WO2001040497A2

WO2001040497A2 - Method for obtaining nucleic acids from an environment sample

Info

Publication number: WO2001040497A2
Application number: PCT/FR2000/003311
Authority: WO
Inventors: Pascale Jeannin; Jean-Luc Pernodet; Michel Guerineau; Pascal Simonet; Sophie Courtois; Carmela Cappellano; François FRANCOU; Alain Raynal; Maria Ball; Guennadi Sezonov; Karine Tuphile; Asa Frostegard
Original assignee: Aventis Pharma S.A.
Priority date: 1999-11-29
Filing date: 2000-11-27
Publication date: 2001-06-07
Also published as: KR20020060242A; IL149846A0; EP1268764A2; BR0015993A; AU2179101A; CA2393041A1; AU2005211587A1; WO2001040497A3; NO20022532D0; AU781961B2; NO20022532L; JP2003520578A

Abstract

The invention concerns a method for preparing nucleic acids from an environment sample, more particularly a method for obtaining a library of nucleic acids from a sample. The invention also concerns nucleic acids of nucleic acid libraries obtained by said method their use in the synthesis of novel compounds, in particular novel compounds of therapeutic interest. The invent further concerns novel means used in the method for obtaining said nucleic acids, such as novel vectors and novel processes for preparing such vectors or recombinant host cells containing said nucleic acid. Finally, the invention concerns methods for detecting a nucleic acid of interest within a library of nucleic acids resulting from said method, and nucleic acids detected by said method and polypeptides encoded by said nucleic acids.

Description

Method for obtaining nucleic acids from a sample of the environment, nucleic acids thus obtained and their application to the synthesis of new compounds

The present invention relates to a method of preparing nucleic acids from a sample of the environment, more particularly to a method of obtaining a collection of nucleic acids from a sample. The invention also relates to nucleic acids or collections of nucleic acids obtained according to the process and their application to the synthesis of new compounds, in particular new compounds of therapeutic interest.

A subject of the invention is also the new means used in the process for obtaining the above nucleic acids, such as new vectors and new methods for preparing such vectors or also recombinant host cells comprising an acid. nucleic acid of the invention.

The invention also relates to methods for detecting a nucleic acid of interest within a collection of nucleic acids obtained according to the above method, as well as the nucleic acids detected by such a method and the polypeptides encoded by such methods. nucleic acids.

The invention also relates to nucleic acids obtained and detected according to the above methods, in particular nucleic acids coding for an enzyme participating in the biosynthetic pathway of antibiotics such as β-lactams, aminoglycosides, nucleotides heterocyclic or polyketides as well as the enzyme encoded by these nucleic acids, the polyketides produced by the expression of these nucleic acids and finally pharmaceutical compositions comprising a pharmacologically active amount of a polyketide produced by the expression of such nucleic acids.

Since the discovery of the production of streptomycin by actinomycetes, the search for new compounds of therapeutic interest, and in particular new antibiotics, has made increasing use of screening methods for the metabolites produced by the microorganisms of the ground. Such methods mainly consist in isolating the organisms from the telluric microflora, in cultivating them on specially adapted nutritive media and then in detecting pharmacological activity in the products found in the culture supernatants or in the cell lysates which have, if necessary, undergone one or more separation and / or purification steps beforehand.

Thus, the methods of isolation and in vitro culture of the organisms constituting the telluric microflora have made it possible, as of today, to characterize approximately 40,000 molecules, of which approximately half have biological activity.

Major products have been characterized according to such in vitro culture methods, such as antibiotics (penicillin, erythromycin, actinomycin, tetracycline, cephalosporin), anticancer drugs, cholesterol-lowering agents or even pesticides. The products of therapeutic interest of microbial origin known to date come mainly (around 70%) from the group of actinomycetes and more particularly from the genus Streptomyces. However, other therapeutic compounds, such as teicoplanins, gentamycin and spinosins, have been isolated from microorganisms of genera more difficult to cultivate such as Micromonospora, Actinomadura, Actinoplanes, Nocardia, Streptosporangium, Kitasatosporia or Saccharomonospora .

However, practice illustrates the fact that the characterization of new natural products synthesized by soil microflora organisms has remained limited, partly because the stage of in vitro cultivation most often results in a selection of already known organisms. previously.

The methods of separation and in vitro culture of telluric organisms in order to identify new compounds of interest therefore have many limits.

In actinomycetes, for example, the rediscovery rate of previously known antibiotics is around 99%. Indeed, fluorescence microscopy techniques have made it possible to count more than 10 ¹⁰ bacterial cells in 1 g of soil, while only 0.1 to 1% of these bacteria can be isolated after seeding on culture media.

Using DNA reassociation kinetics techniques, it has been shown that between 12,000 and 18,000 bacterial species can be contained in 1g of soil, whereas to date, only 5000 non-eukaryotic microorganisms have been described. , all habitats combined.

Molecular ecology studies have made it possible to amplify and clone many new 16S rDNA sequences from environmental DNA. The results of these studies have led to a tripling of the number of previously characterized bacterial divisions.

As of today, bacteria are subdivided into 40 divisions, some of which are only made up of bacteria that cannot be cultivated. These latest results demonstrate the extent of microbial biodiversity that has remained unexploited to date.

Recent work has attempted to overcome the many obstacles to access to biodiversity in the soil microflora, including the stage of in vitro culture prior to isolation and the characterization of compounds of industrial interest, especially therapeutic interest.

Methods have thus been developed which include a step of extracting DNA from telluric organisms, if necessary after prior isolation of the organisms contained in the soil samples. The DNA thus extracted, after lysis of the bacterial cells without prior stage of culture ^' in vitro, is cloned into vectors used to transfect host organisms, in order to constitute DNA libraries originating from soil bacteria.

These libraries of recombinant clones are used to detect the presence of genes coding for compounds of therapeutic interest or alternatively to detect the production of compounds of therapeutic interest by these recombinant clones.

However, the methods of direct access to the DNA of the soil microflora, described in the prior art have drawbacks during the implementation of each of the steps described above, of likely to considerably affect the quantity and quality of the genetic material obtained and usable.

The state of the art relating to each of the stages of construction of DNA libraries from soil samples is detailed below, as well as the technical drawbacks identified by the applicant and which have been overcome according to the present invention.

1. Stage of DNA extraction from a soil sample.

1.1 Direct extraction of DNA from the environment.

It is essentially a process using DNA extraction techniques carried out directly on the sample in the environment, most often after prior in situ lysis of the organisms in the sample.

Such techniques have been used on samples from aquatic environments, whether fresh or marine. They comprise a first stage of prior concentration of the cells present freely or in the form of particles, generally consisting of filtration of large volumes of water on different filtration devices, for example conventional filtration on a membrane, tangential or rotational filtration or even ultrafiltration. . The pore size is between 0.22 and 0.45 mm and often requires prefiltration in order to avoid clogging due to the treatment of large volumes.

Secondly, the harvested cells are lysed directly on the filters in small volumes of solutions, by enzymatic and / or chemical treatment.

This technique is for example illustrated by the work of STEIN et al. , 1996, Journal of Bacteriology, Vol. 178 (3): 591-599 which describes the cloning of genes coding for ribosomal DNA and for a transcription elongation factor (EF 2) from Archaebacteria du marine plankton. Techniques for direct DNA extraction from soil or sediment samples have also been described, based on physical, chemical or enzymatic lysis protocols carried out in situ. For example, U.S. Patent No. 5,824,485 (Chromaxome

Corporation) describes a chemical lysis of the bacteria directly on the sample taken by adding a hot lysis buffer based on guanidium isothiocyanate.

International application n ° WO 99 / 20.799 (WISCONSIN ALUMNI RESEARCH FOUNDATION) describes a step of lysis of bacteria in situ using an extraction buffer containing a protease and SDS.

Other techniques have also been used, such as carrying out several freeze-thaw cycles of the sample and then pressing the thawed sample at high pressure. Bacteria lysis techniques have also been used using a succession of sonication steps, microwave heating and thermal shock (PICARD et al. (1992).

However, the techniques of direct DNA extraction of the prior art described above have a very variable efficiency from a quantitative and qualitative point of view.

Thus, the in situ chemical or enzymatic treatments of the sample have the disadvantage of only lysing certain categories of microorganisms due to the selective resistance of the various indigenous microorganisms at the lysis stage due to their heterogeneous morphology .

Thus, Gram-positive bacteria resist heat treatment with SDS detergent while almost all Gram-negative cells are lysed. In addition, some of the direct extraction protocols described above promote the adsorption of the extracted nucleic acids on the mineral particles of the sample, thus significantly reducing the amount of accessible DNA.

Furthermore, if certain prior art protocols disclose a mechanical processing step to lyse the micro- organisms of the sample taken, such a mechanical lysis step is systematically carried out in a liquid medium in an extraction buffer, which does not allow good homogenization of the starting sample in the form of fine particles allowing maximum accessibility the diversity of organisms present in the sample. Crushing tests were also carried out on a sample of raw soil using glass beads, but the quantity of DNA extracted was small.

It has been observed according to the invention that a first step of mechanical lysis in situ in a liquid medium has negative effects on the quantity of DNA capable of being extracted.

The quantity of DNA directly usable for cloning into recombinant vectors is also dependent on the purification steps subsequent to its extraction. In the prior art, the extracted DNA is then purified, for example by the use of polyvinylpolypyrrolidone, by precipitation in the presence of ammonium or potassium acetate, by centrifugations on a cesium chloride gradient, or else chromatographic techniques, in particular on a hydroxyapatite support, on an ion exchange column or molecular sieving or by electrophoresis techniques on agarose gel.

The DNA purification techniques described above, especially when these are combined with the abovementioned environmental DNA extraction techniques, are liable to lead to co-purification of the DNA with inhibitory compounds originating from of the original sample which are difficult to remove.

The co-extraction of inhibitor compounds with DNA requires the multiplication of the number of purification steps which leads to significant losses of the DNA initially extracted and simultaneously reduces the diversity of the genetic material initially contained in the sample, as well than its quantity.

Another object of the invention was to overcome the drawbacks of the previous purification protocols and to develop a DNA purification step making it possible to optimally maintain the diversity of the DNA of the initial sample, on the one hand, and, quantitatively promoting its obtaining, on the other.

In particular, the qualitative and quantitative improvements in DNA purification are greatest when they use a combination of a direct DNA extraction process according to the invention and a subsequent purification process, such as this will be described below.

1.2. Indirect DNA extraction from the environment.

Such techniques use a first step of separation of the different organisms from the telluric microflora from the other constituents of the starting sample, prior to the step of extraction of the DNA itself. In the prior art, the prior separation of a microbial fraction from a soil sample most often comprises a physical dispersion of the sample by grinding the latter in a liquid medium, for example using devices of the type Waring Blender or a mortar. Chemical dispersions have also been described, for example on ion exchange resins or else dispersions using non-specific detergents such as sodium deoxycholate or polyethylene glycol. Whatever the mode of dispersion, the solid sample must be suspended in water, phosphate buffer or saline solution.

The physical or chemical dispersion step can be followed by centrifugation on a density gradient allowing the separation of the cells contained in the sample and the particles of the latter, it being understood that the bacteria have densities lower than those of most soil particles.

The physical dispersion step can also be followed alternately by a low speed centrifugation step or even a cell elutriation step.

The DNA can then be extracted from the separated cells by all available lysis methods and can be purified by numerous methods, including the purification methods described in paragraph 1.1 above. In particular, the inclusion of cells in agarose with a low melting point can be carried out in order to protect the lysis. However, the methods described in the state of the art known to the applicant are not satisfactory because of the presence, in the fractions containing the extracted DNA, of undesirable constituents of the starting sample having a significant influence on the quality and the amount of final DNA. The present invention proposes to solve the technical difficulties encountered in the processes of the prior art as will be described below.

2. Molecular characterization of the extracted DNA.

When it is desired to build a DNA bank from a sample of the environment, in particular from a soil sample, it is advantageous to check the quality and the diversity of the source of DNA extracted. and purified prior to its insertion into suitable vectors.

The objective of such a molecular characterization of the extracted and purified DNA is to obtain profiles representing the proportions of the different bacterial taxa present in this DNA extract. The molecular characterization of the extracted and purified DNA makes it possible to determine whether artefacts were introduced during the implementation of the various extraction and purification stages and, if necessary, whether the diversity of origin of the DNA. extracted and purified is representative of the microbial diversity initially present in the sample, especially in the soil sample. To the knowledge of the applicant, use is made in the state of the art of quantitative hybridization methods using oligonucleotide probes specific for different bacterial groups, applied directly to DNA extracted from the environment. Unfortunately, such an approach is not very sensitive and does not make it possible to detect genera or taxonomic groups present in low abundance.

The state of the art also describes quantitative PCR methods, such as MPN-PCR or quantitative competition PCR. However, these techniques have significant drawbacks.

Thus, MPN-PCR is of complex use due to the multiplication of dilutions and repetitions which makes it unsuitable for a large number of samples or of pairs of primers.

Furthermore, quantitative PCR by competition is difficult to implement because of the need to construct a specific competitor for the target DNA which, moreover, does not induce bias or artifacts in the competition proper. called. It is thus proposed according to the invention a method of pre-screening a DNA bank originating from a sample of the environment which is both rapid, simple and reliable and makes it possible to test the quality of the DNA previously extracted. and purified and thus determine the advantage of constructing a library of clones prepared from this purified starting DNA.

3. Vectors for cloning DNA extracted and purified from an environmental sample.

Many vectors have already been described in the prior art in order to clone DNA previously extracted from a sample of the environment.

Thus, according to the description of international application No. WO 99 / 20,799, viral vectors, phages, plasmids, phagemids, cosmids, phosmids, vectors of the BAC type (bacterial artificial chromosome) or else can be used. bacteriophage P1, PAC type vectors (artificial chromosome based on bacteriophage P1), YAC type vectors (artificial yeast chromosome), yeast plasmids or any other vector capable of maintaining and stably expressing genomic DNA.

Example 1 of PCT application No. WO 99 / 20,799 describes the construction of a genomic DNA library by cloning into a vector of the BAC type.

To the knowledge of the applicant, no DNA bank originating from a sample of the environment had yet been effectively produced with vectors of the conjugative type, such a technique being made for the first time accessible and reproducible by humans. of the profession through the teaching of the present invention.

4. Cell Hosts

In the state of the art, numerous host cells have been described as being able to be used in order to host the vectors containing the DNA inserts coming from the DNA extracted and purified from a sample of the environment.

Thus, PCT application No. WO 99 / 20,799 cites numerous appropriate cellular hosts, such as Escherichia coli, in particular the strain DH 10B or even the strain 294 (ATCC 31446, the strain E. coli B, E. Coli X 1776 (ATCC N ° 31.537), E.coli DH5 α and E.coli W3110

(ATCC No. 27.325).

This PCT application also cites other appropriate host cells such as Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, Serratia, Schigella or also strains of the bacillus type such as B. subtilis and β. licheniformis as well as bacteria of the genus

Pseudomonas, Streptomyces or Actinomyces.

US Patent No. 5, 824,485 cites in particular the strain of Streptomyces lividans TK66 or also yeast cells such as those of Saccharomyces pombe.

5. Characterization of genes of interest in DNA libraries from a sample of the environment. PCT application No. WO 99 / 20,799 describes an identification of the phenotype of different clones belonging to the DNA library of B. cereus, respectively a clone producing hemolysin, a clone hydrolyzing esculin or a clone producing a orange pigment. Mutagenesis techniques based on the use of a transposon coding for the enzyme pho A subsequently made it possible to isolate mutated clones and to characterize the sequences responsible for the phenotypes observed.

The article by STEIN et al. (1996) cited above describes the use of specific primers of ribosomal DNA in order to amplify the DNA inserted into the vectors hosted by certain clones of a genomic DNA bank of Archaebacteria of plankton marine and identification of several coding sequences in the DNA thus amplified.

The article by BORSCHERT S. et al., (1992) describes the screening of a genomic DNA library of Bacillus subtilis using pairs of primers hybridizing with conserved regions of known peptide synthetases in order to identify one or more corresponding genes in the Bacillus subtilis genome.

This technique made it possible to detect a chromosomal DNA fragment of about 26 kb carrying part of the operon for biosynthesis of surfactin.

The article by KAH-TONG S. et al. (1997) describes the screening of a DNA library from the soil using primers hybridizing with conserved sequences of the operon responsible for the biosynthesis pathway type II polyketides and shows the identification, within this DNA library, of sequences related to the PKS-β gene. This article also describes the construction of hybrid expression cassettes in which the sequence of the PKS-β subunit, found naturally in the operon responsible for the biosynthesis of polyketides, has been replaced by different related sequences found in the library of DNA.

Similarly, the article by HONG-FU et al. , (1995) describes the construction of expression cassettes containing the different open reading phases of the operon responsible for the biosynthesis of polyketides, the different expression cassettes having been constructed artificially by combining the open reading phases which are not found together naturally in the genome of Streptomyces coelicolor. This article shows that the combination, in artificial expression cassettes, of open reading frames originating from different bacterial strains allows the production of polyketides with different structural characteristics and more or less large antibiotic activities against Bacillus subtilis and Bacillus cereus.

Polyketides are part of a large family of natural products of variable structure and with a wide variety of biological activities. Polyketides include, for example, tetracyclines and erythromycin (antibiotics), FK506 (immunosuppressant), doxorubicin (anti-cancer agent), monensin (a coccidiostatic agent) as well as avermectin (an antiparasitic agent).

These molecules are synthesized using multifunctional enzymes called polyketide synthases, which catalyze repeated condensation cycles between acyl thioesters (in general acetyl, propionyl, malonyl or methylmalonyl thioesters). Each condensation cycle results in the formation, on a growing carbon chain, of a β-keto group which can then undergo, if necessary, one or more series of reducing steps.

Given the significant clinical interest of polyketides, their common mechanism of biosynthesis as well as the high degree of conservation observed between the groups of genes coding for polyketides synthases, there has developed an increased interest in the development of new polyketides by genetic engineering.

New artificial polyketides have thus been produced by genetic engineering, such as mederrhodin A or dihydrogranatirhodin. The vast majority of new polyketide molecules obtained by genetic engineering are very different, from a structural point of view, from the corresponding natural polyketides.

From the state of the art, it thus appears that there is a need to obtain new polyketides of interest and very particularly of polyketides of therapeutic interest having in particular, with respect to their natural counterparts, an increased level of antibiotic activity or a spectrum of different antibiotic activity, either wider than that of known polyketides, or on the contrary more selective.

This need is, as will be described below, partially met according to the present invention.

DESCRIPTION OF THE INVENTION

The invention relates first of all to a method for the construction of DNA libraries originating from a sample of the environment, such a sample being able either to be an aquatic medium (fresh or marine water), a soil sample (layer surface, soil or sediment), or a sample of eukaryotic organisms containing an associated microflora, such as for example a sample from plants, insects or even marine organisms and having an associated microflora.

The development of a process for constructing a DNA library of an environmental sample, and in particular of a soil sample, includes critical steps, the implementation of which must necessarily be optimized for obtaining a DNA bank whose content in nucleic acids of interest meets the objectives initially set.

A first critical step consists in the extraction and subsequent purification of the nucleic acids initially contained in the sample, that is to say mainly of the nucleic acids contained in the various organisms making up the microflora of this sample.

The quality of the purification of the extracted DNA is decisive on the result obtained.

A second important step in a process for building a library of nucleic acids from an environmental sample is the evaluation of the genetic diversity of the extracted and purified nucleic acids. The development of a simple and reliable production step of pre-screening the extracted and purified DNA in order to verify that it accounts, at least partially, for the phylogenetic diversity of the organisms initially present in the sample starting point, in fact makes it possible to determine the advantage or not of using the initial source of DNA extracted and purified for the construction of the bank of nucleic acids proper or on the contrary not to continue the construction of the bank d nucleic acids due to excessive artefacts introduced during the extraction and purification of nucleic acids. It has also been identified according to the invention that the quality of the inserts introduced into the vectors to build the library is decisive. It was thus determined that the use of restriction enzymes to cleave the DNA extracted and purified from the environmental sample was likely to introduce artifacts or "bias" in the structure of the inserts obtained. Indeed, the DNA extracted from the soil or from other environments, coming for the most part from non-cultivable organisms, is composed of molecules whose rate of bases G and C is by definition unknown and moreover variable according to l origin of these organisms.

A third critical step is the insertion of the nucleic acids extracted and purified into vectors capable of integrating nucleic acids of selected length, on the one hand, and, on the other hand, of allowing their transfection or even the integration into the genome in specific cell hosts as well as, if necessary, allowing expression thereof in such cell hosts.

Constitute vectors of interest, the vectors capable of integrating large nucleic acids, that is to say of size greater than 100 kb when the objective pursued consists in cloning and identification of one _. complete operon capable of directing a complete pathway for biosynthesis of a compound of industrial interest, in particular of a compound of pharmaceutical or agronomic interest.

DEFINITIONS

For the purposes of the present invention, the term “nucleic acids”, “polynucleotides” and “oligonucleotides” means both DNA and RNA sequences as well as hybrid RNA / DNA sequences of more than 2 nucleotides, indifferently under the single strand or double strand shape. The term "library" or "collection" is used in the present description with reference to either a set of extracted and, where appropriate purified, nucleic acids, coming from a sample of the environment, to a set of recombinant vectors, each of the recombinant vectors of the set comprising a nucleic acid originating from the abovementioned set of nucleic acids extracted and, where appropriate purified, as well as to a set of recombinant host cells comprising one or more nucleic acids originating from the all of the abovementioned extracted and, where appropriate, purified nucleic acids, said nucleic acids being either carried by one or more recombinant vectors, or integrated into the genome of said recombinant host cells.

The term “environmental sample” is used to designate either a sample of aquatic origin, for example fresh or saline water, or a telluric sample originating from the surface layer of a soil, from sediments or from lower layers of the soil. (underground), as well as samples of eukaryotic organisms, possibly multicellular, of plant origin, from marine organisms or even insects and having an associated microflora, this associated microflora constituting organisms of interest .

The term "operon" according to the invention means a set of open reading frames whose transcription and / or translation is co-regulated by a single set of signals for regulating transcription and / or translation. According to the invention, an operon can also comprise said signals for regulating transcription and / or translation.

By “metabolic pathway” for the purposes of the invention or also “biosynthetic pathway” is meant a set of anabolic or catabolic biochemical reactions effecting the conversion of a first chemical species into a second chemical species.

For example, an antibiotic biosynthesis pathway is made up of all of the biochemical reactions converting primary metabolites into antibiotic intermediates, and subsequently into antibiotics. By regulation sequence placed "in phase" (in English operably linked) relative to a nucleotide sequence whose expression is sought, it means that the transcription regulation sequence (s) are localized, relative to the nucleotide sequence d interest whose expression is sought, so as to allow the expression of said sequence of interest, the regulation of said expression being dependent on factors interacting with the regulatory nucleotide sequences.

According to another terminology, it can also be said that the nucleotide sequence of interest whose expression is sought is placed "under the control" of the nucleotide sequences which regulate transcription.

The term "isolated" in the sense of the present invention designates a biological material which has been removed from its original environment (the environment in which it is naturally located).

For example, a polynucleotide or a polypeptide naturally present in an organism (virus, bacteria, fungus, yeast, plant or animal) is not isolated. The same polypeptide separated from its natural environment or the same polynucleotide separated from the adjacent nucleic acids in which it is naturally inserted into the genome of the organism, is isolated.

Such a polynucleotide can be included in a vector and / or such a polynucleotide can be included in a composition and nevertheless remains in an isolated state, because the vector or the composition does not constitute its natural environment.

The term "purified" does not require that the material be present in a form of absolute purity, exclusive of the presence of other compounds. Rather, it is a relative definition.

A polypeptide or a polynucleotide is in the purified state after purification of the starting material of at least one order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.

The "percentage of identity" between two nucleotide or amino acid sequences, within the meaning of the present invention, can be determined by comparing two optimally aligned sequences, through a comparison window. The part of the nucleotide or polypeptide sequence in the comparison window can thus include additions or deletions (for example "gaps") with respect to the reference sequence (which does not include these additions or these deletions) so as to obtain an optimal alignment of the two sequences.

The percentage is calculated by determining the number of positions at which an identical nucleic base or amino acid residue is observed for the two sequences (nucleic or peptide) compared, then by dividing the number of positions at which there is identity between the two bases or amino acid residues by the total number of positions in the comparison window, then multiplying the result by 100 to obtain the percentage of sequence identity.

The optimal alignment of the sequences for the comparison can be achieved by computer using known algorithms contained in the package of the company WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN.

By way of illustration, the percentage of sequence identity may be carried out using the BLAST software (BLAST versions 1.4.9 of March 1996, BLAST 2.0.4. Of February 1998 and BLAST 2.0.6. Of September 1998 ), using only the default settings (SF AltschuI et al., J. Mol. Biol. 1990 215: 403-410, SF AltschuI et al., Nucleic Acids Res. 1997 25: 3389-3402). Blast searches for sequences similar / homologous to a reference "query" sequence, using the algorithm of AltschuI et al. The query sequence and the databases used can be peptide or nucleic, any combination being possible.

EXTRACTION AND PURIFICATION OF NUCLEIC ACIDS FROM A SAMPLE OF THE ENVIRONMENT.

1. Direct extraction of nucleic acids

It has been shown according to the present invention that, for obtaining a library of nucleic acids originating from contained organisms in a soil sample, it was important to create conditions under which, on the one hand, the different organisms in the sample are made accessible in the later stages of nucleic acid extraction and, on the other hand, that the initial stage of treatment of the soil sample allows maximum mechanical lysis of the organisms in the sample so as to make the nucleic acids of these organisms, mainly genomic and plasmid DNA, directly accessible, to the buffers used for the subsequent stages of 'extraction. It has thus been demonstrated according to the invention that maximum accessibility of the nucleic acids originating from the microorganisms of a soil sample was achieved by thorough and dry grinding of the previously dried soil sample in order to obtain microparticles. The applicant has thus determined that the drying of the soil sample prior to any subsequent treatment causes a significant reduction in the cohesion of the raw soil sample and consequently promotes its subsequent disintegration in the form of micro-particles, when an appropriate grinding treatment is carried out.

Surprisingly, the applicant has shown that microparticles from samples of dry soil combine physicochemical properties favorable to the extraction of an optimal quantity of nucleic acids which, in their nature, could be representative of the genetic diversity of organisms initially present in the starting soil sample. It has been shown in particular that the method of direct extraction of nucleic acids according to the invention allows the extraction of DNA from rare microorganisms, such as certain rare Streptomyces or spore-forming microorganisms.

By “micro-particles” of the soil sample for the purposes of the present invention is meant particles derived from the sample having an average size of approximately 50 μm, that is to say on average between 45 and 55 .mu.m /.

According to the invention, the micro-particles are obtained from soil samples previously dried or desiccated and then ground until micro-particles of average size between 2μm and 50μm, before resuspension in a liquid buffer medium of the microparticles obtained.

Such a liquid buffer medium can consist of a nucleic acid extraction buffer, in particular a conventional DNA extraction buffer well known to those skilled in the art.

The grinding of the soil sample into microparticles has the dual function of mechanically lysing the majority of the organisms present in the initial soil sample and of making non-lysed organisms accessible by this mechanical treatment at optional later stages of lysis. chemical and / or enzymatic.

Thus, a first object of the invention consists of a method of preparing a collection of nucleic acids from a soil sample containing organisms, said method comprising a first step (l- (a)) of obtaining micro-particles by grinding the soil sample previously dried or desiccated, then suspending the micro-particles in a liquid buffer medium.

Most preferably, the grinding step is carried out using an agate or tungsten ball device or even using a tungsten ring device. These devices are preferred because the hardness of materials such as agate or tungsten significantly facilitates the production of microparticles of the size specified above. For this reason, we will not preferentially choose, or even avoid, recourse to a glass ball grinding device, which has proved to be much less effective. The drying or classification of the soil sample can be carried out by any method known to those skilled in the art. For example, the raw soil sample can be dried at room temperature for 24 to 48 hours.

As indicated above, the liquid buffer medium can consist of a medium for extracting the DNA present in the microparticles. An extraction buffer designated TENP containing 50 mM tris, 20 mM EDTA, 100 mM NaCl and 1% (weight / volume) of polyvinylpolypyrrolidone, at pH 9.0, will be used most preferably. The method of preparing a collection of nucleic acids from a soil sample is further characterized in that the step of obtaining microparticles by grinding the previously dried or desiccated soil sample is followed by a step 1- (b) of extraction of the nucleic acids present in the microparticles.

It is common ground that the extraction of nucleic acids is accompanied by a co-extraction of undesirable compounds and / or constituents of the soil requiring the subsequent purification of the extracted nucleic acids, such a subsequent purification step having to be both sufficiently selective to allow the elimination of undesirable compounds and / or constituents of the soil and of a sufficient yield to cause a small loss in quantity of the DNA previously extracted.

It has been shown according to the invention that a step of purifying the DNA extracted from the microparticles of the soil sample meeting the selectivity and yield criteria defined above, comprises a treatment of the extracted DNA by a combination of two successive chromatography steps, respectively a molecular sieve chromatography and an anion exchange chromatography.

According to another characteristic of the above method, step I- (b) of extraction of the nucleic acids is followed by a step l- (c) of purification of the nucleic acids extracted using the two steps of chromatography following:

- passage of the solution containing the nucleic acids on a molecular sieve, then recovery of the elution fractions enriched in nucleic acids;

- passage of the elution fractions enriched in nucleic acids on an anion exchange chromatography support, then recovery of the elution fractions containing the nucleic acids.

The nature and order of the above chromatography steps are essential for good selectivity and excellent yield of the step of purifying the DNA previously extracted from the microparticles of the sample of the previously dried or desiccated soil.

Very advantageously, the chromatographic medium of the type "molecular sieve" of the nucleic acid purification step above consists of a Sephacryl type of chromatographic support ^®

S400 HR or a chromatographic support with equivalent characteristics.

Quite preferably, the chromatographic medium anion exchange used in the second stage of purification of the extracted DNA is a media type Elutip ^® d, or a chromatographic support with equivalent characteristics.

By combining steps l- (a) of obtaining micro-particles from the dry soil sample, l- (b) of extraction of the nucleic acids present in the micro-particles and l- (c) of purification by the chromatographic steps described above, it was possible according to the invention to directly extract the DNA from the soil without prior purification of the cells of the organisms initially contained in the sample, while avoiding the co-extraction of contaminants from the soil , such as for example humic acids which is observed with the methods of the prior art.

Contaminants such as humic acids severely affect the analyzes and subsequent uses of the nucleic acids whose purification is sought.

According to the above method, it is also possible to access the nucleic acids contained in the organisms which have not been mechanically lysed during step l- (a) of obtaining microparticles from the sample. soil, with the aim of obtaining an almost exhaustive collection of the genetic diversity of the nucleic acids initially present in the soil sample. Thus, the micro-particles of the soil sample can be the subject of subsequent steps of chemical, enzymatic or physical lysis treatment, or else of a combination of chemical, enzymatic or physical treatments.

According to a first aspect, the method for preparing a collection of nucleic acids from a soil sample according to the invention can be further characterized in that step l- (a) is followed by the following steps:

• treatment of the soil suspension in a liquid buffer medium by sonication;

• extraction and recovery of nucleic acids.

Preferably, use will be made, for a sonication treatment, of a device of the titanium micro-tip type, such as the 600 W Vibracell Ultrasound icator device sold by the company Bioblock or a Cup Horn type sonicator.

Most preferably, the sonication stage is carried out at a power of 15 W for a period of 7 to 10 min and comprises successive sonication cycles, the actual sonication being carried out for 50% of the duration of each cycle.

According to a second aspect, the above method can be further characterized in that step l- (a) is followed by the following steps:

• treatment of the soil suspension in a liquid buffer medium by sonication;

• incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;

• addition of SDS before centrifugation and precipitation of nucleic acids;

• recovery of precipitated nucleic acids.

Preferably, the incubation step in the presence of lysozyme and achromopeptidase will be carried out at a final concentration of 0.3 mg / ml of each of the two enzymes, preferably for 30 minutes at 37 ° C. Preferably, the SDS will be used at a final concentration of 1% and for an incubation time of 1 hour at a temperature of 60 ° C before centrifugation and precipitation.

According to a third aspect, the method for preparing a collection of nucleic acids from a soil sample above is further characterized in that step l- (a) is followed by the following steps:

- homogenization of the soil suspension with a violent mixing step (vortex) followed by a simple stirring step;

- freezing of the homogeneous suspension followed by thawing;

- treatment by sonication of the suspension after thawing; - incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;

- addition of SDS before centrifugation and precipitation of nucleic acids;

- recovery of nucleic acids.

Preferably, the suspensions of soil micro-particles are vortexed and then homogenized by gentle agitation on a circular rotation agitator for a period of two hours before being frozen at −20 ° C. Preferably, the suspensions are again agitated violently by vortexing for 10 minutes, after thawing and before the sonication step.

It goes without saying that the nucleic acids extracted by the embodiments of the direct nucleic acid extraction process described above are preferably purified according to the purification step consisting of a first pass on molecular sieve and then a subsequent pass. elution fractions obtained after chromatography on a molecular sieve on an anion exchange chromatographic support. 2. Indirect extraction of nucleic acids

According to a second embodiment of the method for preparing a collection of nucleic acids from a sample of the environment, according to the invention, said sample of the environment undergoes a first treatment such as to allow separation organisms contained in this sample, other macroconstituents in the sample.

This second embodiment of the method for preparing a collection of nucleic acids according to the invention promotes the obtaining of large nucleic acids, which are practically impossible to obtain according to the first embodiment of the method according to the invention described above, the mechanical lysis step carried out to obtain micro-particles also having the effect of physically breaking the nucleic acids of the soil sample or of the nucleic acids contained in the organisms of the sample of ground.

Obtaining large nucleic acids has been sought by the applicant with the aim of isolating and characterizing nucleic acids comprising, at least partially, all of the coding sequences belonging to the same operon capable of directing biosynthesis a compound of industrial interest.

Preferably, nucleic acids having a size greater than 100 are obtained by implementing the second embodiment of the method for preparing a collection of nucleic acids from a soil sample according to the invention. kb, preferably greater than 200, 250 or 300 kb, and very preferably nucleic acids of size greater than 400, 500 or even 600 kb.

This second embodiment of a process for preparing a collection of acids. nucleic acids from a sample of the environment according to the invention consists of a combination of four successive steps intended for obtaining nucleic acids having the characteristics described above.

When the environmental sample is a soil sample, it has been shown according to the invention that a first step of obtaining a suspension by dispersion of the soil sample in liquid medium favored the accessibility of the organisms contained in the sample without causing significant mechanical lysis of the cells.

The first step of obtaining a dispersion of the above soil sample makes the sample organisms accessible to the outside environment and also allows a partial dissociation of the sample organisms and the macro-constituents. It thus makes possible a subsequent separation of the organisms initially contained in the sample from the other constituents of the latter. When the environmental sample comes for example from plants, marine organisms or insects, a preliminary treatment by grinding is necessary in order to make the organisms of the associated microflora accessible at the later stages of the process.

Thus, the present process comprises a step of separation of the organisms from the other mineral and / or organic constituents obtained previously by centrifugation on a density gradient. The organisms thus separated are then subjected to a step of lysis and then extraction of the nucleic acids.

The centrifugation step on a density gradient surprisingly made it possible to separate the cells of organisms from the soil particles contained in the suspension of the sample. One would indeed have expected that a proportion of the cells would be entrained with the macro-particles within the gradient phase. In addition, it had never been shown until now that a density gradient centrifugation of a soil sample made it possible to find, at the aqueous phase / gradient interface, a population of organisms representative of the diversity organisms present in the initial sample, because these organisms are of extremely variable volume, density and shape. One could reasonably suppose that they would be found indifferently within the aqueous phase, at the interface aqueous phase / density gradient and also within the density gradient itself.

Thus, a person skilled in the art could expect organisms having densities lower or greater than the density of the density gradient used (density of the density gradient between 1, 2 and 1, 5 g / ml, preferably 1, 3 g / ml) could not be recovered, which would have had the effect of introducing a bias in the representativeness of the organisms effectively separated and, consequently , also in the diversity of the nucleic acids extracted.

In addition, in a particular embodiment of the method, a step of germination of the spores, in particular of actinomycetes, is carried out, which has the effect of significantly increasing the amount of actinomycete DNA recovered. The last step consists of a step of purification of the nucleic acids thus extracted on a cesium chloride gradient.

Surprisingly, the purification of nucleic acids on the cesium chloride gradient allows a substantial, even complete elimination, of the substances making up the density gradient. This characteristic is decisive with regard to the subsequent use of the purified nucleic acids since the density gradient is known as a powerful enzymatic inhibitor, capable if necessary of inhibiting the catalytic activity of the enzymes used to prepare the insertion of the acids. nucleic acids extracted into vectors. According to this second embodiment, the method for preparing a collection of nucleic acids from a sample of the environment containing organisms according to the invention comprises the following sequence of steps:

(i) obtaining a suspension by dispersing the sample from the environment in a liquid medium and then homogenizing the suspension obtained by gentle stirring;

(ii) separation of the organisms from the other mineral and or organic constituents of the homogeneous suspension obtained in step (i) by centrifugation on a density gradient;

(iii) lysis of the microorganisms separated in step (ii) and extraction of the nucleic acids; (iv) purification of the nucleic acids on a cesium chloride gradient.

Preferably, the suspension of the soil sample is obtained by dispersing this sample by grinding using a device of the Waring Blender type or a device with equivalent characteristics. Most preferably, the sample suspension is obtained after three successive grindings of a duration of one minute each in a device of the Waring Blender type. Preferably, the ground sample will be cooled in ice between each of the grindings.

Preferably, the organisms are then separated from the soil particles by centrifugation on a density cushion of the "Nycodenz" type, sold by the company Nycomed Pharma AS. (Oslo, Norway). The preferred centrifugation conditions are 10,000 g for 40 minutes at 4 ° C., advantageously in a rotor with movable bowls of the "TST 28.38 rotor" type sold by the company KONTRON.

The ring of organisms localized, after centrifugation, at the interphase of the upper aqueous phase and the lower phase of Nycodenz is then removed and washed by centrifugation before resumption of the cell pellet in an appropriate buffer.

Step (iii) of lysis of the organisms separated in step (ii) described above can be carried out in any manner known to those skilled in the art. Advantageously, the cells are lysed in a solution

Tris 10 mM-100 mM EDTA at pH 8.0 in the presence of lysozyme and achromopeptidase, advantageously for one hour at 37 ° C.

The actual DNA extraction can advantageously be carried out by adding a solution of lauryl sarcosyl (1% of the final weight of the solution) in the presence of proteinase K and incubation of the final solution at 37 ° C. for 30 minutes .

The nucleic acids extracted in step (iii) are then purified on a cesium chloride gradient. Preferably, the step of purification of the nucleic acids on a cesium chloride gradient is carried out by centrifugation at 35,000 revolutions / minute for 36 hours, for example on a rotor of the Kontron 65.13 type.

According to a particular aspect of the process for preparing a collection of nucleic acids from a soil sample containing organisms according to the invention, said nucleic acids consist mainly, if not exclusively, of DNA molecules.

According to another aspect, the nucleic acids can be recovered after inclusion of the organisms, separated on a density gradient, in an agarose block and lysis, for example chemical and / or enzymatic, of the organisms included in the agarose block.

Another subject of the invention consists of a collection of nucleic acids consisting of the nucleic acids obtained in step ll- (iv) of the process for preparing a collection of nucleic acids according to the invention or also obtained in the step (c) or a subsequent step of the process for preparing a collection of nucleic acids according to the invention.

The invention also relates to a nucleic acid characterized in that it is contained in a collection of nucleic acids as defined above.

According to a first aspect, such a nucleic acid constituting a collection of nucleic acids according to the invention is characterized in that it comprises a nucleotide sequence coding for at least one operon, or part of an operon. Most preferably, such an operon codes for all or part of a metabolic pathway.

Example 9 describes the construction of a genomic DNA library from a strain of Streptomyces alboniger and its cloning in the shuttle cosmids pOS700l and pOS700R respectively. It has been shown according to the invention that in the DNA library produced in the integrative vector pOS700l nine clones contain nucleotide sequences belonging to the operon responsible for the puromycin biosynthetic pathway. Likewise, it could be identified within the DNA library produced in the replicative vector pOS 700R twelve. clones containing nucleotide sequences of the operon responsible for the puromycin biosynthetic pathway.

In particular, certain integrative and replicative cosmids of the libraries produced present, after digestion with the restriction endonucleases Clal and EcoRV, a fragment with a size of 12 kb capable of containing all the sequences of the operon responsible for the biosynthesis pathway puromycin.

Thus, according to another aspect, a nucleic acid according to the invention contains, at least in part, nucleotide sequences of the operon responsible for the puromicyne biosynthetic pathway.

Example 2 below describes the construction of a DNA library according to a process in accordance with the present invention in a pBluescript SK ^' vector from a soil contaminated with lindane.

The recombinant vectors were transfected into cherscherichia coli DH10B cells and then the transformed cells were cultured in an appropriate culture medium in the presence of lindane. Screening of the transformed cell clones of the library made it possible to show that, out of 10,000 clones screened, 35 of them exhibited a degradation phenotype of lindane. The presence of the linA gene in these clones could be confirmed by PCR amplification using primers specific for this gene.

Thus, according to another aspect, the invention also relates to a nucleic acid containing a nucleotide sequence of the metabolic pathway causing the biodegradation of lindane. It is therefore clearly demonstrated, as described above, that a method of preparing a collection of nucleic acids from a soil sample containing organisms according to the invention as well as a method of preparing a collection of recombinant vectors containing the nucleic acids constituting the above-mentioned collection of nucleic acids was entirely suitable for the isolation and characterization of nucleotide sequences included in an operon.

A further demonstration of the ability of a method according to the invention to identify coding nucleotide sequences involved in a biosynthetic pathway regulated in the form of an operon is further described below: this is cloning and some characterization of sequences coding for polyketide synthases involved in the biosynthetic pathway of polyketides, which belong to a family of molecules of which certain representatives are of major therapeutic interest, in particular antibiotic. The present invention therefore further relates to a nucleic acid constituting a collection of nucleic acids according to the invention, characterized in that it comprises the whole of a nucleotide sequence coding for a polypeptide.

According to a first aspect, a nucleic acid constituting a collection of nucleic acids according to the invention is of prokaryotic origin.

According to a second aspect, a nucleic acid constituting a collection of nucleic acids according to the invention comes from a bacterium or a virus.

According to a third aspect, a nucleic acid constituting a collection of nucleic acids according to the invention is of eukaryotic origin.

In particular, such a nucleic acid is characterized in that it comes from a fungus, a yeast, a plant or an animal.

MOLECULAR CHARACTERIZATION OF THE COLLECTION OF NUCLEIC ACIDS EXTRACTED FROM THE SOIL.

In order to overcome the numerous technical drawbacks of the methods for characterizing DNA libraries extracted and purified from a sample of the environment which have been described in the part of the description relating to the state of the art, the applicant has developed a simple and reliable method for qualitatively and semi-quantitatively characterizing the nucleic acids obtained at the end of the method described above.

The method according to the invention thus consists in universally amplifying a 700 bp fragment located inside a 16 S ribosomal DNA sequence, then hybridizing the amplified DNA with an oligonucleotide probe of variable specificity and finally to compare the intensity of hybridization of the sample compared to an external standard range of DNA of known sequence or origin. The amplification prior to hybridization with the oligonucleotide probe makes it possible to quantify genera or species of microorganisms which are not abundant. In addition, amplification with universal primers makes it possible, during hybridization, to use a large series of oligonucleotide probes.

Thus, the subject of the invention is also a method for determining the diversity of nucleic acids contained in a collection of nucleic acids, and very particularly of a collection of nucleic acids originating from a sample of the environment, preferably a sample of the soil, said method comprising the following steps:

contacting the nucleic acids of the collection of nucleic acids to be tested with a pair of oligonucleotide primers hybridizing to any bacterial 16 S ribosomal DNA sequence;

- carrying out at least three amplification cycles;

- detection of amplified nucleic acids using an oligonucleotide probe or a plurality of oligonucleotide probes, each probe specifically hybridizing with a 16 S ribosomal DNA sequence common to a kingdom, an order, a subclass or a bacterial genus;

- If necessary, comparison of the results of the previous detection step with the detection results, using the probe or the plurality of nucleic acid probes of known sequence constituting a standard range.

Preferably, a first pair of primers hybridizing with universally conserved regions of the 16 S ribosomal RNA gene consists respectively of the primers FGPS 612 (SEQ ID No 12) and FGPS 669 (SEQ ID No 13).

A second embodiment of a pair of primers preferred according to the invention consists of the pair of universal primers 63 f (SEQ ID No. 22) and 1387r (SEQ ID No. 23).

According to a particular embodiment of a method for determining the diversity of nucleic acids in a collection nucleic acids, the amplification step using a pair of universal primers can be carried out on a collection of recombinant vectors into each of which has been inserted a nucleic acid from the collection of nucleic acids considered, prior to the hybridization step with oligonucleotide probes specific for a kingdom, an order, a subclass or a particular bacterial genus.

Such a method for determining the diversity of nucleic acids contained in a collection is very particularly applicable to collections of nucleic acids obtained in accordance with the teaching of the present description.

Thus, Example 3 details a method for preparing a collection of nucleic acids from a soil sample containing organisms, comprising a step of indirect DNA extraction by dispersing a soil sample before separation of the cells on a Nycodenz gradient, lysis of the cells then purification of the DNA on a cesium chloride gradient.

The nucleic acid collection thus obtained was used as such or in the form of inserts in cosmid-type vectors in an amplification process using the aforementioned universal primers of the 16 S rDNA, then the DNAs. amplified were subjected to a detection step using oligonucleotide probes of sequences SEQ ID No. 14 to SEQ ID No. 21 which are presented in Table 4.

The results show that a process for preparing a collection of nucleic acids from a soil sample containing organisms according to the invention makes it possible to access the DNA of more than 14% of the total telluric microflora , or 2 x 10 ⁸ cells per gram of soil, while the total cultivable microflora represents only 2% of the total microbial population. In order to determine the phylogenetic diversity of a collection of nucleic acids prepared in accordance with the invention, 47 sequences of the 16S rRNA gene were isolated and sequenced. These sequences correspond respectively to the nucleotide sequences SEQ ID No. 60 to SEQ ID No. 106. The nucleic acids comprising the sequences SEQ ID No. 60 to SEQ ID No. 106 also form part of the invention, as well as the nucleic acids having at least 99%, preferably 99.5% or 99.8% identity. nucleic acids with the nucleic acids comprising the sequences SEQ ID No. 60 to SEQ ID No. 106. Such sequences can be used in particular as probes to screen clones of a DNA library and thus identify those, among the clones of the library, which contain such sequences, these sequences being likely to be in the vicinity of coding sequences of interest, such as sequences coding for enzymes involved in the pathway for biosynthesis of antibiotic metabolites, for example polyketides.

Comparison of the 16S rRNA sequences from a DNA library carried out in accordance with the invention with the sequences listed in the RDP database (Maidak BL, Cole JR, Parker CT, Garrity GM, Larsen N., Li B., Lilburn TG, McCaughey, MJ, Olsen GJ, Overbeek R., Pramanik S., Schmidt TM, Tiedje JM, Woese CR (1999) "A new projet of the RDP (Ribosomal Database Project)" Nucleic Acids Research Vol. 27: 171-173) made it possible to determine that the nucleic acids contained in a collection of nucleic acids according to the invention come from α-proteobacteria, β-proteobacteria, δ-proteobacteria, γ-proteobacteria, actinomycetes as well as a genus related to acidobacterium. These results, presented in Table 7 as well as by the phylogenetic tree of FIG. 7, account for the great phylogenetic diversity of the nucleic acids contained in a DNA library prepared in accordance with the method according to the invention.

CLONING AND / OR EXPRESSION VECTORS

Each of the nucleic acids contained in a collection of nucleic acids prepared in accordance with the invention can be inserted into a cloning and / or expression vector.

To this end, all types of vectors known from the prior art can be used, such as viral vectors, phages, plasmids, phagemids, cosmids, phosmids, BAC type vectors, P1 bacteriophages, BAC type vectors, YAC type vectors, yeast plasmids or any other vector known to the state of technique by those skilled in the art.

Advantageously, according to the invention, use will be made of vectors allowing stable expression of the nucleic acids of a DNA library. To this end, such vectors preferably include transcription regulation sequences which are located in phase ("operably linked") with the genomic insert so as to allow the initiation and / or regulation of the expression of at least part of said DNA insert.

It follows from the above, that the invention also relates to a process for the preparation of a collection of recombinant vectors characterized in that the nucleic acids obtained in step ll- (iv) or in step l- (c ) or any other subsequent step in a process for preparing a collection of nucleic acids from a soil sample containing organisms according to the invention are inserted into a cloning and / or expression vector. Prior to their insertion into a cloning and / or expression vector, the nucleic acids constituting a collection of nucleic acids according to the invention can be separated according to their size, for example by electrophoresis on a gel. agarose, if necessary after digestion using a restriction endonuclease. According to another aspect, the average size of the nucleic acids constituting a collection of nucleic acids according to the invention can be made of a substantially uniform size by the implementation of a physical rupture step prior to their insertion into the cloning and / or expression vector. Such a step of physical or mechanical rupture of the nucleic acids can consist of successive passages of the latter, in solution, in a metal channel of approximately 0.4 mm in diameter, for example the channel of a syringe needle having a such diameter.

The average size of the nucleic acids can in this case be between 30 and 40 kb in length. The construction of the preferred vectors according to the invention is shown in FIGS. 25 (integrative cosmid conjugate) and 26 (integrative BAC).

Cloning and / or expression vectors which can advantageously be used for the insertion of nucleic acids contained in a DNA collection or library according to the invention are in particular the vectors described in European patent N ° EP-0 350 341 and in US Pat. No. 5,688,689, such vectors being specially adapted for the transformation of strains of actinomycetes. Such vectors contain, in addition to a DNA sequence of the insert, an att attachment sequence as well as a DNA sequence coding for an integrase (int sequence) functional in the strains of actinomycetes.

However, it has been observed according to the invention that certain cloning and / or expression vectors have drawbacks and that their theoretical functional capacity has not been achieved in practice.

Thus, it appeared that the integration system contained in vectors of the state of the art, and in particular in the vectors described in European patent n ° EP 0 350 41 did not in reality allow good integration of the DNA insert from the bank within the bacterial chromosome.

Based on the assumption that the functional deficits of integration of such vectors within the bacterial chromosome were due to a defect in the expression of the integrase gene present in these vectors, the applicant first sought to increase expression of the integrase gene by substituting for the initial transcription promoter a transcription promoter capable of significantly increasing the number of integrase transcripts.

The results have been disappointing and the chromosome integration function of these vectors has not been improved.

Surprisingly, it has been shown according to the invention that the difficulties of expression of the integrase contained in this family of Integrative vectors was not at the level of the amount of expression of the transcripts, but at the level of their stability.

According to a second hypothesis, the applicant was able to show that the lack of stability of the integrase transcripts was caused by deficits in the termination of the transcription of the corresponding messenger RNA.

The applicant then inserted a terminator site placed downstream of the sequence coding for the integrase of the vector so as to obtain a messenger RNA of determined size. The insertion of an additional termination signal downstream of the nucleotide sequence coding for the integrase of the vector has made it possible to obtain a family of integrative vectors of cosmid type and of BAC type.

Preferably, the terminating site is placed downstream of the att attachment site.

In addition, the applicant has developed new conjugate vectors and new replicative vectors of the cosmid type and new conjugate vectors of the BAC type which can advantageously be used for the insertion of the nucleic acids constituting a collection of nucleic acids. prepared according to the process of the invention.

When the insertion of DNA fragments of medium size is sought, use is preferably made of vectors of the cosmid type, capable of receiving inserts having a maximum size of approximately 50 kb.

Such cosmid vectors are very particularly suitable for the insertion of nucleic acids constituting a collection of nucleic acids obtained according to the method of the invention comprising a first step of direct DNA extraction by mechanical lysis of the organisms contained in the initial soil sample.

When the insertion of large nucleic acids, in particular nucleic acids of a size greater than 100 kb, or even greater than 200, 300, 400, 500 or 600 kb is sought, then use will preferably be made of BAC type vectors capable of receiving DNA inserts of such size. Such BAC type vectors are very particularly suitable for the insertion of the nucleic acids constituting a collection of nucleic acids obtained in accordance with the method according to the invention in which the first step consists of an indirect extraction of DNA. by prior separation of the organisms contained in the initial soil sample and elimination of the macro-constituents of said soil sample.

In particular, vectors of the BAC type are advantageously used for the insertion of large nucleic acids containing, at least partially, the nucleotide sequence of an operon.

Thus, the process for preparing a collection of recombinant cloning and / or expression vectors according to the invention is further characterized in that the cloning and / or expression vector is of the plasmid type.

According to another aspect, such a method is characterized in that the cloning and / or expression vector is of the cosmid type.

According to a first aspect, it may be a replicative cosmid in E. coli and integrative in Streptomyces. An entirely preferred cosmid vector corresponding to such a definition is the cosmid pOS700l described in Example 3.

According to yet another aspect, the cosmid vector is conjugative and integrative in Streptomyces.

In general, conjugate vectors of the cosmid type or of the BAC type, which include in their nucleotide sequences a motif recognized by the cellular enzymatic machinery called "origin of conjugation" are used whenever it is desired to avoid the use of techniques. heavy and not very automated transformation. For example, the transfection of vectors initially hosted by E. coli cells into Streptomyces cells conventionally requires a stage of recovery of the recombinant vector contained in Esche chia coli cells, and its purification prior to the stage of transformation of protoplasts of Streptomyces. It is commonly accepted that a transfection of a set of 1000 clones of Escherichia coli in Streptomyces requires obtaining approximately 8000 clones so that each clone of E. coli has a chance to be represented.

Conversely, a transfection step by conjugation of a vector hosted by E.coli to Streptomyces cells requires the same number of clones of each of the microorganisms, the conjugation step taking place "clone to clone" and also not understanding the technical difficulties associated with the step of transferring genetic material by transformation of protoplasts, for example in the presence of polyethylene glycol.

In order to optimize the construction of a DNA bank in Streptomyces, novel conjugation vectors of cosmid type and of BAC type have been developed according to the invention so as to allow maximum efficiency of the conjugation step. In particular, the new conjugative vectors according to the invention have been constructed by placing a selection marker gene at the end of the DNA of the vector which is lastly transferred to the receptor bacteria. This improvement in the conjugative vectors of the prior art makes it possible to positively select only the recipient bacteria having received all of the DNA of the vector and, consequently, all of the DNA of the insert of interest.

Conjugative and integrative cosmids in Streptomyces preferred according to the invention are the cosmids pOSV303, pOSV306 and pOSV307 described in Example 5. According to another aspect, a process for preparing a collection of recombinant vectors according to the invention is implemented. works with a replicating cosmid both in E. coli and in Streptomyces. Such a cosmid is advantageously the cosmid pOS 700R described in Example 6. According to yet another aspect, the above method can be implemented with a replicative cosmid in E. coli and Streptomyces and conjugative in Streptomyces.

Such a replicative and conjugative cosmid can be obtained from a replicative cosmid according to the invention, by the insertion of a appropriate transfer origin, such as RK2, as described in Example 5 for the construction of the vector pOSV303.

According to another advantageous embodiment of the method for preparing a collection of recombinant vectors according to the invention, use is made of a BAC-type cloning and / or expression vector.

According to a first aspect, the vector of the BAC type is integrative and conjugative in Streptomyces.

Very preferably, such an integrative and conjugative BAC vector in Streptomyces is the BAC vector pOSV 403 described in Example 8, or else the BAC vectors pMBD-1, pMBD-2, pMBD-3, pMBD-4, pMBD-5 and pMBD-6 described in Example 15.

The invention further relates to a recombinant vector characterized in that it is chosen from the following recombinant vectors: a) a vector comprising a nucleic acid constituting a collection of nucleic acids according to the invention; b) a vector as obtained according to a method eliminating any recourse to the action of a restriction endonuclease on the DNA fragment to be inserted, as described previously. Very preferably, the invention also relates to a vector chosen from the following vectors:

- the cosmid pOS700l;

- the cosmid pOSV303; - the cosmid pOSV306;

- the cosmid pOSV307;

- the cosmid pOS700R;

- the vector BAC pOSV403;

- the BAC vector pMBD-1; - the BAC vector pMBD-2;

- the BAC vector pMBD-3;

- the BAC vector pMBD-4;

- the BAC vector pMBD-5;

- the BAC vector pMBD-6. The invention further relates to a collection of recombinant vectors as obtained according to any one of the methods according to the invention.

Process for the preparation of a recombinant cloning and / or expression vector according to the invention.

Conventional techniques for inserting DNA into a vector in order to prepare a cloning and / or recombinant expression vector conventionally use a first step during which a restriction endonuclease is incubated with both the DNA to be inserted and with the receptor vector thus creating compatible ends between the DNA to be inserted and the DNA of the vector allowing the assembly of the two DNAs before a final ligation step allowing the recombinant vector to be obtained.

However, such a conventional technique has notable drawbacks, particularly when the insertion of large nucleic acids into a cloning and / or expression vector is sought. Indeed, the prior action of a restriction enzyme on the DNA fragments intended to be inserted into a vector is capable of significantly reducing the size of this DNA before its insertion into the vector. It goes without saying that a significant reduction in the size of DNA prior to its insertion into a vector is a particularly unfavorable situation when the cloning of large DNA fragments likely to contain all of the sequences is sought. coding agents and, where appropriate, also regulatory sequences, of an operon whose expression constitutes a complete biosynthesis pathway of a metabolite of industrial interest, and very particularly of a compound of therapeutic interest.

To remedy the drawbacks of the techniques of the prior art, two methods have been developed according to the invention for preparing a recombinant cloning and / or expression vector which do not require the use of a restriction endonuclease on the DNA to be inserted prior to its introduction into the vector. Of such methods are therefore entirely suitable for cloning long DNA fragments capable of containing, at least partially, all of the coding sequences and, where appropriate, also regulatory sequences, of a complete operon responsible for a biosynthetic pathway.

According to a first aspect, a method for preparing a recombinant cloning and / or expression vector according to the invention is characterized in that the insertion of a nucleic acid into the cloning and / or expression vector , includes the following steps:

- open the cloning and / or expression vector at a chosen cloning site, using an appropriate restriction endonuclease;

- add a first homopolymeric nucleic acid to the free 3 'end of the open vector;

- Add a second homopolymeric nucleic acid, of sequence complementary to the first homopolymeric nucleic acid, at the free 3 'end of the nucleic acid to be inserted into the vector;

- Assemble the nucleic acid of the vector and the nucleic acid by hybridization of the first and of the second homopolymeric nucleic acid of sequences complementary to each other;

close the vector by ligation.

Such a method is described in Examples 10 and 13 below. Advantageously, the above process can have the following characteristics, individually or in combination:

- the first homopolymeric nucleic acid is of poly (A) or poly (T) sequence; - the second homopolymeric nucleic acid is of poly (T) or poly (A) sequence.

Most preferably, the homopolymeric nucleic acids have a length of between 25 and 100 nucleotide bases, preferably between 25 and 70 nucleotide bases. The process for the preparation of a recombinant cloning and / or expression vector described above is particularly suitable for the construction of DNA libraries in BAC type vectors. Thus, according to an advantageous embodiment of the method for preparing a recombinant vector described above, said method is further characterized in that the size of the nucleic acid to be inserted is at least 100 kb, and preferably at least 200, 300, 400, 500 or 600 kb. Such a preparation process is therefore particularly suitable for the insertion of the nucleic acids contained in a collection of nucleic acids obtained according to the process of the invention.

In order to allow the insertion of large DNA fragments into cloning and / or expression vectors, it was developed according to the invention, a second method having made it possible to eliminate any recourse to the action of a restriction endonuclease on DNA intended to be inserted into the vector.

Such a method of preparing a recombinant cloning and / or expression vector according to the invention is characterized in that the step of inserting a nucleic acid in said cloning and / or expression vector comprises the following steps:

- creation of blunt ends on the ends of the nucleic acid of the collection by elimination of the outgoing 3 'sequences and filling of the outgoing 5' sequences;

- Opening of the cloning and / or expression vector at a chosen cloning site using an appropriate restriction endonuclease;

- addition of complementary oligonucleotide adapters; - creation of blunt ends at the ends of the nucleic acid of the vector by elimination of the outgoing 3 'sequences and filling of the outgoing 5' sequences, then dephosphorylation of the 5 'ends in order to prevent recircularization of the vector;

- insertion of the nucleic acid from the collection into the vector by ligation.

Preferably, the elimination of the outgoing 3 ′ sequences is carried out using an exonuclease, such as the Klenow enzyme.

Preferably, the filling of the outgoing 5 ′ sequences is carried out using a polymerase, and very preferably T4 polymerase, in the presence of the four nucleotide triphosphates.

A process for preparing a recombinant cloning and / or expression vector by eliminating the outgoing 3 'sequences and filling in the outgoing 5' sequences as described above is particularly suitable for the construction of DNA libraries from of cosmid-like vectors.

Such a process for obtaining recombinant vectors is described in Example 12.

In a particular mode of preparation of a recombinant vector according to the invention, oligonucleotides comprising one or more rare restriction sites are added to the vector at the level of the cloning site of the DNA to be inserted, in accordance with the teaching of Example 10. This addition of oligonucleotides facilitates the subsequent recovery of the inserts without cleavage of the latter.

HOST CELLS

Although any type of host cell can be used for transfection or transformation with a nucleic acid or a recombinant vector according to the invention, in particular a prokaryotic or eukaryotic host cell, use will preferably be made of host cells whose physiological, biochemical and genetic characteristics are well characterized, easily cultivable on a large scale and whose culture conditions for the production of metabolites are well known. Preferably, the host cell receiving a nucleic acid or a recombinant vector according to the invention is phylogenetically close to the donor organisms initially contained in the sample from the environment from which the nucleic acids originate. Most preferably, a host cell according to the invention must have a use of codons similar to, or at least close to, the donor organisms initially present in the environmental sample, especially the soil sample. The size of the DNA fragments capable of carrying the nucleotide sequences of interest sought can be variable. Thus, enzymes encoded by genes of average size of 1 kb can be expressed from small inserts while the expression of secondary metabolites will require the maintenance in the host organism of fragments of much larger size, for example from 40 kb to more than 100 kb, 200 kb, 300 kb, 400 kb or 600 kb.

Thus, Eschenchia coli host cells are a preferred choice for cloning large DNA fragments.

Most preferably, use will be made of the strain of Eschenchia coli designated DH10B and described by Shizuya et al; (1992) for which cloning protocols in BAC vectors have been optimized.

However, other strains of Eschenchia coli can be advantageously used for the construction of a DNA library according to the invention, such as the strains E.coli Sure, E.coli DH5 α, or even E.coli 294 ( ATCC No. 31446).

In addition, the construction of a DNA library by transfection of E. coli cells with recombinant vectors according to the invention is also possible, the expression of genes of various prokaryotes such as that Bacillus, Thermotoga, Corynebacterium, Lactobacillus or Clostridium having been described in PCT application No. WO 99/20799.

In general, E. coli host cells can in all cases constitute transient hosts in which the recombinant vectors according to the invention can be maintained with great efficiency, the genetic material being able to be easily manipulated and archived and stably.

In order to express the greatest possible molecular diversity, other cellular hosts can also be advantageously used, such as cells of Bacillus, Pseudomonas, Streptomyces, Myxococcus, Aspergillus nidulans or even Neurospora crassa.

It has further been shown according to the present invention, that Streptomyces lividans cells can be used with success and constitute expression systems complementary to Eschenchia coli.

Streptomyces lividans is a model for studying the genetics of Streptomyces and has also been used as a host for heterologous expression of many secondary metabolites. Streptomyces lividans, has in common with other actinomycetes such as Streptomyces coelicolor, Streptomyces griseus, Streptomyces fradiae, as well as Streptomyces griseochromogenes, precursor molecules and regulatory systems necessary for the expression of all or part of the complex biosynthetic pathways, such as for example the pathway for biosynthesis of polyketides or the pathway for biosynthesis of non-ribosomal polypeptides representing classes of molecules of very diverse structures.

Streptomyces lividans also has the advantage of accepting foreign DNA with high transformation efficiencies.

Thus, the invention also relates to a recombinant host cell comprising a nucleic acid according to the invention, constituting a collection of nucleic acids prepared according to a process in accordance with the invention, or a recombinant host cell comprising a recombinant vector as defined above.

According to a first aspect, it may be a recombinant host cell of prokaryotic or eukaryotic origin. Advantageously, a recombinant cell according to the invention is a bacterium, and very preferably a bacterium chosen from E.coli and Streptomyces.

According to another aspect, a recombinant host cell according to the invention is characterized in that it is a yeast or else a filamentous fungus.

The invention also relates to a collection of recombinant host cells, each of the constituent host cells of the collection comprising a nucleic acid originating from a collection of nucleic acids produced according to a method for preparing a collection of nucleic acids. from a soil sample containing organisms as described above.

The invention also relates to a collection of recombinant host cells, each of the constituent host cells of the collection comprising a recombinant vector according to the invention. Due to the large size of the inserts it is necessary to have maximum processing efficiency. For this purpose, a Streptomyces lividans receptor strain constitutively expressing the integrase of pSAM2 in order to promote the site-specific integration of the vector is preferred. For this, the int gene under the control of a strong promoter is integrated into the chromosome. The overproduction of integrase does not induce excision phenomena (Raynal et al., 1998).

The production of a new metabolite from the insert could be toxic to Streptomyces if the insert does not contain genes for resistance to the antibiotic produced or if this gene is little or not expressed. The capacity of different genes allowing Streptomyces ambofaciens to resist the antibiotic it produces is studied (Gourmelen et al., 1998; Pernodet et al., 1999). Some of these genes code for ABC-type transporters capable of conferring a broad spectrum of resistance. These genes can be introduced and overexpressed in the host strain of Streptomyces lividans. Conversely, a strain hypersensitive to antibiotics can be used (Pernodet et al., 1996), in order to detect in the bank the presence of resistance genes. In fact, in antibiotic-producing microorganisms, these resistance genes are often associated with genes in the antibiotic biosynthetic pathway. The selection of resistant clones can allow a simple initial sorting to be carried out before the more complex tests for the detection of a new metabolite produced by the clone.

ISOLATION AND CHARACTERIZATION OF NEW NUCLEOTIDE SEQUENCES ENCODING SYNTHASE POLYKETIDES.

According to the invention, a collection of recombinant host cells was obtained after transfection of the host cells by a collection of recombinant vectors each containing a nucleic acid insert from a collection of nucleic acids prepared according to the method according to the invention .

More specifically, the DNA fragments obtained according to the method of the invention in which a step of indirect DNA extraction from the organisms contained in the soil sample is implemented were first of all cloned into the integrative cosmid pOS700l.

The step of inserting the DNA fragments into the integrative cosmid pOS700l was carried out according to the method of the invention in which tails of homopolymeric polynucleotides poly (A) and poly (T) were added at the end 3 'respectively of the vector nucleic acid and DNA fragments to be inserted.

The recombinant vectors thus constructed were packaged in lambda phage heads and the phages obtained were used to infect E. coli cells according to techniques well known to those skilled in the art.

A bank of approximately 5000 clones of Eschenchia coli was obtained.

This bank of clones was screened with pairs of primers specific for a nucleotide sequence coding for a enzyme involved in the polyketide biosynthesis pathway, the PKS type I enzyme, also known as β-ketoacyl synthase.

It is recalled here that polyketides constitute a chemical class of great structural diversity comprising a large number of molecules of pharmaceutical interest such as tylosin, monensin, vermectin, erythromycin, doxorubicin or even FK506.

Polyketides are synthesized by condensation of acetate molecules under the action of enzymes called polyketide synthases (PKSs). There are two types of polyketide synthases. Polyketide synthases type II are generally involved in the synthesis of polycyclic aromatic antibiotics and catalyze the condensation of acetate units iteratively.

Polyketide synthases type I are involved in the synthesis of macrocyclic polyketides or macrolides and constitute multifunctional modular enzymes.

Given their therapeutic interest, there is a need in the state of the art to isolate and characterize new polyketide synthases which can be used for the production of new pharmaceutical compounds, in particular new pharmaceutical compounds with antibiotic activity.

The screening of the library of recombinant clones described above using PCR primers selectively amplifying nucleotide sequences coding for polyketide synthases of type I made it possible to identify recombinant clones containing DNA inserts comprising a sequence nucleotide encoding new polyketide synthases. The nucleotide sequences coding for these new polyketide synthases are referenced as the sequences SEQ ID No. 33 to SEQ ID No. 44 and SEQ ID No. 115 to SEQ ID No. 120. Another subject of the invention consists of a nucleic acid coding for a new polyketide synthase I, characterized in that it comprises one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No. 44 and SEQ ID No. 115 at SEQ ID N ° 120.

Preferably, such a nucleic acid is in an isolated and / or purified form. The invention also relates to a recombinant vector comprising a polynucleotide comprising one of the sequences SEQ ID No. 34 to SEQ ID No. 44 and SEQ ID No. 115 to SEQ ID No. 120

The invention also relates to a recombinant host cell comprising a nucleic acid chosen from polynucleotides comprising one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No. 44 and SEQ ID No. 115 to SDEQ ID No. 120 as well than to a recombinant host cell comprising a recombinant vector into which is inserted a polynucleotide comprising one of the nucleotide sequences SEQ ID No. 34 to SEQ ID No. 44 and SEQ ID No. 115 to SEQ ID No. 120.

Advantageously, the recombinant vectors containing a DNA insert coding for a new polyketide synthase type I according to the invention are vectors for cloning and expression. Preferably, a recombinant host cell as described above is a bacterium, a yeast or even a filamentous fungus.

The amino acid sequences of new polyketide synthases originating from organisms contained in a soil sample have been deduced from the nucleotide sequences SEQ ID No. 34 to SEQ ID No. 44 AND SEQ ID No. 115 to SEQ ID No. 120 below. above. These are polypeptides comprising one of the amino acid sequences SEQ ID No. 48 to SEQ ID No. 59 and SEQ ID No. 121 to 126.

The invention also relates to new polyketide synthases comprising an amino acid sequence chosen from the sequences SEQ ID No. 48 to SEQ ID No. 59 and SEQ ID No. 121 to SEQ ID No. 126.

Also part of the invention is the nucleotide sequence SEQ ID No 114 which comprises six open reading frames which respectively encode the polypeptides of sequences SEQ ID No 121 to SEQ ID No 126.

Also part of the invention is the nucleotide sequence SEQ ID No. 113 of the cosmid a26G1, which contains the sequence complementary to the sequence SEQ ID No. 114. Genomic DNA was also extracted and amplified according to the invention from pure bacterial strains, such as

Streptomyces coelicolor (ATCC N ° 101.478), Streptomyces ambofaciens

(NRRL N ° 2.420), Streptomyces lactamandurans (ATCC N ° 27.382), Streptomyces rimosus (ATCC N ° 109.610), Bacillus subtilis (ATCC

No. 6633) or Bacillus lichenifornis and Saccharopolyspora erythrea.

PCR amplification of the DNA of each of the bacterial strains described above was carried out using pairs of primers specific for polyketide synthase type I nucleic sequences.

New bacterial polyketide synthase type I genes were thus isolated and characterized. These are the nucleic sequences of sequences SEQ ID No. 30 to SEQ ID No. 32.

A subject of the invention is therefore also nucleotide sequences coding for new type I polyketide synthases chosen from polynucleotides comprising one of the nucleotide sequences SEQ ID No. 30 to SEQ ID No. 32.

Also part of the invention are recombinant vectors comprising the nucleotide sequences coding for new polyketide synthase type I defined above.

The invention also relates to recombinant host cells characterized in that they contain a nucleic acid coding for a new polyketide synthase type I comprising a nucleotide sequence chosen from the sequences SEQ ID No. 30 to SEQ ID No. 32 as well as Recombinant host cells comprising a recombinant vector as defined above.

The subject of the invention is also polypeptides encoded by sequences comprising the nucleic acids SEQ ID Nos. 30 to 32, and more precisely polypeptides comprising the amino acid sequences SEQ ID No. 47 to SEQ ID No. 50.

The subject of the invention is also a process for the production of a polyketide synthase type I according to the invention, said process for producing comprising the following steps: - Obtaining a recombinant host cell comprising a nucleic acid coding for a polyketide synthase type I comprising a nucleotide sequence chosen from the sequences SEQ ID No. 33 to SEQ ID No. 44, SEQ ID No. 30 to SEQ ID No. 32 and SEQ ID No. 115 to SEQ ID No. 120;

- culture of the recombinant host cells in an appropriate culture medium;

- recovery and, if necessary, purification of polyketide synthase type I from the culture supernatant or the cell lysate.

The new type I polyketide synthases obtained according to the method described above can be characterized by fixation on an immunoaffinity chromatography column on which antibodies recognizing these polyketide synthases have been immobilized beforehand.

The type I polyketide synthases according to the invention, and more particularly the recombinant polyketide synthases described above can also be purified by high performance liquid chromatography techniques (HPLC), such as for example reverse phase chromatography techniques. or anion or cation exchange chromatography, well known to those skilled in the art.

The polyketide synthases, recombinant or non-recombinant, according to the invention can be used for the preparation of antibodies.

According to another aspect, the invention therefore also relates to an antibody specifically recognizing a polyketide synthase type I according to the invention or a peptide fragment of such a polyketide synthase.

The antibodies according to the invention can be monoclonal or polyclonal. Monoclonal antibodies can be prepared from of hybridoma cells according to the technique described by KOHLER and MILSTEIN C. (1975), Nature, Vol. 256: 495.

The polyclonal antibodies can be prepared by immunization of a mammal, in particular mice, rats or rabbits with a polyketide synthase of type I according to the invention, if necessary in the presence of an adjuvant compound of immunity, such as Freund's complete adjuvant, Freund's incomplete adjuvant, aluminum hydroxide or a compound from the family of muramyl peptides. Also constituting "antibodies" within the meaning of the present invention, the antibody fragments such as the Fab, Fab ', F (ab') ₂ fragments, or even the single chain antibody fragments containing the variable part (ScFv) described by MARTINEAU et al. (1998) J. Mol. Biol., Vol. 28O (1): 117-127 or also in US patent 4,946,778, as well as the humanized antibodies described by REINMANN KA et al. (1997), AIDS Res. Hmm. Retroviruses, vol.13 (11): 933-943 or by LEGER OJ et al. (1997), Hum. Antibodies, vol.8 (1): 3-16.

The antibody preparations according to the invention are useful in particular in qualitative or quantitative immunological tests aimed either at simply detecting the presence of a polyketide synthase type I according to the invention, or at quantifying the amount of this polyketide synthase, for example in the culture supernatant or the cell lysate of a bacterial strain capable of producing such an enzyme. Another subject of the invention consists of a method for detecting a polyketide synthase type I according to the invention or a peptide fragment of this enzyme, in a sample, said method comprising the steps of:

a) bringing an antibody according to the invention into contact with the test sample;

b) detecting the antigen / antibody complex possibly formed. The invention also relates to a kit or kit for detecting a polyketide synthase type I according to the invention in a sample, comprising: a) an antibody according to the invention; b) where appropriate, reagents necessary for the detection of the antigen / antibody complex possibly formed.

An antibody directed against a polyketide synthase type I according to the invention can be labeled using a detectable isotopic or non-isotopic marker, according to methods well known to those skilled in the art.

The screening of a DNA library according to the invention using a pair of primers hybridizing with target sequences whose presence is sought, such as sequences of the puromycin biosynthesis pathway, sequences of the linA gene involved in the biodegradation of lindane or of the sequences coding for polyketide synthase type I have been detailed above.

The subject of the invention is therefore a method for detecting a nucleic acid of determined nucleotide sequence, or of nucleotide sequence structurally related to a determined nucleotide sequence, in a collection of recombinant host cells according to the invention, characterized in that it includes the following stages:

- contacting the collection of recombinant host cells with a pair of primers hybridizing with the determined nucleotide sequence or hybridizing with the nucleotide sequence structurally related to a determined nucleotide sequence;

- carry out at least three amplification cycles;

- detect possibly amplified nucleic acid.

For the appropriate amplification conditions as a function of the target sequences sought, the person skilled in the art may advantageously refer to the examples below.

According to another aspect, the invention also relates to a method for detecting a nucleic acid, of determined nucleotide sequences, or of nucleotide sequences structurally related to a determined nucleotide sequence, in a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- contacting the collection of recombinant host cells with a probe hybridizing with the determined nucleotide sequence or hybridizing with a nucleotide sequence structurally related to the determined nucleotide sequence;

- detect the hybrid possibly formed between the probe and the nucleic acids included in the vectors of the collection.

To screen a DNA library according to the invention with a view to detecting the presence of a nucleotide sequence coding for a polypeptide capable of degrading lindane, the recombinant clones of interest were detected by their phenotype corresponding to their ability to degrade lindane. For this purpose, the isolated clones and / or clone sets of the prepared DNA library were cultured in a culture medium in the presence of lindane and the degradation of lindane was observed by the formation of a halo disorder in the immediate environment of the cells.

The invention also relates to a method for identifying the production of a compound of interest by one or more recombinant host cells in a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- culture of the recombinant host cells of the collection in an appropriate culture medium; - detection of the compound of interest in the culture supernatant or in the cell lysate of one or more of the recombinant cells cultured.

The subject of the invention is also a method for selecting a recombinant host cell producing a compound of interest from a collection of recombinant host cells according to the invention, characterized in that it comprises the following steps:

- culture of the recombinant host cells of the collection in an appropriate culture medium; - detection of the compound of interest in the culture supernatant or in the cell lysate of one or more of the cultured recombinant host cells;

- selection of recombinant host cells producing the compound of interest.

The invention also relates to a process for the production of a compound of interest, characterized in that it comprises the following steps:

- cultivating a recombinant host cell selected according to the method described above;

- Recover and, if necessary, purify, the compound produced by said recombinant host cell.

The invention also relates to a compound of interest characterized in that it is obtained according to the method described above. A compound of interest according to the invention may consist of a polyketide produced by the expression of at least one nucleotide sequence comprising a sequence chosen from the sequences SEQ ID N ° 33 to 44, SEQ ID N ° 30 to 32 and SEQ ID N ° 1 15 to SEQ ID N ° 120. The invention also relates to a composition comprising a polyketide produced by the expression of at least one nucleotide sequence comprising a sequence chosen from the sequences SEQ ID No. 33 to SEQ ID No. 44, SEQ ID No. 30 to SEQ ID N ° 32, and SEQ ID N ° 115 to SEQ ID N ° 120. A polyketide produced by the expression of at least one nucleotide sequence above is preferably the product of the activity of several coding sequences included within a functional operon whose translation products are the different enzymes necessary for the synthesis of a polyketide, one of the above sequences being understood and expressed in said operon. Such an operon comprising a nucleic acid sequence according to the invention coding for a polyketide synthase can be constructed for example according to the teaching of Borchert et al. (1992).

The invention also relates to a pharmaceutical composition comprising a pharmacologically active amount of a polyketide according to the invention, where appropriate in combination with a pharmaceutically compatible vehicle.

Such pharmaceutical compositions will advantageously be suitable for the administration, for example parenterally, of an amount of a polyketide synthesized by a polyketide synthase of type I according to the invention ranging from 1 μg / kg per day to 10 mg / kg per day, preferably at least 0.01 mg / kg per day and most preferably between 0.01 and 1 mg / kg per day.

The pharmaceutical compositions according to the invention can be administered either orally, rectally, parenterally, intravenously, subcutaneously or even intradermally.

The invention also relates to the use of a polyketide obtained by the expression of a polyketide synthase type I according to the invention for the manufacture of a medicament, in particular of a medicament with antibiotic activity.

The invention will be further illustrated, without being limited, by the figures and examples below.

FIG. 1 illustrates the diagram of the different lysis steps carried out according to protocols 1, 2, 3n 4a, 4b, 5a, and 5b described in Example 1.

Figure 2 illustrates one. 0.8% agarose gel electrophoresis of DNA extracted from 300 mg of soil no. 3 (Côte St André) after various lysis treatments (protocols 1 to 5, see Fig. 1). M: lambda phage molecular weight marker

Figure 3 illustrates the proportion of different genera of actinomycetes cultivated following treatments 1 to 5 (see Fig. 1). The number of cfu (colony forming unit) was determined on a selective medium for this group of bacteria. A total number of approximately 400 colonies was analyzed.

Figure 4 illustrates the. recovery of lambda phage DNA digested with Hind \\\ added in soils at different concentrations before (G) or after (G ^* ) grinding. T treatments (thermal shock) and S (sonication) are additional lysis treatments. The quantification was carried out by phospho-imager analysis after dot-blot hybridization. A sample of each soil was used for each concentration of lambda phage added. The soil characteristics are reproduced in Table 1. The samples corresponding to 10 and 15 μg of added DNA were not treated.

Figure 5 illustrates the PCR amplification of DNAs extracted from soil No. 3 according to protocols 1, 2, 3, 5a and 5b. Primers FGPS 122 and FGPS 350 (Table 2) were used to target Streptosporangium spp. native. The DNA extracts were used undiluted or diluted 1/10 ^th and 1/100 ^th . M: 123 bp molecular weight marker (Gibco BRL), C: amplification control without DNA.

Figure 6 illustrates the quantities of DNA extracted after inoculation of spores (a) or mycelium (b) of S. lividans OS48.3 inoculated in soils at different concentrations. The amount of mycelium added to the soil corresponds to the number of spores inoculated into the germination medium. About 50% of the spores have germinated, the number of cells or genomes contained in the hyphae of the germinated spores has not been determined. The quantities of spores and mycelium inoculated are therefore not directly comparable. The extraction protocol was carried out according to protocol 6 (cf. equipment and methods section). The symbol (') indicates that RNA has been included in the extraction buffer. The target DNA was amplified by PCR with the primers FGPS 516 and FGPS 517, the quantification was carried out by phosphoimager after hybridization in dot blot using the probe FGPS 518. A sample of each sol was used for each concentration of hyphae or spores. The soil characteristics are described in Table 1.

FIG. 7 represents the phylogenetic tree obtained by the Neighbor Joining algorithm, positioning the 16S rDNA sequences contained in the soil DNA bank, with respect to cultured reference bacteria. In gray :. the sequences from the clone pools of the bank. The bootstrap values are indicated at the node level, after resampling 100 repetitions. The scale bar indicates the number of substitutions per site. The access number of the sequences in the Genbank database is indicated in brackets.

FIG. 8 represents a diagram of the vector pOSint 1.

FIG. 9 represents a diagram of the vector pWED1.

FIG. 10 represents a diagram of the vector pWE15 (ATCC No. 37503).

FIG. 11 represents a diagram of the vector pOS 700I.

FIG. 12 represents a diagram of the vector pOSV010.

FIG. 13 represents the fragment containing a "cos" site inserted into the plasmid pOSV010 during the construction of the vector pOSV 303.

FIG. 14 represents a diagram of the vector pOSV 303.

FIG. 15 represents a diagram of the vector pE116.

FIG. 16 represents a diagram of the vector pOS 700 R.

FIG. 17 represents a diagram of the vector pOSV 001.

FIG. 18 represents the diagram of the vector pOSV 002.

FIG. 19 represents a diagram of the vector pOSV 014.

FIG. 20 represents a diagram of the vector pBAC 11. FIG. 21 represents a diagram of the vector pOSV 403.

FIG. 22 represents the DNA electrophoresis gels of the library after digestion with the enzymes BamHI and Dral of the positive clones of the library screened with the oligonucleotides PKS-I.

FIG. 23 illustrates the production of puromycin by the recombinants of S. lividans compared to the production of the wild strain S. alboniger.

Figure 24 illustrates Alignment of soil PKSs with conserved active sites of other PKSs. The references for each peptide are indicated. The beta-ketoacyl synthase domains were aligned using the PILEUP program from GCG (Wisconsin Package Version 9.1, Genetics Computer Group, Madison, Wisc).

Figure 25 illustrates the construction of a conjugative integrative cosmid.

Figure 26 illustrates the construction of an integrative conjugative BAC.

FIG. 27 illustrates the construction diagram of the vector pOSV 308.

FIG. 28 illustrates the construction diagram of the vector POSV306.

FIG. 29 illustrates the construction diagram of the vector pOSV307.

FIG. 30 illustrates the construction diagram of the vector PMBD-1. FIG. 31 presents a detailed map of the plasmid pMBD-2 as well as a diagram of construction of the vector pMBD-3.

Figure 32 illustrates a detailed map of plasmid pMBD-4.

FIG. 33 illustrates the scheme of construction of the plasmid pMBD-5 from the plasmid pMBD-1.

Figure 34 illustrates the detailed map of the pBTP-3 vector.

Figure 35 illustrates the construction scheme of the vector pMBD-6 from the vector pMBD-1.

FIG. 36 illustrates the map of cosmid a26G1, the DNA insert of which contains open reading frames coding for several polyketide synthase.

FIG. 37 is a diagram representing the DNA insert (strand +) of the cosmid a26G1, on which the different reading frames coding for several polyketide synthase are positioned.

EXAMPLES:

EXAMPLE 1 Method for preparing a collection of nucleic acids from a soil sample containing organisms, comprising a step of direct extraction of DNA from the soil sample.

1. MATERIALS AND METHODS

1.1 SOILS: The characteristics of the six soils used in this study are listed in Table 1.

The content of clay and organic matter ranges respectively from 9 to 47% and from 1.7 to 4.7%, the pH varying from 4.3 to 5.8.

Soil samples were collected from the surface layer 5-10 cm deep. All visible roots have was removed and the soils were stored at 4 ° C for a few days if necessary, after which they were dried for 24 hours at room temperature and sieved (average mesh size 2 mm) before being kept for several months at 4 ° C.

1.2 BACTERIAL STRAINS AND CULTURE CONDITIONS:

The extracellular DNA as well as the bacterial strains providing vegetative cells, spores or hyphae, used to innoculate the soil samples, were chosen so that their presence can be specifically monitored.

In order to obtain large quantities of extracellular DNA, the lysogenic strain of E.coli 1192 Hfr P4X (metB), containing the lambda phage CI857 Sam7, was cultured on Luria-Bertani medium (LB) for two hours at 30 ° C, then 30 minutes at 40 ° C, then 3 hours at 37 ° C. The lambda phage DNA was extracted according to the technique described by SAMBROOK J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd, ed. Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y.

The avirulent strain of Bacillus anthracis (STERNE 7700) was used as an inoculum of bacterial cells. Bacillus anthracis was multiplied on a culture broth of the "trypticase soy broth" (TSB) type (Biomérieux, Lyon, France) for approximately 6 hours, checking that the DOβoo was kept below 0.6. These conditions allow the development of vegetative cells without spore formation (Patra et al., (1996), FEMS Immunol. Médical Microbiology, vol.15: 223-231.). The spores of Streptomyces lividans OS48.3 (CLERC-BARDIN et al. Unpublished) were mechanically eliminated from the cultures of the organism on an R2YE medium (HOPWOOD et al., (1985), Genetic Manipulation of Streptomyces-A Laboratory Manual The John Innés Foundation, Norwich. United Kingdom). The hyphae of S. lividans OS48.3 were obtained from pre-germinating spores, as the use of short hyphae was expected to minimize breakage and subsequent loss of DNA. The spores were suspended in TES buffer (N-Tris [hydroxymethyl] methyl-2-aminoethanesulfonic acid; Sigma-Aldrich Chimie, France) (0.05M; pH 8) (Holben WE et al., (1988), APPL. Approx. Microbiol. Vol. 54: 703-711, then were subjected to a thermal shock (50 ° C. for 10 minutes followed by cooling under a stream of cold water and then added to an equal volume of pre-germination medium (1% yeast extract, 1% CaCI casamino acids ₂ 0.01 M). The solution was incubated at 37 ° C. on a shaker. The proportion of germinated spores was estimated at approximately 50%, in agreement with the results of HOPWOOD et al. (1985). the pellets were resuspended in TES buffer, added to 3% of TSB medium, and incubated at 37 ° C. until an OD ₄₅ o of 0.15 is obtained (HOPWOOD et al., (1985)) Streptomyces hygroscopicus SWN 736 and

Streptosporangium fragile AC1296 (Institute Pushino, Moscow) were cultivated according to techniques described by HICKEY and TRESNER (1952).

The DNA of the spores and hyphae of S. Lividans was extracted from the pure cultures according to the lysis protocol 6 described below (except that no grinding was carried out), while the spores of S. hygroscopicus and S. fragile were extracted by chemical / enzymatic lysis (Hintermann et al., 1981).

1.3 CHOICE OF THE EXTRACTION BUFFER: A TENP buffer (50 mM Tris, 20 mM EDTA, 100 mM NaCl, 1% w / v of polyvinylpolypyrrolidone developed by PICARD (1992) was used. Similar buffers were later used by d '' other authors (CLEGG et al., 1997; KUSKE et al., 1998; ZHOU et al., 1996).

Tris and EDTA protect DNA from nuclease activity, NaCI provides a dispersing effect and PVPP absorbs humic acids and other phenolic compounds (HOLBEN et al. (1988); PICARD et al., (1992 ).

In this study, the extraction efficiency of this buffer was evaluated at different pH (6.0 - 10.0) using 20 different soils with a pH range of 5.8 to 8.3 and a content of organic matter between 0.2 and 6.3%. These twenty soils (the other characteristics are not indicated) were used only in this experiment. The amount of DNA was determined colorimetrically as described by RICHARD (1974), and detailed below. 1.4 IN SITU LYSE AND DNA EXTRACTION PROTOCOL:

Several protocols using an increasing number of steps have been tested in order to evaluate the effectiveness of different techniques for lysing soil microbes in situ. For these experiments, the native soil microflora was targeted in six soils. Additional experiments were carried out in order to study the effects of lysis treatments on the released DNA, by analyzing the quantities and the quality of DNA recovered from a phage lambda DNA previously added to the soils.

Once an optimized protocol (designated protocol 6) was developed, this protocol was used to quantify DNA from native Actinomycetes and DNA from Gram-positive bacteria inoculated in selected soils. In all cases, the soil samples were dried and sieved as described above. After grinding, 0.5 ml of TENP buffer was added to 200 mg dry weight of soil (except for protocol 1 in which the buffer was added to unground ground).

For the various lysis treatments (see below), the soil suspensions were Vortexed for ten minutes and centrifuged (4000 g for five minutes), after which an aliquot fraction (25 μl) of the supernatant was analyzed by gel electrophoresis (0.8% agarose).

Another aliquot of the supernatant representing a known volume, generally 350 μl, was precipitated with isopropanol.

Five aliquots (representing DNA derived from 1 g of soil) were combined and resuspended in 100 μl of sterile TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) before purification (protocol D, see below) and quantification, either by hybridization (Dot Blot) of the total DNA, or by hybridization (Dot Blot) of the PCR amplification products (see below).

The hybridization signals were quantified by phosphorescence imaging ("phospho-imaging" technique see below). 1.5 EVALUATION OF IN SITU CELL LYSIS METHODS:

The quality and quantity of the DNA extracted after an increasing number of lysis treatment steps (protocol 2-5b) were compared with those of the extracellular DNA obtained after washing the soil with an extraction buffer (protocol 1; see also figure 1).

Protocol 1: No lysis treatment.

TENP buffer was added to unground ground, a DNA extraction step was performed as described above.

Protocol 2. Ground grinding followed by DNA extraction.

Two different types of devices have been used for grinding the soil.

In order to compare their respective efficacy, 5 g of dry soil were ground for 30 seconds in a grinder containing tungsten rings, or for various times up to 60 minutes in a soil grinder containing a mortar and agate beads ( 20 mm in diameter).

The TENP buffer is then added and the DNA is extracted as described above.

The results of gel electrophoresis showed that 40 minutes of grinding using agate beads were necessary in order to obtain amounts of extracted DNA equivalent to those obtained after 30 seconds of grinding using tungsten rings.

The size distribution of the DNA fragments is similar regardless of the method used.

Thus, these treatments have been considered equivalent and that which will be used in the protocols described below will therefore not be specified.

In protocols 3 to 5, the effectiveness of several other treatments of lysis subsequent to the grinding of the soil was tested, either separately or in different combinations. Protocol 3:

This protocol is identical to protocol 2, except that it includes a homogenization step using an Ultraturrax type mixer (Janker and Kunkel, IKA Labortechnik, Germany) set at half the maximum speed for 5 minutes .

PROTOCOLS 4a and 4b:

These protocols are identical to protocol 3 except for an additional sonication step.

Two types of sonicator were compared: a titanium microtip sonicator (600W Vibracell Ultrason icator, Bioblock, lllkirch, France) (Protocol 4a) and a Cup Horn type sonicator (protocol 4b).

The Vibracell microtip producing ultrasound is in direct contact with the soil solution.

In the case of the Cup Horn type device, the soil solution is stored in tubes which are placed in a water bath through which the ultrasound passes.

Preliminary experiments were carried out to determine the optimal conditions for the two sonicators (results not shown).

The best compromise, in terms of quantity of DNA extracted and size of fragments, consists of sonication with the titanium microtip and the Cup Horn type sonicator respectively for 7 and 10 minutes, by setting the power to 15 W and with active cycles at 50%.

Protocols 5a and 5b:

After sonication with a titanium microtip or a Cup Horn device (protocols 4a and 4b respectively), lysozyme and achromopeptidase were added, each of the enzymes at a final concentration of 0.3 mg / ml. The soil suspensions were incubated for 30 minutes at 37 ° C, after which lauryl sulfate at a final concentration of 1% was added, then suspensions were incubated for 1 hour at 60 ° C before centrifugation and precipitation as described above. In addition to the protocols described above, the effect of sonication

(Cup Horn, see protocol 4b) and thermal shock (30 seconds in liquid nitrogen followed by three minutes in boiling water, the treatments being repeated three times) on the lambda phage DNA digested with Hindlll previously added to soil have been examined (see below). Thermal shocks have been suggested in the prior art as means of in situ cell lysis (PICARD et al. (1992)). However, since such treatment has a detrimental effect on free DNA (see results section) it was not included in the protocols described above.

OPTIMIZED PROTOCOL

After evaluation of the different lysis treatments, an optimized protocol has been defined, designated protocol 6. Protocol 6 is identical to protocol 5b except that, before sonication, the soil suspensions are subjected to a Vortex treatment and then agitated by rotation on a wheel for two hours before being frozen at - 20 ° C.

After thawing, the soil suspensions are passed through the Vortex for 10 minutes before sonication. Protocol 6 was used in the experiments in which the soils were seeded with bacterial cells as well as in the experiments in which the native actinomycetes were quantified (see below).

1.6 MICROSCOPE COUNTING: The efficiency of soil crushing as a method for lysing bacterial cells was examined under a microscope.

5 g of dried raw soil were mixed in a Waring Blender type device with 50 ml of ultrapure sterilized water for 1.5 minutes; simultaneously, 1 g (dry weight) of ground ground (protocol n ° 2) a was suspended in 10 ml by shaking for 10 minutes. The soil suspensions were diluted in series and acridine orange was added to a final concentration of 0.001%.

After 2 minutes, the suspensions were filtered through a 0.2 μm black NUCLEOPORE brand membrane. Each filter was rinsed with sterile lysed water, treated with 1 ml of isopropanol for 1 minute to fix the bacterial cells, then rinsed again.

The bacterial cells were counted using an epifluorescence microscope of the Zeiss Universal type with a 100x objective. For each soil type, three filters were counted, and at least 200 cells were counted on each of the filters.

1.7 NUMBER OF CULTIVABLE ACTINOMYCETS AND TOTAL NUMBER OF COLONY FORMING UNITS (CFU): Actinomycetes which survived the lysis treatments (protocols 1-5) were examined specifically with soil No. 3 (Côte Saint André, see Table 1) .

After a 10-fold dilution of a solution of yeast extract (6% weight / volume) and SDS (0.05%) in order to induce germination

(Hayakawa et al. (1988)), the soil suspensions were diluted in series in sterile water, incubated at 40 ° C for 20 minutes and seeded on HV medium (HAYAKAWA et al., 1987).

Actidione (50 mg / l) and nystatin (50 mg / ml) were added to the HV medium.

Actinomycete colonies were counted after incubation for 15 days at 28 ° C.

In total, about 400 colonies were examined.

Identification was carried out on the basis of macro- and microscopic morphological characteristics as well as on the analysis of the diaminopimelic acid content of the isolates (SHIRLING et al., 1966);

STANECK et al., 1974; WILLIAMS et al., 1993).

The total quantity of cultivable bacteria (total CFU) was also determined for each of the lysis protocols 1 to 5. The soil suspensions were diluted in series and seeded in triplicate on Bennett agar medium (WAKSMAN et al., 1961) supplemented with nystatin and actidione (each at 50 mg / l).

Each Petri dish was covered with a cellulose nitrate filter (Millipore) and incubated for three days at 28 ° C. After the colony count on the membranes, the filters were removed and the petri dishes were again incubated for 7 days at 28 ° C and then counted again.

1.8 RECOVERY OF LAMBDA PHAGE DNA ADDED TO THE SOILS: The lambda phage DNA was digested with Hindlll, extracted with a phenol-chloroform mixture, precipitated and then resuspended in sterile ultrapure water according to standard protocols (SAMBROOK et al., 1989).

Dilutions corresponding respectively to 0, 2.5, 5, 7.5, 10 and 15 μg of DNA / g of dry weight of soil were prepared in volumes of 60 μl. These DNA dilutions were added to batches of 5g of dry soil which were subsequently vigorously mixed by vortexing for 5 minutes before grinding.

Phage lambda DNA was also added to a soil before grinding at concentrations corresponding to 0, 10 and 15 μg of DNA / g of dry weight of the soil.

After grinding, the extraction buffer is added and the DNA is extracted according to protocol 2 (see above).

1.9 SATURATION OF ADSORPTION SITES WITH RNA: In order to determine whether the saturation of the nucleic acid adsorption sites of soil colloids could increase the recovery rate of DNA, sandy soil (soil no. 4) and the clay soil (soil No. 5) were incubated with an RNA solution before any other treatment. Commercial RNA from Saccharomyces cerevisiae

(BOHRINGER MANNHEIM, MEYLAN, France) was diluted in phosphate buffer (pH 7.1) and added to the samples of dry and sieved soil (2 ml / g of soil) at final concentrations of 20, 50 and 100 mg of 'RNA / g dry weight of soil. The tubes containing the soil suspensions were rotated for two hours at room temperature. After centrifugation, the soil pellets were dried in the oven (50 ° C) overnight. The phage lambda DNA was then added to the soils (0, 20 or 50 μg / g of dry weight of the soil) in order to simulate the fate of the DNA released after cell lysis.

The DNA was extracted according to protocol No. 2. It was subsequently determined that an identical effect of the addition of RNA on DNA recovery could be achieved by adding the RNA directly to the extraction buffer.

This simplified procedure was used for clay soil # 5 in experiments in which microorganisms were inoculated into the soil.

The RNA was then added at a concentration corresponding to 50 mg of RNA / g of dry weight of the soil.

1.10 QUALITATIVE AND QUANTITATIVE DETERMINATION OF THE EFFICACY OF THE EXTRACTION PROTOCOLS: The quality of the DNA (absence of degradation) was estimated on the basis of the size of the DNA fragments or of the relative position of the migration bands. DNA after electrophoresis of an aliquot of a DNA solution on a 0.8% agarose gel.

The intensity of fluorescence allowed a semi-quantitative estimate of the extraction yields. Another aliquot fraction was used for quantitative determinations of the DNA content by hybridization (Dot Blot) and analysis with phospho-lmager. The stain hybridization protocol has been described by SIMONET et al. (1990).

The hybridization membranes (GeneScreen plus, Life Science Products, Boston, United States of America) were prehybridized for at least 2 hours in 20 ml of a solution containing 6 ml of 20 x SSC, 1 ml of solution of DENHARDT's, 1 ml of 10% SDS and 5 mg of salmon sperm DNA.

Hybridization was carried out overnight in the same solution in the presence of a probe labeled beforehand with two membrane washes in 2 x SSC buffer for 5 minutes at room temperature, then a third wash in 2 x SSC buffer, 0.1% SDS and a fourth wash in 1 x SSC buffer, 0.1% SDS for 30 minutes at hybridization temperature. The hybridization signals were quantified with a BIORAD radioanalytical imaging system (Molecular Analyst Software, BIORAD, Ivry S / Seine, France).

In order to quantify the total amount of DNA derived from the native microflora, the different soils were extracted according to protocols 1 to 5. The non-amplified DNA was applied to the membranes of Dot Blot and hybridized using the probe universal

FGPS431 (Table 2).

This probe, which hybridizes at positions 1392-1406 of the 16.c rDNA gene of E. coli (Amann et al. (1995)) was labeled at its ends with ATPα ³² P using a T4 polynucleotide kinase (BOEHRINGER MANNHEIM , Melan, France).

A calibration curve was prepared from the DNA of E.coli DH5α. The conversion of stones to bacteria in the soil required simplification, assuming that the average number of copies (rm) is 7, as for E.coli.

HindIII digested lambda phage DNA was used to quantify the recovery of extracellular DNA. Unamplified extracts from soils, to which lambda phage DNA had been added, were hybridized with HindIII digested lambda phage DNA randomly labeled using the Klenow fragment (Boehringer Mannheim, Melan, France ).

The amounts of DNA were calculated by interpolation from a calibration curve prepared with the purified DNA.

The total quantity of DNA extracted from soils 1, 2, 3, 4 and 6 according to protocol No. 2 (grinding) was also quantified in colorimetric manner according to the technique described by RICHARD (1974).

Briefly, DNA was mixed with concentrated HCIO ₄

(the final concentration of HCIO was 1.5 N). 2.5 volumes of this solution were mixed with 1.5 volumes of DPA (diphenylamine, Sigma-Aldrich, France) and the mixture was incubated at temperature. ambient for 18 hours, prior to determining the OD at 600 nn. The DNA extracts from the soil were quantified relative to a standard curve produced by the DNA extracted from E.coli DH5α according to standard protocols (SAMBROOK et al., (1989)).

1.11 DEVELOPMENT OF A DNA QUANTIFICATION TECHNIQUE USING PCR AMPLIFICATION AND HYBRIDIZATION:

For PCR amplifications, Taq DNA polymerase (Appligene Oncor, France) was used according to the manufacturer's instructions. The PCR program used for all the amplifications is as follows: initial denaturation for 3 minutes at 95 ° C, then 35 cycles consisting of 1 minute at 95 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C, followed by a final extension at 72 ° C for 3 minutes.

The DNA isolated and purified from fragile Streptosporangium was used as a control at concentrations ranging from 100 fg to 100 ng.

In order to specifically amplify the DNA of this bacterial genus, the primers FGPS122 and FGPS350 (Table 2) were chosen, complementary to part of the 16S rDNA, after alignment of the 16S rDNA sequences of actynomycetes. Their specificity has been tested on a collection of strains of actynomycetes (Streptomyces, Streptosporangium and other closely related genera).

The PCR products were hybridized with the oligonucleotide probe FGPS643 (Table 2). In order to simulate the level of purity routinely obtained with DNA extracted from the soil, controls of pure DNA from S. fragile were mixed with the soil extracts obtained after treatments according to the lysis protocols 4b and 5b then purified according to protocol D.

Before use, the soil extracts were treated with DNase (one unit of DNase / ml, GIBCO BRL) for 30 minutes at room temperature. DNase was then inactivated by heating at 65 ° C for 10 minutes. Inactivation verification was performed by PCR. The humic acid concentrations were measured by spectrophotometry (DO ₂ sonm) against a standard curve of commercial humic acids (Sigma). Undiluted, 10x diluted and 10x diluted Dnase sol solutions were mixed from 100. fg to 100ng of S. fragile DNA before PCR amplification. In another series of experiments, increasing concentrations of Streptomyces hygroscopicus DNA from (100 pg to 1 μg) were added to the DNA of S. fragile in order to simulate the presence of non-target DNA and its influence on the PCR process.

1.12 PURIFICATION OF CRUDE DNA EXTRACTS: Four methods of DNA purification were compared. The DNA was extracted from 1 g (dry weight of soil according to protocol 4a and resuspended in 100 μl of TE8 buffer (50 mM Tris, 20 mM (EDTA, pH 8.0).

Protocol A

Elution through two successive Elutip d columns (SCHLEICHER and SCHUELL, Dassel, Germany) (PICARD et al., (1992)).

Protocol B:

Elution through a SEPHACRYL S200 column (Pharmacia Biotech, Uppsala, Sweden) followed by elution through an Elutip d column (NESME et al. (1995)).

Protocol C:

Separation using a two-phase aqueous system with 17.9% (weight / weight) of PEG 8000 (Merck, Darmstadt, Germany) and 14.3% (weight / weight) of (NH ₄ ) ₂ SO ₄ (ZASLAVSKY, (1995)).

After vigorous mixing with a vortex, the two phases were left at room temperature for their separation.

1 ml of each of the phases was transferred to another tube, mixed with 100 μl of the sample and left at 4 ° C overnight to allow separation. The lower phase was dialyzed for one hour through a Millipore membrane in the presence of an excess of a 7.5 TE buffer (10 mM Tris, 1 mM EDTA at pH 7.5 and 1 M Mg Cl ₂ ) in order to d '' remove excess salts.

Protocol D:

Elution through a column of the Microspin Sephacryl S400 HR type (Pharmacia Biotech, Uppsala, Sweden), followed by elution through a column of the Elutip d type.

Each protocol is terminated by an ethanol precipitation step, and the DNA is resuspended in 10 μl of TE 7.5 buffer. The efficiency of the purification protocols was verified by PCR amplification of undiluted aliquots of the DNA solutions and of aliquots diluted 10 and x 100 times, using standard protocols (see below).

1.13 RECOVERY OF DNA FROM INNOCULATED MICROORGANISMS: The cells, spores and hyphae were washed twice and counted by counting on a plate or direct microscopic counting. Batches of 5 g of dry, sieved soil (soils 2, 3 and 5) were inoculated with 100 μl of a suspension of spores and hyphae of S. lividans at concentrations corresponding to 0.10 ³ , 10 ⁵ , 10 ⁷ and 10 ⁹ spores / g dry weight of soil, or with vegetative cells of B. anthracis at concentrations corresponding to 0.10 ⁷ and 10 ⁹ cells per gram of dry weight of soil.

The quantities of hyphae of S. lividans were calculated on the basis of the number of spores from which they originate. After adding the bacterial suspensions, the soil samples are mixed vigorously by vortexing for 5 minutes before grinding. The DNA is extracted according to protocol No. 6 (see below).

PCR amplification followed by spot hybridization (Dot Blot) and phosphorescence imaging (phospho-imaging) was used to quantify the amounts of DNA recovered from cells, spores and bacterial mycelium inoculated in the soil.

DNA extraction was carried out according to lysis protocol No. 6. PCR amplification and hybridization were performed as described above. The primers and probes are targeted to chromosomal regions located outside the 16S region, and are highly specific for the respective organisms, so as to avoid background signals.

For soils seeded with β. anthracis, primers R499 and R500 were used (Patra et al. (1996)) and the amplification products were hybridized with the oligonucleotide probe C501 (Table 2).

For the soils seeded with S. lividans, the PCR reactions were carried out using the primers FGPS516 and FGPS517, and the amplification products were hybridized with the oligonucleotide probe FGPS518 (Table 2).

The amplified region is a part of the cassette specifically constructed to obtain the strain OS48.3 (CLERC-BARDIN et al., Unpublished). The calibration accounts were in all cases obtained using the purified DNA of the target organism.

2. RESULTS

2.1 CHOICE OF THE EXTRACTION PAD:

20 different soils were used to determine the optimal pH of the DNA extraction buffer. For all soils, the DNA yield increases with the increasing pH of the buffer. The yield for each pH (+/- sd), calculated as the percentage of the highest value for each of the soils, is as follows: pH 6.0: 31 +/- 13; pH 7.0: 43 +/- 16; pH 8.0: 60 +/- 14; pH 9.0: 82 +/- 12; pH 10.0: 98 +/- 3.

For 16 of the 20 soils, the highest yield was obtained at pH 10.0, while for the other four soils the highest yield was was obtained at pH 9.0. However, at pH 10.0, larger amounts of humic material were released, compared to pH 9.0 (results not shown). Consequently, pH 9.0 was chosen for all of the experiments presented below.

2.2 EFFECTIVENESS OF DNA EXTRACTION PROTOCOLS:

Total DNA from native soil organisms was extracted and quantified to assess the effectiveness of many in situ cell lysis protocols. Soil samples 1-6 (Table 1) were treated according to protocols 1 to 5 described in the Materials and Methods section (figure

D-

After DNA extraction, the soil suspensions were precipitated with isopropanol, and aliquots of the resuspended pellets were analyzed by gel electrophoresis, in a first step, in order to estimate the quality and the amount of DNA released.

However, the color of the DNA extract became more and more dark as the number of lysis steps increased, due to the co-extraction of compounds, such as humic acids, with the DNA.

Some of these crude dark extracts do not migrate as expected in agarose gels.

Consequently, the raw DNA solutions were purified (protocol B) before quantification. The gel electrophoresis of the purified solutions obtained after the various lysis treatments are exemplified on soil No. 3 (Figure 2).

A visual comparison of the intensities of the colored DNA with ultraviolet radiation allowed a semi-quantitative estimate of the effectiveness of the treatments. In addition, the presence of migration profiles of multiple sizes of DNA fragments (discrete bands) and the disappearance of long fragments indicates that DNA degradation has taken place.

No DNA could be extracted from No. 5 clay soil. A more precise quantification of the DNA of all the soils, extracted according to protocols n ° 1 to 5, was carried out by spot hybridization (Dot

Blot) without prior PCR amplification step and using an oligonucleotide probe complementary to a highly conserved sequence of the 16S rDNA region (FGPS probe 431, table 2).

DNA was detected in the extracts of all the soils after each of the different lysis stages, with the exception of clay soil No. 5.

The results agree with the estimates made after gel electrophoresis. In order to compare with an independent method for quantification, the DNA extracted according to protocol No. 2 (all soils except soil No. 5) was also quantified using a colorimetric method of DNA detection (RICHARD, 1974).

We found a good correlation (r = 0.88) between DNA quantified using this colorimetric technique and the results obtained by Dot Blot / radio-imaging hybridization, confirming the hypothesis that the average copy number of soil bacteria (rrn) is 7.

Hybridization (Dot Blot) showed that the quantities of extracellular DNA, as determined by extraction without lysis treatment (protocol No. 1), ranged from 4 μg / g for the acidic soil (No. 6) to 36 μg / g for soil n ° 3 (table 3).

Ground grinding (protocol 2) increased the amounts of DNA extracted from all soils (e.g. 26 μg / g soil) for soil 6 and 59 μg / g soil ( for floor 3) (table 3; figure 2).

For the two grinding treatments (see the Materials and Methods section), discrete DNA migration was detected on the agarose gels, indicating that the DNA molecules were partially degraded (Figure 2). The size of the DNA fragments is between 20 and 0.2 kb.

The band intensity of the smallest fragments is very low, indicating that most of the fragments are much larger than 1 kb.

Protocol No. 3 includes a homogenization step in an Ultraturax-type mixer device after the addition of the buffer extraction to soil samples. This step leads to an increase in the quantities of DNA extracted, as determined by dot blot hybridization for two of the soils (sandy soil No. 3 and acidic soil No. 6), while the two soils rich in organic matter (soil no. 1 and no. 2) led to the production of lower amounts of DNA.

Protocols No. 4a and No. 4b made it possible to assess the influence of two types of sonication on DNA yields from previously ground and homogenized soils. Sonication did not have a positive effect on

DNA, compared to protocol # 3, except for soil # 6. However, the lysis efficiency of the two types of sonicator differ. For soils 2, 3 and 4, the largest quantities of extracted DNA were obtained using the titanium microtip (Table 3; Figure 2), while for soils 1 and 6, DNA yield was higher using the Cup Horn device.

Conflicting results were also obtained when an enzymatic / chemical lysis step was added (protocols 5a and 5b) after the sonication step: in some cases, the quantities of DNA extracted were greater than those recovered according to protocols 4a and 4b, while in other cases the yields were lower (Table 3).

2.3 DIRECT COUNTING OF MICRO-ORGANISMS:

Microscopic counts of the total number of bacterial cells after staining with acridine orange were performed for all soils, before and after grinding.

Before grinding, the number of bacteria per gram of dry weight of the soil ranged from 1.4 x 10 ⁹ (+/- 0.4) in tropical soil No. 5 to 10 x 10 ⁹

(+/- 0.7) in the soil from Côte Saint-André (soil no.3) (table

D-

After grinding, the cell numbers were respectively 45, 74, 75, 54, 34 and 75% of the initial values for soils 1 to 6. 2.4 NUMBER OF CULTURAL ACTINOMYCETS BELONGING TO DIFFERENT KINDS:

A modification in the populations of actinomycetes in soil No. 3 was noted after the various lysis treatments (FIG. 3).

For example, colonies of Streptomyces sp. dominated the viable actinomycete flora when no lysis treatment was applied (protocol 1), and represented 65% of the total number of colonies identified. After grinding, the percentage of colonies of Streptomyces decreased to 51%, while the proportion of colonies belonging to the genus Micromonospora increased from 14% to 41%.

Chemical / enzymatic lysis (protocols 5a and 5b) appeared to be particularly effective for the lysis of streptomycetes. When all the lysis treatments were applied, including chemical / enzymatic lysis (protocols 5a and 5b), the microflora of actinomycetes, which still included more than 10 ⁶ CFU / g of soil, was dominated by the species belonging to the genus Micromonospora, when none or very few colonies of Streptomyces have been recovered.

Organisms belonging to the genera such as Streptosporangium, Actinomadura, Microbispora, Dactilosporangium and Actinoplanes appeared on the plates in small numbers (2-8% of the total number of colonies identified) after grinding, homogenization with the Ultraturrax device, and were sonicated, but were generally absent when these treatments were combined with chemical / enzymatic lysis.

The total number of cultivable bacteria remaining after each lysis treatment (protocols 2 to 5) was also sought for soil No. 4. The results indicate that the number of cultivable bacteria does not decrease with the intensity of the lysis treatments (approximately 2 × 10 ⁶ CFU / g of soil in all cases, and also when a treatment is applied, as according to Protocol 1).

Obtaining these low CFU values is probably due to the fact that dry soil was used and that only bacteria more resistant have multiplied on the plates. The number of actinomycetes forming colonies was generally greater than that of total CFUs (all bacteria) due to the fact that a spore germination step, included in the actynomycete detection protocol, was missing when monitoring total bacteria.

2.5 RECOVERY OF ADDED LAMBDA PHAGE DNA:

The aim of these experiments was to estimate how successive lysis treatments could affect the recovery of naked DNA, and whether these successive lysis treatments contributed to its degradation.

DNA could either be a fraction of extracellular DNA released from already dead organisms, which can persist in the soil for months (WARD et al., 1990), or DNA released from organisms easily lysed during the first stages of treatment. In order to simulate this situation, lambda phage DNA digested with HindIII was added, in various concentrations, to the soils before and after grinding. In addition to grinding, a combination of other lysis treatments has been tested, including sonication (Cup device

Horn, see protocol n ° 4b) and thermal shocks (see section

Material and methods).

After extraction, aliquots which theoretically should contain 25 to 150 ng of lambda phage DNA were analyzed by gel electrophoresis. No DNA fragment specific to lambda phage could be observed when the DNA was inoculated in the soil samples prior to grinding, regardless of the dose or type of soil.

When the DNA was added after grinding, and extracted without additional lysis treatment step, the specific DNA profiles of phage lambda were detected in the extracts of four of the five soles tested.

In all of these cases, a direct cause and effect relationship was obtained between the amount of DNA added and the intensity of the signals on the agarose gels. The signal intensities were, however, lower than expected signal intensities when compared to molecular standards.

In addition, the 23 kb band was absent in several cases, indicating that the long fragments were preferentially adsorbed to soil particles, or were more sensitive to degradation, compared to the short fragments.

No band was detected in the samples of tropical soil No. 5 which is characterized by a very high clay content (Table 1). For a more precise quantification, the DNA recovery was determined on a phosphorescence imaging device (phospho-imager) after hybridization in a spot (Dot Blot). According to this technique, DNA was detected in all the samples, including those which had been inoculated before grinding, with the exception of soil No. 5 in which no DNA could be detected.

In all other soils, the quantity of DNA extracted increases with the increase in size of the inoculum (Figures 4a-d).

However, recoveries of lambda phage DNA were poor. When grinding was the only lysis treatment applied, the recoveries were between 0.6 and 5.9% of the DNA added when the latter was added before grinding, and from 3.6 to 24% of the DNA added when the latter was added after grinding. The highest recovery levels were obtained from soil # 2.

Gel electrophoresis of aliquots of heat-treated and sonicated samples failed to observe DNA bands in any of the samples, including the test in which DNA was added after grinding. Dot blot hybridization experiments confirmed these results.

The hybridization signals obtained from soil suspensions which were treated by thermal shock and sonication were, at most, weak.

The sample with the highest amount of DNA (15 μg DNA / g dry weight of soil) was the only one for which the signal obtained was significantly different from the level of background noise. No difference, (or small differences) was observed between the samples treated by thermal shock and those treated by thermal shock and sonication, indicating that thermal shock has a detrimental effect on DNA. The best recoveries were observed for soil # 2, which has the highest organic matter content (Table 1), while no DNA was recovered from clay soil # 5.

Additional experiments were carried out with unmilled samples of soil no. 4 and no. 5, which were seeded with 20 and 50 μg of lambda phage DNA per gram of soil.

The samples were extracted immediately or after a one hour incubation period at 28 ° C, then the DNA extracts were purified and analyzed by gel electrophoresis.

The incubation of soil No. 4 for one hour after inoculation did not lead to qualitatively or quantitatively different profiles from those obtained without incubation or from those observed previously when the DNA had been added after grinding.

These results indicate that the enzymatic degradation by nucleases in the soil is not implicated in the low rate of DNA recovery. In addition, the absence of a grinding step does not allow an increase in the recovery of DNA from soil No. 5, indicating that the changes in soil structure due to grinding do not significantly increase adsorption. nucleic acids on colloids.

2.6 SATURATION OF ADSORPTION SITES WITH RNA:

Most of the profiles obtained on agarose gels do not differ significantly from previous profiles in which RNA processing was not carried out.

For example, no band was detected from clay-rich soil # 5, regardless of the RNA concentrations and the lambda phage DNA concentrations used. In addition, specific bands of phage lambda DNA digested with HindIII remained undetectable in the sandy soil treated with RNA (soil No. 4) when the RNA is added before grinding.

The intensity of the bands obtained from samples seeded with DNA after grinding increases with the concentration of RNA, indicating that the treatment could have a positive effect.

However, the results after hybridization and analysis by phosphorescence imaging did not confirm the results of the electrophoresis. For example, the positive effect of RNA processing on the recovery of DNA from clay soil, when the DNA has been added after grinding, is not clear.

• t

On the other hand, a positive effect of RNA was found for the clay-rich soil (No. 5) when the DNA was added after grinding.

Although the hybridization signals for the control samples did not differ from the background noise levels, significant amounts of DNA were released from the RNA-treated samples, and the signals increased with the amount of DNA added as well as with RNA concentration.

However, even for the highest concentration of RNA (100 mg / g dry weight of soil) the recovery rate never exceeded 3%.

2.7 PURIFICATION OF RAW DNA EXTRACTS:

Of the four protocols tested, the best amplification of the undiluted DNA extracts (1 μl of extract in 50 μl of PCR mixture) was observed after elution through columns of Microspin S400 type followed by elution through an Elutip d type column, as shown by gel electrophoresis of the PCR products. DNA purified by the double phase aqueous system (protocol

C) gave lower amounts of PCR products after amplification from undiluted DNA extract.

No amplification product could be obtained from the undiluted extracts after amplification following the implementation of protocols A or B. Consequently, protocol B (see section Materials and Methods) was used for all the experiments in which PCR amplifications and / or hybridizations on task (Dot Blot) were carried out.

2.8 QUANTIFICATION BY PCR AND HYBRIDIZATION:

The first step was to determine whether the quantities of PCR product were proportional to the number of target DNA molecules initially present in the reaction tube. Streptosporangium fragile DNA was used as target (see Materials and Methods section).

The primers used were the primers FGPS122 and FGPS350 (Table 2). The gel electrophoresis of the PCR products showed that the band intensity increases with the increase in the concentration of the targets. The PCR products were hybridized with the oligonucleotide probe FGPS643 (table 2), and the signals were quantified by phosphorescence imaging (phospho-imaging).

We found a good correlation (i ^ ≈ 0.98) between the logfnumber of targets] and the log [intensity of the hybridization signal]. It was then investigated whether the efficiency of PCR amplification was affected by humic acids and non-target DNA. When analyzed by gel electrophoresis, the increased intensity of the bands of the PCR products, corresponding to the different quantities of target DNA, was preserved when the amplification was carried out with DNA solutions to which extracts had been added. soil treated with DNase, containing wet acids at concentrations up to 8ng in the PCR mixture with a volume of 50 μl.

With 20 ng of humic acid in the PCR mixture, the bands corresponding to the low levels of target DNA disappeared, and at humic acid concentrations of 80 ng and at higher concentrations, no band was visible.

The various amounts of target S. fragile DNA made it possible to provide the expected amounts of PCR product when, before amplification, the DNA of S. fragile was mixed with DNA of Streptomyces hygroscopicus and added to the PCR mixture of 50 μl in a range of 100 pg to 1 μg in order to simulate the non-target DNA released from the soil microflora.

2.9 QUANTIFICATION OF THE INDIGENOUS ACTINOMYCETES OF THE SOIL AFTER DIFFERENT LYSE TREATMENTS:

Purification protocol D followed by PCR amplification was applied as described above in order to quantify the actinomycetes belonging to the genus Streptosporangium in soil No. 3 after extraction in accordance with protocols No. 1, 2, 3, 5a and 5b (Figure 5).

After grinding, (protocol No. 2) the quantity of target DNA originating from this actinomycete was estimated by hybridization (Dot Blot) and radio-imaging as being 2.5 +/- 1.3 ng / g of weight. dry soil. If we postulate that the DNA content is 10 fg per cell, as for Streptomyces (Gladek et al. 1984), this value corresponds to approximately 2.5 x 10 ⁵ genomes. Similar values were obtained after the other lysis treatments (2.6 +/- 1.1 and 1.8 +/- 1.3 ng DNA / g dry soil, respectively, using protocols 3 and 4b respectively).

2.10 EFFECTIVENESS OF DNA RECOVERY FROM SOILS PREVIOUSLY INOCULATED WITH BACTERIA:

Three soils (nos. 2, 3 and 5) were inoculated with spores or hyphae of Streptomyces lividans at different concentrations (see Material and Methods section). The amounts of mycelium added to the soil (Figure 6b) correspond to the number of spores inoculated into the germination medium. Approximately 50% of these spores have germinated. The exact number of cells in the hyphae of germinated spores has not been determined. Consequently, the quantities of spores and mycelium sown in the soil are not directly comparable.

For each soil sample, extraction protocol No. 6, purification method D, and PCR amplification combined with spot hybridization (Dot Blot) and phosphorescence imaging (phospho-imaging) were used to count target DNAs that had been released. The extracted DNA can be clearly distinguished from background noise only when the number of added spores exceeds 10 ⁵ for soils 3 and 5 and 10 ⁷ for soil 2 (Figure 6a). When the mycelium is added, the extracted DNA can be detected above an amount corresponding to 10 ³ spores / g of soil for soils 2 and 3, and above 10 ⁷ spores / g for soil n ° 5 (figure b).

Above the detection level, the hybridization signal increases with increasing amounts of the inoculated cells. For the spore inoculum, a 100-fold increase in the number of seeded cells leads to an almost 100-fold increase in DNA yield. This increase is clearly less when the hyphae are inoculated, particularly in soils 2 and 3 (Figure 6). On the contrary, the results obtained when phage lambda DNA was used as an inoculum, the DNA was also recovered from clay-rich soil (# 5) when the bacterial cells were used as an inoculum. However, for the latter too, RNA treatment increased the recovery of Streptomyces DNA from this soil for both the spores and the mycelium (Figure 6).

Inoculating soils with vegetative Bacillus anthracis cells provided similar recovery rates to those obtained for Streptomyces. In addition, DNA recovery rates from soil # 5 increased after RNA treatment also for this inoculum.

Example 2: Construction of a DNA library of low molecular weight (<10 kb) from a soil contaminated with lindane: cloning and expression of the linA gene

This example describes the construction of a soil DNA library in E. coli. It demonstrates the cloning and expression of small genes from a non-cultivable microflora. Lindane is an organochlorine pesticide, recalcitrant to degradation and persistent in the environment. Aerobically, its biodegradation is catalyzed by a dehydrochlorinase, coded by the linA gene, making it possible to transform lindane into 1,2,4-trichlorobenzene. The linA gene has only been identified among two strains isolated from the soil: Sphingomonas paucimobilis, isolated in Japan (Seeno and Wada 1989, Imai et al 1991, Nagata et al 1993) and Rhodanobacter lindaniclasticus isolated in France (Thomas et al 1996, Nalin et al 1999).

However, the degradation potential of lindane, demonstrated by assaying the chloride ions released and amplification by PCR of the linA gene from soils which have been in contact or not with lindane, seems to be more widely spread in the environment (Biesiekierska-

Galguen, 1997).

1. Direct extraction of DNA from soil

Dry soils are ground for 10 minutes in a Restch centrifugal mill equipped with 6 tungsten balls. 10 grams of ground ground are suspended in 50 ml of TENP pH 9 buffer (Tris 50 mM, EDTA 20 mM, NaC1 100 mM, polyvinylpolypirrolidone 1% w / v), and homogenized using a vortex for 10 min.

After centrifugation for 5 minutes, 4000 g at 4 ° C, the supernatant is precipitated with sodium acetate (3M, pH 5.2) and isopropanol, to be taken up in sterile TE buffer (10 mM Tris, EDTA 1 mM, pH 8.0). The extracted DNA is then purified on a S400 molecular sieving column (Pharmacia) and on an Elutip d ion exchange column (Schleicher and Schuell), according to the manufacturers' instructions, then stored in TE.

2. Construction of the DNA library extracted from the soil in the vector pBluescript SK-

The vector pBluescript SK- and the DNA extracted from the soil are each digested by the enzymes Hind \\\ and BamHI (Roche), at the rate of 10 units of enzymes for 1 μg of DNA (incubation for 2 hours at 37 ° C. ). DNA is then ligated by the action of T4 DNA ligase (Roche), overnight at 15 ° C, at the rate of one unit of enzyme per 300 ng of DNA (approximately 200 ng of DNA insert and 100 ng of digested vector) . The electrocompetent Escherichia coli cells, ElectroMAX DH10B ™ (Gibco BRL) are transformed by the ligation mixture (2 μl) by electroporation (25 μF, 200 and 500 Ω, 2.5 kV) (Biorad Gene Puiser).

After one hour of incubation in LB medium, the transformed cells are diluted so as to obtain approximately 100 colonies per dish and then are spread on LB medium (10 g / l Tryptone, 5 g / l yeast extract, 5 g / NaCl ) added with Ampicilin (100 mg / l), γ-HCH (500 mg / l), X-gal 60 mg / l (5-bromo-4-chloro-3-indolyl-α-D-galactoside) , and IPTG 40 mg / l (isopropylthio-β-D-galactoside), and incubated overnight at 37 ° C. Since γ-hexachlorocyclohexane (Merck-Schuchardt) is insoluble in water, a 50 g / l solution is prepared in DMSO (dimethyl sulfoxide) (Sigma).

A bank of 10,000 clones was thus obtained.

3.Cloning and expression of the linA gene

The screening of the library is carried out by visualization of a halo of degradation of lindane around the colony (lindane precipitating in culture media). Out of 10,000 clones screened, 35 thus exhibited a degradation activity of lindane. The presence of the linA gene in these clones could be confirmed by PCR using specific primers, described by Thomas et al (1996). Digests carried out on the inserts as well as on the amplification products showed identical profiles between all the screened clones and the reference control, R. lindaniclasticus. The clones carrying the linA gene also presented an insert of the same size (approximately 4 kb).

It could thus be demonstrated that the soil DNA could be cloned and expressed in a heterologous host: E. coli, and that genes from a difficult-to-cultivate microflora could be expressed. Banks made from partial digestion of DNA extracted from the soil by restriction enzymes such as Sau3A \ are therefore also conceivable. EXAMPLE 3:

A method of preparing a collection of nucleic acids from a soil sample, comprising a step of indirect DNA extraction.

1. MATERIALS AND METHODS.

1.1 Extraction of the bacterial fraction from the soil.

5 g of soil are dispersed in 50 ml of sterile 0.8% NaCl, by grinding with Waring Blender for 3 x 1 minute, with cooling in ice between each grinding, the bacterial cells are then separated from the particles of the soil by centrifugation on a cushion of density of Nycodenz (Nycomed Pharma AS, Oslo, Norway). In a centrifuge tube, 11.6 ml of a 1.3 g Nycodenz solution. ml ^"1 (8 g of Nycodenz suspended in 10 ml of sterile water) are placed below 25 ml of the soil suspension previously obtained. After centrifugation at 10,000 g in a rotor with movable cups (rotor TST 28.38, Kontron) for 40 minutes at 4 ° C., the cell ring, located at the interphase of the aqueous phase and the Nycodenz phase, is removed, washed in 25 ml of sterile water and centrifuged at 10,000 g for 20 minutes. cell is then taken up in a 10 mM Tris solution, EDTA 100 mMn pH 8.O. Prior to the dispersion of the soil in the Waring Blender, a step of enriching the soil in a solution of yeast extract can be included in order to allow in particular the germination of the bacterial spores of the soil. 5 g of soil are then incubated in 50 ml of a sterile 0.8% NaCl solution - 6% yeast extract, for 30 minutes at 40 ° C. The yeast extract is eliminated by centrifugation at 5000 rpm for 10 minutes to avoid for foaming during grinding.

1.2 Lysis of soil bacterial cells. - Lysis of cells in a liquid medium and purification on a cesium chloride gradient.

The cells are lysed in a 10 mM Tris solution, 100 mM EDTA, pH 8.0 containing 5 mg.ml ^'1 of lysozyme and 0.5 mg.ml ^"1 of achromopeptidase for 1 hour at 37 ° C. A solution of lauryl sarcosyl ( 1% final) and proteinase K (2 mg.ml ^"1 ) is then added and incubated at 37 ° C for 30 minutes. The DNA solution is then purified on a cesium chloride density gradient by centrifugation at 35,000 rpm for 36 hours on a Kontron 65.13 rotor. The cesium chloride gradient used is a gradient at 1 g / ml of CsCI, having a refractive index of 1.3860 (Sambrook et al., 1989).

- Cell lysis after inclusion in an agarose block.

The cells are mixed with an equal volume of agarose at 1.5% (weight / volume) Seaplaque (Agarose Seaplaque FMC Products. TEBU, Le Perray en Yvelines, France), at low melting point and poured into a 100 μl block. The blocks are then incubated in a lysis solution: EDTA 250 mM, sucrose 10.3%, lysozyme 5 mg.ml ^"1 and achromopeptidase 0.5 mg.ml ^{" 1} at 37 ° C for 3 hours. The blocks are then washed in a 10 mM Tris - 500 mM EDTA solution and incubated overnight at 37 ° C. in 500 mM EDTA containing 1 mg.ml ^'1 of proteinase K and 1% lauryl sarcosyl. After several washes in Tris-EDTA, the blocks are stored in 500 mM EDTA.

The quality of the DNA thus extracted is checked by electrophoresis in pulsed fields. The amount of DNA extracted was evaluated on an electrophoresis gel against a standard range of calf thymus DNA.

1.3 Molecular characterization of DNA extracted from the soil.

The DNAs extracted from the soil are characterized by PCR hybridization, a method which consists in first amplifying the DNAs using primers located on universally conserved regions of the rR16S gene, then in hybridizing the amplified DNAs with different oligonucleotide probes of known specificity (Table 4), for the purpose quantify the intensity of the hybridization signal with respect to an external standard range of genomic DNA.

The DNAs extracted from the soil as well as the genomic DNAs extracted from pure cultures are amplified with the primers FGPS 612-669 (Table 1) under the standard conditions of amplification by PCR. The amplification products are then denatured by an equal volume of 1N NaOH, deposited on a nylon membrane (GeneScreen Plus, Life Science Products) and hybridized with an oligonucleotide probe marked at its end with g ³² P ATP by action of the T4 polynucleotide kinase. After prehybridization of the membrane in a 20 ml solution containing 6 ml of SSC 20X, 1 ml of Denhardt solution, 1 ml of 10% SDS and 5 mg of heterologous DNA from salmon sperm, the hybridizations are carried out overnight at the temperature defined by the probe. The membranes are washed twice in SSC 2X for 5 minutes at room temperature, then once in SSC 2X 0.1% SDS and a second time in SSC 1X, 0.1% SDS for 30 minutes at room temperature. 'hybridization. Hybridization signals are quantified using Molecular Analyst software (Biorad, Ivry sur Seine, France) and the quantities of DNA are estimated by interpolation of the standard curves obtained from genomic DNA.

2. RESULTS AND DISCUSSION

2.1 Extraction and lysis of the bacterial fraction from the soil.

Separating microbial cells from soil particles, prior to DNA extraction, is an alternative with many advantages over direct methods of extracting DNA from the soil. Indeed, the extraction of the microbial fraction limits the contamination of the DNA extract by extracellular DNA freely present in the soil or by DNA of eukaryotic origin. Above all, the DNA extracted from the microbial fraction of the soil presents fragments of longer size and better integrity than the DNA extracted by direct lysis JACOBSON and RASMUSSEN (1992). In addition, the separation of soil particles makes it possible to avoid contamination of the DNA extract by humic and phenolic compounds, compounds which can subsequently seriously harm the cloning efficiencies.

One of the decisive steps for the extraction of soil cells is the dispersion of the soil sample in order to dissociate the cells adhering to the surface or inside the aggregates of soil particles. Three successive grinding cycles of one minute each make it possible to obtain a better extraction efficiency of the cells as well as a larger quantity of DNA recovered, compared to a single grinding cycle of one minute 30.

Table 5 reports the extraction efficiencies obtained after centrifugation on a Nycodenz gradient, on the total viable microflora (counted by microscopy after staining with acridine orange), on the total cultivable microflora (counted on solid medium Trypticase-Soy 10% ), and on the microflora of actinomycetes cultivable on HV agar medium (after incubation at 40 ° C in a solution of yeast extract 6% -SDS 0.05% in order to cause sprout germination). On the other hand, the extracted DNA was quantified either after a lysis of the cells in a liquid medium (without purification on a cesium chloride gradient) or after a lysis of the cells included in an agarose block (after digestion of the agarose with a b-agarase).

The results show that more than 14% of the total telluric microflora is recovered by this method (ie 2 10 ⁸ cells per gram of soil), and that the total cultivable microflora represents only barely 2% of the total microbial population.

On the other hand, the quantity of DNA extracted from the cells is 330 ng per gram of dry soil. By estimating the DNA content per microbial cell in the soil between 1.6 and 2.4 fg, and taking into account the quantity of cells extracted (2 10 ⁸ cells per gram of soil), it can be estimated that almost all of the cells have been lysed and thus lysis does not bring any significant bias to this approach.

Electrophoresis in pulsed fields showed that the soil DNA extracted after Nycodenz and CsCI gradient could reach a size of 150 kb and that the agarose block lysis made it possible to extract fragments greater than 600kb. These results confirm the interest of this culture-independent approach for the construction of environmental DNA libraries, by presenting itself as an alternative to direct methods of DNA extraction.

2.2 Molecular characterization of DNA extracted from the soil.

The aim of the molecular characterization of the DNA extracted from the soil is to obtain profiles representing the proportions of the different bacterial taxa present in the DNA extract. It also involved knowing the extraction biases induced by the prior separation of the cell reaction from the soil, in comparison with a direct extraction method due to the lack of direct visualization of the microbial diversity present in the soil. Indeed, little information has been gathered on the extraction of cells on a Nycodenz gradient according to their morphological structure (cell diameter, filamentous or sporulated forms).

The methods hitherto in place were based on: quantitative hybridizations using oligonucleotide probes specific to different bacterial groups, applied directly to DNA extracted from the environment. Unfortunately, this approach is not very sensitive and does not make it possible to detect genera or taxonomic groups present in low abundance AMANN (1995). - Quantitative PCR such as MPN-PCR (Most Probable

Number) SYKES et al. (1992) or the quantitative PCR by competition DIVIACCO et al. (1993). The respective drawbacks of each of these approaches are (i) the heaviness of use due to the multiplication of dilutions and repetitions which makes the technique inappropriate for a large number of samples or of pairs of primers, and (ii) the need to build a competitor specific to the target DNA and not inducing bias in the competition.

The method implemented according to the present invention consists in universally amplifying a 700 bp fragment inside the 16S rDNA sequence, in hybridizing this amplifier with a probe. oligonucleotide of variable specificity (in terms of reign, order, subclass or genus) and to compare the hybridization intensity of the sample compared to an external standard range. The amplification prior to hybridization makes it possible to quantify genera or species of microorganisms which are not abundant. In addition, amplification with universal primers makes it possible, during hybridization, to use a large series of oligonucleotide probes. It allows them to compare different lysis modes (direct or indirect extraction) on well-defined taxonomic groups. The results are collated in Table 6.

They show similar profiles between the two extraction methods (direct and indirect). Thus, it appears that the prior extraction of the telluric microbial fraction does not introduce real biases among the taxa tested. The only significant difference between the two extraction approaches would seem to be the greater abundance of rDNA sequences belonging to γ proteobacteria in the extract by the indirect extraction method.

In addition, a significant effect of the incubation of the soil sample in a solution of yeast extract is observed on spore-forming populations of the soil (Gram ⁺ , low percentage of GC and Actinomycetes).

This stage causes the germination of the spores, and on the one hand certainly allows better recovery of this type of cells and on the other hand greater efficiency of lysis on germinating cells.

This approach allows a semi-quantitative analysis, targeted on the main taxa defined from cultivated microorganisms and usually found in soils. Only molecular tools make it possible to estimate the importance of the different taxa, the cultivation methods being too restrictive and dependent on the specificity of the medium used. The results show that a large part of the microbial population is not represented in the phylogenetic groups described, thus highlighting the existence of new groups composed of microorganisms not cultivated until now, or not cultivable. Thus, new probes can be defined from sequences determined from DNA extracted from the soil (new phyla composed of uncultivated microorganisms, LUDWIG et al. (1997) in order to obtain a more exact image of the composition. DNA extract.

Example 4: - CONSTRUCTION OF THE POS 700I COSMIDE Characteristics of POS 700I:

Replicative in E. coli I ntég ratif in Streptomyces

Selectable from E. coli AmpR, HygroR and Streptomyces HygroR

The properties of the cosmid make it possible to insert large DNA fragments between 30 and 40kb. He understands

1 - The inducible tipA promoter of Streptomyces lividans

2 - The specific integration system of the pSAM2 element

3 - The gene for resistance to hygromycin 4- the cosmid pWED1, derived from pWED15

1) - The inducible promoter of the tip A gene of S. lividans

The tipA gene codes for a 19 KD protein, the transcription of which is induced by the antibiotic thiostrepton or nosiheptide. The tipA promoter is well regulated: induction in exponential phase and in stationary phase (200X) Murakami T, Holt TG, Thompson CJ. J. Bacteriol

1989; 171: 1459-66

2) - The hygromycin resistance gene

- Hygromycin: antibiotic produced by S. hygroscopicus

- The resistance gene codes for a phosphotransferase (hph)

- The gene used comes from a cassette constructed by Blondelet et al in which the hyg gene is under the control of its own promoter and the promoter plac inducible by IPTG Blondelet-Rouault et al; .

3) - The site-specific integration system

The pSAM2 element is integrated into the chromosome by a site-specific integration mechanism. Recombination takes place between two identical 58 bp sequences present on the plasmid (attP) and on the chromosome (atfB). The int gene, located near the aftP site, is involved in the site-specific integration of pSAM2, and its product has similarities to the integrases of temperate bacteriophage enterobacteria. It has been shown that a fragment of pSAM2 containing only the attP attachment site as well as the int gene was able to integrate in the same way as the whole element. See French patent n ° 88 06638 dated 05/18/1988, as well as Raynal A et al. Mol Microbiol 1998 28: 333-42).

4) - Construction of the cosmid pOS700l

Step 1 / The TipA promoter was isolated from the plasmid pPM927 (Smokvina et al. Gene 1990; 94: 53-9) on a 700 base pair Hindlll-BamHI fragment cloned into the vector pUC18 (Yannish-Perron et al. , 1985) digested with Hindlll / BamHI

Step 2 / This HindIII-BamHI fragment was subsequently transferred from pUC18 to pUC19 (Yannish-Perron et al., 1985).

Step 3 / A BamHI-BamHI insert of 1500 base pairs carrying the int gene and the attP site of pSAM2 was isolated from the plasmid pOSintl, represented in FIG. 8, (Raynal A et al. Mol Microbiol 1998 28: 333-42 ) and cloned at the BamHI site of the preceding vector (pUC19 / TipA), in the orientation making it possible to put the int gene under the control of the TipA promoter. Step 4 / The BamHI site located 5 ′ of the int gene was deleted by partial BamHI digestion then treatment with the Klenow enzyme. A Hindlll-BamHI fragment carrying TipA-int-attP was thus isolated from pUC19 and transferred to pBR322 Hindlll / BamHI.

Step 5 / The Hygromycin cassette isolated from pHP45Ωhyg (Blondelet-Rouault et al., 1997) on a Hindlll-Hindlll fragment was cloned at the Hindlll site located upstream of the TipA promoter.

Step 6 / The Hindlll site located between the ΩHyg cassette and the TipA promoter was removed by Klenow treatment after partial Hindlll digestion.

Step 7 / The plasmid obtained at the end of the previous step makes it possible to isolate a single Hindlll-BamHI fragment, carrying all the ΩHyg / TipA / int attP elements, which was cloned after Klenow treatment at the EcoRV site of the cosmid pWED Le cosmid pWED1, shown in Figure 9, is derived from cosmid pWE15, shown in Figure 10 (Wahl GM, et al. Proc Natl Acad Sci USA 1987 84: 2160-4) by deletion of a Hpal-Hpal fragment carrying the Neomycin gene and SV40 origin.

A map of the pOS 700I vector is shown in Figure 11.

Example 5: Construction of several conjugative and integrative cosmids in Streptomyces, the vector pOSV 303. POSV306 and POSV307

5.1 Construction of the vector pOSV303.

Since the packaging selects clones larger than 30kb, only 10 to 15% of the clones do not contain an insert, so it is not really necessary to have a recombinant selection system, which allows to build a smaller vector. Construction:

Step 1: the pOSVOOl vector

Cloning of a Pstl-Pstl fragment of 800 base pairs carrying the OriT transfer origin of the RK2 replicon (Guiney et al., 1983), in the plasmid pUC19 opened by PstI. This cloning step makes it possible to obtain a vector transferable from E. coli to Streptomyces by conjugation.

The vector map pOSV 001 is shown in Figure 17.

Step 2: the vector pOSV002

Insertion of the Hygromycin marker (Ωhyg cassette), and selectable from Streptomyces, so that the gene conferring resistance to hygromycin is transferred last, which ensures complete transfer of the BAC with the DNA insert from the ground. Cloning of the Hygromycin cassette isolated from pHP45Ωhyg on a Hindlll-Hindlll fragment carrying the Hygromycin resistance gene. This fragment is cloned at the PstI site (position 201) of the vector pOSVOOl. This PstI site was chosen, taking into account the direction of the transfer, so that the Hygro marker is the last transferred during conjugation. The PstI and Hindlll ends are made compatible after treatment with the Klenow fragment of the DNA polymerase making it possible to generate "blunt ends". The orientation of the Ωhyg fragment is determined at the end of construction.

The vector map pOSV002 is shown in Figure 18.

Step 3: the vector pOSV010

The Xbal-Hindlll fragment isolated from the plasmid pOSV002 and containing the hygromycin resistance marker and the origin of transfer is cloned into the plasmid pOSintl digested with Xbal and Hindlll. The orientation of the sites is such that the hygromycin marker will always be transferred last.

The plasmid pOSintl, represented in FIG. 8, was described in the article by Raynal et al. (Raynal A et al. Mol Microbiol 1998 28: 333-42).

This construction allows the expression of integrase in E. coli and in Streptomyces. Step 4: insertion of the "cos" site

The principle is to insert a "cos" site in the plasmid pOSV010 allowing the packaging in the plasmid pOSV010, represented in FIG. 12.

Obtaining the "cos" fragment is shown in Figure 13.

This fragment is obtained by PCR. From a fragment carrying the cohesive ends (cos) of λ (lambda bacteriophage or cosmid pHC79), amplification by PCR is carried out using oligonucleotides corresponding to the sequences -50 / + 130 relative to the cos site. These oligonucleotides also contain the Nsil, PstI compatible, Xhol, Sali compatible, EcoRV, "blunt end" cloning sites.

The addition of the rare Swal and Pacl sites makes it possible to isolate and / or map the clone insert.

The PCR fragment is bounded by a PstI site at the 5 'end and by a Hincll site at the 3' end, allowing cloning into the vector pOSV010 (Figure 12) previously digested with the enzymes Nsil and EcoRV, causing the deletion of the laclq repressor. The vector map pOSV303 is shown in Figure 14.

The vector pOSV303, contains cloning sites such as the Nsil site,. PstI compatible, the Xhol site, Sali compatible or the EcoRV site for obtaining "free ends".

5.2 Construction of the vector pOSV306

Step 1: Construction of the vector POSV308.

The vector pOSV308 was constructed according to the method illustrated in FIG. 27. A 643 bp fragment containing the cos region was amplified using the pair of primers with sequences SEQ ID No. 107 and

SEQ ID No. 108 from the cosmid vector pHc79 described by HOHM B and COLLINS (1980). This amplified nucleotide fragment was cloned directly into the vector pGEMT-easy sold by the company PROMEGA, as illustrated in FIG. 27 in order to produce the vector pOSV308.

Step 2: Construction of the vector pOSV306.

The vector pOSV010 was constructed as described in step 3 of construction of the vector pOSV303, as described in paragraph 5.1 of this example. The vector pOSVIO was digested with the enzymes EcoRV and Nsil in order to excise a fragment of 7874 bp which was subsequently purified, as illustrated in FIG. 28.

Then, the vector pOSV308 obtained in step 1) above was subjected to digestion with the enzymes EcORV and PstI in order to excise a fragment of 617 bp, which was subsequently purified.

Then, the 617 bp cos fragment obtained from the vector pOSV308 was ligated into the vector pOSVI O, in order to obtain the vector pOSV306, as illustrated in FIG. 28.

5.3 Construction of the vector POSV307.

The cosmid pOSV307 still contains the Laclq gene, in order to improve the stability of the cosmid in Streptomyces, for example in the strain S17-1 of Streptomyces. In order to construct the vector pOSV307, the vector pOSV010 was subjected to digestion with the enzyme Pvull, to obtain a fragment of 8761 bp which was purified, then dephosphorylated.

Then, the vector pOSV308, as obtained as described in step 1) of paragraph 5.2 above, was digested with the enzyme EcoRI in order to obtain a fragment of 663 bp, which was then purified and treated by Klenow's enzyme.

The nucleotide fragment thus treated was integrated into the vector pOSV010 after ligation in order to obtain the vector pOSV307, as illustrated in FIG. 29. Example 6: Construction of the replicative cosmid shuttle E. coli-Streptomvces pOS700R.

The fragments of the plasmid pEI16 (Volff et al., 1996) shown in Figure 15 were isolated and treated by Klenow. These fragments contain the sequences necessary for replication and stability originating from the plasmid SCP2.

These two fragments are inserted separately in the site

EcoRV of cosmid pWED1 leading to 2 different clones. The Hygromycin cassette isolated from pHP45Ωhyg on a Hindlll-Hindlll fragment was cloned at the Hindlll site of the cosmids pWED1 containing the ScP2 insert in the form of Pstl-EcoRI fragments or

XbaI. It confers resistance to Hygromycin selectable both in E. coli and in Streptomyces. Transformation of S. lividans and determination of the transformation efficiency.

It appeared that the cosmid containing the Xbal insert was less stable than that containing the PstI EcoRI fragment. It is therefore the latter which was retained under the name of pOS700R. The pOS 700R vector map is shown in Figure 16.

Example 7: Transformation efficiency of integrative vectors (POS700I. And replicatives

potential

Make the S. lividans strain resistant to thiostrepton by integration of the plasmid pTO1 carrying the thiostrepton resistance marker

Preparation of protoplasts from S. lividans cultivated in the presence of thiostrepton

With the vector pOS700l, the transformation efficiency is approximately 3000 transformants per μg of DNA.

With the vector pOS700R, the transformation efficiency is approximately 30,000 transformants per μg of DNA. Example 8: Construction of an integrative BAC vector in

Streptomyces and conjugative

Characteristics:

Replicative in E. coli

Transferable by conjugation of E. coli to Streptomyces

Integrative at Streptomyces

Selectable in E. coli and Streptomyces Capable of inserting large DNA fragments; it should be emphasized that it is necessary to have soil DNA whose size is between

100 and 300kb and not contaminated with small fragments. Indeed, the small fragments are very preferably integrated.

Equipped with a screen to select the plasmids carrying an insert. This screen makes it possible, by eliminating the vectors which are closed on themselves and not digested, to work with a higher ratio between vector and DNA to be inserted, which allows better cloning efficiency to constitute banks.

Construction:

Step 1: the pOSVOOl vector

The vector map pOSV 001 is shown in Figure 17.

Step 2: the vector pOSV002

Insertion of the Hygromycin marker (Ωhyg cassette), and selectable from Streptomyces, so that the gene conferring resistance to hygromycin is transferred last, which ensures complete transfer of the BAC with the DNA insert from the soil.

Cloning of the Hygromycin cassette isolated from pHP45Ωhyg on a Hindlll-Hindlll fragment carrying the Hygromycin resistance gene. This fragment is cloned at the PstI site (position 201) of the vector pOSVOOl. This PstI site was chosen, taking into account the direction of the transfer, so that the Hygro marker is the last transferred during conjugation. The PstI and Hindlll ends are made compatible after treatment with the Klenow fragment of the DNA polymerase making it possible to generate "blunt ends". The orientation of the Ωhyg fragment is determined at the end of construction.

The vector map pOSV002 is shown in Figure 18.

Step 3: the pOSVOIQ vector

The Xbal-Hindlll fragment isolated from the plasmid pOSV002 and containing the hygromycin resistance marker and the origin of transfer is cloned into the plasmid pOSintl digested with Xbal and Hindlll.

The orientation of the sites is such that the hygromycin marker will always be transferred last.

The plasmid pOSintl, represented in FIG. 8, was described in the article by Raynal et al. (Raynal A et al. Mol Microbiol 1998 28: 333-42). This construction allows the expression of integrase in E. coli and in Streptomyces.

Step 4: the vector POSV014

Addition of a "cassette" allowing in the long term to select in the final construction the plasmids having inserted foreign DNA.

This "cassette" carries the gene coding for the repressor C1 of phage λ and the gene conferring resistance to tetracycline. This gene carries in its 5 'non-coding region the target sequence of the repressor. insertion of DNA in the HindIII site located in the coding sequence of C1 leads to the non-production of the repressor and therefore to the expression of resistance to tetracycline.

It is carried by the plasmid pUN99 described in the article: Nilsson et al. (Nucleic Acids Res 1983, 11: 8019-30)

A Pvull-Hindlll fragment isolated from pOSV010 and containing the sequences

Int, attP, Hygro and oriT is cloned to the Mscl site of pUN99.

The vector map pOSV014 is shown in Figure 19.

Step 5: the vector pOSV 403, integrative and conjugative BAC vector

This last cloning step in pBAC11 (represented in FIG. 20) makes it possible to confer on the final plasmid characteristics of BAC (Bacterial Artificial Chromosome), in particular the ability to accept very large DNA inserts.

The Pstl-Pstl fragment of the vector pOSV014 carrying all of the elements and functions described above is cloned into the pasmide pBAC11 (pBeloBACH) digested with NotI. The ends are made compatible by treatment with the Klenow enzyme. The vector map pOSV403 is shown in Figure 21. The diagram in Figure 21 shows the orientation selected.

Step 6:

The vector pOSV403 contains the Hindlll and Nsil sites. The Nsil site is quite rare in Streptomyces and has the advantage of being compatible with PstI. On the other hand, the PstI site is frequent at

Streptomyces and can be used to perform partial digestions.

Recombinant clones carrying an insert cloned into the repressor C1, and therefore inactivating this repressor become resistant to tetracycline. Since the BACs are only present at the rate of one copy per cell, it is necessary to select the recombinant clones with a lower dose of tetracycline than the usual dose of 20 μg / ml, for example with a dose of 5 μg / ml. Under these conditions there is no background noise. It is also possible to use a system developed and marketed by the company InVitrogen, in which the insertion of DNA into the vector inactivates a gyrase inhibitor whose expression is toxic for E. coli. The fragment is preferably isolated from the vector pZErO-2 (http://www.invitrogen.com/).

Example 9: Construction of a S. alboniger bang in the 2 integrative (pOS700l) and replicative .pOS700R_ cosmids

1) - Construction of the Bank

To evaluate the efficiency of the cloning system, the puromycin biosynthesis pathway from Streptomyces alboniger, was cloned in the two cosmid shuttles pOS700l and pOS700R. The genes of the puromycin biosynthetic pathway are carried by a BamHI DNA fragment of approximately 15 Kb.

The genomic DNA of Streptomyces alboniger was isolated. 90% of this

DNA has a molecular weight between 20 and 150 Kb, determined by pulsed field electrophoresis. The two cosmids were digested with the enzyme BamHI (single cloning site).

The BamHI partial digestion conditions for genomic DNA were determined (50 μg of DNA and 12 units of enzyme, 5 minutes of digestion). After checking the size by agarose gel electrophoresis, the partially digested DNA was introduced into the vectors. In the ligation, 15 μg of genomic DNA + 2 μg of the integrative vector or 5 μg of the replicative vector were used.

Each ligation mixture was used for the in vitro packaging of DNA in the heads of lambda bacteriophage. The packaging mixtures (0.5 ml) were titrated (Integrative vector pOS700l = 7.5 x

10 ⁵ cosmids / ml, Replicative vector≈ 5 x 10 ⁴ cosmids / ml).

The cosmids were used to transfect E. coli and thus generate two libraries of approximately 25,000 ampicillin-resistant clones.

The DNA of all of these clones was isolated and quantified. To test the libraries, several clones were chosen, the DNA purified and was digested with BamHI, in order to verify the presence and the size of the inserts. The clones tested contain between 20 and 35 Kb of S. alboniger insert.

2) - Identification of clones containing the puromycin biosynthetic pathway

The clones capable of containing the complete puromycin biosynthesis pathway were identified by hybridization with a probe corresponding to the puromycin resistance gene, the 1.1 kb pac gene. (Lacalle et al. Gene 1989; 79, 375-80)

Bank made in the Integrative Vector pOS 7001:

Among 2000 clones analyzed, 9 clones hybridized with the probe and they contain inserts of around 40 kb.

Bank made in the pOS 700R Replicative Vector:

Among 2000 clones analyzed, 12 clones hybridized with the probe; they contain inserts of about 40 kb.

Using the data published by Tercero et al. (J Biol Chem. 1996; 271, 1579-90), the clones containing the entire biosynthetic pathway were identified, after hybridization with appropriate probes. Some integrative and replicative cosmids present after Clal-EcoRV digestion a fragment of 12360 base pairs, which suggests an insert containing the entire puromycin biosynthesis pathway.

4) - Verification of the production of puromycin by resistant clones (Rhône-Poulenc). a) Materials and Methods

Cultivation strains and conditions:

Three resistant clones were selected to verify the production of puromycin. They correspond to the recombinants of S. lividans containing an insert in the integrative vector pOS700l (G 20) or an insert in the replicative vector (G21 and G22).

Reference strains were used to ensure that the culture media used allowed this production. It is the wild strain S. alboniger ATCC 12461, producer of puromycin and the recombinant strain S. lividans containing the complete cluster of puromycin cloned in the plasmid pRCP11 (Lacalle et al, 1992, the EMBO journal, 11, 785-792) (G23).

The strains are seeded in a culture medium, the composition of which is as follows: Bacteriological peptone Organotechnics 5 g / l of final medium

Springer 5 yeast extract

Liebig 5 meat extract

Glucose Prolabo 15

CaCO3 (1) Prolabo 3 NaCI Prolabo 5

Agar (2) Difco 1

(1) The 3g of carbonate are mixed with 200ml of distilled water and then sterilized separately. The addition being made after sterilization. (2) The agar is previously melted in 100ml of distilled water before being added to the other ingredients of the medium

pH adjusted to 7.2 before sterilization sterilization 25 minutes at 121 ° C 50 μg / l of hygromycin and 5 μg / l of thiostrepton are added to the medium after sterilization so as to maintain a pressure for selecting the clones containing an insert thanks to the marker gene present on the vector (the gene for resistance to thiostrepton being carried by the plasmid pRCP11).

50 ml of liquid culture medium, distributed in 250 ml Erlenmeyer flasks, are inoculated with 2 ml of aqueous suspension of spores and mycelium of each of the strains. The cultures are incubated for 4 days at 28 ° C. with shaking at 220 rpm. 50 ml of production media, distributed in 250 ml Erlenmeyer flasks, are then seeded with 2 ml of these precultures. The production medium used is an industrial medium optimized for the production of pristinamycin (RPR 201 medium). The cultures are incubated at 28 ° C., with shaking at 220 rpm. After different incubation times, an Erlenmeyer flask from each culture is brought to pH 11 and then extracted with 2 times 1 volume of dichloromethane. The organic phase is concentrated to dryness under reduced pressure, then the extract is taken up in 10 μl of methanol. 100 μl of the methanolic solution are analyzed by HPLC equipped with a diode array detector in a water-acetonitrile 0.05% TFA VA system on column C18 for the detection of puromycin.

b) Results

Comparative HPLC analyzes from the cultures of the different strains show the production of puromycin in the culture of the wild strain from 24 h of incubation. A production, although lower, is also clearly detected from 48 h on in the culture of clone G20 containing the cosmid pOS700l (FIG. 23). Puromycin was also detected as a trace in clone G23 containing the full operon coding for the compound in the plasmid pRCPH. However, no production was observed in the cultures of clones G21 and G22 containing the cosmid pOS700R. The results are shown in Figure 23. c) Conclusions

The results obtained make it possible to demonstrate the effectiveness of the cloning system developed in the cosmid pOS700l for expressing in a heterologous host such as S. lividans in a complete biosynthetic pathway under the control of regulatory sequences which are specific to it.

On the other hand, these data also validate the screening of the libraries obtained on the basis of the resistance of the clones to puromycin since it has led to the identification, among a small number of clones, of a recombinant capable of expressing the associated biosynthetic pathway. resistance gene. The absence of puromycin production in the other clones can probably be explained by the cloning of only part of the operon containing the resistance gene but lacking certain regulatory, transduction or transcription sequences necessary for the synthesis of the compound. .

EXAMPLE 10: - DNA CLONING OF SOLDANS OF VECTORS 1) - Preparation of DNA from the soil to be cloned

The different DNA fragments must be purified according to their destination:

cosmids

The size of the molecules must be between 30 and 40kb. However, the DNA extracted from the soil is heterogeneous in size and includes molecules reaching 200 or 300kb. In order to homogenize the sizes, the DNA is broken mechanically by passing the solution through a 0.4mm diameter needle. Fragments of a size close to 30kb are not affected by these repeated passes through a needle and it is therefore not necessary to make a separation by size especially since the packaging in the particles automatically eliminates the short inserts. BACs

DNA preparation

The soil DNA is separated by pulsed field electrophoresis (CHEF type) under conditions such that the fragments between

100 and 300kb are concentrated in a band of about 5mm. This is obtained by carrying out the migration in a gel with 0.7% normal agarose or 1% low melting agarose with a pulse time of 100 seconds for 20 hours and at a temperature of 10 ° C.

DNA recovery

Two methods are used, their choice depends on the size of the molecules that we want to isolate, either up to 150kb or above.

- Up to 150kb

The porosity of a 0.7% agarose gel allows the DNA to be removed by electroelution provided that there is a total absence of ethidium bromide.

This DNA is then manipulated with pipetting instruments with an enlarged and hydrophobic orifice to avoid mechanical fragmentation of the molecules. - Between 100 and 300 kb

The strip containing the fragments of a size between 100 and 300kb is cut. For migration a 1% agarose gel with a low melting point is used. This property makes it possible to melt the gel at a tolerable temperature for DNA of 65 ° C and to then digest it with agarase (Agarase marketed by the company Boehringer) at a temperature of 45 ° C according to the supplier's prescriptions. 2) - Use of the integrative cosmids pOS700l and replicatives POS700R

Construction with polyA polvT tails Principle

A cosmid vector, open to any cloning site, is modified at the 3 'ends by adding a monotonic polynucleotide. On the other hand, the DNA to be cloned is modified at the 3 'ends by adding a monotonic polynucleotide which can pair with the previous one.

The vector-fragment association to be cloned is made by these polynucleotides and the cos sequence of the vector allows the in vitro packaging of DNA in capsids of phage Lamda.

Vector preparation

The vector used is a self-replicating vector in E. coli and integrative in Streptomyces.

For E. coli, the selection is made on resistance to ampicillin and for Streptomyces, it is made on resistance to hygromycin. The cosmid is open at one of the 2 possible sites (BamHI or Hindlll) and the 3 ′ ends are lengthened by polyA with the terminal transferase under the conditions where the supplier of the enzyme provides for the addition of 50 to 100 nucleotides.

Preparation of the DNA to be inserted.

The 3 ′ ends of the DNA are lengthened by polyT with terminal transferase under the conditions providing an elongation comparable to that of the vector. Under the experimental conditions described by the manufacturer, the polyA polyT tails are 30 to 70 bases long. Molecule assembly and in vitro packaging.

For the assembly of the molecules, a vector molecule is mixed for an inserted DNA molecule. The mass concentration of DNA is 500 μg.ml ^"1 .

The mixture is packaged and the transfection efficiency depends on the strain used as receptor and on the inserted DNA: zero with the test DNA and the strain DH5α, the efficiency is comparable for the strains SURE and DH10B; on extraction, the DNA yield is however higher with the strain DH10B.

Construction by dephosphorylation

Soil DNA is blunt-ended by eliminating outgoing 3 'sequences and filling outgoing 5' sequences. This is done with: Klenow enzyme, T4 polymerase, the 4 nucleotide triphosphates. The cosmid vector is digested with BamHI, then treated with the Klenow enzyme to make it blunt and then dephosphorylated to prevent it from closing on itself. After ligation, the mixture is packaged and transfected as previously described.

3) - Use of pBAC Principle.

The conjugative and integrative pBAC plasmid has Hindlll and Nsil sites as cloning sites. The insertion of a DNA sequence at these sites inactivates the repressor C1 of the phage Lambda which controls the expression of the gene for resistance to tetracycline. Inactivation of the repressor therefore makes the cell resistant to this antibiotic (δμg.ml ^"1 ). Cloning at these sites is facilitated by the modification of the vector and the preparation of the DNA to be cloned. Vector preparation. Hindlll example

So that the vector does not close on itself, the Hind III site is modified: the first base (A) is replaced to form an outgoing 5 'sequence, which cannot pair with its similars. The operation is carried out by the Klenow enzyme in the presence of dATP.

The success of the operation is verified by carrying out a ligation of the vector on itself before and after treatment with the Klenow enzyme. With the same amount of DNA tested, 3000 clones are obtained before treatment and 60 after treatment.

DNA preparation (size between 100 and 300kb). DNA blunt ends.

The DNA is blunt-ended by eliminating the outgoing 3 'sequences and filling in the outgoing 5' sequences. This operation is done with: Klenow enzyme, T4 polymerase, the 4 nucleotide triphosphates.

Preparation of the ends-Hindlll example

The addition of the DNA to the vector is carried out by means of oligonucleotides recognizing the modified HindIII sequence of the vector. They contain rare restriction sites to allow subsequent cloning (Swal; Notl). this technique is derived from that of: Elledge SJ, Mulligan JT, Ramer SW, Spottswood M, Davis RW. Proc Natl Acad Sci U S A 1991 Mar 1; 88 (5): 1731-5 Two complementary oligonucleotides are used: Oligo 1: 5'-GCπATTTAAATATTAATGCGGCCGCCCGGG-3 '

(SEQ ID N ° 25)

Oligo 2: 5'-CCCGGGCGGCCGCATTAATATTTAAATA-3 '(SEQ ID N ° 26) They are phosphorylated 5 ′ by the T4 polynucleotide kinase in the presence of ATP, after their hybridization. This phosphorylation step can be eliminated using the already phosphorylated oligonucleotides. The ligation of this double-stranded adapter with the DNA to be inserted into a vector is made by the T4 ligase in the presence of a very large excess of adapter (1000 molecules of adapter for a DNA molecule to be inserted), in 15 hours at 14 ° C. The excess adapter is removed by electrophoresis on an agarose gel and the molecules of interest are recovered from the gel by hydrolysis of the latter with agarase or by electroelution.

Vector-DNA ligation.

Ligation is carried out at 14 ° C. over 15 hours with 10 vector molecules for one insert molecule.

Transformation.

The receptor strain is strain DH10B. The transformation is done by electroporation. To express resistance to tetracycline, the transformants are incubated at 37 ° C. for 1 hour in an environment without antibiotics. The selection of the clones is done by culture overnight, on LB agar medium supplemented with tetracycline at δμg.ml ^{* 1} .

Example 11: CLONE-TO-CLONE CONJUGATION BETWEEN E. COLI AND STREPTOMYCES

CONJUGATION BETWEEN STRAIN COLI S17.1 CONTAINING PPM803 AND

STREPTOMYCES LIVIDANS TK 21

Introduction

It is possible to make conjugations between E. coli and Streptomyces

(Mazodier et al, 1989). Adaptation of this method by developing a so-called drop technique in which 10 μl of a culture of E. coli containing a vector recombinant to a drop of receptor S. lividans consists in carrying out a transformation from clone to clone while ensuring that at the end of the operation the whole library constructed in E. coli is introduced into S. lividans. Bulk transformation would necessarily lead to a multiplication of transforming Streptomyces clones in order to be practically sure that the library in E. coli is completely represented in S. lividans. In addition, this method is easily automated.

Preliminary tests

Conjugation between E. coli strain S17.1 containing the vector pOSV303 and S. lividans TK21.

Under these conditions, 6 × 10 ⁶ E. coli cells are mixed with 2 × 10 ⁶ pre-germinated spores of S. lividans in a final volume of 20 μl.

Development of the method

It is known that the DNA extracted from certain actinomycetes is modified and therefore cannot be introduced into certain strains of E. coli without it being restricted. The E. coli DH10B strain which accepts these DNAs is not capable of transferring a plasmid containing only oriT to Streptomyces, and it is therefore necessary to construct one. There should be introduced by integration into the chromosome a derivative of RP4 capable of providing in trans all the functions necessary to ensure the transfer of the recombinant clones containing the origin of oriT transfer.

Example 12: Construction of a cosmid bong in E. coli and Streptomyces lividans: Cloning of soil DNA

The objective is the construction of a large DNA library from the environment, without prior stage of culture of microorganisms, in order to access the metabolic genes of bacteria (or any other organism) that we do not know how to cultivate under standard laboratory conditions. The procedure described was used to generate a DNA library in Escherichia coli using the shuttle cosmid E. coli-S. lividans pOS700l and DNA extracted and purified from the bacterial fraction of a soil. This latter method makes it possible to obtain DNA of high purity and an average size of 40 kb. Also, in order to avoid partial digestion of the extracted DNA for cloning, an alternative strategy was adopted based on the use of the terminal enzyme tranferase which makes it possible to add polynucleotide tails at the 3 ′ ends of the And vector.

5 μg of DNA were extracted from 60 mg of “Côte Saint André” soil according to the protocol described in Example 3 and treated with the terminal transferase (Pharmacia) to lengthen the 3 ′ ends with a monotonic polynucleotide ( poly T) (Example 10). The integrative cosmid pOS700l is prepared according to the protocol

B1, Orsay. After a conventional purification step in the presence of phenol / chloroform, the DNA and the vector are assembled by mixing a vector molecule and an inserted DNA molecule. The mixture is then packaged in the heads of lambda bacteriophages (Amersham kit) which are used to transfect E. coli DH10B. The transfected cells are then seeded on LB agar medium in the presence of ampicillin for selection of the recombinants resistant to this antibiotic.

A bank of around 5000 clones of E. ampicillin resistant coli was obtained. Each clone was seeded in LB or TB medium + ampicillin in a microplate well (96 wells) and stored at -80 ° C.

The sequence at the sites of insertion of the soil fragments into the vector, pOS7001, generated during the construction of the library was analyzed. To do this, 17 cosmids from the library were purified and sequenced with a primer, seq. 5 'CCGCGAATTCTCATGTTTGACCG 3', which hybridizes between the BamHI sites and the HindIII cloning site present in the vector. The sequences obtained made it possible to estimate that the length of the homopolymeric tails at the junction points is very variable, between 13 and 60 poly-dA / dT. Beyond the tails, the sequences of the soil fragments thus generated have a G + C percentage between 53 and 70%. Such high percentages were unexpected, but similar results have already been reported on crude DNA preparations from soil (Chatzinotas A. et al., 1998).

A "pooling" strategy of 48 or 96 clones was used for the analysis of microbial and metabolic wealth. The cosmid DNA extracted from these "clone pools" was then used to carry out PCR or hybridization experiments.

Example 13: Diversity of 16S ribosomal DNA within cloned DNA.

a) Materials and methods The cosmids of the bank are extracted from clone pools by alkaline lysis and are then purified on a cesium chloride gradient, in order to take the cosmid DNA band in supercoiled form and with the aim of eliminating any Escherichia coli chromosomal DNA that may interfere with the study. After linearization of the cosmids by the action of nuclease S1

(50 units, 30 minutes at 37 ° C.), the 16S rDNA sequences contained in the clone pools are amplified under standard amplification conditions, from the universal primers 63f (5'- CAGGCCTAACACATGCAAGTC-3 ') and 1387r (5'- GGGCGGWGTGTACAAGGC-3 ') defined by MARCHESI et al. (1998). The amplification products of approximately 1.5 kilobases are purified from the Qiaquik gel extraction kit (Qiagen) and then directly cloned into the vector pCR II (Invitrogen) in Escherichia coli TOP10, according to the manufacturer's instructions. The insert is then amplified using primers M13 Forward and M13 reverse specific to the cloning site of the vector. pCR II. The amplification products of expected size (approximately 1.7 kb) are analyzed by RFLP (Restriction Fragment Length Polymorphism) using the enzymes Cfol, Mspl and BstUI (0.1 units) in order to select the clones to be sequenced. The restriction profiles obtained are separated on 2.5% metaphor agarose gel (FMC Products) containing 0.4 mg of ethidium bromide per ml.

The 16S rDNA sequences are then determined directly using the PCR products purified by the "Qiaquick gel extraction" kit using the sequencing primers defined by Normand (1995). Phylogenetic analyzes are obtained by comparing the sequences with the prokaryotic 16S rDNA sequences gathered in the Ribosomal Database Project (RDP) database, version 7.0 MAIDAK et al. (1999) thanks to the SIMILARITY MATCH program, allowing obtain the similarity values with respect to the sequences in the database.

b) Results

To determine the phylogenetic diversity represented in the library, 47 sequences of the ARNM6S gene were isolated from pools of 288 clones and were almost entirely sequenced. The results are reported in Table 7.

Analysis of the sequences by interrogating the databases reveals that the majority of the sequences (> 61%) have similarity percentages less than or equal to 95% with identified bacterial species (Table 7). Of the 47 sequences analyzed, 28 sequences have as their closest neighbors uncultivated bacteria, the sequences of which were directly derived from DNA extracted from the environment. The majority of these sequences also have very low similarity percentages (88-95%), 17 sequences out of 28 thus differ by more than 5% compared to their closest neighbors.

Among the sequences which can be classified in a phyletic group, a majority of sequences belong to the subclass has proteobacteria (18 sequences with a percentage of similarity between 89 and 99%). A second group of sequences is represented by the subclass g of proteobacteria, comprising 9 sequences whose percentages of similarity vary between 84 and 99%). The groups of b-proteobacteria, d-proteobacteria, firmicutes with low G + C% and high G + C% respectively comprise 1, 4, 3 and 5 sequences. Only one sequence could not be classified within the large bacterial taxonomic groups defined: the sequence a22.1 (19), its closest neighbor Aerothermobacter marianas (with a similarity of 89%) being itself a strain isolated from the marine environment and not currently classified. Finally, 6 sequences can be classified within the group of Acidobacteriuml Holophaga. This group has the particularity of being represented only by two cultivated bacteria Acidobacterium capsulatum and Holophaga foetida, the whole of this group being composed of bacteria of which only the ARNM6S gene was detected by amplification and cloning from extracted DNA. environmental sample (mainly soil), Ludwig et al (1997). The low values of similarity between the different sequences making up this group suggests great heterogeneity and diversity within this group. All the results are shown in Table 7.

These results show that the sequences contained in the cosmid library would come from microorganisms which are not only phylogenetically diversified but especially from microorganisms which have never been isolated to date. The results of the sequencing of the amplified DNAs made it possible to establish a phylogenetic tree of the organisms present in the soil sample from which the characterized sequences originate.

The phylogenetic tree represented in FIG. 7 was produced from the alignment of the sequences by the MASE software (Faulner and Jurak, 1988) and corrected by the method of the 2 parameters of Kimura (1980), and using the Neighbor Joining algorithm (Saitou and Nei 1987). Phylogenetic analysis made it possible to compare the 16S rDNA sequences cloned in the soil DNA library, with the prokaryotic 16S rDNA sequences gathered in the Ribosomal databases Database Project (RDP), (version 7.0, SIMILARITY-MATCH program, Maidak et al 1999), and in the GenBank database thanks to BLAST 2.0 software (Atschul et al, 1997).

Example 14 Genetic Preselection of the Bank for the Assessment of Metabolic Richness

To characterize the library obtained in terms of metabolic diversity and to identify clones containing inserts carrying genes which may be involved in biosynthetic pathways, genetic screening techniques based on PCR methods have been developed according to the invention. and to identify PKS type I genes.

1 Bacterial strains, plasmids and culture conditions

S. coelicolor ATCC101478, S. ambofaciens NRRL2420, S. lactamandurans ATCC27382, S. rimosus ATCC109610, B. Subtilis ATCC6633 and B. licheniformis THE1856 (RPR collection) were used as DNA sources for the PCR experiments. S. lividans TK24 is the host strain used for the cosmid shuttle POSI700.

For the preparation of genomic DNA, spore suspensions, protoplasts and for the transformation of S. lividans, the standard protocols described in Hopwood et al. (1986) were followed.

Escherichia coli Top10 (INVITROGEN) was used as host for the cloning of PCR products and E. coli Sure (STRATAGENE) was used as host for the shuttle cosmid pOS700l. The culture conditions for E. coli, the preparation of plasmids, the digestion of DNA, the electrophoresis on agarose gel were carried out according to standard procedures (Sambroock et al., 1996).

2. PCR primers:

The pairs of primers a1-a2 and b1-b2 were defined by the team of N. Bamas-Jacques and their use was optimized for the screening of DNA from pure strains and the soil bank for genes encoding PKSI)

Table 8: PCR primers homologous to the PKSI genes used for screening the library.

Amplification conditions:

For the search for PKS I from the DNA of pure strains, the amplification mixture contained: in a final volume of 50 μl, between 50 and 150 ng of genomic DNA, 200 μM of dNTP, 5 mM of MgCl ₂ final, 7% DMSO, 1x Appligene buffer, 0.4 μM of each primer and 2.5U of Taq Polymerase Appligene. The amplification conditions used are: denaturation at 95 ° C for 2 minutes, hybridization at 65 ° C for 1 minute, elongation at 72 ° C for 1 minute, for the first cycle, followed by 30 cycles where the temperature is lowered up to 'at 58 ° C as described in K. Seow et al., 1997. The final extension step is carried out at 72 ° C for 10 minutes.

For the search for PKS I from the DNA of the library, the PCR conditions are the same as above for the a1-a2 pair using between 100 and 500 ng of cosmid extracted from pools of 48 clones.

For the pair of primers b1-b2, 500 ng of cosmids from pools of

96 clones were used. The amplification mixture contained 200 μM dNTP, 2.5mM final MgCI ₂ , 7% DMSO, 1x Quiagen buffer, 0.4 μM of each primer and 2.5U of Taq polymerase Hot-start (Qiagen). The amplification conditions used are: denaturation 15 'at 95 ° C followed by 30 cycles: the denaturation at 95 ° C + the hybridization at 65 ° C for the first cycle and 62 ° C for the other cycles , elongation at 72 ° C, final extension step from 10 'to 72 ° C.

The identification of positive clones from pools of 48 or 96 clones is carried out using replicates of the corresponding mother microplates on solid medium or any other standard replication method.

3 Subcloning and sequencing

The PCR products of the identified clones were sequenced according to the following protocol:

The fragments are purified on agarose gel (Gel Extraction Kit (Qiagen)) and cloned in E.coli TOP 10 (Invitrogen) using the TOPO TA cloning kit (Invitrogen). The plasmid DNA of subclones is extracted by alkaline lysis on a Biorobot (Qiagen) and dialysis for 2 h on VS membrane 0.025 μm (Millipore). The samples are sequenced with the primers M13 "Universal" and "Reverse" on the sequencer ABI 377 96 (PERKIN ELMER).

4) Results

Definition and validation of PCR primers

Two highly conserved regions of actinomycete type I PKS, comprising the active site of the enzyme, were targeted for the amplification of homologous genes with degenerate primers. These two regions correspond to the PQQR (L) (L) LE and VE (A) HGTGT sequences respectively.

Primers (Table 8) were tested with the DNA of strains producing or not producing macrolides: Streptomyces coelicolor, Streptomyces ambofaciens, producer of spiramycin, and Saccharopolyspora erythraea, producer of erythromycin. Whatever the primers used, bands representing fragments of approximately 700 bp and corresponding to the length of the expected fragment were obtained with all the strains.

These results demonstrate the specificity of primers a and b for the PKS I genes of producer strains or of silent genes in S. coelicolor.

The sequencing of the PCR products obtained with the pair of primers a1-a2 made it possible to identify, from the strain S. ambofaciens, the sequence of a KS gene already described (European Patent Application No. EP0791656) as belonging to the biosynthesis pathway for plantenolide, macrolidic precursor of spiramycin, and two sequences never described, Stramb 9 and Stramb12, (see sequence list).

As regards, S. erythraea, the screening method allowed the identification of a KS sequence (sacen / 17) identical to that of the KS of module 1 already published in Genebank (Access number M63677), coding for synthetase 1 (DEBS1) of 6-deoxyerythronolide B. Another sequence not correlated to the erythromycin biosynthetic pathway has been identified and it is the sequence SEQ ID No. 32.

Conclusion

A method for analyzing the presence of genes coding for type I PKS by PCR from different microorganisms has been developed. The very conserved structure of the type I ketosynthetase domain made it possible to carry out a PCR method based on the use of degenerate primers biased in GC for the choice of codons.

This approach shows the possibility of identifying genes or clusters involved in the biosynthetic pathway of type I polyketides. The cloning of these genes allows the creation of a collection which can then be used to build polyketide hybrids. The same principle can be applied to other classes of antibiotics.

The results obtained here also show the presence of genes which may belong to silent clusters (SEQ ID N ° 30 to 32). The presence of silent clusters has already been documented in

S. lividans and their expressions are triggered by specific or pleiotropic regulators (Horinouchi et al.; Umeyama et al. 1996). These results suggest that the detection of genes belonging to so-called silent pathways actually code for active enzymes capable of directing, in association with the other pathway-specific enzymes, the enzymatic steps necessary for the synthesis of secondary metabolites.

Screening the bangue

The screening was carried out under the conditions described in the Materials and Methods section using the pairs of primers validated from producing strains.

In the presence of the pair of primers a1-a2, the size of the PCR products obtained from cosmid DNA extracted from pools of 48 or 96 clones was approximately 700 bp, therefore in agreement with the expected results.

The intensity of the bands obtained was variable, but only one amplification band was present for each target DNA pool. Under these conditions, 8 groups of target DNA were detected, corresponding to 9 positive clones after dereplication. The screening carried out with the second pair of primers, b1-b2, gave less specific amplification results since numerous satellite bands were observed alongside the 700 bp band. However, 9 groups of target DNA were detected, corresponding to 14 positive clones after dereplication from these positive clones, the DNA was extracted for the sequencing and transformation steps of .S. lividans. Cosmid analysis

Digestion of the cosmids identified by PCR with the enzyme Dral, recognizing a site rich in AT, releases a fragment greater than 23 kb (FIG. 22). This suggests that the PCR method preferentially targets soil DNA containing a high percentage of G + C. This result is the consequence of the degeneration of the primers used, biased in GC for the choice of codons. The inserts, as expected in the case of cosmids, have a size greater than 23 kb, except in one case (clone a9B12), which could reflect a certain instability of the cosmids. On the other hand, among all the clones selected, only two of them, GS.F1 and GS.G1 1, showed the same restriction profile indicating a low rate of redundancy in the library. The selected cosmids have been transferred to

Streptomyces lividans by transformation of protoplasts in the presence of PEG 1000. The transformation efficiency varies between 30 and 1000 transformants per μg of cosmid DNA used.

Sequencing and phylogenetic analysis of soil PKS I genes

The PCR method developed on pure strains was used as described on the bank's cosmids and 24 clones were thus identified. The PCR products of approximately 700 bp obtained from the DNA of two pools (48 clones) and 8 unique clones, were cloned, after purification on agarose gel, and sequenced. This allowed the identification of 11 sequences.

The alignment of the protein sequences deduced from PKSs I of the soil with other PKSs I present in different microorganisms (FIG. 24) shows the presence of a very conserved region which corresponds to the consensus region of the active site of b-ketoacyl. synthetase. Analysis of the sequences obtained with the "Codonpreference" method (Gribskov et al., 1984; Bibb et al., 1984) revealed the presence of a strong bias in the use of codons rich in G + C in a single reading phase. The proteins deduced according to this reading phase show a strong similarity with known type I KSs (Blast program). In particular, the similarity between the sequences of soil KSs and KSs of the erythromycin cluster is approximately 53%.

After dereplication of a pool and identification of the unique clone, the sequence of the PCR product obtained from this clone is identical to that of the pool, which confirms the reliability of the method used.

Analysis of the sequence of the PCR product of a clone enabled the probable identification of 3 different KSI genes. One of these sequences (SEQ ID No. 34) has a similarity of 98.7% with the sequence of another pool, suggesting that they code for the same enzyme. The other two sequences are different but highly homologous.

Here, the cloning and identification in a soil DNA library of biosynthetic pathways for secondary metabolites containing genes encoding type I KS is described for the first time.

The high percentage of G + C in soil sequences suggests that they can be derived from genomes with codon usage similar to that of actinomycetes.

Even if the data available in the literature is limited, it is known that the genes encoding PKS type I are very diverse by their physical organization in the genome, the size and the number of modules contained in each gene.

The presence of several domains originating from a single clone is a confirmation of their belonging to clusters of asymmetric polyketides. In a single case, two clones seem to form a contiguous since they share the same sequence for the KS domain. The size of the genetic regions involved in the synthesis of

PKSI ranges from a few kb for penicillin to around 120 kb for rapamycin. The size of the cosmid inserts may therefore not be sufficient for the expression of the most complex clusters.

Genes coding for PKSs I, capable of working iteratively like PKS II and of controlling the synthesis of aromatic polyketides, have been described (Jae-Hyuk et al., 1995). The study of the PKSs I clusters in the soil could bring further innovations in this area.

5. Identification of 6 genes encoding polyketide synthases.

Continuing the screening of the cosmid library according to the protocols described in the present example, the inventors identified a cosmid clone containing an insert of 34071 bp containing several open reading frames coding for polypeptides of the polyketide synthase type.

More precisely, the cosmid thus identified by screening the library contains six open reading frames coding for polyketide synthase polypeptides or for strongly related polypeptides, non-ribosomal peptides synthase. A detailed map of this cosmid is shown in Figure 36.

The complete nucleotide sequence of the cosmid constitutes the sequence SEQ ID No. 113 of the sequence listing. The DNA insert contained in the sequence SEQ ID No. 113 constitutes the complementary nucleotide sequence (strand -) of the nucleotide sequence coding for the various polyketide synthases.

The nucleotide sequence of the DNA insert contained in the cosmid of FIG. 36 which includes the open reading frames coding for the polyketide synthase (strand +) polypeptides is shown diagrammatically in FIG. 37 and constitutes the sequence SEQ ID No. 114 sequence listing.

In addition, a detailed map of the different open reading frames contained in the DNA insert of this cosmid is shown in Figure 37.

The characteristics of the nucleotide sequences comprising open reading frames contained in the DNA insert of this cosmid are detailed below. ORF1 sequence

The orfl sequence comprises an open partial reading frame with a length of 4615 nucleotides. This sequence constitutes the sequence SEQ ID No. 115, which begins at the nucleotide in position 1 and ends at the nucleotide in position 4615 of the sequence SEQ ID No. 114.

The sequence SEQ ID No. 1 15 codes for the ORF1 polypeptide of 1537 amino acids, this polypeptide constituting the sequence SEQ ID No. 121. The polypeptide of sequence SEQ ID No. 121 is related to the non-ribosomal peptide synthases. This polypeptide has a degree of amino acid identity of 37% with the peptide synthase of Anabaena sp.90 referenced under the access number "emb CACO1604.1" in the Genbank database.

ORF2 sequence

The nucleotide sequence orf2 is 8301 nucleotides in length and constitutes the sequence SEQ ID No 116 which begins at the nucleotide at position 4633 and ends at the nucleotide at position 12933 of the sequence SEQ ID No 114.

The ORF2 sequence codes for the ORF2 peptide with a length of 2766 amino acids, this polypeptide constituting the sequence SEQ ID No. 122. The polypeptide of sequence SEQ ID No. 122 has an amino acid sequence identity of 41% with the MtaD sequence of Stigmatella aurantiaca referenced under the access number "gb AAF 19812.1" from the GENBANK database.

The ORF2 polypeptide constitutes a polyketide synthase.

ORF3 sequence

The nucleotide sequence orf3 has a length of 5292 nucleotides and constitutes the sequence SEQ ID No. 117. The sequence SEQ ID No. 117 corresponds to the sequence which begins at the nucleotide in position 12936 and which ends at the nucleotide in position 18227 of the sequence SEQ ID No. 114.

The nucleotide sequence SEQ ID No. 117 codes for the polyketide synthase ORF3 polypeptide of 1763 amino acids, this polypeptide constituting the sequence SEQ ID No. 123 according to the invention.

The ORF3 polypeptide of sequence SEQ ID No. 123 has an identity of 42% in amino acids with the MtaB sequence of Stigmatella aurantiaca referenced under the access number “gb AAF 19810.1” from the GENBANK database.

ORF4 sequence

The nucleotide sequence orf4 has a length of 6462 nucleotides and constitutes the sequence SEQ ID No. 118 according to the invention. The nucleotide sequence SEQ ID No. 118 corresponds to the sequence starting at the nucleotide at position 18224 and ending at the nucleotide at position 24685 of the nucleotide sequence SEQ ID No. 114.

The nucleotide sequence SEQ ID No. 118 codes for the polyketide synthase ORF4 polypeptide of 2153 amino acids, this polypeptide constituting the sequence SEQ ID No. 124 according to the invention.

The ORF4 polypeptide of sequence SEQ ID No. 124 has an amino acid sequence identity of 46% with the epoD sequence of Sorangium cellulosum referenced under the access number “gb AAF62883.1 from the GENBANK database.

ORF5 sequence

The orfδ nucleotide sequence has a length of 5088 nucleotides and constitutes the sequence SEQ ID No. 119 according to the invention.

The sequence SEQ ID No. 119 corresponds to the sequence starting at the nucleotide at position 24682 and ending at the nucleotide at position 29769 of the nucleotide sequence SEQ ID No. 114. The nucleotide sequence SEQ ID No 119 codes for the polyketide synthase ORF5 polypeptide of 1695 amino acids, this polypeptide constituting the sequence SEQ ID No 125 according to the invention.

The polyketide synthase ORF5 polypeptide of sequence SEQ ID No. 125 has an amino acid identity of 43% with the epod sequence of Sorangium cellulosium referenced under the access number "gb AAF 62883.1" from the GENBANK database.

ORF6 sequence

The nucleotide sequence ifif has a length of 4306 nucleotides, and constitutes the sequence SEQ ID No. 120 according to the invention. The nucleotide sequence SEQ ID No. 120 corresponds to the sequence starting at the nucleotide at position 29766 and ending at the nucleotide at position 34071 of the sequence SEQ ID ID No. 1 14.

The sequence SEQ ID No. 120 contains an open partial reading frame coding for the ORF6 polypeptide of 1434 amino acids of the polyketide synthase type, this polypeptide constituting the sequence SEQ ID No. 126 according to the invention. The polypeptide of sequence SEQ ID No. 126 has an amino acid identity of 43% with the epoD sequence of Sorangium cellulosum referenced under the access number "gb AAF 62883.1" from the GENBANK database.

EXAMPLE 15: Construction of integrative BAC shuttle vectors at Streptomyces

Construction of integrative and conjugative BAC shuttle vectors at Streptomyces

15.1 Construction of the vector pMBD-1

The BAC vector pMBD-1 was obtained according to the following steps: Step 1: The vector pOSVO10 was subjected to digestion with the enzymes PsTI and BstZ171 in order to obtain a nucleotide fragment of 6.3 kb.

Step 2: The vector pDNR-1 was digested with the enzymes PstI and Pvull in order to obtain a nucleotide fragment of 4.145 kb.

Step 3: The 6.3 kb nucleotide fragment originating from the vector pOSV017 was ligated to the 4.15 kb fragment originating from the vector pDNR-1, in order to produce the vector pMBD-1, as illustrated in the figure. 30.

15.2 Construction of the vector pMBD-2

The vector pMBD-2 is a vector of the BAC type containing an integrative box "φc31 int-Ωhyg". φc31 is a temperate phage with a broad host spectrum whose attachment site (attP) is well located. The φc31 int fragment is the minimal fragment of the φc31 actinophagus capable of inducing the integration of a plasmid into the chromosome of Streptomyces Lividans.

Ωhyg is a derivative of the interposon Ω capable of conferring resistance to hygromicine in E. coli and S. Lividans.

BAC vectors containing the integration system φc31 are described by SOSIO et al. (2000) and in PCT application No. 99 6734 published on December 29, 1999.

The BAC pmBD-2 vector was constructed according to the following steps:

Step 1: Construction of an integrative box intc31 int Ωhyg in a multicopy plasmid of E.coli. The φc31 int fragment was first amplified from the plasmid pOJ436 using the following pair of primers:

- The primer EVφc31 l (SEQ ID No. 109) (which makes it possible to introduce an EcoRV site at the 5 ′ end of the sequence φc31) and the primer Bllφc31 F (SEQ ID No. 110) (which allows 'introduction of a BgLII site at the 3' end of the sequence φc31). The Ωhyg fragment was obtained by digestion using the enzyme BamHI from the plasmid pHP45 Ωhyg described by BLONDELET-ROUAULT (1997).

Then the integrative box φc31 int-Ωhyg was cloned into the vector pMCS5 digested with the enzymes Bglll and EcoRV.

Step 2: Construction of the vector pMBD-2.

The bacterial artificial chromosome pBAce3.6 described by FRENGEN et al. (1999) was digested with the enzyme Nhel and then treated with the enzyme Eco polymerase.

Then, the vector pMCS5 φc31 int-Ωhyg was digested with the enzymes SnaBI and EcoRV in order to recover the integrative box.

The detailed map of the vector pMBD2 is shown in Figure 31.

15.3 Construction of the vector pMBD-3.

The vector pMBD-3 is an integrative (φc31 int) and conjugative (OriT) vector of the BAC type, which comprises the selection marker Ωhyg.

The vector map pMBD-3 and its construction method are illustrated in Figure 31.

The vector pMBD-3 was obtained by amplifying the OriT gene from the plasmid pOJ436 using the pair of primers with sequences SEQ ID No. 111 and SEQ ID No. 112 which contain pacl restriction sites.

The nucleotide fragment amplified using the primers SEQ ID No. 111 and SEQ ID No. 112 was cloned into the vector pMBD2 previously digested with the enzyme Pac1. The construction diagram of the vector pMBD-3 is illustrated in FIG. 31. 15.4 Construction of the DMBD-4 vector

The detailed map of the vector pMBD-4 is represented in FIG. 32. The vector pMBD4 was obtained by cloning the integrative box φc31 int-Ωhyg into the vector pCYTAC2.

15.5 Construction of the vector pMBD-5

The construction diagram of the vector pMBD-5 is illustrated in FIG. 33.

The vector pMBD-5 was constructed by recombination of the nucleotide fragment comprised between the two loxP sites of the vector pMBD-1 illustrated in FIG. 33 with the loxp site contained in the BAC vector designated pBTP3, a detailed map of the plasmid pBTP3 being represented at Figure 34.

15.6 Construction of the vector pMBD-6

The vector pMBD-6 was constructed by recombining the nucleotide fragment comprised between the two loxP sites of the vector pMBD-1 at the level of the loxP site of the BAC vector pBeloBad 1, as shown in FIG. 35.

TABLE 1 Location of the samples and characteristics of the soils used in the different experiments. Direct microbial counts using acridine orange staining were performed before and after grinding the soil

n = 3; standard deviation in parentheses.

TABLE 2

Primers and probes used for PCR amplification and task hybridization

4-r

^a) The positions on the E.coli 16S rRNA gene are given in parentheses. For β. anthracis and S. lividans, primers and probes target specific chromosomal sequences of the respective organisms. These sequences are not localized in the 16S rRNA gene. The cassette containing the target region of S. lividans is described by Clerc-Bardin et al. (non published).

TABLE 3

Quantity of DNA extracted from different soils after lysis treatments according to protocols 1 to 5 (μg DNA / g dry weight of soil ± standard deviation) ³

Solsl, 2, 3 and 6; n = 3; sol 4: n = 1.

Sol Protocol of Ivse number ¹³

Number and origin 1 2 3 4a 4b 5a 5b

1. Australia 17 +/- 2 52 +/- 2 32 +/- 5 16 +/- 3 33 +/- 2 59 +/- 1 27 +/- 0

2. Peyrat 29 +/- 2 58 +/- 1 40 +/- 2 29 +/- 2 18 + / 3 56 +/- 1 15 +/- 1

3.Côte St-André 36 +/- 7 60 +/- 6 148 +/- 10 94 +/- 7 38 +/- 6 73 +/- 5 47 +/- 6

4. Chazay 9 16 ND 32 15 15 70

6. Dombes 4 +/- 2 26 +/- 3 43 +/- 1 61 +/- 66 +/- 1 160 +/- 7 102 +/- 5

³ Quantification by phosphorescence imaging after task hybridization with the universal probe FGPS431

(table 2). ^b 1: No treatment; 2: dry grinding of the soil (G); 3: Cr + homogenization Ultraturax (H);

4a: G + H + Microtip sonication (MT); 4b: G + H + Sonication Cup Horn (CH); 5a: Cr + H + NT + chemical / enzymatic lysis. See also figure 1. ^c ND = Not determined.

Table 4:

Primers and probes used in the molecular characterization of DNA extracted from the soil

position on the Escherichia coli 6S RNA gene

Table 5:

Extraction efficiency of bacterial cells on Nycodenz gradient and quantities of DNA extracted.

Effect of incubating the soil sample in a 6% yeast extract solution,

-J

b: Enumeration on solid medium Trypcase-Soy 10% c: Enumeration on solid medium HV Agar, after enrichment for 20 minutes at 40 ° C in a solution of yeast extract

6% - SDS 0.05%. d: The quantity of DNA extracted was evaluated on an electrophoresis gel relative to a standard range of calf thymus DNA. e: The quantification was carried out after digestion of the agarose by the action of a b-agarase

Table 6: Characterization of the DNAs extracted according to their proportion in a, b, and g subclasses of Proteobacteria, in Gram + with low GC% and in Actinomycetes; the hybridization signal with the prokaryotic probe serving as a 100% reference.

vs

a: grinding in a tungsten ball mill, with centrifugal force (extraction protocol described in article Frostegard et al.)

YE: 6% yeast extract solution

Table 7: Diversity of βS DNA sequences contained in the cosmid library

sO

TABLE 7 (continued 1)

Diversity of ΘS DNA sequences contained in the cosmid library

O

TABLE 7 (continued 2)

Diversity of ΘS DNA sequences contained in the cosmid library

Ludwig (1997)

TABLE 9: Sequences

TABLE 9 (continued 1): Sequences

TABLE 9 (continuation 2): Sequences

TABLE 9 (continued 3) Sequences

REFERENCES

• Amann, R. I., W. Ludwig, and K.-H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143-169.

• Atschul SF, Madden TL, Schâffer AA, Zhang J., Zhang Z., Miller W., Lipman DJ (1997) "Gapped BLAST and PSI-BLAST: a nex generation of protein databses search programs" Nucleic Acid Researchs Vol 25: 3389- 3404

• Atschul SF et al., 1990, J. Mol Biol, 215: 403-410.

• Bakken, L. R. 1985. Separation and purification of bacteria from soil. Appl. About. Microbiol. 49: 1482-1487.

• Bibb MJ, Findlay PR, Johnson MW, The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences., Gene 30: 1-3, 157-66, Oct, 1984.

• Biesiekierska-Galguen M. (1997) "Biological attenuation of xenobiotic contaminants in the soil - lindane model" Diploma of DEΞA National de Toxicologie, Université Claude Bernard Lyon I.

• Blondelet-Rouault MH, Weiser J, Lebrihi A, Branny P, Pernodet JL.

Institute of Genetics and Microbiology, URA CNRS 2225, University of Paris XI, Orsay, France. Gene 1997 May 6; 190 (2): 315-7

• Borchert S et al., 1992, Microbiology Letters, 92: 175-180

• BLONDELET-ROUAULT, 1997, Gene, 315-317. • Boccard, F., Smokvina, T. Pernodet, JL Friedmann, A. & Guerineau

M. (1989). The integrated conjugative plasmid pSAM2 of Streptomyces ambofaciens is related to temperature bacteriophages. Embo J 8,973-80

• Chatzinotas A., Sandaa RA., Schônhuber W., Amanna R., Daae FL, Torsvik V., Zeyer J., Hahn D. (1998) "Analysis of broad-scale differences in microbial community composition of two pristine forest soils "Systematic and Applied Microbiology -J \ 21: 579-587

• Clegg, C. D., K. Ritz, and B. S. Griffiths. 1997. Direct ectraction of microbial community DNA from humified upland soils. Lett. Appl. Microbiol. 25: 30-33.

• Clerc-Bardin, S., J.-L. Pernodet, A. Frostegard, and P. Simonet.

Development of a conditional suicide System for a Streptomyces lividans strain and its use to investigate conjugative transfer in soil. Submitted.

• Elledge SJ, Mulligan JT, Ramer SW, Spottswood M, Davis RW.

Department of Biochemistry, Baylor College of Medicine, Houston, TX 77030. Proc Natl Acad Sci U S A 1991 Mar 1; 88 (5): 1731-5

• Engelen, B., K. Meinken, F. Von Wintzingerode, H. Heuer, H.-P. Malkomes, and H. Backhaus. 1998. Monitoring impact of a pesticide treatment on bacterial soil communities by metabolic and genetic fingerprinting in addition to conventional testing procedures. Appl. About. Microbiol. 64: 2814-2821.

• Farrelly, V., F. A. Rainey, and E. Stackebrandt. 1995. Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species. Appl. About. Microbiol. 61: 2798-2801.

• Faulkner D.V., Jurka J. (1988) "Multiple Aligned Séquence Editor (MASE)" Trends in Biochemical Sciences Vol 13: 321-322

• FRENGEN et al., 1999, Genomics, 58: 250-258. • Frostegard, A., Tunlid, A., and Bââth, E. 1991. Microbial biomass measured as total lipid phosphate in soils of different organic content. J. Microbiol. Meth. 14: 151-163.

• Giddings, G. 1998. The release of genetically engineered micro-organisms and viruses into the environment. New Phytol. 140: 173-184.

• Gladek, A., and J. Zakrzewska. 1984. Genome size of Streptomyces. FEMS Microbiol. Lett. 24: 73-76.

• Gribskov M, Devereux J, Burgess RR, The codon preference plot: graphie analysis of protein coding sequences and prediction of gene expression., Nucleic Acids Res 12: 1 Pt 2, 539-49, Jan 11, 1984.

• Guiney et al., 1983, Proc. Natl. Acad. Sci USA, (12): 3595-3598.

• Gourmelen, A. Blondelet-Rouault, M.H. & Pernodet, J.L. (1998). Characterization of a glycosyl transferase inactivating macrolides, encoded by gimA from Streptomyces ambofaciens, Antimicrob Agents Chemother 42, 2612-9.

• Hayakawa, M., and H. Nonomura. 1987. Humic acid-vitamin agar, a new medium for the selective isolation of soil actinomycetes. J. Ferment. Technol. 65: 501-509.

• Hayakawa, M., Ishizawa K., and H. Nonomura. 1988. Distribution of rare actinomycetes in Japanese soils. J. Ferment. Technol. 66: 367-373.

• Hickey, R. J., and H. D. Tresner. 1952. A cobalt containing medium for sporulation of Streptomyces species. J. Bacteriol. 64: 891-892.

• Hintermann, G., R., Crameri, Kieser, T., and R. Hϋtter. 1981. Restriction analysis of the Streptomyces glaucescens genome by agarose gel electrophoresis. Arch. Microbiol. 130: 218-222. • Holben, WE, JK Jansson, BK Chelm, and JM Tiedje. 1988. DNA probe method for the detection of specifies microorganisms in the soil bacterial community. Appl. About. Microbiol. 54: 703-711.

• Hong Fu et al., 1995, Molecular diversity, 1: 121-124

• Hopwood DA, Bibb M J, Chater K F, Kieser T., Bruton C.J., Kieser H.M., Lydiate D.J., Smith C.P., Ward J.M. and Scrempf H. 1985. Genetic Manipulation of Streptomyces. A Laboratory manual. The John Innés Foundation, Norwich, U.K.

• Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985. Genetic manipulation of streptomyces - a laboratory manual. The John Innés Foundation, Norwich, United Kingdom.

• Hohm B. and Collins J., 1980, Gene, 11: 291-298.

• Horinouchi S., Malpartida F., Hopwood D. and Beppu T., Mol. Gen. Broom. (1989) 215: 355-357.

• Imai R., Nagata Y., Fukuda M., Takagi M., Yano K. (1991) "Molecular cloning of a Pseudomonas paucimobilis gene encoding a 17-kilodalton plypeptide that eliminates HCI molecules from? -Hexachlorocyclohexane" Journal of Bacteriology Vol 17 ", No21: 6811-6819

• Jacobsen, C. S., and O. F. Rasmussen. 1992. Development and application of a new method to extract bacterial DNA from soil based on separation of bacteria from soil with cation-exchange resin. Appl. About. Microbiol. 58: 2458-2462.

Jae-Hyuk YU and Léonard TJ, 1995. Sterigmetseytin biosynthesis in Aspergilus nidulans requires a ... type I polyketide synthase. J. Bacteriol, (August): 4792-4800. • Ka, JO, WE Holben, and JM Tiedje. 1994. Analysis of competition in soil among 2,4-dichlorophenoxyacetic acid-degrading bacteria. Appl. About. Microbiol. 60: 1121-1128.

• Kah-Tong S et al., 1997, J Bacteriol, G179 (23): 7360-7368

• Kimura M. (1980) "A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences" Journal of Molecular Evolution Vol 16: 111 -120

• Kuske, C. R., K. L. Banton, D. L. Adorada, P. C. Stark, K. K. Hill, and P. J. Jackson. 1998. Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil. Appl. About. Microbiol. 64: 2463-2472.

• Lacalle RA, Pulido D, Vara J, Zalacain M, Jimenez A. Centro de Biologia Molecular (CSIC-UAM), Universidad Autonoma, Canto Blanco, Madrid, Spain. Gene 1989 Jul 15; 79 (2): 375-80

• Lee, S. -Y., J. Bollinger, D. Bezdicek, and A. Ogram. 1996. Estimate of the abundanee of an uncultured soil bacterial strain by a competitive quantitative PCR method. Appl. About. Microbiol. 62: 3787-3793.

• Leff, L. G., J. R. Dana, J. V. McArthur, and L. J. Shimkets. 1995. Comparison of methods of DNA extraction from stream sediments. Appl. About. Microbiol. 61: 1141-1143.

• Liesack, W., and E. Stackebrandt. 1992. Occurrence of novel groups of the domain Bacteria as revealed by analysis of genetic material isolated from an Australian terrestrial environment. J. Bacteriol. 174: 5072-5078.

• Liesack, W., PH Janssen, FA Rainey, NL Ward-Rainey, and E. Stackebrandt. 1997. Microbial diversity is soil: the need for a combined approach using molecular and cultivation techniques. In JD Van Elsas, J. T. Trevors, and EMH Wellington (ed.), Modem soil microbiology, Marcel Dekker, Inc., New York, (p 375-439)

• Lorentz, M. G., and W. Wackernagel. 1994. Bacterial gene transfer by natural genetic transformation in the environment. Microbiol. Reviews 58: 563-602.

• Maidak BL, Cole JR, Parker CT, Garrity GM, Larsen N., Li B., Lilburn TG, McCaughey MJ, Olsen GJ, Overbeek R., Pramanik S., Schmidt TM, Tiedje JM, Woese CR (1999) " A new project of the RDP (Ribosomal Database Project) "Nucleic Acids Research Vol 27: 171-173

• Mazodier P. et al., 1989, J. Bacteriol., 171 (6): 3583-3585.

• More, M. L, J. B. Herrick, M. C. Silva, W. C. Ghiorse, and E. L. Madsen.

1994. Quantitative cell lysis of indigenous microorganisms and rapid extraction of microbial DNA from sediment. Appl. About. Microbiol. 60: 1572-1580.

• Murakami T, Holt TG, Thompson CJ, Microbiological Engineering Unit, Institut Pasteur, Paris, France. J. Bacteriol 1989 Mar; 171 (3): 1459-66

• Nagata Y., Hatta T., Imai R., Kimbara K., Fukuda M., Yano K., Takagi M.

(1993) "Purification and characterization of? -Hexachlorocyclohexane (? - HCH) dehydrochlorinase (LinA) from Pseudomonas paucimobilis" Bioscience, Biotechnology and Biochemistry Vol 57 No 9: 1582-1583

• Nalin R., Simonet P., Vogel T.M., Normand P. (1999) "Rhodanobacter lindaniclasticus gen.nov., Sp., Nov., A lindane-degrading bacterium" International Journal of Systematic Bacteriology Vol 49: 19-23

• Nesme, X., C. Picard, and P. Simonet. 1995. Specifies DNA sequences for detection of soil bacteria. In JT Trevors, and JD van Elsas (ed.), Nucleic acids in the environment, methods and application. Springer Lab Manual. (p 111-139) • Nilsson B, Uhlen M, Josephson S, Gatenbeck S, Philipson L. Nucleic Acids Res 1983 Nov 25; 11 (22): 8019-30

• Normand P. et al., 1995, Océanis, 21 (1): 31-56

• Ogram, A. V., M. L. Mathot, J. B. Harsh., J. Boyle, and C. A. Pettigrew,

JR. 1994. Effects of DNA polymer length on its adsorption to soils. Appl. About. Microbiol. 60: 393-396.

• Ogram, A., G. S. Sayler, and T. Barkay. 1987. The extraction and purification of microbial DNA from sediments. J. Microbiol. Methods 7: 57-66.

• Olsen, R. A., and Bakken, L. R. 1987. Viability of soil bacteria: optimization of the plate-counting technique. Microb. School. 13: 59-74.

• Paget, E., L. Jocteur Monrozier, and P. Simonet. 1992. Adsorption of DNA on clay ores: protection against DNasel and influence on gene transfer. FEMS Microbiol. Lett. 97: 31-40.

• Patra, G., P. Sylvestre, V. Ramisse, J. Thérasse, and J.-L. Guesdon.

1996. Isolation of a specifies chromosomic DNA sequence of Bacillus anthrasis and its possible use in diagnosis. FEMS Immunol. Medical Microbiology 15: 223-231.

• Pernodet J.L. Fish, S. Blondelet-Rouault, M.H. & Cundliffe, E. (1996). The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using a specifieally deleted, antibiotic-sensitive strain of Streptomyces lividans. Antimicrob Agents Chemother 4O, 581, 5.

• Pernodet J.L., Gourmelen, A., Blondelet-Rouault, M.H. & Cundliffe, E.

(1999). Dispensable ribosomal resistance to spiramycin conferred by srmA in the spiramycin producer Streptomyces ambofaciens. 145, 2355-64.

• Picard, C, C. Ponsonnet, X. Nesme, and P. Simonet. 1992. Detection and enumeration of bacteria in soil by direct DNA extraction and polymerase chain reaction. Appl. About. Microbiol. 58: 2717-2722. • Preud'homme, J., Belloc, A., Charpentié, Y., and Tarridec, P. 1965. An antibiotic formed from two groups of synergistically active components: pristinamycin CR Acad. Sci. 260: 1309-1312.

• Priemé, A., J. I. B. Sitaula, A. K. Klemedtsson, and L. R. Bakken. 1996. Extraction of methane-oxidizing bacteria from soil particles. FEMS Microbiol. School. 21: 59-68.

• Prosser, J. 1994. Molecular marker Systems for detection of genetically engineered micro-organisms in the environment. Microbiol. 140: 5-17.

• Raynal A, Tuphile K, Gerbaud C, Luther T, Guérineau M, Pernodet JL;

Laboratory of Molecular Biology and Genetics, Institute of Genetics and Microbiology, URA CNRS 2225, Paris-Sud University, Orsay, France. Mol Microbiol 1998 Apr; 28 (2): 333-42

• Raynald A. Tuphile, K. Gerbaud, C, Luther, T. Guérineau, M. & PERNODET, J.L. (1998). Structure of the chromosomal insertion site for pSAM2: functional analysis in Escherichia coli. Mol. Microbiol 28, 333-42.

• Richard, G. M. 1974. Modifications of the diphenylamine reaction giving increased sensitivity and simplicity in the estimation of DNA. Analytical Biochem. 57: 369-376.

• Romanowski, G., M. G. Lorentz, and W. Wackernagel. 1993. Use of polymerase chain reaction and electroporation of Escherichia coli to monitor the persistence of extracellular plasmid DNA introduced into natural soils. Appl. About. Microbiol. 59: 3438-3446.

• Saitou N., Nei M. (1987) "The Neighbor-Joining method: a new method for reeonstrueting phylogentie trees" Molecular and Biological Evolution Vol 2: 112-118 • Sambrook J., Fritsch EF and Maniatis T. 1996. Molecular cloning: a laboratory manual, 2 ^nd ed. Cold spring Harbor Laboratory Press, Cold Sring Harbor, NY

• Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

• Senoo K., Wada H. (1989) "Isolation and identification of an aerobic? - HCH-decomposing bacterium from soil" Soil Science, Plant Nutrition Vol 35, No 1: 79-87.

• Sezonov, G., Blanc, V., Bamas-Jacques, N., Friedmann, A. Pernodet, J.L. & Guérineau, M. (1997). Complete conversion of antibiotic preeursor to pristinamycin MA by overexpression of Streptomyces pristinae biosynthetics genes. Nat Biotechnol 15,349-53.

• Shirling, E. B., and D. Gottlieb. 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 16: 313-340.

Shizuga et al., 1992, Proc. Natl. Acad. Sci USA, 89: 8794-8797.

• Siefert, J. L., and G. E. Fox. 1998. Phylogenetic mapping of bacterial morphology. Microbiology 144: 2803-2808.

• Simonet, P., P. Normand, A. Moiroud, and R. Bardin. 1990. Identification of Frankia strains in nodules by hybridization of polymerase chain reaction products with strain-specific oligonucleotide probes. Arch. Microbiol. 153: 235-240.

• Smalla, K., N. Cresswell, L. Mendonca-Hagler, A. Wolters, and D. J. van Elsas. 1993. Rapid DNA extraction protocol from soil for polymerase chain reaction-mediated amplification. J. Appl. Bacteriol. 74: 78-85.

• SOSIO M. et al. 2000, Nature Biotechnology, vol.18,: 343-345. • Smit, E., P. Leeflang, and K. Wernars. 1997. Detection of shifts in microbial community structure and diversity in soil caused by copper contamination using amplified ribosomal DNA restriction analysis. FEMS Microbiol. School. 23: 249-261.

• Smokvina T, Mazodier P, Boccard F, Thompson CJ, Guérineau M.

Molecular Biology and Genetics Laboratory, Paris-Sud University, Orsay, France. Gene 1990 Sep 28; 94 (1): 53-9

• Smolvina, T., Mazodier, P. Boccard, F. Thompson, C.J. & Guérineau, M. (1990). Construction of a series of pSAM2-based integrative vectors for use in actinomycetes. Gene 94, 53-9.

• Stackebrandt, E. 1988. Phylogenetic relationships vs. phenotypic diversity: how to achieve a phylogenetic classification System of the eubacteria. Can. J. Microbiol. 34: 552-556.

• Staneck, J. L., and G. D. Roberts. 1974. Simplified approach to identification of aerobics Actinomycetes by thin-layer chromatography. Appl. Microbiol. 28: 226-231.

• Stapleton, R. D., S. Ripp, L. Jimenez, S. Cheol-Koh, J. T. Fleming, I. R. Gregory, and G. S. Sayler. 1998. Nucleic acid analytical approaches in bioremediation: site assessment and characterization. J. Microbiol. Methods 32: 165-178.

• Steffan, R. J., J. Goksoyr, A. K. Bej, and R. Atlas. 1988. Recovery of DNA from soils and sediments. Appl. About. Microbiol. 54: 2908-2915.

• Tebbe, C. C, and W. Vahjen. 1993. Interference of humic acids and DNA extracted direetly from soil in detection and transformation of recombinant DNA from bacteria and a yeast. Appl. About. Microbiol. 59: 2657-2665. • Tercero JA, Espinosa JC, Lacalle RA, Jimenez A. Centro de Biologia Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientificas, Madrid, Spain. J Biol Chem 1996 Jan 19; 271 (3): 1579-90

• Thomas JC, Berger F., Jacquier M., Bernillon D., Baud-Grasset F., Truffaut N., Normand P., Vogel T .M., Simonet P. (1996) "Isolation and Characterization of a novel? -Hexachlorocyclohexane-degrading bacterium "Journal of Bacteriology 'o \ 178, No20: 6049-6055

• Torsvik, V. L. 1980. Isolation of bacterial DNA from soil. Soil Biol. Biochem. 12: 15-21.

• Torsvik, V., R. Sorheim, and J. Goksoyr. 1996. Total bacterial diversity in soil and sediment communities - a review. J. Ind. Microbiol. 17: 170-178.

• Tsai, Y.-L., and B. Oison. 1991. Rapid method for direct extraction of DNA from soil and sediments. Appl. About. Microbiol. 57: 1070-1074.

• Umeyama T., Tanabe Y., Aigle B.D. and Horinuochi S., FEMS (1996) 144: 177-184.

• Van Elsas, J. D., G. F. Duarte, A. S. Rosado, and K. Smalla. 1998. Microbiological and molecular biological methods for monitoring microbial inoculants and their effects in the soil environment. J. Microbiol. Methods 32: 133-154.

• Van Elsas, J. D., V. Màntynen, and A. C. Wolters. 1997. Soil DNA extraction and assessment of the fate of Mycobacterium chlorophenolicum strain PCP-1 in different soils by 16S ribosomal RNA gene sequence based most-probable-number PCR and immunofluoreseenee. Biol. Fert. Soils 24: 188-195.

• Volff JN et al., 1996, Mol. Microbiol., 21 (5): 1037-1047.

• Volossiouk, T., EJ Robb, and RN Nazar. 1995. Direct DNA extraction for PCR-mediated assays. Appl. About. Microbiol. 61: 3972-3976. • Wahl GM, Lewis KA, Ruiz JC, Rothenberg B, Zhao J, Evans GA. Proc Natl Acad Sci USA 1987 Apr; 84 (8): 2160-4

• Waksman, S. A. 1961. Williams and Wilkins (ed.) The actinomycetes. Classification, identification and description of gene and species.Vol 2. Baltimore.

• Ward, D. M., R. Weller, and M. M. Bateson. 1990. 16S rRNA sequences reveal numerous uncultured microorganisms in a natural community. Nature 344: 63-65.

• Widmer, F., R. J. Seidler, and L. S. Watrud. 1996. Sensitive detection of transgenic plant marker gene persistence in soil microcosms. Mol. School. 5: 603-613.

• Williams, S.T., R. Locci, A. Beswick, D. I. Kurtbôke, V. D. Kuznetsov, F. J. Le Monnier, P. F. Long, K. A. Maycroft, R. A. Palma, B. Petrolini, S. Quaroni, J. I. Todd, and M. West. 1993. Detection and identification of novel actinomycetes. Res. Microbiol. 144: 653-656.

• Wilson, I. G. 1997. Inhibition and facilitation of nucleic acid amplification. Appl. About. Microbiol. 63: 3741-3751.

• Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271.

Yannish-Perron et al., 1985, Gene, 33 (1): 103-119.

• Zasiavsky, B. Y. 1995. Separation of biomolecules, p. 503-667. In Aqueous two-phase partitioning. Boris Y. Zasiavsky (ed.) Physieal Chemistry and Bioanalytical Applications, Marcel Dekker, Inc., New York.

• Zhou, J., M. A. Bruns, and J. M. Tiedje. 1996. DNA recovery from soils of diverse composition. Appl. About. Microbiol. 62: 316-322.

Claims

1. A method of preparing a collection of nucleic acids from a soil sample containing organisms, said method comprising the following succession of steps:

- 1 (a) Obtaining micro-particles by grinding a sample of previously dried or desiccated soil, then suspending the micro-particles in a liquid buffer medium; and

(b) extraction of the nucleic acids present in the microparticles; and

(c) - passage of the solution containing the nucleic acids over a molecular sieve, then recovery of the elution fractions enriched in nucleic acids and passage of the elution fractions enriched in nucleic acids on an anion exchange chromatography support , then recovery of the elution fractions containing the purified nucleic acids.

2. Method for preparing a collection of nucleic acids from a sample of the environment containing organisms, said method comprising the following succession of steps:

- It (i) Obtaining a suspension by dispersing the sample from the environment in a liquid medium and then homogenizing the suspension by gentle stirring; and

(ii) separation of the organisms and other mineral and / or organic constituents from the homogeneous suspension obtained in step (i) by centrifugation on a density gradient; and

(iii) lysis of the organisms separated in step (ii) and extraction of the nucleic acids; and

(iv) purification of the nucleic acids on a cesium chloride gradient.

3. Method according to claim 1, characterized in that step I- (a) is followed by a complementary step of:

- treatment of micro-particles in suspension in a liquid buffer medium by sonication;

4. Method according to claim 1, characterized in that step l- (a) is followed by the following additional steps:

- incubation of the suspension at 37 ° C after sonication in the presence of lysozyme and achromopeptidase;

- addition of SDS

- recovery of nucleic acids.

5. Method according to claim 1, characterized in that step I- (a) is followed by the following additional steps:

- homogenization of the micro-particles using a violent mixing step (vortex) followed by a simple stirring step;

- freezing of the homogeneous suspension followed by thawing;

- treatment by sonication of the suspension after thawing;

- addition of SDS;

6. Process according to one of claims 1 to 5, characterized in that the nucleic acids are DNA molecules.

7. A method of preparing a collection of recombinant vectors, characterized in that the nucleic acids obtained by the method according to one of claims 1 to 6 are inserted into a cloning and / or expression vector.

8. Method according to claim 7, characterized in that the nucleic acids are separated according to their size prior to their insertion into the cloning and / or expression vector.

9. Method according to claim 7, characterized in that the average size of the nucleic acids is made substantially uniform by physical rupture, prior to their insertion into the cloning and / or expression vector.

10. Method according to claim 7, characterized in that the cloning and / or expression vector is of the plasmid type.

11. Method according to claim 7, characterized in that the cloning and / or expression vector is of the cosmid type.

12. Method according to claim 11, characterized in that it is a replicative cosmid in E. coli and integrative in Streptomyces.

13. Method according to claim 12, characterized in that it is the cosmid pOS700l.

14. Method according to claim 11, characterized in that it is a conjugative and integrative cosmid in Streptomyces.

15. The method of claim 14, characterized in that the cosmid is chosen from the cosmids pOSV303, pOSV306 and pOSV307.

16. The method of claim 11, characterized in that it is a replicative cosmid both in E. coli and in Streptomyces.

17. The method of claim 16, characterized in that it is the cosmid pOS 700R.

18. The method of claim 11, characterized in that it is a replicative cosmid in E. coli and Streptomyces and conjugative in Streptomyces.

19. The method of claim 7, characterized in that the cloning and / or expression vector is of the BAC type.

20. The method of claim 19, characterized in that it is an integrative and conjugative BAC vector in Streptomyces.

21. Method according to claim 20, characterized in that the vector is chosen from the BAC vectors pOSV403, pMBD-1, pMBD-2, pMBD-3, pMBD-4, pMBD-5 and pMBD-6.

22. Method for preparing a recombinant cloning and / or expression vector, characterized in that the step of inserting a nucleic acid into the cloning and / or expression vector comprises the following steps:

- add a first homopolymeric nucleic acid to the free 3 'end of the open vector;

- Add a second homopolymeric nucleic acid, of sequence complementary to the first homopolymeric nucleic acid, at the free 3 'end of the nucleic acid of the collection to be inserted into the vector;

- Assemble the nucleic acid of the vector and the nucleic acid of the collection by hybridization of the first and of the second homopolymeric nucleic acid of sequences complementary to each other;

- close the vector by ligation.

23. Method according to claim 22, characterized in that:

- the first homopolymeric nucleic acid is of poly (A) or poly (T) sequence; and

- the second homopolymeric nucleic acid is of poly (T) or poly (A) sequence.

24. Method for preparing a recombinant vector according to one of claims 22 or 23, characterized in that the size of the nucleic acid to be inserted is at least 100 kilobases, preferably at least 200 kilobases.

25. Method for preparing a recombinant vector according to one of claims 22 to 24, characterized in that the nucleic acid to be inserted is contained in the collection of nucleic acids obtained by the method according to one of claims 1 to 6.

26. A method for preparing a recombinant cloning and / or expression vector, characterized in that the step of inserting a nucleic acid into the cloning and / or expression vector comprises the steps following:

- Opening of the cloning and / or expression vector at a chosen cloning site, using an appropriate restriction endonuclease;

- creation of blunt ends at the ends of the nucleic acid of the vector by elimination of the outgoing 3 'sequences and filling of the outgoing 5' sequences, then dephosphorylation of the 5 'ends;

- Addition of complementary oligonucleotide adapters;

27. A method of preparing a recombinant vector according to claim 26, characterized in that the size of the nucleic acid to be inserted is at least 100 kilobases, preferably at least 200 kilobases.

28. Method for preparing a recombinant vector according to one of claims 26 or 27, characterized in that the nucleic acid to be inserted is contained in the collection of nucleic acids obtained by the method according to one of claims 1 to 6.

29. Method according to one of claims 22 to 28, characterized in that the nucleic acids are inserted as such, without treatment with one or more restriction endonucleases prior to their insertion into the cloning and / or expression vector.

30. Collection of nucleic acids consisting of the nucleic acids obtained by the process according to one of claims 1 to 6.

31. Nucleic acid characterized in that it is contained in the collection of nucleic acids according to claim 30.

32. Nucleic acid according to claim 31, characterized in that it comprises a nucleotide sequence encoding at least one operon, or part of an operon.

33. Nucleic acid according to claim 32, characterized in that the operon codes for all or part of a metabolic pathway.

34. Nucleic acid according to claim 33, characterized in that the metabolic pathway is the pathway for the synthesis of polyketides.

35 Nucleic acid according to claim 34, characterized in that it is chosen from polynucleotides comprising the sequences SEQ ID N ° 30 to 44 and SEQ ID N ° 115 to 120.

36. Nucleic acid according to claim 31, characterized in that it comprises the whole of a nucleotide sequence coding for a polypeptide

37. Nucleic acid according to one of claims 31 to 36, characterized in that it is of prokaryotic origin.

38. Nucleic acid according to claim 37, characterized in that it comes from a bacterium or a virus.

39. Nucleic acid according to one of claims 31 to 33 and 36, characterized in that it is of eukaryotic origin.

40. Nucleic acid according to claim 39, characterized in that it comes from a fungus, a yeast, a plant or an animal.

41. Recombinant vector characterized in that it is chosen from the following recombinant vectors: a) a vector comprising a nucleic acid according to one of claims 35 to 40; b) a vector obtained according to the method of one of claims 22 to 25 and 29; c) a vector obtained according to the method of one of claims 26 to 29.

42 Vector characterized in that it is the cosmid pOS 700I.

43. Vector characterized in that it is the cosmid pOSV303.

44. Vector characterized in that it is the cosmid pOSV306.

45. Vector characterized in that it is the cosmid pOSV307.

46. Vector characterized in that it is the cosmid pOS 700R.

47. Vector characterized in that it is the vector BAC pOSV403.

48. Vector characterized in that it is the vector pMBD-1.

49. Vector characterized in that it is the vector pMBD-2

50. Vector characterized in that it is the vector pMBD-3.

51. Vector characterized in that it is the vector pMBD-4.

52. Vector characterized in that it is the vector pMBD-5.

53. Vector characterized in that it is the vector pMBD-6.

54. Collection of recombinant vectors as obtained according to the method of one of claims 7 to 21, 25 and 28.

55. Recombinant cloning and / or expression vector characterized in that it is contained in the collection of recombinant vectors according to claim 54.

56 Recombinant host cell comprising a nucleic acid according to one of claims 31 to 40 or a recombinant vector according to claim 55.

57. Recombinant host cell according to claim 56, characterized in that it is a prokaryotic or eukaryotic cell.

58. Recombinant host cell according to claim 57, characterized in that it is a bacterium.

59. Recombinant host cell according to claim 58, characterized in that it is a bacterium chosen from E. coli and Streptomyces.

60. Recombinant host cell according to claim 58, characterized in that it is a yeast or a filamentous fungus.

61. Collection of recombinant host cells, each of the constituent host cells of the collection comprising a nucleic acid of the collection of nucleic acids according to claim 30.

62. Collection of recombinant host cells, each of the constituent host cells of the collection comprising a recombinant vector according to one of claims 41 or 55.

63. Method for detecting a nucleic acid of determined nucleotide sequence, or of nucleotide sequence structurally related to a determined nucleotide sequence, in a collection of recombinant host cells according to one of claims 61 or 62, characterized in that it comprises the following steps:

- carry out at least three amplification cycles;

- detect possibly amplified nucleic acid.

64. A method of detecting a nucleic acid of determined nucleotide sequence, or of nucleotide sequence structurally related to a determined nucleotide sequence, in a collection of recombinant host cells according to one of claims 61 or 62, characterized in that it includes the following steps:

65. Method for identifying the production of a compound of interest by one or more recombinant host cells in a collection of recombinant host cells according to one of claims 61 or 62, characterized in that it comprises the following steps:

- culture of the recombinant host cells of the collection in an appropriate culture medium;

- Detection of the compound of interest in the culture supernatant or in the cell lysate of one or more of the recombinant host cells cultivated.

66 Method for selecting a recombinant host cell producing a compound of interest from a collection of host cells recombinants according to one of claims 61 or 62, characterized in that it comprises the following stages:

- selection of recombinant host cells producing the compound of interest.

67. Process for the production of a compound of interest characterized in that it comprises the following stages:

- cultivating a recombinant host cell selected according to the method of claim 66;

68. Compound of interest, characterized in that it is obtained according to the method of claim 67.

69. Compound according to claim 68, characterized in that it is a polyketide.

70. Polyketide characterized in that it is produced by the expression of at least one nucleotide sequence comprising a sequence chosen from the sequences SEQ ID N ° 30 to 44 and SEQ ID N ° 115 to 120.

71. Composition comprising a polyketide according to claim 69 or 70.

72. A pharmaceutical composition comprising a pharmacologically active amount of a polyketide according to claim 69 or 70, in association with a pharmaceutically compatible vehicle.

73. Method for determining the diversity of nucleic acids contained in a collection of nucleic acids and more particularly of a collection of nucleic acids originating from a sample of the environment, preferably from a sample of the soil, said method including the following steps:

- carrying out at least three amplification cycles;

- If necessary, compare the results of the previous detection step with the detection results, using the probe or the plurality of probes, of nucleic acids of known sequence constituting a standard range.

74. Method according to claim 73, characterized in that the pair of primers hybridizing to any bacterial 16 S ribosomal DNA sequence consists of the primer FGPS 612 (SEQ ID No. 12) and the primer FGPS 669 (SEQ ID N ° 13).

75. Method according to claim 73, characterized in that the pair of primers hybridizing to any bacterial 16 S ribosomal DNA sequence consists of primer 63 f (SEQ ISD No. 22) and primer 1387 ( SEQ ID No. 23).

76. Nucleic acid comprising a nucleotide sequence of 16S rDNA chosen from sequences having at least 99% nucleotide identity with the sequences SEQ ID No. 60 to SEQ ID No. 106.

77. Process for the production of a polyketide synthase type I, said production process comprising the following steps:

- Obtaining a recombinant host cell comprising a nucleic acid coding for a polyketide synthase type I comprising a nucleotide sequence chosen from the sequences SEQ ID No. 33 to SEQ ID No. 44, SEQ ID No. 30 to SEQ ID No. 32 and SEQ ID N ° 115 to SEQ ID N ° 120. - culture of the recombinant host cells in an appropriate culture medium;

78. Polyketide synthase comprising an amino acid sequence chosen from the sequences SEQ ID N ° 45 to 59 and SEQ ID N ° 121 to SEQ ID N ° 126.

79. Antibody directed against a polyketide synthase according to claim 78.

80. A method of detecting a polyketide synthase type I or of a peptide fragment of this enzyme, in a sample, said method comprising the steps of: a) bringing an antibody according to claim 79 into contact with the sample to be test; b) detecting the antigen / antibody complex possibly formed.

81. Kit for detecting a polyketide synthase type I in a sample comprising: a) an antibody according to claim 79; b) where appropriate, reagents necessary for the detection of the antigen / antibody complex possibly formed.