rDNA sequences of actinomycetes. Their specificity was tested on a collection of actinomycetes strains (Streptomyces Streptosporangium and other closely related genera).

PCR products were hybridized with the oligonucleotide probe FGPS643 (Table 2). To simulate the purity routinely obtained with DNA extracted from soil, S. delicate pure DNA controls were mixed with soil extracts obtained after treatment according to the lysis protocols and 4b 5b and purified according to protocol D.

Before use, the soil extracts were treated with DNase (DNase one unit / ml, GIBCO BRL) for 30 minutes at room temperature. DNase was then inactivated by heating at 65 ° C for 10 minutes. A check of inactivation was performed by PCR. The concentrations of humic acids were measured spectrophotometrically (OD 2 AUDIOM) against a standard curve of commercial humic acids (Sigma). Soil solution treated with DNase undiluted, diluted and diluted 10x x 100 were mixed with 100 fg to 100 ng of DNA of S. brittle before PCR amplification. In another series of experiments, increasing concentrations of Streptomyces hygroscopicus DNA (100 pg to 1 .mu.g) were added to the fragile S. DNA to simulate the presence of DNA target and non-influence on the PCR process.

1.12 Purification of DNA CRUDE EXTRACTS: Four methods of DNA purification were compared. The DNA was extracted from 1 g (dry weight soil according to the protocol 4a and resuspended in 100 .mu.l of TE8 buffer (5O mM Tris, 20 mM (EDTA, pH 8.0).

Protocol A

Elution through two successive columns of Elutip (Schleicher and Schuell, Dassel, Germany) (Picard et al., (1992)).

Protocol B:

Elution through a column SEPHACRYL S200 (Pharmacia Biotech, Uppsala, Sweden) followed by elution through a column Elutip (NESME et al. (1995)).

Protocol C:

Separation using an aqueous two-phase system with 17.9% (w / w) PEG 8000 (Merck, Darmstadt, Germany) and 14.3% (w / w) of (NH 4) 2 SO 4 (ZASLAVSKY, (1995)).

After vigorous vortex mixing, the two phases were left at room temperature for separation.

1 ml of each phase was transferred to another tube, mixed with 100 .mu.l of the sample and left at 4 ° C overnight to allow separation. The lower phase was dialyzed for one hour through a Millipore membrane in the presence of an excess of a 7.5 TE buffer (10 mM Tris, 1 mM EDTA at pH 7.5 and 1 M Mg Cl 2) to remove excess salts.

Protocol D:

Elution through a column of type Microspin Sephacryl S400 HR (Pharmacia Biotech, Uppsala, Sweden), followed by elution through a Elutip type column.

Each protocol is terminated by a precipitation step with ethanol, and the DNA is resuspended in 10 .mu.l of TE buffer 7.5. The effectiveness of the purification protocol was verified by PCR amplification of undiluted aliquots of DNA and aliquots diluted solutions and 10 x 100 times, using standard protocols (see below).

1.13 RECOVERY OF DNA FROM MICROORGANISMS INNOCULES: The cells, spores and hyphae were washed twice and counted by plate count or direct microscopic counting. 5g dry soil batches and sieved (soil 2, 3 and 5) were inoculated with 100 .mu.l of a suspension of spores and hyphae of S. lividans at concentrations equal to 0.10 3 10 5 10 7 10 9 spores / g of dry weight of soil or with vegetative cells of B. anthracis in concentrations equal to 0.10 7 to 10 9 cells per gram of dry weight of soil.

The amounts of hyphae of S. lividans were calculated based on the number of spores which they originate. After addition of the bacterial suspensions, soil samples are vigorously mixed by vortex for 5 minutes prior to grinding. The DNA is extracted according to the protocol # 6 (see below).

PCR amplification followed by a dot blot (dot blot) and imaging phosphorescence (phospho-imaging) was used to quantify the amounts of DNA recovered from the cells, spores, and the inoculated bacterial mycelium in soils.

Extraction of DNA was performed by lysis protocol # 6. PCR amplification and hybridization were performed as described above. The primers and probes are targeted to chromosomal regions located outside the region 16S, and are highly specific to the respective bodies so as to prevent any background noise signals.

For soils seeded with β. anthracis, the R499 and R500 primers were used (Patra et al. (1996)) and the amplification products were hybridized with the oligonucleotide probe C501 (Table 2).

For soils seeded with S. lividans, PCR reactions were performed using the primers and FGPS516 FGPS517, and the amplification products were hybridized with the oligonucleotide probe FGPS518 (Table 2).

The amplified region is a part of the cassette constructed specifically for the OS48.3 strain (Clerc-Bardin et al., Unpublished). Calibration accounts were in any case obtained by using purified DNA from the target organism.

2. RESULTS

2.1 CHOICE OF EXTRACTION BUFFER:

20 different soils were used to determine the pH optimum of the DNA extraction buffer. For all soils, DNA yield increases with increasing pH buffer. The yield for each pH (+/- sd), calculated as the percentage of the highest value for each of the soil, is as follows: pH 6.0: 31 +/- 13; pH 7.0: 43 +/- 16; pH 8.0: 60 +/- 14; pH 9.0: 82 +/- 12; pH 10.0: 98 +/- 3.

For 16 of the 20 floors, the highest yield was obtained at pH 10.0, while for the other four the highest yield soil was obtained at pH 9.0. However, at pH 10.0, larger amounts of humic material were released, compared to pH 9.0 (data not shown). Accordingly, pH 9.0 was chosen for all experiments presented below.

2.2 EFFECTIVENESS OF PROTOCOLS DNA EXTRACTION:

Total DNA of indigenous organisms in the soil was extracted and quantified in order to assess the effectiveness of many cell lysis protocols in situ. Samples of soil 1-6 (Table 1) were treated according to the protocols No. 1-5 described in the Materials and Methods section (FIG

D-

After DNA extraction, soil suspensions were precipitated with isopropanol, and aliquots of resuspended pellets were analyzed by gel electrophoresis, in a first step, in order to estimate the quality and the amount of released DNA.

However, the color of the extracted DNA was becoming darker at progressively increasing numbers of lysis steps, due to the co-extraction of compounds, such as humic acids, with the DNA.

Some of these crude extracts dark do not migrate as expected in agarose gels.

Accordingly, crude DNA solutions were purified (protocol B) before quantification. The gel electrophoresis of the purified solutions obtained after the various lysis treatments are exemplified on the floor 3 (Figure 2).

A visual comparison to ultraviolet radiation intensities of stained DNA allowed a semi-quantitative estimation of the effectiveness of treatments. Moreover, the presence of multiple sizes migration profiles fragments (discrete bands) DNA and the disappearance of long fragments indicates that DNA damage has occurred.

No DNA could be extracted from the clay soil 5. A more precise quantification of the DNA of all soils, extracted according to the protocols 1 to 5, was carried out by dot blot (Dot

Blot) without prior PCR amplification step and using an oligonucleotide probe complementary to a highly conserved sequence of the 16S rDNA region (FGPS probe 431, Table 2).

The DNA was detected in extracts of all soils after each of the different stages of lysis, except clay soil 5.

The results are consistent with estimates made after electrophoresis gel. In order to compare with independent quantification method, the DNA extracted according to the protocol # 2 (all floors except the floor # 5) was also quantitated using a colorimetric method for DNA detection (RICHARD, 1974).

We found a good correlation (r = 0.88) between the DNA quantified using the colorimetric technique and the results obtained by hybridizing the type Dot-Blot / radioimaging, confirming the hypothesis that the average number of copies of soil bacteria (rrn) is 7.

Hybridization (Dot Blot) showed that the amounts of extracellular DNA, as determined by extraction without lysis treatment (Protocol 1), ranged from 4μg / g for the acid sol (# 6) at 36 mcg / g for the ground 3 (table 3).

grinding the soil (Protocol 2) increased the amount of DNA extracted from any soil (p. ex. 26 mg / g of soil) to the soil 6 and 59 mg / g of soil ( for soil No. 3) (table 3; Figure 2).

For both grinding treatment (see Materials and Methods section) the discrete migration of DNA was detected on agarose gels, indicating that the DNA molecules were partially degraded (Figure 2). The size of the DNA fragments is between 20 and 0.2 kb.

The band intensity of smaller fragments is very low, indicating that most of the fragments have a size much greater than 1 kb.

Protocol 3 includes a homogenization step in an Ultraturrax mixing device type after addition of the extraction buffer to the soil samples. This step leads to increased amounts of DNA sample, as determined by dot blot (Dot Blot) for two soil (sandy soil 3 and the acid No. floor 6), while the two rich soils organic material (soil # 1 and # 2) resulted in obtaining smaller amounts of DNA.

Protocols No. 4a and 4b were used to assess the influence of two types of sonication on the yields of DNA from previously crushed and homogenized soil. Sonication had no positive effect on yield

DNA compared to Protocol 3, except for the floor 6. However, lysis of the effectiveness of two types of sonicateur differ. For floors 2, 3 and 4, the amounts of DNA larger extracts were obtained using the titanium microtip (Table 3; Figure 2), whereas for soils No. 1 and No. 6, DNA yield was higher using the device Horn Cup.

Conflicting results were also obtained when added a step of enzymatic / chemical lysis (Protocols 5a and 5b) after the step of sonication: in some cases, the amounts of DNA were extracted larger than those recovered according protocols 4a and 4b, while in other cases the yields were lower (table 3).

2.3 DIRECT COUNTING MICROORGANISMS:

Accounts under the microscope of the total number of bacterial cells after staining with acridine orange has been made for all soils before and after grinding.

Before grinding, the number of bacteria per gram of dry weight of soil ranged from 1, 4 x 10 9 (+/- 0.4) in the tropical soil No. 5-10 x 10 9

(+/- 0.7) in soil from the Côte Saint-André (ground 3) (Table

D-

After grinding, cell numbers were respectively 45, 74, 75, 54, 34 and 75% of initial values ​​for the soil 1 to 6. 2.4 COUNTING OF ACTINOMYCETES CULTIVATED BELONGING TO DIFFERENT KIND:

A change in the population of actinomycetes in the soil 3 was noticed after the various lysis treatments (Figure 3).

For example, colonies of Streptomyces sp. dominated the flora viable actinomycetes lysis when no treatment is applied (Protocol 1), and accounted for 65% of the total number of identified colonies. After grinding, the percentage of colonies of Streptomyces decreased to 51%, while the proportion of colonies belonging to the genus Micromonospora increased 14% to 41%.

The chemical / enzymatic lysis (5a and 5b protocols) has emerged as particularly effective in the lysis of streptomycetes. When all the lysis treatments were applied, including a chemical / enzymatic lysis (protocols 5a and 5b), the actinomycete microflora, which still contained more of 10 6 CFU / g soil, was dominated by species belonging to genus Micromonospora, while no or very little Streptomyces colonies were recovered.

Organizations such as the genera Streptosporangium, Actinomadura, Microbispora, Dactilosporangium and Actinoplanes appeared on the low number plates (2-8% of the total number of identified colonies) after milling, homogenization with the Ultraturrax device, and sonication, but were usually absent when these treatments were combined with a chemical / enzymatic lysis.

The total number of culturable bacteria remaining after each lysis treatment (protocol 2-5) was also searched for the floor 4. The results indicate that the number of culturable bacteria does not decrease with the lysis treatment intensity (about 2 × 10 -6 CFU / g soil in all cases, and also when a treatment is applied, as according protocol 1).

Obtaining such low values ​​of CFU is probably due to the fact that dry soil was used and only the most resistant bacteria have multiplied on the plates. The number of colony forming actinomycetes was generally greater than that of the total CFU (all bacteria) that a spore germination step, included in the actinomycetes detection protocol lacked when monitoring total bacteria.

2.5 RECOVERY OF DNA Phage Lambda ADDED:

The aim of these experiments was to estimate how successive lysis treatments could affect the recovery of naked DNA, and if these successive lysis treatment contributed to its degradation.

The DNA could be either an extracellular DNA fraction released from already dead organisms, which can persist in the soil for months (Ward et al., 1990), or DNA released from organisms lysed easily in the early stages of treatment. To simulate this, the lambda phage DNA digested with HindIII was added at various concentrations, soil before and after grinding. In addition to grinding, a combination of the other lysis treatments were tested, including sonication (device Cup

Horn, see Protocol 4b) and thermal shock (see

Material and methods).

After extraction, aliquots which theoretically should contain 25 to 150 ng of lambda phage DNA were analyzed by gel electrophoresis. No specific DNA fragment of lambda phage could be observed when DNA was inoculated into the soil samples prior to grinding, regardless of dose or the type of soil.

When DNA was added after grinding, and extracted without lysing additional processing step, specific profiles of lambda phage DNA were detected in extracts from four of the five tested soils.

In all these cases, a direct cause and effect was obtained between the amount of added DNA and the intensity of signals on agarose gels. The signal intensities were, however, lower than the expected signal strengths when compared to those molecular standards.

Moreover, the band at 23 kb was absent in many cases, indicating that long fragments were preferentially adsorbed to soil particles, or were more susceptible to degradation compared to short fragments.

No band was detected in samples of tropical soil # 5 which is characterized by a very high clay content (Table 1). For more accurate quantification, the DNA recovery was determined on an imaging device by phosphorescence (phospho-imager) after hybridization blot (dot blot). In this technique, the DNA was detected in all samples, including those who had been inoculated before grinding, with the exception of soil No. 5 in which no DNA could be detected.

In all other floors, the DNA extracted quantity increases with increasing inoculum size (4a-d).

However, lambda phage DNA recoveries were low. When grinding was the only treatment applied lysis, the recoveries were between 0.6 and 5.9% of the added DNA when it was added before grinding, and from 3.6 to 24% DNA added when it was added after grinding. The highest recovery levels were obtained from the ground 2.

The electrophoresis gel fractions Aliquots of samples treated by heat shock and sonication was allowed to observe DNA bands in any of the samples, including the assay in which DNA was added after grinding. The spot in hybridization experiments (dot blot) confirmed these results.

Hybridization signals obtained from soil suspensions which have been treated by thermal shock and sonication were, at most, low.

The sample having the largest amount of DNA (15 ug DNA / g of dry weight of soil) was the only one for which the signal obtained was significantly different from the level of background noise. No difference (or minor differences) was observed between the samples treated with heat shock and those treated by thermal shock and sonication, indicating that the thermal shock has a detrimental effect on DNA. The best recoveries were observed for the soil 2, which has the highest content of organic matter (Table 1), whereas no DNA was recovered from the clay soil # 5.

Additional experiments were performed with unground soil samples No. 4 and No. 5, who were seeded with 20 and 50 mcg lambda phage DNA per gram of soil.

The samples were extracted immediately or after an incubation period of one hour at 28 ° C, then the DNA extracts were purified and analyzed by gel electrophoresis.

The incubation of the soil # 4 for one hour after inoculation did not lead to profiles qualitatively or quantitatively different from those obtained without incubation or those previously observed when DNA was added after grinding.

These results indicate that the enzymatic degradation by nucleases ground would not be involved in the low recovery rate of DNA. Moreover, the absence of grinding stage does not allow an increase in the recovery of DNA from soil No. 5, indicating that the soil structure changes due to milling do not significantly increase the adsorption nucleic acids on the colloids.

2.6 SATURATION ADSORPTION SITES WITH RNA:

Most profiles obtained on the agarose gels are not significantly different from previous profiles in which the RNA processing has not been performed.

For example, no band was detected from the soil rich in clay # 5, regardless of the RNA concentrations and lambda phage DNA concentrations used. In addition, specific bands of lambda phage DNA digested with HindIII remained undetectable in the sandy soil treated RNA (sol # 4) when the RNA is added before grinding.

The intensity of the bands obtained from samples inoculated with the DNA after grinding increases with the concentration of RNA, indicating that the treatment could have a positive effect.

However, the results after hybridization and phosphorescence imaging analysis did not confirm the results of the electrophoresis. For example, the positive effect RNA treatment on the recovery of DNA from the clayey soil, when DNA was added after grinding, is not clear.

• t

On the other hand, a positive effect of the RNA was found for the soil rich in clay (No. 5) when the DNA was added after grinding.

Although hybridization signals for control samples do not differ from background levels, significant amounts of DNA were released from the samples treated with the RNA, and the signal increased with the amount of added DNA as well as RNA concentration.

However, even for the highest concentration of RNA (100 mg / g of dry soil weight) the recovery never exceeded 3%.

2.7 PURIFICATION OF CRUDE EXTRACTS DNA:

The four protocols tested, the best amplification of undiluted DNA extracts (1 .mu.l of extract in 50 .mu.l of PCR mix) was observed after elution through S400 Microspin columns followed by elution through a Elutip-type column, as shown by gel electrophoresis of PCR products. The DNA purified by the two-phase aqueous system (protocol

C) yielded lower amounts of PCR products after amplification from undiluted DNA extracted.

No amplification product could be obtained from undiluted extracted after amplification as a result of the implementation of protocols A or B. Accordingly, the protocol B (see Materials and Methods section) was used to all experiments in which the PCR amplifications and / or hybridizations task (Dot Blot) were performed.

2.8 QUANTIFICATION BY PCR AND HYBRIDIZATION:

The first step was to determine whether the amounts of PCR product were proportional to the number of DNA target molecules initially present in the reaction tube. DNA Streptosporangium fragile was used as a target (see Materials and Methods section).

The primers used were the primers and FGPS122 FGPS350 (Table 2). Electrophoresis PCR products gel showed that the band intensity increases with increasing concentration of target. The PCR products were hybridized with the oligonucleotide probe FGPS643 (Table 2), and signals were quantitated by imaging phosphorescence (phospho-imaging).

We found a good correlation (i ^ ≈ 0.98) between target logfnombre] and log [intensity of the hybridization signal]. Was then examined whether the efficiency of PCR amplification was affected by humic acids and non-target DNA. When analyzed by gel electrophoresis, the increased intensity of the bands of the PCR products, corresponding to different amounts of target DNA, was retained when amplification was performed with DNA solutions which had been added extracts soil treated with DNase, containing wet acid at concentrations up to 8 ng in the PCR mixture with a volume of 50 .mu.l.

With 20 ng humic acid in the PCR mixture, the bands corresponding to low target DNA levels have disappeared, and humic acid concentrations of 80 ng and at higher concentrations, no band was visible.

The varied amounts of target DNA S.fragile have provided product quantities expected PCR when, before amplification, DNA fragile S. was mixed with Streptomyces hygroscopicus DNA and added to the PCR mix 50 .mu.l in a range of 100 pg to 1 mcg to simulate the non-target DNA released from the soil microflora.

2.9 Quantification of ACTINOMYCETE NATIVE SOIL AFTER DIFFERENT TREATMENT Lysis:

D was applied purification of the protocol followed by amplification by PCR as described above to quantify the actinomycetes belonging to the genus Streptosporangium soil # 3 after extraction according to protocols 1, 2, 3, 5a and 5b (Figure 5).

After grinding, (Protocol 2) the amount of target DNA from this actinomycete was estimated by hybridization (Dot Blot) and radioimaging as 2.5 +/- 1, 3 ng / g of weight dry soil. If one assumes that the DNA content is 10 fg per cell, as for Streptomyces (Gladek et al. 1984), this value corresponds to approximately 2.5 × 10 5 genomes. Similar values ​​were obtained after the other lysis treatments (respectively 2.6 and 1.1 +/- 1 8 +/- 1, 3 ng DNA / g of dry soil using respectively the 3 protocols and 4b).

2.10 EFFECTIVENESS OF DNA FROM SOIL RECUPARATION PREVIOUSLY inoculated with BACTERIA:

Three floors (2, 3 and 5) were inoculated with spores or hyphae of Streptomyces lividans in different concentrations (see Materials and Methods section). The amounts of added ground mycelium (Figure 6b) corresponding to the number of spores inoculated in the germination medium. Approximately 50% of these spores germinated. The exact number of cells in the hyphae of germinated spores has not been determined. Accordingly, the amounts of spores and mycelia seeded in soils are not directly comparable.

For each sample soil, the extraction protocol No. 6, the purification method D, and PCR amplification in combination with the dot blot (dot blot) and imaging phosphorescence (phospho-imaging) were DNAs used to enumerate specific targets that had been released. The extracted DNA can be clearly distinguished from the background noise only when the number of spores added exceeds 10 5 for soil # 3 and # 5 and 10 7 in the floor 2 (Figure 6a). Where the mycelium is added, the extracted DNA can be detected beyond an amount corresponding to 10 3 spores / g soil for soil # 2 and # 3, and beyond of 10 7 spores / g for soil # 5 (Figure b).

Above the detection level, the hybridization signal increases with increasing amounts of the inoculated cells. For spore inoculum, a 100-fold increase in the number of seeded cells led to an increase of nearly 100 of the DNA yield. This increase is clearly lower when the hyphae are inoculated, especially in soils 2 and 3 (Figure 6). On the contrary, the results obtained when the lambda phage DNA was used as inoculum, the DNA was also recovered from the soil rich in clay (No. 5) when the bacterial cells were used as inoculum. However, the latter also, treatment with RNA increased the Streptomyces DNA recovery from the soil for both spores and mycelia (Figure 6).

The fact seeding soil with vegetative cells of Bacillus anthracis provided similar rates of recovery to those for Streptomyces. In addition, DNA recovery from soil No. 5 increased after treatment with RNA also for this inoculum.

Example 2: Construction of a low molecular weight DNA library (<10 kb) from a contaminated soil by lindane: cloning and expression of the gene linA

This example describes the construction of a soil DNA library in E. coli. It allows to demonstrate the cloning and expression of small genes from a non-cultivable microflora. Lindane is an organochlorine pesticide, recalcitrant to degradation and persistent in the environment. In aerobic biodegradation is catalyzed déhydrochlorinase encoded by the gene linA, for transforming the lindane in 1, 2,4 trichlorobenzene. The linA gene has been identified as one of two strains isolated from soil: Sphingomonas paucimobilis isolated in Japan (Seeno and Wada, 1989, Imai et al 1991 Nagata et al 1993) and Rhodanobacter lindaniclasticus isolated in France (Thomas et al 1996 Nalin fl al 1999).

Yet the potential for degradation of lindane, highlighted by assay of chlorides ions released and amplification by PCR of linA gene from soil have been in contact or not with lindane seems to be spread more widely in the environment (Biesiekierska-

Galguen 1997).

1. Direct Extraction of soil DNA

Dry soils are milled for 10 minutes in a centrifugal mill fitted Restch 6 tungsten beads. 10 grams of crushed soil were suspended in 50 ml of pH 9 TENP buffer (Tris 50 mM, EDTA 20 mM, NaC1 100 mM, polyvinylpolypirrolidone 1% w / v) and homogenized by vortexing for 10 min.

After centrifugation for 5 minutes 4000 g at 4 ° C, the supernatant is precipitated with sodium acetate (3M, pH 5.2) and isopropanol, to be taken up in sterile TE buffer (10 mM Tris, 1mM EDTA mM, pH 8.0). The extracted DNA is then purified on a column of molecular sieve S400 (Pharmacia) and ion exchange column of Elutip (Schleicher and Schuell), according to manufacturers instructions, and stored in TE.

2. Construction of the DNA extracted from soil bank in the vector pBluescript SK

The vector pBluescript SK- and DNA extracted from the ground are chacuns digested with Hind \\\ and BamHl enzymes (Roche) at 10 units of enzyme per 1 ug of DNA (incubation 2 hours at 37 ° C ). The DNAs are then ligated by the action of T4 DNA ligase (Roche), overnight at 15 ° C at a rate of one unit of enzyme per 300 ng of DNA (approximately 200 ng insert DNA and 100 ng of digested vector). The electrocompetent cells of Escherichia coli, DH10B ElectroMAX ™ (Gibco BRL) were transformed with the ligation mixture (2 .mu.l) by electroporation (25 uF, 200 and 500 Ω, 2.5 kV) (Biorad Gene Pulser).

After one hour of incubation in LB medium, the transformed cells were diluted to obtain about 100 colonies per plate and then are plated on LB medium (10 g / l Tryptone, 5 g / l yeast extract, 5 g / NaCl ) supplemented with ampicillin (100 mg / l) γ-HCH (500 mg / l), X-gal 60 mg / l (5-bromo-4-chloro-3-indolyl-α-D-galactoside) and IPTG 40 mg / l (isopropylthio-β-D-galactoside) and incubated overnight at 37 ° C. The γ-hexachlorocyclohexane (Merck-Schuchardt) being insoluble in water, a solution containing 50 g / l is prepared in DMSO (dimethyl sulfoxide) (Sigma).

A bank of 10,000 clones was obtained.

3.Clonage and expression of the gene linA

The screening of the library is effected by viewing a halo degradation lindane around the colony (lindane precipitating in the culture media). 10 000 clones screened, 35 and exhibited lindane degrading activity. The presence of linA gene in these clones was confirmed by PCR using specific primers, described by Thomas et al (1996). Digestions carried out on the inserts and on the amplification products showed identical profiles among all clones screened and the reference control, R. lindaniclasticus. Clones carrying the linA gene also had the same size insert (about 4 kb).

It could thus be shown that the soil DNA could be cloned and expressed in a heterologous host E. coli, and that genes from a difficult cultivable microflora could be expressed. Banks made from partial digestion of DNA extracted from the ground by restriction enzymes such as Sau3A \ are therefore also possible. Example 3

A method of preparing a collection of nucleic acids from a soil sample comprising a step of indirect extraction of DNA.

1. MATERIALS AND METHODS.

1.1 Extraction of bacterial fraction of the soil.

soil 5g are dispersed in 50 ml NaCl 0.8% sterile, by grinding Waring Blender for 3 x 1 minute, with cooling on ice between each grinding, the bacterial cells are then separated from the soil particles by centrifugation on a cushion Nycodenz density (Nycomed Pharma AS, Oslo, Norway). In a centrifuge tube, 11, 6 ml of a Nycodenz solution of density 1.3 g. ml "1 (8g Nycodenz suspended in 10 ml of sterile water) are placed under 25 ml of the soil suspension obtained above. After centrifugation at 10,000 g in a swinging bucket rotor (rotor TST 28.38, Kontron) for 40 minutes at 4 ° C, the cell ring, located at the interphase of the aqueous phase and the Nycodenz phase is removed, washed in 25 ml sterile water and centrifuged at 10,000 g for 20 minutes. the pellet cell is then taken up in a 10 mM Tris solution EDTA 100 MMN pH 8.O. Prior to the dispersion of the ground Waring Blender, a soil enrichment step in a yeast extract solution may be included to allow . including bacterial spores germination soil 5 g of soil are then incubated in 50 ml of a sterile solution of NaCl 0.8% - 6% yeast extract for 30 minutes at 40 ° C. the yeast extract is eliminated. by centrifugation at 5000 rpm for 10 minutes to avoid the for foam mation during grinding.

1.2 Lysis of soil bacterial cells. - Lyse cells in a liquid medium and purification on a cesium chloride gradient.

Cells were lysed in a 10 mM Tris solution, 100 mM EDTA, pH 8.0 containing 5 mg.ml '1 lysozyme and 0.5 mg.ml "1 achromopeptidase for 1 hour at 37 ° C. A solution of lauryl sarcosyl ( 1% final) and proteinase K (2 mg.ml "1) is then added and incubated at 37 ° C for 30 minutes. The DNA solution is then purified on a density gradient of cesium chloride by centrifuging at 35,000 rpm for 36 hours on a Kontron rotor 65.13. The employee cesium chloride gradient is a gradient to 1 g / ml CsCl, having a refractive index of 1.3860 to (Sambrook et al., 1989).

- Lyse cells after inclusion in an agarose block.

The cells are mixed with an equal volume of 1.5% agarose (w / v) Seaplaque (FMC Seaplaque agarose Products. TEBU, Le Perray en Yvelines, France), low-melting and cast in a block of 100 .mu.l. The blocks are then incubated in a lysis solution: 250 mM EDTA, 10.3% sucrose, lysozyme 5 mg.ml "1 and achromopeptidase 0.5 mg.ml" 1 at 37 ° C for 3 hours. The blocks are then washed in a solution of Tris 10 mM - 500 mM EDTA and incubated overnight at 37 ° C in 500 mM EDTA containing 1 mg.ml '1 of proteinase K and 1% lauryl sarcosyl. After several washes in Tris-EDTA, the blocks are preserved in 500 mM EDTA.

The quality of the DNA thus extracted is controlled by pulsed field electrophoresis. The amount of extracted DNA was evaluated by gel electrophoresis compared with a DNA standard range of calf thymus.

1.3 Molecular characterization of the DNA extracted from the ground.

Soil extracts are characterized by DNA hybridization PCR method of amplifying in a first step the DNAs using primers located on universally conserved regions of the 16S rRNA gene, and hybridizing the amplified DNAs with different oligonucleotide probes of known specificity (table 4) in order to quantify the intensity of the hybridization signal with respect to an external reference range of genomic DNA.

The DNA extracted from the ground and the genomic DNA pure cultures of extracts were amplified with the primers FGPS 612-669 (Table 1) under standard PCR amplification conditions. The amplification products are then denatured with an equal volume of 1N NaOH, deposited on a nylon membrane (GeneScreen Plus, Life Science Products) and hybridized with an oligonucleotide probe labeled at its end by the g 32 P ATP by the action of T4 polynucleotide kinase. Following prehybridization of the membrane in a solution of 20 ml containing 6 ml of 20X SSC, 1 ml of Denhardt's solution, 1 ml of 10% SDS and 5 mg heterologous DNA of salmon sperm, hybridizations are conducted overnight at the temperature defined by the probe. The membranes were washed twice in 2X SSC for 5 minutes at room temperature, and once in 2X SSC 0.1% SDS and once in 1X SSC, 0.1% SDS for 30 minutes at the temperature 'hybridization. The hybridization signals are quantified using Molecular Analyst software (BioRad, Ivry sur Seine, France) and the amounts of DNA are estimated by interpolation from standard curves obtained from the genomic DNA.

2. RESULTS AND DISCUSSION

2.1 Extraction and lysis of bacterial fraction of the soil.

Separating the microbial cells of the soil particles, prior to the extraction of the DNA, is an alternative with many advantages over methods of direct extraction of DNA into the ground. Indeed, the extraction of microbial fraction limits the contamination of the DNA extracted from the extracellular DNA present freely in the soil or by the DNA of eukaryotic origin. Importantly, the DNA extracted from the microbial fraction of the present ground fragments of size longer and better integrity than DNA extracted by direct lysis JACOBSON and Rasmussen (1992). In addition, the separation of soil particles avoids contamination of the DNA extracted humic and phenolic compounds, which can, thereafter, cause serious harm to cloning efficiencies.

One of the stages for the extraction of the ground cells is the dispersion of the soil sample to dissociate the cells adhering to the surface or inside of soil particles aggregates. Three successive grinding cycles of one minute each allow to obtain a better extraction efficiency of the cells and a larger amount of recovered DNA, compared with a single grinding cycle of a minute 30.

Table 5 reports the extraction efficiencies obtained after Nycodenz gradient centrifugation, the total viable microflora (enumerated by microscopy after staining with acridine orange) on the total cultivable microflora (counted on solid media Trypticase-Soy 10% ), and on the microflora of culturable actinomycetes on HV agar medium (after incubation at 40 ° C in a yeast extract solution 6% SDS-0.05% in order to cause the germination of sprores). On the other hand, the extracted DNA was quantified either after lysis of the cells in liquid medium (without gradient purification of cesium chloride) after lysis of the cells included in a block of agarose (after digestion of the agarose by agarase-b).

The results show that over 14% of the total soil microbial population is recovered by this method (or 2 10 8 cells per gram of soil), and the total cultivable microflora represents just 2% of the total microbial population.

On the other hand, the amount of DNA extracted from the cells was 330 ng per gram of dry soil. By estimating the DNA content per microbial cell from the ground between 1.6 and 2.4 fg, and taking into account the amount of extracted cells (2 10 8 cells per gram of soil), it is estimated that almost all cells were lysed and thus lysis provides no significant bias in this approach.

Electrophoresis pulsed field showed that DNA extracted from the ground after Nycodenz gradient CsCl and could reach a size of 150 kb and the agarose block lysis allowed to extract higher fragments 600kb. These results confirm the interest of this independent approach to culture for the construction of environmental DNA libraries, by presenting itself as an alternative to direct methods of DNA extraction.

2.2 Molecular characterization of the DNA extracted from the ground.

The object of the molecular characterization of the DNA extracted from the ground is to obtain profiles representing the proportions of the different taxons present in the DNA extract. It was also to know the means of extraction induced by the prior separation of the cellular reaction of the soil, in comparison with a method of direct extraction for lack of direct visualization of microbial diversity in soils. In fact, little information has been gathered on the extraction of cells Nycodenz gradient based on their morphological structure (cell diameter filamentous forms or spore).

The methods in place so far were based on: quantitative hybridizations using oligonucleotide probes specific for different bacterial groups, applied directly to DNA extracted from the environment. Unfortunately, this approach is not very sensitive and does not detect gender or taxonomic groups present in low abundance Amann (1995). - quantitative PCR such as PCR-MPN (Most Probable

Number) SYKES et al. (1992) or quantitative PCR DIVIACCO et al competition. (1993). The respective disadvantages of each approach are (i) the heaviness of use due to the proliferation of dilutions and repetitions that makes the technique unsuitable for a large number of samples or pairs of primers, and (ii) the need to build a specific competitor DNA target and does not induce bias in the competition.

The method implementation according to the present invention is to universally amplify a 700 bp fragment within the 16S rDNA sequence, hybridizing the amplification product with an oligonucleotide probe specific variable (at the reign of order, sub class or genus) and comparing the intensity of hybridization of the sample with respect to a range external standard. The pre-amplification hybridization quantifies gender or scarce species of microorganisms. In addition, amplification universal primers allows, upon hybridization, using a large set of oligonucleotide probes. It compares them different lysis modes (direct or indirect extraction) on well defined taxonomic groups. The results are summarized in Table 6.

They show similar patterns between the two extraction methods (direct and indirect). Thus, it appears that prior extraction of the telluric microbial fraction introduces no real bias among taxa tested. The only significant difference between the two extraction approaches seem to be the most abundant rDNA sequences belonging to γ-Proteobacteria in the extract by the indirect extraction method.

In addition, a significant effect of incubation of the soil sample in a yeast extract solution is observed on sporulating soil populations (Gram +, low percentage of GC and Actinomycetes).

This step causes the spore germination, and allows a hand certainly better recovery of these cells and also more effective lysis of cells germinating.

This approach allows a semi-quantitative analysis, focused on key taxa defined from microorganisms grown and usually found in soil. Only molecular tools for estimating the importance of different taxa, methods of cultivation are too restrictive and dependent on the specificity of the medium used. The results show that a large proportion of the microbial population is not represented in the phylogenetic groups described, thus highlighting the existence of new groups made uncultivated microorganisms far or not arable. Thus, new probes can be defined based on sequences determined from DNA extracted from the ground (phyla new compounds of uncultivated microorganisms, LUDWIG et al. (1997) to obtain a more accurate picture of the composition of the DNA extract.

Example 4 - CONSTRUCTION COSMID POS POS 700I 700I Features:

Replicative in E. coli I ntég ratif in Streptomyces

Selectable in E. coli Amp, HygroR and Streptomyces HygroR

The cosmid properties allow to insert large DNA fragments between 30 and 40 kb. II comprises

1 - The inducible promoter tipA Streptomyces lividans

2 - The specific integration system of the element pSAM2

3 - The gene for resistance to hygromycin 4- cosmid pWED1 derived from pWED15

1) - The tip of the inducible promoter gene of S. lividans

TipA the gene encodes a protein of 19 KD whose transcription is induced by the antibiotic thiostrepton or nosiheptide. The tipA promoter is well regulated: induction log phase and stationary phase (200X) Murakami T, TG Holt, CJ Thompson. J. Bacteriol

1989; 171: 1459-1466

2) - The gene for resistance to hygromycin

- Hygromycin: antibiotic produced by S. hygroscopicus

- resistance gene encodes a phosphotransferase (hph)

- The gene used is from a cassette constructed by Blondelet et al wherein the hyg gene is under control of its own promoter and the plac promoter inducible by IPTG Blondelet-Rouault et al; .

3) - The site-specific integration system

The pSAM2 element is integrated in the chromosome by a site-specific integration mechanism. Recombination occurs between identical sequences of 58 bp present in the plasmid (attP) and the chromosome (TANF). The int gene, located near the site AFTP, is involved in the integration site-specific pSAM2, and its product has similarities with the integrase temperate phages of enterobacteria. It has been shown that a fragment containing only the pSAM2 attP attachment site and the int gene was able to fit in the same way that the entire element. See French Patent No. 88 06638 of 18.5.1988 and Raynal A et al. Mol Microbiol 1998 28: 333-42).

4) - Construction of cosmid pOS700l

Step 1 / TIPA promoter was isolated from plasmid pPM927 (Smokvina et al Gene 1990; 94:. 53-9) on a HindIII-BamHI fragment of 700 bp and cloned into the vector pUC18 (Yannish-Perron et al. , 1985) digested with HindIII / BamHI

Step 2 / The HindIII-BamHI fragment was subsequently transferred to pUC18 pUC19 (Yannish-Perron et al., 1985).

Step 3 / A BamHI-BamHI insert of 1500 base pairs with the int gene and attP site pSAM2 was isolated from the plasmid pOSintl, shown in Figure 8, (Raynal A et al Mol Microbiol 1998 28:. 333-42 ) and cloned into the BamHI site of the above vector (pUC19 / TIPA), in the direction for carrying the int gene under control of the tipA promoter. Step 4 / BamHI site located 5 'of the int gene was removed by partial BamHI digestion and treatment with Klenow enzyme. A HindIII-BamHI fragment carrying TIPA-attP-int was thus isolated from pUC19 and transferred into pBR322 HindIII / BamHI.

Step 5 / Isolated Hygromycin cassette pHP45Ωhyg (Blondelet- Rouault et al., 1997) on a HindIII-HindIII fragment was cloned into the HindIII site upstream of the promoter TIPA.

Step 6 / HindIII site located between the cassette and ΩHyg TIPA promoter was deleted by Klenow treatment after partial digestion HindIII.

Step 7 / The plasmid obtained at the end of the previous step makes it possible to isolate a single HindIII-BamHI fragment, carrying all elements ΩHyg / TIPA / int attP, which was cloned after Klenow treatment at the EcoRV site of the cosmid pWED The cosmid pWED1, shown in Figure 9, derived from the pWE15 cosmid, shown in Figure 10 (Wahl GM, et al Proc Natl Acad Sci USA 1987 84:.. 2160-4) by deletion of a HpaI-HpaI fragment carrying the Neomycin gene and the SV40 origin.

A vector map pOS 700I is shown in Figure 11.

Example 5: Construction of several cosmids conjugative and integrative in Streptomyces, the vector vPos 303. POSV306 and POSV307

5.1 Construction of pOSV303 vector.

Since the packaging selects clones having greater than 30kb in size, only 10 to 15% of the clones do not contain insert, it is not really necessary to have a recombinant selection system, which allows to build smaller vector. Construction:

Step 1: the vector pOSVOOl

Cloning of a PstI-PstI fragment of 800 bp carrying the origin of transfer OriT replicon RK2 (Guiney et al., 1983), into pUC19 plasmid opened with PstI. This cloning step provides a transferable vector from E. coli to Streptomyces by conjugation.

Map vPos 001 vector is shown in Figure 17.

Step 2: vector pOSV002

Inserting the Hygromycin marker (Ωhyg cassette) and selectable in Streptomyces, so that the gene conferring resistance to hygromycin is transferred last which allows to ensure the complete transfer of LAC with the DNA insert ground. Hygromycin cassette cloning pHP45Ωhyg isolated on a HindIII-HindIII fragment carrying the gene for resistance to hygromycin .. This fragment is cloned at the PstI site (position 201) of pOSVOOl vector. The PstI site was chosen, considering the direction of the transfer, for the Hygro marker is the last transferred during conjugation. PstI and HindIII ends are made compatible after treatment with the Klenow fragment of DNA polymerase to generate "blunt ends." The orientation of the fragment is determined Ωhyg near completion.

POSV002 vector map is shown in Figure 18.

Step 3: The vector pOSV010

The isolated XbaI-HindIII fragment of plasmid pOSV002 and containing the resistance marker hygromycin and the transfer origin was cloned into the plasmid pOSintl digested with XbaI and HindIII. The orientaion sites is such that the hygromycin marker will always be transferred last.

POSintl the plasmid, shown in Figure 8, has been described in the article by Raynal et al (Raynal A et al Mol Microbiol 1998 28:. 333-42)..

This construction allows the expression of integrase in E. coli and in Streptomyces. Step 4: Insert the site "cos"

The principle is to insert a "cos" site in the plasmid allowing pOSV010 packaging into plasmid pOSV010, shown in Figure 12.

Obtaining fragment "cos" is shown in Figure 13.

This fragment was obtained by PCR. From a fragment carrying the cohesive ends (cos) of λ (lambda bacteriophage or cosmid pHC79), PCR amplification is performed using oligonucleotides corresponding to sequences -50 / + 130 relative to the cos site. These oligonucleotides also contain cloning sites NsiI compatible PstI, XhoI-compatible SalI, EcoRV, "blunt end".

The addition of the few sites SwaI and PacI possible to isolate and / or mapping of the cloned insert.

The PCR fragment is bounded by a PstI site at 5 'end and a HincII site at the 3' end, for cloning into the vector pOSV010 (Figure 12) prélablement digested with the enzymes NsiI and EcoRV, resulting in the deletion the lacI q repressor. POSV303 vector map is shown in Figure 14.

The pOSV303 vector contains cloning sites such as NsiI site,. Compatible PstI site XhoI compatible Sali or the Eco RV site for obtaining "blunt".

5.2 Construction of the vector pOSV306

Step 1: Construction of vector POSV308.

The pOSV308 vector was constructed according to the method illustrated in figure 27. A fragment of 643 bp containing the cos region was amplified using the primer pair sequences SEQ ID N ° 107 and

SEQ ID NO 108 from the cosmid vector pHC79 described by Hohm B and Collins (1980). This amplified nucleotide fragment was cloned directly into the vector pGEMT-easy sold by Promega Corporation, as shown in Figure 27 to produce the vector pOSV308.

Step 2: Construction of the vector pOSV306.

The vector pOSV010 was constructed as described in step 3 of construction pOSV303 vector, as described in Section 5.1 of this example. POSVIO the vector was digested with the EcoRV and NsiI enzymes to excise a fragment of 7874 bp which was subsequently purified, as illustrated in FIG 28.

Then the pOSV308 vector obtained in step 1) above was digested by EcoRV and PstI enzymes to excise a fragment of 617 bp which was subsequently purified.

Then, the cos fragment of 617 bp obtained from the vector pOSV308 was incorporated by ligation into the vector pOSVI O to obtain the pOSV306 vector, as shown in Figure 28.

5.3 Construction of POSV307 vector.

Cosmid pOSV307 always contains the lacI q gene, in order to improve the stability of cosmid in Streptomyces, for example in the S17-1 strain of Streptomyces. In order to construct the pOSV307 vector, pOSV010 vector was digested by PvuII enzyme to obtain a fragment of 8761 bp which was purified and dephosphorylated.

Then the pOSV308 vector as obtained as described in step 1) of paragraph 5.2 above, was digested with the enzyme EcoRI to obtain a fragment of 663 bp, which was then purified and treated by the Klenow enzyme.

The thus treated nucleotide fragment was integrated into the pOSV010 vector after ligation in order to obtain the pOSV307 vector as shown in Figure 29. Example 6 - Construction of cosmid shuttle replicative E. coli- Streptomyces pOS700R.

The fragments of the plasmid pEI16 (Volff et al., 1996) shown in Figure 15 were isolated and treated with Klenow. These fragments contain sequences necessary for the replication and stability from the plasmid SCP2.

Both fragment are separately inserted into the site

EcoRV cosmid pWED1 leading to two different clones. Isolated Hygromycin cassette pHP45Ωhyg on a HindIII-HindIII fragment was cloned into the HindIII site of the cosmid containing the SCP2 pWED1 insert as PstI-EcoRI fragments or

XbaI. It confers resistance to hygromycin selectable in both E. coli and in Streptomyces. S. lividans transformation and determination of transformation efficiency.

It appeared that the cosmid containing the XbaI insert was less stable than that containing the PstI EcoRI fragment. It is the latter which was retained as the pOS700R. Map vector pOS 700R is shown in Figure 16.

EXAMPLE 7 vector transformation efficiency integrative (POS700I and replicative.

potential

Making strain of S. lividans to thiostrepton resistant by integration of PTO1 plasmid carrying the thiostrepton resistance marker

Preparation of protoplasts from S. lividans grown in the presence of thiostrepton

With pOS700l vector, the transformation efficiency is about 3000 transformants per ug of DNA.

POS700R with the vector, the transformation efficiency is about 30 000 transformants per ug of DNA. Example 8: Construction of an integrative vector in LAC

Streptomyces and conjugatif

Characteristics:

Replicative in E. coli

Transferable via conjugation from E. coli to Streptomyces

Integrative in Streptomyces

Selectable in E. coli and Streptomyces Able to insert large DNA fragments; it must be emphasized that it is necessary to have DNA floor whose size is between

100 and 300kb and not contaminated with small fragments. Indeed the small fragments are preferentially integrated.

With a screen for selecting the plasmids carrying an insert. This screen allows eliminating the vectors closed on themselves and undigested to work with a higher ratio of vector DNA and insert which allows for greater efficiency of cloning to form banks.

Construction:

Step 1: the vector pOSVOOl

Cloning of a PstI-PstI fragment of 800 bp carrying the origin of transfer OriT the replicon RK2 (Guiney et al., 1983), into pUC19 plasmid opened with PstI. This cloning step provides a transferable vector from E. coli to Streptomyces by conjugation.

Map vPos 001 vector is shown in Figure 17.

Step 2: vector pOSV002

Inserting the Hygromycin marker (Ωhyg cassette) and selectable in Streptomyces, so that the gene conferring resistance to hygromycin is transferred last which allows to ensure the complete transfer of LAC with the DNA insert ground.

Hygromycin cassette cloning pHP45Ωhyg isolated on a HindIII-HindIII fragment carrying the gene for resistance to hygromycin .. This fragment is cloned at the PstI site (position 201) of pOSVOOl vector. The PstI site was chosen, considering the direction of the transfer, for the Hygro marker is the last transferred during conjugation. PstI and HindIII ends are made compatible after treatment with the Klenow fragment of DNA polymerase to generate "blunt ends." The orientation of the fragment is determined Ωhyg near completion.

POSV002 vector map is shown in Figure 18.

Step 3: the vector pOSVOIQ

The isolated XbaI-HindIII fragment of plasmid pOSV002 and containing the resistance marker hygromycin and the transfer origin was cloned into the plasmid pOSintl digested with XbaI and HindIII.

The orientation of the sites is such that the hygromycin marker will always be transferred last.

POSintl the plasmid, shown in Figure 8, has been described in the article by Raynal et al (Raynal A et al Mol Microbiol 1998 28:. 333-42).. This construction allows the expression of integrase in E. coli and in Streptomyces.

Step 4: POSV014 vector

Addition of a "cassette" that will ultimately select in the final construction of the plasmids having inserted foreign DNA.

This "cassette" carries the gene encoding the cI repressor of phage λ and the gene conferring resistance to tetracycline. This gene carries in its 5 'noncoding sequence of the target repressor. Insertion of DNA in the HindIII site located in the coding sequence of C leads to the non-production of the repressor and thus to the expression of tetracycline resistance.

It is carried by the plasmid pUN99 described in the article: Nilsson et al. (Nucleic Acids Res 1983 11: 8019-30)

An isolated PvuII-HindIII fragment containing the sequences and pOSV010

Int, attP, Hygro and ori cloned site of pUN99 Msc.

POSV014 vector map is shown in Figure 19.

Step 5: the vector vPos 403 vacteur LAC integrative and conjugative

This last cloning step in pBAC11 (shown in FIG. 20) makes it possible to confer the final characteristics of plasmid BAC (Bacterial Artificial Chromosome), in particular the ability to accept DNA inserts of very large size.

The PstI-PstI fragment of pOSV014 vector carrying all elements and functions described above is cloned into the pasmide pBAC11 (pBeloBACH) digested with NotI. The ends are made compatible pat treatment with Klenow enzyme. POSV403 vector map is shown in Figure 21. The diagram of Figure 21 shows the retaining orientation.

Step 6:

The pOSV403 vector contains the HindIII and NsiI sites. The NsiI site is quite rare in Streptomyces and has the advantage of being compatible with Pst. However, the PstI site is common among

Streptomyces and can be used to make partial digestion.

Recombinant clones carrying a cloned insert in the Cl repressor and thus inactivating the repressor becomes tetracycline resistant. Since the BACs are present only because of one copy per cell, it is necessary to select recombinant clones with a lower dose of tetracycline than the usual dose of 20 mcg / ml, for example with a dose of 5 mcg / ml. Under these conditions there is no background noise. It is also possible to use a system developed and marketed by the company Invitrogen, wherein insertion of DNA in the vector inactivates a gyrase inhibitor whose expression is toxic to E. coli. The fragment is preferably isolated from the pZErO-2 vector (http://www.invitrogen.com/).

Example 9: Construction of a bangue S. alboniger within 2 cosmids integrative (pOS700l) and replicative .pOS700R_

1) - Construction Bank

To assess the efficiency of the cloning system, the biosynthetic pathway of Streptomyces alboniger puromycin, was cloned in both cosmids pOS700l and pOS700R shuttles. The genes of the puromycin biosynthesis pathway are carried by a BamHI DNA fragment of about 15 Kb.

The genomic DNA of Streptomyces alboniger was isolated. 90% of this

DNA has a molecular weight between 20 and 150 Kb, as determined by pulsed field electrophoresis. Both cosmids were digested by the enzyme BamHI (single cloning site).

The partial digestion conditions BamHI genomic DNA were determined (50 ug of DNA and 12 units of enzyme, 5 minutes of digestion). After checking the size by agarose gel electrophoresis, the partially digested DNA was introduced into the vectors. In the ligation, 15 ug of genomic DNA + 2 ug of the integrative vector or 5 micrograms of the replicative vector were used.

Each ligation mixture was used to in vitro packaging of DNA in bacteriophage lambda heads. Mixtures encapsidation (0.5 ml) were titered (Vector integrative pOS700l = 7.5 x

10 5 cosmids / ml, Vector réplicatif≈ 5 * 10 4 cosmids / ml).

The cosmids were used to transfect E.coli and thus generate two banks of about 25000 clones resistant to ampicillin.

The DNA of all of these clones was isolated and quantified. To test the banks, several clones were selected, purified DNA was digested with BamHI, to verify the presence and size of inserts. The tested clones contain between 20 and 35 Kb insert of S. alboniger.

2) - Identification of clones containing the biosynthetic pathway of puromycin

Clones likely to contain the full channel puromycin biosynthesis were identified by hybridization with a probe corresponding to the gene for resistance to puromycin, the pac gene 1, 1 kb. (Gene Lacalle et al. 1989; 79, 375-80)

Bank made in the Integrative Vector pOS 7001:

Among 2000 clones analyzed, nine clones hybridized with the probe and contain approximately 40 kb inserts.

Bank made in the replicative vector pOS 700R:

Among 2000 clones analyzed, 12 clones hybridized with the probe; they contain about 40 kb inserts.

Using data published by Tercero et al. (J Biol Chem. 1996; 271, 1579-1590), clones containing the entire biosynthetic pathway have been identified after hybridization with appropriate probes. Some cosmids replicative and integrative present after EcoRV-ClaI digestion a fragment of 12360 bp, suggesting an insert containing the entire biosynthetic pathway puromycin.

4) - Verification of production by the puromycin resistant clones (Rhône-Poulenc). a) Materials and Methods

Strains and culture conditions:

Three resistant clones were selected to ensure the production of puromycin. They correspond to the recombinant S. lividans containing an insert in the integrative vector pOS700l (G 20) or an insert in the replicative vector (G21 and G22).

reference strains were used to ensure that the culture media used allowed this production. This is the wild strain ATCC 12461 S. alboniger, producer puromycin and the recombinant strain S. lividans containing the full cluster puromycin cloned into plasmid pRCP11 (Lacalle et al, 1992, the EMBO Journal, 11, 785-792) (G23).

The strains are seeded in a culture medium whose composition is as follows: Bacteriological peptone Organotechnie 5 g / l of final medium

yeast extract 5 Springer

Liebig Meat Extract 5

Glucose Prolabo 15

CaCO3 (1) Prolabo 3 NaCl Prolabo 5

Agar (2) Difco 1

(1) 3 g of carbonate are mixed with 200ml of distilled water and sterilized separately. The addition being after sterilization. (2) Agar is previously melted in 100 ml of distilled water before being added to the other ingredients of the medium

pH adjusted to 7.2 before sterilization sterilization 25 minutes at 121 ° C 50 g / l of hygromycin and 5 g / l thiostrepton are added to the medium after sterilization so as to maintain a selection pressure of the clones containing an insert with the marker gene present on the vector (the gene for resistance to thiostrepton being carried by the plasmid pRCP11).

50 ml of liquid culture medium, divided into 250 ml Erlenmeyer flasks are inoculated with 2 ml of an aqueous suspension of spores and mycelium of each strain. The cultures are incubated for 4 days at 28 ° C with stirring at 220 rev / mn.50 ml of production media, distributed into 250 ml Erlenmeyer flasks are then inoculated with 2 ml of these precultures. The production medium used is an optimized industrial applications for the production of pristinamycin (RPR 201 medium). The cultures are incubated at 28 ° C with stirring for 220trs / min. After different incubation times, an Erlenmeyer flask of each culture is adjusted to pH 11 and then extracted 2 times with 1 volume of dichloromethane. The organic phase is concentrated to dryness under reduced pressure and the extract is taken up in 10 .mu.l of methanol. 100 .mu.l of the methanolic solution are analyzed by HPLC equipped with a diode array detector in a water-acetonitrile gradient system 0.05% TFA VA C18 column for the detection of puromycin.

b) Results

Comparative HPLC analysis from the cultures of the various strains show the production of puromycin in the culture of the wild strain from 24 hours of incubation. Production, although weaker, was also clearly detected from 48 hr in culture the G20 clone containing the cosmid pOS700l (Figure 23). Puromycin was also detected in trace amounts in the G23 clone containing the full operon encoding the compound in plasmid pRCPH. However, no production was observed in the cultures of the G21 and G22 clones containing the cosmid pOS700R. The results are shown in Figure 23. c) Conclusions

The results obtained demonstrate the efficiency of the cloning system developed in pOS700l cosmid to express in a heterologous host such as S. lividans a path of complete biosynthesis under the control of regulatory sequences that are unique.

Furthermore, these data also validate screening the libraries obtained based on the resistance of clones puromycin as it led to identify from a small number of clones, a recombinant capable of expressing the associated biosynthetic pathway resistance gene. The absence of puromycin production among other clones can probably s "explained by the cloning of only part of the operon containing the resistance gene but lacking some regulatory sequences, or transcription transduction necessary for the synthesis of compound .

Example 10 - CLONING OF DNA SOLDANS VECTOR 1) - Soil Preparation DNA cloning

The different fragments of DNA must be purified according to their destination:

cosmids

The size of the molecules must be between 30 and 40 kb. However, DNA extracted from the ground is heterogeneous in size and comprises molecules of up to 200 or 300 kb. In order to standardize the sizes, the DNA is mechanically broken by passing the solution through a 0.4 mm diameter needle. Fragments of a size close to 30kb are not affected by these repeated passes through a needle and it is therefore not necessary to make a separation by size especially as packaging in the particles automatically eliminates short inserts. BACs

Preparation of DNA

The soil DNA is separated by electrophoresis in a pulsed field (CHEF type) under conditions such that fragments between

100 and 300 kb are concentrated in a band of about 5mm. This is achieved by making the migration in a normal agarose gel 0.7% or 1% agarose low melting point with a 100 second pulse time for 20 hours and at a temperature of 10 ° C.

DNA recovery

Two methods are used, their choice depends on the size of the molecules that we want to isolate, up to 150kb or above.

- Up to 150kb

The porosity of a 0.7% agarose gel allows the release of the DNA by electroelution condition of total absence of ethidium bromide.

This DNA is then treated with pipetting instruments enlarged and hydrophobic orifice to avoid the mechanical fragmentation of the molecules. - Between 100 and 300 kb

The band containing the fragments of a size between 100 and 300 kb is cut. For migrating an agarose gel and 1% low melting point is used. This property makes it possible to melt the gel to a temperature tolerable for the DNA of 65 ° C and then digested by the agarase (Agarase marketed by Boehringer) at a temperature of 45 ° C according to the supplier's instructions. 2) - Use of cosmids pOS700l integrative and replicative POS700R

tails by Construction poly polvT Principle

A cosmid vector, opened at any cloning site, is modified at the 3 'by adding a monotonous polynucleotide. On the other hand, the DNA clone is modified at the 3 'by adding a monotonous polynucleotide can anneal to the preceding.

The vector fragment association clone is done by these polynucleotides and the cos sequence of the vector permits the in vitro packaging of DNA into phage capsids Lamda.

Preparation of vector

The vector used is a self-replicating vector in E. coli and integrative in Streptomyces.

For E. coli, the selection is made on resistance to ampicillin and for Streptomyces, it is made on the resistance to hygromycin. The cosmid is open to one of two possible sites (BamHI and HindIII) and 3 'ends are extended with polyA with terminal transferase under conditions where the enzyme supplier provides for the addition of 50 to 100 nucleotides.

Preparation of DNA insert.

The 3 'ends of the DNA are extended by the polyT with terminal transferase under conditions providing an elongation comparable to that of the vector. Under the experimental conditions described by the manufacturer polyT polyA tails are long from 30 to 70 bases assembly of molecules and in vitro packaging.

For assembling molecules, mixing a vector molecule for an inserted DNA molecule. The concentration of mass in the DNA is 500 microg x ml "1.

The mixture is packaged and transfection efficiency Te depends on the strain used as a recipient and the inserted DNA: nil with the test DNA and the DH5a strain, the efficiency is comparable to the SURE strains DH10B and; extraction the DNA yield is however higher with strain DH10B.

Construction by dephosphorylation

The tillage DNA is blunted by removing 3 'sequences outgoing and filling sequences protruding 5'. This operation is made with: Klenow enzyme, T4 polymerase, the four nucleotide triphosphates. The cosmid vector is digested with BamHI and then treated with Klenow enzyme to make blunt and dephosphorylated to prevent it closes on itself. After ligation, the mixture was packaged and transfected as previously described.

3) - Use of pBAC Principe.

The plasmid pBAC conjugative and integrative has the HindIII and NsiI sites like cloning sites. The insertion of a DNA sequence to these inactive site Lambda phage repressor Cl which controls the expression of the gene of resistance to tetracycline. Inactivation of the repressor thus makes the cell resistant to this antibiotic (δμg.ml "1). Cloning in these sites is facilitated by the modification of the vector and preparation of DNA to be cloned. Preparation of vector. Example HindIII

For the vector does not turn in on itself, the Hind III site is amended first base (A) is back in place to form a sequence 5 'outgoing, which can not match with others. The operation is performed by Klenow enzyme in the presence of dATP.

The success of the operation is verified by performing a ligation of the vector to itself before and after treatment with Klenow enzyme. A quantity of DNA tested identical, one obtains 3000 clones before treatment and 60 after treatment.

DNA preparation (size between 100 and 300 kb). Getting blunt ends of DNA.

The DNA is blunted by removing 3 'sequences outgoing and filling sequences protruding 5'. This operation is made with: Klenow enzyme, T4 polymerase, the four nucleotide triphosphates.

Preparation Example HindIII-ends

The addition of DNA on the vector by means of oligo- nucleotides recognizing the modified HindIII sequence of the vector. They contain rare restriction sites to allow subsequent cloning (SwaI, NotI). this technique is derived from that: Elledge SJ, Mulligan JT, Rowing SW, Spottswood M, Davis RW. Proc Natl Acad Sci USA 1991 March 1; 88 (5): 1731-5 Two complementary oligonucleotides are used: Oligo 1: 5'-GCπATTTAAATATTAATGCGGCCGCCCGGG-3 '

(SEQ ID NO: 25)

Oligo 2: 5'-CCCGGGCGGCCGCATTAATATTTAAATA-3 '(SEQ ID NO: 26) They are 5' phosphorylated with T4 polynucleotide kinase in the presence of ATP, after hybridization. This phosphorylation step may be eliminated by using the oligonucleotides previously phosphorylated. The ligation of this double-stranded adapter with the DNA to be inserted into a vector is made by T4 ligase in the presence of a very large excess of adapter (1000 adapter molecules to a DNA molecule to be inserted), in 15 hours at 14 ° C. Excess adapter is removed by electrophoresis on an agarose gel and molecules of interest are recovered from the gel by hydrolysis thereof by agarase or by electroelution.

Ligation-vector DNA.

The ligation is carried out at 14 ° C over 15 hours with 10 of vector molecules for insert molecule.

Transformation.

The recipient strain is strain DH10B. The transformation is by electroporation. To express the resistance to tetracycline, the transformants were incubated at 37 ° C for 1 hour in medium without antibiotic. Clone selection is performed by overnight growth on LB agar medium supplemented with tetracycline δμg.ml * 1.

Example 11: Conjugation A CLONE CLONE BETWEEN E. coli and Streptomyces

CONJUGATION BETWEEN E COLI STRAIN AND CONTAINING S17.1 PPM803

Streptomyces lividans TK 21

Introduction

It is possible to make conjugation between E. coli and Streptomyces

(Mazodier et al, 1989). The adaptation of this method by developing a technique called drop where the mixture 10 .mu.l of a culture of E. coli containing a recombinant vector to a drop of S. lividans receiver consists in producing a clone to clone transformation into ensuring that at the end of the operation the entire library constructed in E. coli is introduced into S. lividans. A bulk transformation necessarily lead to a multiplication of the Streptomyces transformants clones to be virtually certain that the library in E. coli is shown fully in S. lividans. Also this method is easily automated.

preliminary tests

Conjugation between E. coli S17.1 strain containing the pOSV303 vector and S. lividans TK21.

Under these conditions, mixing 6 × 10 6 E. coli cells with 2 × 10 6 pre-germinated spores of S. lividans in a final volume of 20 .mu.l.

Development of the method

It is known that DNA extracted from some actinomycetes is changed and therefore can not be introduced in certain E. coli strains without restricted. The E. coli strain DH10B which accepts these DNA is not capable of transferring to a Streptomyces plasmid containing only oriT, and it is therefore necessary to build one. It would introduce by integration into the chromosome an RP4 derivative capable of providing in trans all the functions necessary for the transfer of recombinant clones containing the origin of transfer oriT.

Example 12: Construction of a cosmid bangue in E. coli and Streptomyces lividans Cloning DNA from the ground

The goal is to build a large library of DNA from the environment without previous stage culture.des microorganisms, in order to access the metabolic genes of bacteria (or other organization) that we do not know grown under standard laboratory conditions. The described procedure was used to generate a DNA library in E. coli using the cosmid shuttle E. coli-S. lividans pOS700l and DNA extracted and purified from the bacterial fraction of a soil. The latter method provides DNA of high purity and an average size of 40 kb. Also, to avoid for cloning partially digested DNA extracted was adopted an alternative strategy based on the use of terminal transferase enzyme that adds tails polynucleotide the 3 'ends of DNA and the vector.

5 .mu.g of DNA were extracted from 60 mg of soil "Cote Saint André" according to the protocol described in Example 3 and treated with terminal transferase (Pharmacia) to extend the 3 'ends with a monotonous polynucleotide ( poly T) (Example 10). Cosmid integrative pOS700l is prepared according to the protocol

B1, Orsay. After a conventional purification step in the presence of phenol / chloroform, the DNA and vector are assembled by mixing a vector molecule and a molecule of inserted DNA. The mixture is then packaged into bacteriophage lambda heads (Amersham kit) used to transfect E. coli DH10B. The transfected cells are then plated on LB agar medium in the presence of ampicillin for selection of resistant recombinants to this antibiotic.

A library of about 5000 clones of E. coli resistant to ampicillin was obtained. Each clone was inoculated in LB or TB medium + ampicillin in a microplate wells (96 wells) and stored at -80 ° C.

The sequence at sites of insertions of soil fragments in the vector, pOS700l, generated during the library construction was analyzed. For this the 17 cosmid libraries were purified and sequenced with a primer, seq.5 'CCGCGAATTCTCATGTTTGACCG 3' which hybridises between the BamHI site and the HindIII cloning site present in the vector. The sequences obtained were used to estimate the length of the homopolymeric tails to the junctions points varies between 13 and 60 poly-dA / dT. Beyond the tails, the sequences of the fragments thus generated soil have a percent G + C content between 53 and 70%. such high percentages were unexpected, but similar THE FINDINGS were already carried on crude preparation of DNA from soil (Chatzinotas A. et al., 1998).

A strategy of "pooling" of 48 or 96 clones were used for analysis of the microbial metabolic and wealth. The cosmid DNA extracted from these "pools" of clones was then used to carry out experiments of PCR or hybridization.

Example 13: Diversity ribosomigue 16S DNA in the cloned DNA.

a) Materials and Methods The bank's cosmids were extracted from pools of clones by alkaline lysis and then were purified on cesium chloride gradient, to collect the DNA band cosmid supercoiled form and to eliminate all chromosomal DNA of Escherichia coli that can interfere in the study. After linearization cosmids per share of S1 nuclease

(50 units, 30 minutes at 37 ° C), the 16S rDNA sequences contained in clone pools were amplified under standard amplification conditions from the universal primers 63f (5'CAGGCCTAACACATGCAAGTC-3 ') and 1387r (5'GGGCGGWGTGTACAAGGC-3 ') defined by Marchesi et al. (1998). The amplification products of about 1.5 kb are purified from the Qiaquik gel extraction kit (Qiagen) and cloned directly into the pCR II vector (Invitrogen) in Escherichia coli TOP10 according to the manufacturer's instructions. The insert is amplified using the primers M13 Forward and M13 Reverse specific to the pCR II vector cloning site. expected size of amplification product (approximately 1.7 kb) were analyzed by RFLP (Restriction Fragment Length Polymorphism) using Cfol enzymes, MspI and BstUI (0.1 units) in order to select the clones to be sequenced. The restriction patterns obtained were separated on agarose gel 2.5% Metaphor (FMC Products) containing 0.4 mg of ethidium bromide per ml.

The 16S rDNA sequences are then determined directly using the purified PCR products by the kit "Qiaquick gel extraction" using sequencing primers defined by Norman (1995). Phylogenetic analyzes were obtained by comparing the sequences with the 16S rDNA sequences prokaryotic gathered in the database Ribosomal Database Project (RDP), Version 7.0 MAIDAK et al. (1999) through similarity MATCH program, allowing to obtain values ​​of similarity to the sequences of the database.

b) Results

To determine the phylogenetic diversity represented in the library, 47 sequences ARNM6S gene were isolated from pools of 288 clones were sequenced in their almost entirely. The results are reported in Table 7.

Sequence analysis by questions databases reveals that the majority of sequences (> 61%) exhibit similarity percentages lower than or equal to 95% with identified bacterial species (Table 7). Of the 47 sequences analyzed, 28 sequences have to nearest neighbors of uncultured bacteria, the sequences of which were directly derived from DNA extracted from the environment. Most of these sequences have also very low similarity percentages (88-95%), 17 of 28 sequences and differ by more than 5% from their nearest neighbors.

Among the sequences that can be classified in a phylogenetic group, a majority of sequences belong to the sub class of Proteobacteria (18 sequences with similarity percentage between 89 and 99%). A second sequence group is represented by the subclass of Proteobacteria g, 9 comprising sequences whose similarity percentages vary between 84 and 99%). Groups b-proteobacteria, d-proteobacteria, Firmicutes low G + C% and high G + C% respectively comprise 1, 4, 3 and 5 sequences. Only a sequence could be classified within the major bacterial taxonomic groups defined: a22.1 sequence (19), its nearest neighbor Aerothermobacter marianas (with a similarity of 89%) itself being an isolated strain of marine environment and not classified at present. Finally, 6 sequences can be classified within the Acidobacteriuml Holophaga group. This group has the particularity of being represented by two cultured bacteria Acidobacterium capsulatum and Holophaga foetida, the whole group being composed by bacteria which only the ARNM6S gene was detected by amplification and cloning from DNA extracted sample of the environment (mainly soil), Ludwig et al (1997). The low values ​​of similarity between the different sequences comprising this group suggests a heterogeneity and diversity within this group. All the results shown in Table 7.

These results show that the sequences contained in the cosmid library come from microorganisms not only phylogenetically diverse but mostly microorganisms never been isolated to date. The results of amplified DNA sequencing were used to establish a phylogenetic tree of organisms present in the soil sample which are characterized sequences originate.

The phylogenetic tree shown in Figure 7 was constructed from the sequence alignment software by the MASE (Faulner and Jurak, 1988) etcorrigé by the method of Kimura 2 parameter (1980), and using the neighbor joining algorithm (Saitou and Nei 1987). Phylogenetic analysis was used to compare the 16S rDNA sequences cloned in the DNA library soil with prokaryotic 16S rDNA sequences compiled in databases Ribosomal Database Project (RDP), (7.0, SIMILARITY- program MATCH, Maidak et al 1999) and in GenBank using the BLAST 2.0 logicel (Altschul et al, 1997).

Example 14: Genetic Screening of the bank for the evaluation of the metabolic wealth

To characterize the library obtained in terms of metabolic diversity and identify clones containing inserts carrying genes may be involved in biosynthetic pathways, it has been developed according to the invention genetic screening techniques based on PCR methods to detect and identify the type of PKS genes I.

1 Bacterial strains, plasmids and culture conditions

S. coelicolor ATCC101478 S. ambofaciens NRRL2420 S. lactamandurans ATCC27382, S. rimosus ATCC109610, B. subtilis and B. licheniformis ATCC6633 THE1856 (RPR collection) were used as sources of DNA for PCR experiments. S. lividans TK24 is the host strain used for cosmid shuttle POSI700.

For the preparation of genomic DNA, spore suspensions, protoplasts and transformation of S. lividans, we followed the standard protocol described in Hopwood et a /. (1986).

Escherichia coli TOP10 (Invitrogen) was used as host for cloning of the PCR products and E. coli Sure (STRATAGENE) was used as a host for cosmid shuttle pOS700l. E. coli culture conditions, preparation of plasmids, DNA digestion, agarose gel electrophoresis were performed following standard procedures (Sambroock et al., 1996).

2. PCR primers:

The pairs of a1-a2 and b1, b2 primers were defined by the team of N. Bamas-Jacques and their use has been optimized for screening the DNA of pure strains and soil bank for research genes encoding PKSI)

Table 8: PCR primers homologous to genes PKSI used for screening the library ..

Amplification conditions:

To search PKS I from the DNA of inbred strains, the amplification mixture contained: in a final volume of 50 .mu.l, of 50 to 150 ng genomic DNA, 200 .mu.M dNTP, 5 mM MgCl 2 final, 7% DMSO, 1x buffer Appligene, 0.4 .mu.M of each primer and Taq polymerase 2,5U Appligene. The amplification conditions used were: denaturation at 95 ° C for 2 minutes, annealing at 65 ° C for 1 minute, elongation at 72 ° C for 1 min for the first cycle, followed by 30 cycles where the temperature is decreased up to 58 ° C as described in K. Seow et al., 1997. The final extension step is performed at 72 ° C for 10 minutes.

To search PKS I from the library DNA, the PCR conditions are the same as above for the a1-a2 torque using between 100 and 500 ng of cosmid extracted from pools of 48 clones.

For the couple of b1-b2 primers, 500 ng of cosmid from pools

96 clones were used. The amplification mixture contained 200 .mu.M dNTPs, 2.5 mM of MgCl 2 final, 7% DMSO, 1x buffer Quiagen, 0.4 .mu.M of each primer and Taq polymerase 2,5U Hot-start (Qiagen). The amplification conditions used were: denaturation 15 "at 95 ° C followed by 30 cycles: the denaturation at + 95 ° C the hybridization at 65 ° C for the first cycle and 62 ° C for other cycles , the elongation at 72 ° C, final extension step of 10 to 72 ° C.

Identification of positive clones from pools of clones 48 or 96 is performed from replicas of microplates corresponding mothers on solid medium or other standard replication method.

3 Sub-cloning and sequencing

The PCR products of the identified clones were sequenced using the following protocol:

The fragments are purified on agarose gel (Gel Extraction Kit (Qiagen)) and cloned into E. coli TOP 10 (Invitrogen) using the TOPO TA cloning Kit (Invitrogen). Plasmid DNA from subclones was extracted by alkaline lysis on a Biorobot (Qiagen) and dialyzed for 2 hours on VS 0,025μm membrane (Millipore). The samples were sequenced with the M13 "Universal" primer and "Reverse" on the ABI 377 sequencer 96 (PERKIN ELMER).

4) Results

Definition and validation PCR primers

Two highly conserved regions of PKS Type I actinomycetes, comprising the active site of the enzyme, were targeted for the amplification of homologous genes with degenerate primers. These two regions correspond to sequences PQQR (L) (L) and VE (A) HGTGT respectively.

Primers (Table 8) were tested with DNA from strains producing or not macrolide Streptomyces coelicolor, Streptomyces ambofaciens, producer of spiramycin, and Saccharopolyspora erythraea, producer of erythromycin. Whatever the primers used, bands representing fragments of about 700 bp corresponding to the expected length of the fragment were obtained with all strains.

These results demonstrate the specificity of the primers a and b for PKS I genes producing strains or gene silencing in S. coelicolor.

Sequencing of PCR products obtained with the pair of primers a1-a2 identified, from the S. ambofaciens strain, the sequence of a gene KS already described (European Patent Application No. EP0791656) as belonging in the biosynthetic pathway planténolide, macrolide precursor spiramycin, and two sequences never described Stramb Stramb12 and 9 (see list of sequences).

As regards, S. erythraea, the screening method has allowed the identification of a sequence KS (SACEN / 17) the same as the KS of module 1 already published in Genbank (Accession Number M63677), encoding synthetase 1 (DEBS1) 6- deoxyérythronolide B. another sequence uncorrelated to the biosynthetic pathway of erythromycin have been identified and it is the sequence SEQ ID N ° 32.

Conclusion

A method for analyzing the presence of genes encoding the PKS type I by PCR from various microorganisms was developed. The highly conserved domain structure synthetase keto type I has achieved a PCR method based on the use of degenerate primers biased GC for codon choice.

This approach shows the possibility of identifying genes or clusters involved in the biosynthesis pathway polyketides type I. The cloning of these genes allows the creation of a collection which can then be used to construct hybrid polyketides. The same principle can be applied to other classes of antibiotics.

The results here also show the presence of genes which may belong to quiet cluster (SEQ ID No. 30 to 32). The presence of silent clusters has already been documented in

Lividans and their expressions are triggered by specific or pleiotropic regulators (Horinouchi et al;. Umeyama et al. 1996). These results suggest that detection of genes in pathways called silent actually encode active enzymes capable of directing, in combination with other specific pathway enzymes, the enzymatic steps required for the synthesis of secondary metabolites.

Screening the bangue

The screening was carried out under the conditions described in the Materials and Methods section using the primer pairs validated from producing strains.

In the presence of the pair of a1-a2 primers, the size of the PCR products obtained from the cosmid DNA extracted from pools of 48 or 96 clones was approximately 700 bp, thus in agreement with the expected results.

The intensity of the bands obtained was variable but a single amplification band was present for each target DNA pool. Under these conditions, target DNA 8 groups were detected, corresponding to 9 positive clones after dereplication. Screening performed with the second pair of primers, b1-b2, gave less specific amplification results since many satellite bands were observed adjacent to the band 700 bp. Nevertheless, 9 were detected target DNA groups, corresponding to 14 positive clones after dereplication from these positive clones, DNA was extracted for the steps of sequencing and processing .S. lividans. Analysis cosmids

Digestion cosmids identified by PCR with the DraI enzyme recognizing a site rich in AT releases a greater than 23 kb fragment (Figure 22). This suggests that the PCR target DNA preferably soil with a high percentage G + C. This result is the consequence of the degeneration of the primers used, biased GC for codon choice. The inserts, as expected in the case of cosmids have a size greater than 23 kb, with one exception (a9B12 clone), which could bring some volatility cosmids. Moreover, among all the selected clones, only two of them, and GS.F1 GS.G1 1, showed the same restriction pattern indicating a low redundancy rate in the bank. The selected cosmids were transferred

Streptomyces lividans by protoplast transformation in the presence of PEG 1000. The transformation efficiency varied between 30 and 1000 transformants per ug DNA cosmid used.

Sequencing and phylogenetic analysis of PKS I genes ground

The PCR method making stock of the pure strains was used as described in the cosmid bank and 24 clones were identified. PCR products of about 700 bp obtained from the DNA from two pools (48 clones) and 8 unique clones were cloned, after purification on agarose gel, and sequenced. This allowed the identification of 11 sequences.

Alignment of the deduced protein sequences I PKSs soil with other PKSs I present in various microorganisms (Figure 24) shows the presence of a highly conserved region corresponding to the consensus region of the active site of the b-ketoacyl synthetase. Analysis of the sequences obtained with the method "Codonpreference" (Gribskov et al, 1984;. Bibb et al., 1984) revealed the presence of a strong bias in the use of rich codons G + C in one reading phase. The deduced protein according to this reading frame showed a high homology with the known KSs type I (Blast program). In particular, the similarity between soil sequences of KSS and KSs cluster to erythromycin is about 53%.

After dereplication a pool and identification of single clone, the sequence of the PCR product obtained from this clone is identical to the pool which confirms the reliability of the method used.

Analysis of the PCR product sequence of a clone has enabled the probable identification of 3 different genes KSI. One of these sequences (SEQ ID NO: 34) has a similarity of 98.7% with the sequence of another pool, suggesting that they encode the same enzyme. The other two sequences are different but highly homologous.

Here it is described for the first cloning and identification in a soil DNA library of secondary metabolites biosynthetic pathways containing genes encoding the KS of the type I.

The high G + C percentage in soil sequences suggests that they may be derived from genomes of use of codons similar to those of actinomycetes.

Although the data available in the literature are reduced, it is known that the genes encoding the PKS type I are very diverse in their physical organization in the genome, the size and number of modules contained in each gene.

The presence of multiple domains from a single clone is a confirmation of their membership in clusters polyketides unbalanced. In one case, two clones seem to form a contiguous since they share the same sequence for the KS domain. The size of the genetic regions involved in the synthesis of

PKSI varies from a few kb for penicillin at about 120 kb for rapamycin. The size of the cosmid inserts can therefore not be sufficient for the expression of the most complex clusters.

Genes encoding I PKSs, able to work iteratively as II PKS and control the synthesis of aromatic polyketides have been described (Jae-Hyuk et al., 1995). The study of clusters of PKSs I ground could still bring innovations in this field.

5. Identification of 6 genes encoding polyketide synthases.

On continuing the screening of the cosmid library using the protocols described in the present example, the inventors have identified a cosmid clone containing an 34071 bp insert containing several ORFs encoding the polyketide synthase like polypeptides.

Specifically, cosmid and identified by screening the library contains six open reading frames encoding polyketide synthase polypeptide or highly related polypeptides, non-ribosomal peptide synthase. A detailed map of this cosmid is shown in Figure 36.

The complete nucleotide sequence of cosmid is the sequence SEQ ID No. 113 of the Sequence Listing. The DNA insert contained in the sequence SEQ ID No. 113 is the nucleotide sequence complementary (- strand) of the nucleotide sequence coding for the different polyketide synthases.

The nucleotide sequence of the DNA insert contained in cosmid of Figure 36 which comprises the open reading frames encoding the polyketide synthases polypeptides (+ strand) is shown schematically in Figure 37 and is SEQ ID NO: 114 of the sequence listing.

In addition, a detailed map of the different open reading frames contained in the DNA insert of this cosmid is shown in Figure 37.

The characteristics of the nucleotide sequences comprising open reading frames contained in the DNA insert of the cosmid are detailed below. ORF1 sequence

Orfl the sequence comprises a partial open reading frame with a length of 4615 nucleotides. This sequence is the sequence SEQ ID N ° 115, which starts at the nucleotide at position 1 and ends at the nucleotide in position 4615 of the sequence SEQ ID N ° 114.

SEQ ID No.1 15 code sequence for ORF1 polypeptide of 1537 amino acids, the polypeptide comprising the sequence SEQ ID N ° 121. The polypeptide of sequence SEQ ID No. 121 is related to non-ribosomal peptide synthases. This polypeptide has a degree of amino acid identity of 37% with the synthase peptide Anabaena sp.90 referenced under the access number "emb CACO1604.1" in the Genbank database.

ORF2 sequence

The ORF2 nucleotide sequence has a length of 8301 nucleotides and the sequence is SEQ ID NO: 1 16, which starts at the nucleotide in position 4633 and ends at the nucleotide in position 12933 of the sequence SEQ ID N ° 114.

ORF2 ORF2 sequence encodes the peptide of a length of 2766 amino acids, the polypeptide comprising the sequence SEQ ID N ° 122. The polypeptide of sequence SEQ ID N ° 122 has a sequence of amino acid identity of 41% with the sequence MTAD Stigmatella aurantiaca referenced under the access number "gb AAF 19812.1" of the GENBANK database.

The ORF2 polypeptide is a polyketide synthase.

sequence ORF3

Orf3 the nucleotide sequence has a length of 5292 nucleotides and the sequence is SEQ ID N ° 117. The sequence SEQ ID N ° 117 corresponds to the sequence starting at the nucleotide in position 12936 and ends at the nucleotide in position 18227 of the sequence SEQ ID N ° 114.

The nucleotide sequence SEQ ID NO: 117 encodes the polypeptide polyketide synthase ORF3 of 1763 amino acids, the polypeptide comprising the sequence SEQ ID No. 123 of the invention.

The ORF3 polypeptide sequence SEQ ID NO: 123 has an identity of 42% with the amino acid sequence of MTAB Stigmatella aurantiaca referenced under the Accession No. "gb AAF 19810.1" of the GENBANK database.

sequence ORF4

Orf4 the nucleotide sequence has a length of 6462 nucleotides and is the sequence SEQ ID No. 118 of the invention. The nucleotide sequence SEQ ID NO: 118 corresponds to the sequence starting at nucleotide position 18224 and ending at the nucleotide in position 24685 of the nucleotide sequence SEQ ID N ° 114.

The nucleotide sequence SEQ ID NO: 118 encodes the polypeptide ORF4 polyketide synthase of 2153 amino acids, the polypeptide comprising the sequence SEQ ID No. 124 of the invention.

The sequence of ORF4 polypeptide SEQ ID NO: 124 has a sequence of amino acid identity of 46% with the sequence ePOD of Sorangium cellulosum as referenced Accession No. "gb AAF62883.1 of the GENBANK database.

ORF5 sequence

Orfδ the nucleotide sequence has a length of 5088 nucleotides and is the sequence SEQ ID No. 119 of the invention.

The sequence SEQ ID N ° 119 corresponds to the sequence starting at nucleotide position 24682 and ending at the nucleotide in position 29769 of the nucleotide sequence SEQ ID N ° 114. The nucleotide sequence SEQ ID NO: 119 encodes the polypeptide ORF5 polyketide synthase of 1695 amino acids, the polypeptide comprising the sequence SEQ ID N ° 125 of the invention.

The polypeptide polyketide synthase ORF5 sequence SEQ ID N ° 125 has an amino acid identity of 43% with the sequence epod Sorangium cellulosium referenced under the Accession No. "gb AAF 62883.1" of the GENBANK database.

ORF6 sequence

Oifδ the nucleotide sequence has a length of 4306 nucleotides, and is SEQ ID NO: 120 according to the invention sequence. The nucleotide sequence SEQ ID NO: 120 corresponds to the sequence starting at nucleotide position 29766 and ending at the nucleotide in position 34071 of SEQ ID Sequence ID No.1 14.

SEQ ID NO: 120 contains an open reading frame encoding the partial polypeptide ORF6 1434 amino acids of the polyketide synthase type, constituting the polypeptide sequence SEQ ID N ° 126 of the invention. The polypeptide of sequence SEQ ID NO: 126 has an amino acid identity of 43% with the sequence ePOD Sorangium cellulosum referenced under the access number "gb AAF 62883.1" of the GENBANK database.

Example 15: Construction of shuttle vectors type BAC integrative in Streptomyces

Construction of shuttle vectors type BAC integrative and conjugative in Streptomyces

15.1 Construction of PMBD-1 vector

The BAC vector PMBD-1 was obtained according to the following steps: Step 1: The vector pOSVO10 was digested by PstI and BstZ17l enzymes in order to obtain a nucleotide fragment of 6.3 kb.

Step 2: The pDNR-1 vector was digested with the enzymes PstI and PvuII to obtain a nucleotide fragment of 4.145 kb.

Step 3: The nucleotide fragment of 6.3 kb from the vector was fused pOSV017 ligated to the fragment of 4.15 kb from the vector pDNR-1, to produce the PMBD-1 vector as shown in Figure 30.

15.2 Construction of PMBD-2 vector

The PMBD-2 vector is a BAC type vector containing an integrative box "φc31 Ωhyg-int". φc31 is a temperate phage host range wide whose attachment site (attP) is located. The φc31 int fragment is the minimum fragment of actinophage φc31 able to induce the integration of a plasmid into the chromosome of Streptomyces lividans.

Ωhyg is a derivative of interposon Ω capable of conferring resistance to hygromicin in E. coli and S. lividans.

BAC vectors containing the φc31 integration system are described by Sosio et al. (2000) and in PCT Application No. 99 6734 published December 29, 1999.

The BAC vector PMBD-2 was constructed according to the following steps:

Step 1: Building an integrative box φc31 int Ωhyg in a multicopy plasmid of E.coli. firstly was amplified φc31 int fragment from plasmid pOJ436 using the following pair of primers:

- EVφc31 Primer l (SEQ ID NO: 109) (thereby introducing an EcoRV site at 5 'end of the sequence φc31) and primer Bllφc31 F (SEQ ID NO: 110) (which allows introduction of a BglII site at 3 'end of the sequence φc31). The Ωhyg fragment was obtained by digestion with the enzyme BamHI of plasmid pHP45 Ωhyg described by BLONDELET- Rouault (1997).

Then φc31 integrative box int-Ωhyg was cloned into the vector pMCS5 digested with the enzymes BglII and EcoRV.

Step 2: Building the PMBD-2 vector.

The bacterial artificial chromosome pBACe3.6 described Frengen et al. (1999) was digested with NheI enzyme then treated with Eco polymerase enzyme.

Then the vector pMCS5 φc31 int-Ωhyg was digested by enzymes SnaBI and EcoRV to recover integrative box.

The detailed map of pMBD2 vector is shown in Figure 31.

15.3 Construction of PMBD-3 vector.

The PMBD-3 vector is an integrative vector (φc31 int) and conjugative (OriT) of BAC type which comprises Ωhyg selection marker.

Map PMBD-3 vector as well as its construction method are shown in Figure 31.

The PMBD-3 vector was obtained by amplifying the OriT gene from plasmid pOJ436 using the pair of primers of sequences SEQ ID N ° 111 and SEQ ID NO: 112 containing Pac I restriction sites.

The nucleotide fragment amplified using the primers SEQ ID N ° 111 and SEQ ID NO: 112 was cloned into the pMBD2 vector previously digested with PacI enzyme. The construction scheme for the PMBD-3 vector is shown in Figure 31. 15.4 Construction of DMBD-4 vector

The detailed map of pMBD4 vector is shown in Figure 32. The pMBD4 vector was obtained by cloning integrative box φc31 int-Ωhyg in pCYTAC2 vector.

15.5 Construction of PMBD-5 vector

The scheme for constructing the vector PMBD-5 is illustrated in Figure 33.

The PMBD-5 vector was constructed by recombination of nucleotide fragment between the two loxP sites PMBD-1 vector illustrated in FIG 33 with the loxP site contained in the BAC vector designated pBTP3, a detailed map of pBTP3 plasmid is shown in Figure 34 the.

Construction of the 15.6-6 vector PMBD

The vector PMBD-6 was constructed by recombining the nucleotide fragment between the two loxP sites of the vector PMBD-1 at the loxP site of the BAC vector pBeloBad 1, as shown in Figure 35.

TABLE 1 Location of sample specimens and soil characteristics used in the different experiments. Direct microbial counts using acridine orange staining were performed before and after grinding ground

n = 3; standard deviation in parentheses.

TABLE 2

Primers and probes used for PCR amplification and hybridization task

4-r

a) Positions on the E. coli 16S rRNA gene are given in brackets. For β. anthracis and S. lividans, primers and probes target specific chromosomal sequences of the respective organisms. These sequences are not localized in the gene of the 16S rRNA. The cassette containing the target region of S. lividans is described by Clerc-Bardin et al. (non published).

TABLE 3

Amount of DNA extracted from different soil treatments after lysis according to protocols 1 to 5 (ug DNA / g of dry soil weight ± standard deviation) 3

Solsl, 2, 3 and 6; n = 3; soil 4: n = 1.

Sol Protocol Ivse number 13

Number and origin 1 2 3 4a 4b 5a 5b

1. Australia 17 +/- 2 52 +/- 2 32 +/- 5 16 +/- 3 33 +/- 2 59 +/- January 27 +/- 0

2. Peyrat 29 +/- 2 58 +/- 1 40 +/- 2 29 +/- 2 18 + / 3 56 +/- 1 15 +/- 1

3.Côte St-André 36 +/- 7 60 +/- 6 148 +/- 10 94 +/- 7 38 +/- 6 73 +/- 5 47 +/- 6

4. Chazay September 16 ND 32 15 15 70

6. Dombes 4 +/- 2 26 +/- 3 43 +/- 66 +/- +/- January 61 1160 +/- 7102 +/- 5

3 Quantification by imaging phosphorescence after hybridization task with the universal probe FGPS431

(Table 2).b 1: No treatment; 2: dry milling the ground (G); 3: Cr + homogenization Ultraturrax (H);

4a: G + H + sonication Microtip (MT); 4b: G + H + sonication Cup Horn (CH); 5a: Cr + H + NT + chemical / enzymatic lysis. See Figure 1. c NA = Not applicable.

Table 4:

Primers and probes used in the molecular characterization of DNA extracted from the soil

position 6S RNA gene of Escherichia coli

Table 5:

Efficiencies of extraction of the bacterial cells on Nycodenz gradient and amounts of DNA extract.

Effect of incubation of the soil sample in a yeast extract solution 6%

-J

b: Enumeration on solid media Trypticase-Soy 10% c: Enumeration solid HV agar medium, after enrichment 20 minutes at 40 ° C in a yeast extract solution

6% - 0.05% SDS. d: The quantity of extracted DNA was evaluated by gel electrophoresis compared with a DNA standard range of calf thymus. e: Quantification was achieved after digestion of agarose per share a b-agarase

Table 6: Characterization of DNA extracted according to their proportion by a, b, g and subclasses of Proteobacteria, in Gram + low GC% and Actinomycetes; the hybridization signal with the prokaryotic probe serving as a reference 100%.

c

a: milling in a mill tungsten ball, centrifugal force (extraction protocol described in section Frostegard et al.)

YE: yeast extract solution in 6%

Table 7: Variation of βS DNA sequences contained in the cosmid library

sO

TABLE 7 (continued 1)

Diversity of DNA sequences ΘS contained in the cosmid library

O

TABLE 7 (continued 2)

Diversity of DNA sequences ΘS contained in the cosmid library

Ludwig (1997)

TABLE 9: Sequences

TABLE 9 (continued 1): Sequences

TABLE 9 (continued 2): Sequences

TABLE 9 (continued 3) Sequences

REFERENCES

• Amann, RI, W. Ludwig, and KH Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143-169.

• Altschul SF, Madden TL, Schaffer AA, J. Zhang, Z. Zhang, W. Miller, DJ Lipman (1997) "Gapped BLAST and PSI-BLAST: a nex generation of protein databses search programs" Nucleic Acid Researchs Vol 25: 3389- 3404

. • Altschul SF et al, 1990, J. Mol Biol, 215: 403-410.

• Bakken, LR 1985. Separation and purification of bacteria from soil. Appl. About. Microbiol. 49: 1482-1487.

• Bibb MJ Findlay PR, Johnson MW, The relationship entre base composition and codon use in bacterial genes and Its use for the easy and reliable identification of protein-coding sequences, Gene. 30: 1-3, 157- 66, Oct, 1984.

• Biesiekierska-Galguen M. (1997) "biological contaminant attenuation xenobiotics in soil - model lindane" Diploma DEΞA National Toxicology, University Claude Bernard Lyon I.

• Blondelet Rouault-MH, J Weiser, Lebrihi A Branny P Pernodet JL.

Institute of Genetics and Microbiology, CNRS URA 2225, University of Paris XI, Orsay, France. Gene 1997 May 6; 190 (2): 315-7

• Borchert S et al, 1992, Microbiology Letters., 92: 175-180

• BLONDELET-Rouault, 1997 Gene, 315-317. • Boccard, F., Smokvina, T. Pernodet, JL Friedman, A. & Guerineau

M. (1989). The integrated conjugative plasmid of Streptomyces pSAM2 ambofaciens is related to temperature bacteriophages. Embo J 8.973 to 80

• Chatzinotas A., Sandaa RA., SCHÖNHUBER W. R. Amanna, FL Daae, Torsvik V., J. Zeyer, Hahn D. (1998) "Analysis of broad-scale differences in microbial community composition of two pristine forest soils "Systematic and Applied Microbiology -J \ 21: 579-587

• Clegg, CD, K. Ritz and BS Griffiths. 1997. Direct ectraction of microbial community DNA from humified upland soils. Lett. Appl. Microbiol. 25: 30-33.

• Clerc-Bardin, S., JL Pernodet, Frostegard A., and P. Simonet.

Development of a System for a conditional suicide Streptomyces lividans strain and Its use to Investigate conjugative transfer in soil. Submitted.

• Elledge SJ, JT Mulligan, Rowing SW, Spottswood M, Davis RW.

Department of Biochemistry, Baylor College of Medicine, Houston, TX 77030. Proc Natl Acad Sci USA 1991 March 1; 88 (5): 1731-5

• Engelen, B., K. Meinken, F. Von Wintzingerode, H. Heuer, H.-P. Malkomes, and H. Backhaus. 1998. Monitoring impact of a pesticide treatment is bacterial soil communities by metabolic and genetic fingerprinting in addition to conventional testing procedures. Appl. About. Microbiol. 64: 2814-2821.

• Farrelly, V., FA Rainey, and E. Stackebrandt. 1995. Effect of genome size and rrn gene copy number amplification of 16S is PCR rRNA genes from a mixture of bacterial species. Appl. About. Microbiol. 61: 2798-2801.

• Faulkner DV, Jurka J. (1988) "Multiple Aligned Sequence Editor (MASE)" Trends in Biochemical Sciences Vol 13: 321-322

• Frengen fl al, 1999 Genomics., 58: 250-258. • Frostegard, A., Tunlid, A., and Baath, E. 1991. Microbial biomass Measured as total lipid phosphate in soils of different organic pleased. J. Microbiol. Meth. 14: 151-163.

• Giddings, G. 1998. The release of genetically engineered micro-organisms and viruses into the environment. New Phytol. 140: 173-184.

• Gladek, A., and J. Zakrzewska. 1984. Genome size of Streptomyces. FEMS Microbiol. Lett. 24: 73-76.

• Gribskov M, Devereux J, Burgess RR, The codon preference plot: graphic analysis of protein coding sequences and prediction of gene expression, Nucleic Acids Res. 12: 1 Pt 2, 539-49, January 11, 1984.

• Guiney fl al., 1983, Proc. Natl. Acad. Sci USA (12): 3595-3598.

• Gourmelen, A. Blondelet-Rouault, MH & Pernodet, JL (1998). Characterization of a glycosyl transferase inactivating macrolides from Streptomyces encoded by GIMA ambofaciens, Antimicrob Agents Chemother 42, 2612-9.

• Hayakawa, M., and H. Nonomura. 1987. Humic acid-vitamin agar, a new medium for the selective isolation of soil actinomycetes. J. Ferment. Technol. 65: 501-509.

• Hayakawa, M., K. Ishizawa, and H. Nonomura. 1988. Distribution of actinomycetes uncommon in Japanese soils. J. Ferment. Technol. 66: 367-373.

• Hickey, RJ, and HD Tresner. 1952. Cobalt Containing medium for sporulation of Streptomyces species. J. Bacteriol. 64: 891-892.

• Hintermann, G., R. Crameri, Kieser, T., and R. Hϋtter. 1981. Restriction analysis of the Streptomyces glaucescens genome by agarose gel electrophoresis. Arch. Microbiol. 130: 218-222. • Holben, WE, JK Jansson BK Chelm, and JM Tiedje. 1988. DNA probe method for the detection of specified microorganisms in the soil bacterial community. Appl. About. Microbiol. 54: 703-711.

. • Hong Fu fl al, 1995 Molecular Diversity, 1: 121-124

• Hopwood DA, MJ Bibb, Chater KF, Kieser T., CJ Bruton, Kieser HM, Lydiate DJ, Smith PC, Ward JM and Scrempf H. 1985. Genetic Manipulation of Streptomyces. A Laboratory manual. The John Innés Foundation, Norwich, UK

• Hopwood, DA, MJ Bibb, KF Chater, T. Kieser, CJ Bruton HM Kieser, DJ Lydiate, CP Smith, JM Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces - a laboratory manual. The John Innés Foundation, Norwich, United Kingdom.

• Hohm B. and J. Collins, 1980, Gene, 11: 291-298.

• Horinouchi, S., F. Malpartida, Hopwood D. and T. Beppu, Mol. Gen. Broom. (1989) 215: 355-357.

• R. Imai, Y. Nagata, Mr. Fukuda, Mr. Takagi, Yano K. (1991) "Molecular cloning of a gene encoding Pseudomonas paucimobilis 17-kilodalton plypeptide That Eliminates HCl molecules from? -hexachlorocyclohexane" Journal of Bacteriology Vol 17 ", No.21: 6811-6819

• Jacobsen, CS, and OF Rasmussen. 1992. Development and implementation of a new method to extract bacterial DNA from soil is based separation of bacteria from soil with cation-exchange resin. Appl. About. Microbiol. 58: 2458-2462.

Jae-Hyuk YU and Leonardo TJ 1995. Sterigmetseytin biosynthesis in Aspergillus nidulans requires a ... type I polyketide synthase. J. Bacteriol, (August): 4792-4800. • Ka OJ WE Holben, and JM Tiedje. 1994. Analysis of competition in soil Among 2,4-dichlorophenoxyacetic acid-Degrading bacteria. Appl. About. Microbiol. 60: 1121-1128.

• Kah Tong S fl al, 1997, J Bacteriol, G179 (23). 7360-7368

• Mr. Kimura (1980) "A simpler method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences" Journal of Molecular Evolution Vol 16: 111 -120

• Kuske, CR, KL Banton DL Adorada, Stark PC, KK Hill and PJ Jackson. 1998. Small-scale DNA sample preparation method for PCR field detection of microbial cells and spores in soil. Appl. About. Microbiol. 64: 2463-2472.

• Lacalle RA, Pulido D, Vara J Zalacain M, Jimenez A. Centro de Biologia Molecular (CSIC-UAM) Universidad Autonoma, Canto Blanco, Madrid, Spain. Gene 1989 Jul 15; 79 (2): 375-80

• Lee, S. -Y., J. Bollinger, Bezdicek D., and A. Ogram. 1996. Estimation of the year abundanee of uncultured soil bacterial strain by a quantitative competitive PCR method. Appl. About. Microbiol. 62: 3787-3793.

• Leff, LG, JR Dana McArthur JV, and LJ Shimkets. 1995. Comparison of methods of DNA extraction from stream sediments. Appl. About. Microbiol. 61: 1141-1143.

• Liesack, W. and E. Stackebrandt. 1992. Occurrence of novel groups of the domain Bacteria as Revealed by analysis of genetic material isolated from an Australian terrestrial environment. J. Bacteriol. 174: 5072-5078.

• Liesack, W., PH Janssen FA Rainey, NL Ward-Rainey, and E. Stackebrandt. 1997. Microbial diversity is soil: the need for a combined approach using molecular and technical cultivation. In JD van Elsas, JT Trevors and EMH Wellington (ed.), Modem soil microbiology, Marcel Dekker, Inc., New York, (p 375-439)

• Lorentz, G., and W. Wackernagel. 1994. Bacterial gene transfer by natural genetic transformation in the environment. Microbiol. Reviews 58: 563-602.

• Maidak BL, JR Cole, Parker CT, GM Garrity, Larsen N., Li B, TG Lilburn, McCaughey MJ, GJ Olsen, R. Overbeek, Pramanik S. Schmidt TM, JM Tiedje, Woese CR (1999) " A new project of the RDP (Ribosomal Database Project) "Nucleic Acids Research Vol 27: 171-173

• Mazodier P. fl al, 1989 J. Bacteriol, 171 (6):.. 3583-3585.

• More, Mr. L, JB Herrick, MC Silva, WC Ghiorse, and EL Madsen.

1994. Quantitative cell lysis of indigenous microorganisms and rapid extraction of microbial DNA from sediment. Appl. About. Microbiol. 60: 1572-1580.

• Murakami T, TG Holt, CJ Thompson, Engineering Microbiological Unit, Institut Pasteur, Paris, France. J. Bacteriol March 1989; 171 (3): 1459-1466

• Nagata Y. Hatta, T., R. Imai, K. Kimbara, Mr. Fukuda, K. Yano, Mr. Takagi

(1993) "Purification and characterization of -hexachlorocyclohexane - dehydrochlorinase (Lina) from Pseudomonas paucimobilis? (HCH?)" Bioscience, Biotechnology and Biochemistry, Vol 57 No 9: 1582-1583

• R. Nalin, Simonet P. Vogel TM Normand P. (1999) "... Rhodanobacter lindaniclasticus gen.nov, sp nov, a lindane-Degrading Bacterium" International Journal of Systematic Bacteriology Vol 49: 19-23

• Nesme, X., C. Picard, and P. Simonet. Specifies 1995. DNA sequences for detection of soil bacteria. In JT Trevors, and JD van Elsas (eds.) Nucleic acids in the environment, methods and application. Springer Lab Manual. (P 111-139) • Nilsson B, Uhlen M, Josephson S, S Gatenbeck, Philipson L. Nucleic Acids Res 25 November 1983; 11 (22): 8019-30

• Normand P. et al, 1995 Oceanis 21 (1). 31-56

• Ogram, AV, ML Mathot, JB Harsh., J. Boyle, and CA Pettigrew

JR. 1994. Effects of DNA polymer length is icts adsorption to soils. Appl. About. Microbiol. 60: 393-396.

• Ogram, A., GS Sayler, and T. Barkay. 1987. The extraction and purification of microbial DNA from sediments. J. Microbiol. Methods 7: 57-66.

• Olsen, RA, and Bakken, LR 1987. Viability of soil bacteria: optimization of the technical platform counting. Microb. Ecol. 13: 59-74.

• Paget, E., L. Jocteur Monrozier, and P. Simonet. 1992. Adsorption of DNA are clay minerals: protection contre DNaseI and it influences gene transfer. FEMS Microbiol. Lett. 97: 31-40.

• Patra, G., P. Sylvestre, V. Ramisse J. Thérasse, and JL Guesdon.

1996. Isolation of a specifies chromosomic DNA sequence of Bacillus anthrasis and Its possible to use in diagnosis. FEMS Immunol. Medical Microbiology 15: 223-231.

• Pernodet JL Fish S. Blondelet-Rouault, MH & Cundliffe, E. (1996). The macrolide-lincosamide-streptogramin B resistance phenotypes by using a caractérisée specifieally deleted, antibiotic-sensitive strain of Streptomyces lividans. Antimicrob Agents Chemother 4O, 581, 5.

• Pernodet JL, Gourmelen, A., Blondelet-Rouault, MH & Cundliffe, E.

(1999). Dispensable ribosomal resistance conferred by AHWS to Spiramycin Spiramycin in the producer Streptomyces ambofaciens. 145, 2355-64.

• Picard, C., C. Ponsonnet X. Nesme, and P. Simonet. 1992. Detection and enumeration of bacteria live in soil by DNA extraction and polymerase chain reaction. Appl. About. Microbiol. 58: 2717-2722. • Preud'homme, J., Belloc, A., Charpentié, Y., and Tarridec, P. 1965. An antibiotic formed by two groups of components in synergistic action: pristinamycin CR Acad. Sci. 260: 1309-1312.

• Priemé, A., JIB Sitaula, AK Klemedtsson, LR and Bakken. 1996. Extraction of methane-oxidizing bacteria from soil particles. FEMS Microbiol. Ecol. 21: 59-68.

• Prosser, J. 1994. Molecular marker Systems for detection of genetically engineered micro-organisms in the environment. Microbiol. 140: 5-17.

• Raynal A Tuphile K Gerbaud C Luther T, Guérineau million Pernodet JL;

Laboratory of Biology and Molecular Genetics, Institute of Genetics and Microbiology, CNRS URA 2225, Université Paris-Sud, Orsay, France. Mol Microbiol 1998 Apr; 28 (2): 333-42

• Raynald Tuphile A., K. Gerbaud, C, Luther T. Guérineau, M. & Pernodet, JL (1998). Structure of the chromosomal insertion site for pSAM2: functional analysis in Escherichia coli. Mol. Microbiol 28, 333-42.

• Richard, GM 1974. Modifications of the diphenylamine reaction giving Increased sensitivity and simplicity in the estimation of DNA. Analytical Biochem. 57: 369-376.

• Romanowski, G., MG Lorentz, and W. Wackernagel. 1993. Use of polymerase chain reaction and electroporation of Escherichia coli to monitor the persistence of extracellular plasmid DNA Introduced into natural soils. Appl. About. Microbiol. 59: 3438-3446.

• Saitou N, Nei M. (1987) "The Neighbor-joining method: a new method for reeonstrueting phylogentie trees" Molecular and Biological Evolution Vol 2: 112-118 • Sambrook, J., Fritsch EF and Maniatis T. 1996. Molecular cloning: a laboratory manual, 2nd ed. Cold spring Harbor Laboratory Press, Cold Sring Harbor, NY

• Sambrook, J., EF Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

• Senoo K, Wada H. (1989) "Isolation and identification of aerobic year - HCH-Decomposing bacterium from soil?" Soil Science, Plant Nutrition Vol 35, no. 1: 79-87.

• Sezonov G. White, V., Bamas-Jacques, N., Friedman, A. Pernodet, JL & Guérineau, M. (1997). Complete conversion of antibiotic preeursor to Pristinamycin MA by overexpression of genes Streptomyces pristinae biosynthetie. Nat Biotechnol 15.349 to 53.

• Shirling, EB, and D. Gottlieb. 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 16: 313-340.

Shizuga et al., 1992, Proc. Natl. Acad. Sci USA 89: 8794-8797.

• Siefert, JL, Fox and GE. 1998. Phylogenetic mapping of bacterial morphology. Microbiology 144: 2803-2808.

• Simonet, P., P. Normand, Moiroud A., and R. Bardin. 1990. Identification of Frankia strains in nodules by hybridization of polymerase chain reaction products with strain-specific probes oligonucleotide. Arch. Microbiol. 153: 235-240.

• Smalla, K., N. Cresswell, L. Mendonca-Hagler, A. Wolters, and DJ van Elsas. 1993. Rapid DNA extraction protocol from soil for polymerase chain reaction-mediated amplification. J. Appl. Bacteriol. 74: 78-85.

• Sosio M. et al. 2000 Nature Biotechnology, vol.18,: 343-345. • Smit, E., P. Leeflang, and K. Wernars. 1997. Detection of shifts in microbial community structure and diversity in soil copper contamination Caused by using amplified ribosomal DNA restriction analysis. FEMS Microbiol. Ecol. 23: 249-261.

• Smokvina T Mazodier P, F Boccard, CJ Thompson, Mr. Guérineau

Laboratory of Biology and Molecular Genetics, University Paris-Sud, Orsay, France. Gene 1990 September 28; 94 (1): 53-9

• Smolvina, T., Mazodier P. Boccard, F. Thompson, CJ & Guérineau, M. (1990). Construction of a series of integrative pSAM2-based vectors for use in actinomycetes. Gene 94, 53-9.

• Stackebrandt, E. 1988. Phylogenetic relationships vs. phenotypic diversity: how to accomplish achieve a phylogenetic classification System of the eubacteria. Can. J. Microbiol. 34: 552-556.

• Staneck, JL, and GD Roberts. 1974. Simplified approach to identification of aerobic actinomycetes by thin-layer chromatography. Appl. Microbiol. 28: 226-231.

• Stapleton, RD, S. Ripp, L. Jimenez, S. Cheol-Koh, JT Fleming IR Gregory, and GS Sayler. 1998. Nucleic acid analytical approaches in bioremediation: site assessment and characterization. J. Microbiol. Methods 32: 165-178.

• Steffan, RJ, J. Goksoyr, AK Bej and R. Atlas. 1988. Recovery of DNA from soils and sediments. Appl. About. Microbiol. 54: 2908-2915.

• Tebbe, C. C, and W. Vahjen. 1993. Interference of humic acids and DNA Extracted from direetly soil in detection and processing of recombinant DNA from bacteria and a yeast. Appl. About. Microbiol. 59: 2657-2665. • Tercero JA, JC Espinosa, Lacalle RA, A Jimenez. Centro de Biologia Molecular Severo Ochoa, Consejo Superior de Investigaciones Científicas, Madrid, Spain. J Biol Chem 1996 January 19; 271 (3): 1579-1590

• JC Thomas, F. Berger, Mr. Jacquier, Bernillon D. Baud-Grasset F. Truffaut N., Norman P. Vogel T .M., P. Simonet (1996) "Isolation and Characterization of a novel? -hexachlorocyclohexane-Degrading bacterium "Journal of Bacteriology 'o \ 178, No20: 6049-6055

• Torsvik, VL 1980. Isolation of bacterial DNA from soil. Soil Biol. Biochem. 12: 15-21.

• Torsvik, V., R. Sorheim, and J. Goksoyr. 1996. Total bacterial diversity in soil and sediment communities - a review. J. Ind. Microbiol. 17: 170-178.

• Tsai Y.-L., and B. Olson. 1991. Rapid method for Direct extraction of DNA from soil and sediment. Appl. About. Microbiol. 57: 1070-1074.

• Umeyama T., Y. Tanabe, Eagle comic and Horinuochi S., FEMS (1996) 144: 177-184.

• Van Elsas, JD, GF Duarte, AS Rosado, and K. Smalla. 1998. Microbiological and molecular biological methods for monitoring microbial inoculants and Their effects in the soil environment. J. Microbiol. Methods 32: 133-154.

• Van Elsas, JD, V. Màntynen, and AC Wolters. 1997. Soil DNA extraction and assessment of the fate of Mycobacterium chlorophenolicum strain PCP-1 in different soils by 16S ribosomal RNA gene sequence based most-probable-number and immunofluoreseenee PCR. Biol. Fert. Soils 24: 188-195.

• Volff JN fl al. 1996, Mol. Microbiol, 21 (5):. 1037-1047.

• Volossiouk, T., EJ Robb, RN and Nazar. 1995. Direct DNA extraction for PCR-mediated assays. Appl. About. Microbiol. 61: 3972-3976. • GM Wahl, Lewis KA, JC Ruiz, Rothenberg B, Zhao J, Evans GA. Proc Natl Acad Sci USA 1987 Apr; 84 (8): 2160-4

• Waksman, SA 1961. Williams and Wilkins (eds.) The actinomycetes. Classification, identification and description of and interfere species.Vol 2. Baltimore.

• Ward, MD, R. Weller, and Mr. Bateson. 1990. 16S rRNA sequences reveal Numerous uncultured microorganisms in a natural community. Nature 344: 63-65.

• Widmer, F., RJ Seidler, and LS Watrud. 1996. Sensitive detection of transgenic plant marker gene persistence in soil Microcosms. Mol. Ecol. 5: 603-613.

• Williams, ST, R. Locci, A. Beswick, DI Kurtbôke, VD Kuznetsov, FJ Le Monnier, PF Long, KA Maycroft, RA Palma B. Petrolini, S. Quaroni, JI Todd, and M. West. 1993. Detection and identification of novel actinomycetes. Res. Microbiol. 144: 653-656.

• Wilson, IG 1997. Inhibition and facilitation of nucleic acid amplification. Appl. About. Microbiol. 63: 3741-3751.

• Woese, CR 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271.

Yannish-Perron fl al, 1985 Gene, 33 (1). 103-119.

• Zasiavsky, 1995. BY separation of biomolecules, p. 503-667. In Aqueous two phase partitioning. Boris Y. Zasiavsky (ed.) Physieal Bioanalytical Chemistry and Applications, Marcel Dekker, Inc., New York.

• Zhou, J., A. Bruns, and JM Tiedje.1996. DNA recovery from soils of diverse composition. Appl. About. Microbiol. 62: 316-322.

Claims

1. A process for preparing a collection of nucleic acids from a soil sample containing organisms, said method comprising the following succession of steps:
- 1 (a) micro-particles of receipt by grinding a soil sample previously dried or desiccated, then micro-particles suspended in a liquid buffer setting medium; and
(B) extracting nucleic acids present in the microparticles; and
(C) - passing the solution containing the nucleic acids on a molecular sieve, followed by recovery of elution fractions enriched in nucleic acids and passage of the elution fractions enriched in nucleic acids on an exchange chromatographic medium anions and then recovering the elution fractions containing purified nucleic acids.
2. A method of preparing a collection of nucleic acids from an environmental sample containing organisms, said method comprising the following succession of steps:
- It (i) obtaining a suspension by dispersing the environmental sample in a liquid medium and homogenizing the suspension by gentle stirring; and
(Ii) separation of the bodies and other inorganic components and / or organic of the homogeneous suspension obtained in step (i) by centrifugation on a density gradient; and
(Iii) lysing the separated bodies in step (ii) nucleic acid extraction; and
(Iv) nucleic acid purification on a cesium chloride gradient.
3. The method of claim 1, characterized in that the step I- (a) is followed by a supplementary step of:
- treatment of micro-particles suspended in a liquid medium by sonication buffer;
4. A method according to claim 1, characterized in that the l- step (a) is followed by the following additional steps:
- treatment of micro-particles suspended in a liquid medium by sonication buffer;
- incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;
- addition of SDS
- recovery of nucleic acids.
5. The method of claim 1, characterized in that the step I- (a) is followed by the following additional steps:
- micro-particles homogenization using a violent mixing of step (vortex) followed by simple stirring step;
- freezing the homogeneous suspension followed by thawing;
- sonication by treating the suspension after thawing;
- incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;
- addition of SDS;
6 .Method according to one of claims 1 to 5 characterized in that the nucleic acids are DNA molecules.
7. A method of preparing a collection of recombinant vectors, characterized in that the nucleic acids obtained by the method according to one of claims 1 to 6 are inserted into a cloning vector and / or expression.
8. A method according to claim 7, characterized in that the nucleic acids are separated according to their size prior to their insertion into the cloning vector and / or expression.
9. A method according to claim 7, characterized in that the average size of nucleic acid is rendered substantially uniform physical disruption prior to their insertion into the cloning vector and / or expression.
10. The method of claim 7, characterized in that the cloning vector and / or expression of the plasmid type.
11. The method of claim 7, characterized in that the cloning vector and / or expression is the cosmid.
12. The method of claim 11, characterized in that it is a cosmid replicative in E. coli and integrative in Streptomyces.
13. The method of claim 12, characterized in that it is the cosmid pOS700l.
14. The method of claim 11, characterized in that it is a cosmid conjugative and integrative in Streptomyces.
15. The method of claim 14, characterized in that the cosmid is selected from cosmids pOSV303, pOSV306 and pOSV307.
16. The method of claim 11, characterized in that it is a cosmid replicating in both E. coli and Streptomyces.
17. The method of claim 16, characterized in that it is the cosmid pOS 700R.
18. The method of claim 11, characterized in that it is a cosmid replicative in E. coli and Streptomyces and conjugative in Streptomyces.
19. The method of claim 7, characterized in that the cloning vector and / or expression is the BAC type.
20. The method of claim 19, characterized in that it is a BAC vector integrative and conjugative in Streptomyces.
21. The method of claim 20, characterized in that the vector is selected from the BAC vectors pOSV403, PMBD-1, PMBD-2, 3-PMBD, PMBD-4, 5-PMBD and PMBD-6.
22. A method for preparing a recombinant cloning and / or expression, characterized in that the step of inserting a nucleic acid into the cloning vector and / or expression comprises the steps of:
- open the cloning and / or expression in a selected cloning site, using an appropriate restriction endonuclease;
- adding a first homopolymeric nucleic acid to the free 3 'end of the open vector;
- adding a second homopolymeric nucleic acid, a complementary sequence to the first homopolymeric nucleic acid, to the free 3 'end of the nucleic acid of collection to be inserted into the vector acid;
- assembling the vector nucleic acid and the nucleic acid of acid hybridization collection of the first and second nucleic acid homopolymeric sequences complementary to each other;
- close the vector by ligation.
23. The method of claim 22, characterized in that:
- the first nucleic acid is homopolymeric poly (A) or poly (T); and
- the second nucleic acid is homopolymeric poly (T) or poly (A).
24. A process for preparing a recombinant vector according to one of Claims 22 or 23, characterized in that the size of the nucleic acid to be inserted is at least 100 kilobases, preferably at least 200 kilobases.
25. A process for preparing a recombinant vector according to one of claims 22 to 24, characterized in that the nucleic acid insert is contained in the collection of nucleic acids obtained by the method according to one of claims 1 6.
26. A method for preparing a recombinant cloning and / or expression, characterized in that the step of inserting a nucleic acid into the cloning vector and / or expression comprises the steps following:
- creation of blunt ends on the ends of the nucleic acid of the collection by removal of the 3 'sequences outgoing and filling sequences protruding 5';
- opening of the cloning vector and / or expression in a selected cloning site, with a suitable restriction endonuclease;
- creation of blunt-ended at the ends of the vector nucleic acid by removal of the 3 'sequences outgoing and filling sequences protruding 5', then dephosphorylating the 5 'ends;
- Addition complementary oligonucleotide adapters;
- insertion of the nucleic acid of the collection into the vector by ligation.
27. A process for preparing a recombinant vector according to claim 26, characterized in that the size of the nucleic acid to be inserted is at least 100 kilobases, preferably at least 200 kilobases.
28. A process for preparing a recombinant vector according to one of Claims 26 or 27, characterized in that the nucleic acid insert is contained in the collection of nucleic acids obtained by the method according to one of claims 1 6.
29. A method according to one of claims 22 to 28, characterized in that the nucleic acids are inserted as is, without treatment with one or more restriction endonucleases prior to their insertion into the cloning vector and / or expression.
30. Nucleic acid vector consisting of nucleic acids obtained by the method according to one of claims 1 to 6.
31. Nucleic acid characterized in that it is contained in the collection of nucleic acids according to claim 30.
32. Nucleic acid according to claim 31, characterized in that it comprises a nucleotide sequence encoding at least one operon, or a part of an operon.
33. Nucleic acid according to claim 32, characterized in that the operon encodes all or part of a metabolic pathway.
34. Nucleic acid according to claim 33, characterized in that the metabolic pathway is the route of synthesis of the polyketide.
35 Nucleic acid according to claim 34, characterized in that it is selected from polynucleotides comprising SEQ ID NO: 30-44 and SEQ ID N ° 115 to 120.
36. Nucleic acid according to claim 31, characterized in that it comprises the whole of a nucleotide sequence encoding a polypeptide
37. Nucleic acid according to one of claims 31 to 36, characterized in that it is of prokaryotic origin.
38. Nucleic acid according to claim 37, characterized in that it originates from a bacterium or virus.
39. Nucleic acid according to one of claims 31 to 33 and 36, characterized in that it is of eukaryotic origin.
40. Nucleic acid according to claim 39, characterized in that it is from a fungus, a yeast, a plant or animal.
41. Recombinant vector characterized in that it is chosen from the following recombinant vectors: a) a vector comprising a nucleic acid according to one of claims 35 to 40; b) a vector obtained by the method of one of claims 22 to 25 and 29; c) a vector obtained by the method of one of claims 26 to 29.
42 Vector characterized in that it is the cosmid pOS 700I.
43. Vector characterized in that it is the cosmid pOSV303.
44. Vector characterized in that i is the cosmid pOSV306.
45. Vector characterized in that i is the cosmid pOSV307.
46. ​​Vector characterized in that i is the cosmid pOS 700R.
47. Vector characterized in that i is the vector LAC pOSV403.
48. Vector characterized in that i is the PMBD-1 vector.
49. Vector characterized in that i is the PMBD-2 vector
50. Vector characterized in that i is the PMBD-3 vector.
51. Vector characterized in that i is the PMBD-4 vector.
52. Vector characterized in that i is the PMBD-5 vector.
53. Vector characterized in that i is the vector PMBD-6.
54. Recombinant vector Collection as obtained according to the method of one of claims 7 to 21, 25 and 28.
55. Recombinant cloning vector and / or expression vector characterized in that it is contained in the collection of recombinant vectors according to claim 54.
56 A recombinant host cell comprising a nucleic acid according to one of claims 31 to 40 or a recombinant vector according to claim 55.
57. A recombinant host cell according to claim 56, characterized in that it is a prokaryotic or eukaryotic cell.
58. A recombinant host cell according to claim 57, characterized in that it is a bacterium.
59. A recombinant host cell according to claim 58, characterized in that it is a bacterium selected from E. coli and Streptomyces.
60. A recombinant host cell according to claim 58, characterized in that it is a yeast or a filamentous fungus.
61. Collection of recombinant host cells, each host cells constituting the collection comprising a nucleic acid of the collection of nucleic acids of claim 30.
62. Collection of recombinant host cells, each host cells constituting the collection comprising a recombinant vector according to one of claims 41 or 55.
63. A method of detecting a nucleic acid determined nucleotide sequence, or nucleotide sequence structurally related to a particular nucleotide sequence to a collection of recombinant host cells according to one of claims 61 or 62, characterized in that comprises the following steps:
- contacting the recombinant host cell collection with a pair of primers which hybridize with the determined nucleotide sequence or hybridizing with the nucleotide sequence structurally related to a nucleotide sequence determined;
- performing at least three cycles of amplification;
- detecting the amplified nucleic acid optionally ..
64. A method of detecting a nucleic acid determined nucleotide sequence, or nucleotide sequence structurally related to a particular nucleotide sequence to a collection of recombinant host cells according to one of claims 61 or 62, characterized in that comprises the following steps:
- contacting the collection of recombinant host cells with a probe hybridizing to the specific nucleotide sequence or hybridizes with a nucleotide sequence structurally related to the determined nucleotide sequence;
- detecting the hybrid possibly formed between the probe and nucleic acids contained in the vectors in the collection.
65. A method for identifying the production of a compound of interest by one or more recombinant host cells in a collection of recombinant host cells according to one of claims 61 or 62, characterized in that it comprises the following steps:
- culturing the recombinant host cells of the collection in a suitable culture medium;
- detection of the compound of interest in the culture supernatant or in the cell lysate of one or more of the cultured recombinant host cells.
66 A method for selecting a recombinant host cell producing a compound of interest in a collection of recombinant host cells according to one of claims 61 or 62, characterized in that it comprises the following steps:
- culturing the recombinant host cells of the collection in a suitable culture medium;
- detection of the compound of interest in the culture supernatant or in the cell lysate of one or more of the cultured recombinant host cells.
- selection of recombinant host cells producing the compound of interest.
67. A method for producing a compound of interest characterized in that it comprises the following steps:
- cultivating a selected recombinant host cell according to the method of claim 66;
- recover and, if necessary, purifying the compound produced by said recombinant host cell.
68. A compound of interest characterized in that it is obtained according to the method of claim 67.
69. A compound according to claim 68, characterized in that it is a polyketide.
70. polyketide characterized in that it is produced by the expression of at least one nucleotide sequence comprising a sequence chosen from sequences SEQ ID N ° 30 to 44 and SEQ ID N ° 115 to 120.
71. A composition comprising a polyketide of claim 69 or 70.
72. A pharmaceutical composition comprising a pharmacologically active amount of a polyketide of claim 69 or 70, in association with a pharmaceutically compatible vehicle.
73. A method of determining the diversity of nucleic acids contained in a collection of nucleic acids and most preferably from a collection of nucleic acids from an environmental sample, preferably of a soil sample, said method comprising the steps of:
- contacting the nucleic acids of the collection of nucleic acids to be tested with a pair of oligonucleotide primers which hybridize to any DNA sequence ribosomal bacterial 16 S;
- producing at least three cycles of amplification;
- detection of amplified nucleic acids with an oligonucleotide probe or a plurality of oligonucleotide probes, each probe specifically hybridizing with a DNA sequence ribosomal 16 S common to a rule, an order, a subclass or a bacterial genus;
- where appropriate, comparing the results of the previous step of detecting with the detection results, by using the probe or the plurality of probes, nucleic acids of known sequence forming a reference range.
74. The method of claim 73, characterized in that the pair of primers hybridize to any DNA sequence ribosomal bacterial 16 S consists of FGPS primer 612 (SEQ ID NO 12) and primer 669 FGPS (SEQ ID NO: 13).
75. The method of claim 73, characterized in that the pair of primers hybridize to any DNA sequence ribosomal bacterial 16 S consists of the primer 63 f (ISD SEQ NO: 22) and primer 1387 ( SEQ ID NO: 23).
76. A nucleic acid comprising a 16S rDNA nucleotide sequence chosen from the sequences having at least 99% nucleotide identity with the sequences SEQ ID No. 60 to SEQ ID NO: 106.
77. A method for producing a polyketide synthase of type I, said production method comprising the steps of:
- obtaining a recombinant host cell comprising a nucleic acid encoding a polyketide synthase type I comprising a nucleotide sequence chosen from the sequences SEQ ID NO: 33 to SEQ ID No 44, SEQ ID NO: 30 to SEQ ID NO: 32 and SEQ ID N ° 115 to SEQ ID N ° 120. - cultivation of recombinant host cells in a suitable culture medium;
- recovery and, where appropriate, purification of the type I polyketide synthase from the culture supernatant or the cell lysate.
78. polyketide synthase comprising an amino acid sequence selected from the sequences SEQ ID NO: 45 to 59 and SEQ ID N ° 121 to SEQ ID N ° 126.
79. An antibody directed against a polyketide synthase according to claim 78.
80. A method of detecting a type I polyketide synthase or a peptide fragment of this enzyme, in a sample, said method comprising the steps of: a) contacting an antibody according to claim 79 with the sample to test; b) detecting the antigen / antibody complex formed optionally.
81. A kit for detecting a type I polyketide synthase in a sample comprising: a) an antibody according to claim 79; b) optionally, reagents necessary for the detection of the antigen / antibody complex formed optionally.
EP00985340A 1999-11-29 2000-11-27 Method for obtaining nucleic acids from an environment sample Withdrawn EP1268764A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
FR9915032 1999-11-29
FR9915032A FR2801609B1 (en) 1999-11-29 1999-11-29 Method of nucleic acids obtained from a sample of the environment, nucleic acids obtained and their application to the synthesis of new compounds
US20980000P true 2000-06-07 2000-06-07
US209800P 2000-06-07
PCT/FR2000/003311 WO2001040497A2 (en) 1999-11-29 2000-11-27 Method for obtaining nucleic acids from an environment sample

Publications (1)

Publication Number Publication Date
EP1268764A2 true EP1268764A2 (en) 2003-01-02

Family

ID=26235170

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00985340A Withdrawn EP1268764A2 (en) 1999-11-29 2000-11-27 Method for obtaining nucleic acids from an environment sample

Country Status (8)

Country Link
EP (1) EP1268764A2 (en)
JP (1) JP2003520578A (en)
AU (2) AU781961B2 (en)
BR (1) BR0015993A (en)
CA (1) CA2393041A1 (en)
IL (1) IL149846D0 (en)
NO (1) NO20022532L (en)
WO (1) WO2001040497A2 (en)

Families Citing this family (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010047029A1 (en) * 2000-04-26 2001-11-29 Handelsman Jo E. Triaryl cation antibiotics from environmental DNA
US8288523B2 (en) 2003-09-11 2012-10-16 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US20040121311A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in livestock
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7226739B2 (en) 2001-03-02 2007-06-05 Isis Pharmaceuticals, Inc Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US20030027135A1 (en) 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US7217510B2 (en) 2001-06-26 2007-05-15 Isis Pharmaceuticals, Inc. Methods for providing bacterial bioagent characterizing information
FR2834997B1 (en) * 2002-01-21 2004-03-19 Evialis Method for detection of fungi producers of ochratoxin or has citrinine
EP1386966A1 (en) 2002-07-24 2004-02-04 Libragen Method for the expression of unknown environmental DNA into adapted host cells
AT471981T (en) 2002-08-20 2010-07-15 B R A I N Biotechnology Res An Isolation and cloning of dna from uncultivated organisms
EP1905833B1 (en) 2002-10-08 2015-08-12 Aventis Pharma S.A. Polypeptides involved in the biosynthesis of spiramycins, nucleotide sequences coding these polypeptides and their uses
WO2004060278A2 (en) 2002-12-06 2004-07-22 Isis Pharmaceuticals, Inc. Methods for rapid identification of pathogens in humans and animals
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
JP4665124B2 (en) * 2004-01-28 2011-04-06 株式会社東京大学Tlo Recovery method of dna from environmental samples
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
EP1766659A4 (en) 2004-05-24 2009-09-30 Ibis Biosciences Inc Mass spectrometry with selective ion filtration by digital thresholding
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
EP1767621A4 (en) * 2004-06-08 2008-03-19 Toagosei Co Ltd Method of purifying environmental dna and method of efficiently screening protein-encoding gene from environmental dna
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
AU2007353877B2 (en) 2006-09-14 2012-07-19 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
WO2010033599A2 (en) 2008-09-16 2010-03-25 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
WO2010033627A2 (en) 2008-09-16 2010-03-25 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
EP2344893B1 (en) 2008-09-16 2014-10-15 Ibis Biosciences, Inc. Microplate handling systems and methods
US9175353B2 (en) 2008-11-14 2015-11-03 Gen-Probe Incorporated Compositions, kits and methods for detection of campylobacter nucleic acid
EP2396803A4 (en) 2009-02-12 2016-10-26 Ibis Biosciences Inc Ionization probe assemblies
WO2011008971A1 (en) 2009-07-17 2011-01-20 Ibis Biosciences, Inc. Lift and mount apparatus
WO2011008972A1 (en) 2009-07-17 2011-01-20 Ibis Biosciences, Inc. Systems for bioagent identification
EP2957641B1 (en) 2009-10-15 2017-05-17 Ibis Biosciences, Inc. Multiple displacement amplification
EP2325312A1 (en) * 2009-11-19 2011-05-25 Qiagen GmbH Method for selective enrichment and isolation of microbial and optional additionally of viral nucleic acids

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4900677A (en) * 1986-09-26 1990-02-13 E. I. Du Pont De Nemours And Company Process for rapid isolation of high molecular weight DNA
US5824485A (en) * 1995-04-24 1998-10-20 Chromaxome Corporation Methods for generating and screening novel metabolic pathways
US6261842B1 (en) * 1997-10-23 2001-07-17 Wisconsin Alumni Research Foundation Microorganism genomics, compositions and methods related thereto
CA2330543A1 (en) * 1998-06-23 1999-12-29 Biosearch Italia S.P.A. Methods for transferring the capability to produce a natural product into a suitable production host

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0140497A2 *

Also Published As

Publication number Publication date
CA2393041A1 (en) 2001-06-07
AU2179101A (en) 2001-06-12
AU2005211587A1 (en) 2005-10-13
IL149846D0 (en) 2002-11-10
NO20022532D0 (en) 2002-05-28
NO20022532L (en) 2002-06-26
AU781961B2 (en) 2005-06-23
WO2001040497A2 (en) 2001-06-07
WO2001040497A3 (en) 2002-10-17
BR0015993A (en) 2002-08-06
JP2003520578A (en) 2003-07-08

Similar Documents

Publication Publication Date Title
Smalla et al. Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids
Yarden et al. Chitin synthase 1 plays a major role in cell wall biogenesis in Neurospora crassa.
US7105297B2 (en) Methods and compositions for cellular and metabolic engineering
Mincer et al. Culture-dependent and culture-independent diversity within the obligate marine actinomycete genus Salinispora
Allignet et al. Diversity among the gram-positive acetyltransferases inactivating streptogramin A and structurally related compounds and characterization of a new staphylococcal determinant, vatB.
McSpadden Gardener et al. A rapid polymerase chain reaction-based assay characterizing rhizosphere populations of 2, 4-diacetylphloroglucinol-producing bacteria
Frostegård et al. Quantification of bias related to the extraction of DNA directly from soils
Bangera et al. Identification and characterization of a gene cluster for synthesis of the polyketide antibiotic 2, 4-diacetylphloroglucinol from Pseudomonas fluorescens Q2-87
US6391640B1 (en) Methods and compositions for cellular and metabolic engineering
Busti et al. Antibiotic-producing ability by representatives of a newly discovered lineage of actinomycetes
Ito et al. Quinolone resistance mutations in the DNA gyrase gyrA and gyrB genes of Staphylococcus aureus.
Leblond et al. Physical map of the Streptomyces lividans 66 genome and comparison with that of the related strain Streptomyces coelicolor A3 (2).
KR100501838B1 (en) Methods for generating and screening noverl metabolic pathways
Leskiw et al. Accumulation of bldA-specified tRNA is temporally regulated in Streptomyces coelicolor A3 (2).
ES2299240T3 (en) biosynthetic genes for the production of spinosyn insecticides.
AU741139B2 (en) Screening for novel bioactivities
Jiang et al. Diversity of culturable actinobacteria isolated from marine sponge Haliclona sp.
US7795030B2 (en) Methods and compositions for cellular and metabolic engineering
US7689366B2 (en) Integrated system for high throughput capture of genetic diversity
Schupp et al. Cloning and sequence analysis of the putative rifamycin polyketide synthase gene cluster from Amycolatopsis mediterranei
Beyer et al. Metabolic diversity in myxobacteria: identification of the myxalamid and the stigmatellin biosynthetic gene cluster of Stigmatella aurantiaca Sg a15 and a combined polyketide-(poly) peptide gene cluster from the epothilone producing strain Sorangium cellulosum So ce90
CA2261025A1 (en) Novel polyketide derivatives and recombinant methods for making same
Pradella et al. Characterisation, genome size and genetic manipulation of the myxobacterium Sorangium cellulosum So ce56
Clancy et al. Cloning and characterization of a novel macrolide efflux gene, mreA, from Streptococcus agalactiae.
AU781961B2 (en) Method for obtaining nucleic acids from an environment sample, resulting nucleic acids and use in synthesis of novel compounds

Legal Events

Date Code Title Description
17P Request for examination filed

Effective date: 20020701

AK Designated contracting states:

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent to

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report

Effective date: 20071113

18D Deemed to be withdrawn

Effective date: 20080326