FR2935146A1 - POLYNUCLEOTIDES REGULATING NEGATIVELY THE EXPRESSION OF SBI PROTEIN - Google Patents

Abstract

The invention relates in particular to a particular isolated polynucleotide, a composition comprising it and its non-therapeutic use for inhibiting the expression of the gene encoding the Sbi protein.

Description

The present invention relates to polynucleotides capable of negatively regulating the expression of the Sbi protein and to their application, in particular for the detection, prevention and / or treatment of a staphylococcal infection. . Staphylococcal infections are widespread throughout the world, affecting both humans and animals. The bacteria of the genus Staphylococcus were discovered by Louis Pasteur in 1880. To date, about twenty species have been identified. Of these, the most commonly encountered in human and / or animal pathology are Staphylococcus epidermidis, Staphylococcus saprophyticus, Staphylococcus hyicus, Staphylococcus intermedius and Staphylococcus aureus. These commensal species are called opportunistic pathogens since they can cause infections under particular conditions.

Thus, Staphylococcus epidermidis may be responsible for infections of the skin, nasal and also of endocarditis and localized infections in immunocompromised patients. Staphylococcus saprophyticus has been identified as responsible for some urinary tract infections. Staphylococcus hyicus and Staphylococcus intermedius may be responsible for various infections in animals such as exudative piglet dermatitis (S. hyicus) or furunculosis of the dog (S. intermedius). The most pathogenic species of Staphylococcus bacteria is Staphylococcus aureus (S. aureus). S. aureus is a member of human commensal flora. However, if mucosal barriers are breached or the host's immune defenses are altered, S.aureus can become an opportunistic pathogen and one of the leading causes of nosocomial infections and community-acquired infections in humans and humans. animals (Lowy, 1998). The pathogenesis of S. aureus-associated disease usually begins with a local infection (eg, infection of a wound, boil, cellulitis) and can then be followed by systemic spread (bacteremia) followed by metastatic infections (eg example endocarditis, osteomyelitis and septic arthritis).

S. aureus is also one of the pathogens most frequently isolated from bovine mastitis in both the United States and Europe. Affected cows then have a drop in milk production which has serious economic consequences for farms.

The study of the molecular mechanisms allowing staphylococcal infection to develop and persist in the colonized organism has shown that one of the main causes of success of staphylococcal infections, in particular S. aureus, is their ability to produce a large number of virulence factors. Some of these factors are exported to the surface of cells and others are excreted in the extracellular environment of the host. Thus, for example, S. aureus is able to bypass the defenses of the host by producing traps of the immune response of the infected host such as the SpA protein (Staphylococcal protein A, Moks et al., 1986) and Sbi protein (S. aureus IgG binding protein).

Sbi protein was originally identified in S. aureus as an IgG immunoglobulin binding protein (Zhang et al., 1998). It has been shown later that its expression is induced by the presence of human IgG (Zhang et al, 2000) and that it precipitates with human IgG (Atkins et al., 2008). It is now established that the Sbi protein also has the ability to interact with components of the innate immune system of the host. Indeed, Sbi is a secreted protein that traps the complement system by fixing and titrating the complement C3 factor (Burman et al, 2008, Upadhyay et al, 2008), the central molecule of the three complement activation pathways. Thus, the Sbi multifunctional protein directly interferes with the host's adaptive immune system via its first two IgG binding domains (Sbi-I and Sbi-II, Atkins et al., 2008) and modulates the innate immune system of the host. host by using the alternative pathway of complement activation via its third and fourth domains (Sbi-III and Sbi-IV, Burman et al., 2008), in particular by the interaction between its fourth domain and the C3 protein of the complement (Upadhyay et al, 2008). So far, the most common treatment for staphylococcal infection is antibiotics such as penicillins (penicillin G, methicillin, oxacillin cephalosporins), macrolides and tetracyclines. However, with the widespread use of antibiotics, the spread of bacterial strains of the genus Staphylococcus, particularly S. aureus, highly resistant to antibiotics, including methicillin (SRM), has increased significantly in recent years and is a clinical challenge. and epidemiological, especially in hospitals. With a view to treatment but also to preventing staphylococcal infection, there is a need in both humans and animals to have new classes of antistaphylococcal agents as alternatives to antibiotics.

The inventors have now isolated polynucleotides which make it possible to solve all or part of the problems mentioned above. These polynucleotides have the ability to negatively regulate the expression of the Sbi protein. The inventors have demonstrated that these polynucleotides hybridize specifically, without the aid of associated chaperone protein, with a particular sequence that they have located at the 5 'end of the messenger RNA (mRNA) encoding the Sbi protein. . By analyzing this particular sequence, the inventors have identified the shine-Dalgarno sequence predicted to interact with 16S ribosomal RNA and the translation initiation codon of the mRNA encoding the Sbi protein. The inventors have shown that the specific hybridization of these polynucleotides with this particular sequence of the mRNA encoding the Sbi protein, prevents the binding of 70S ribosomes to said mRNA. The inventors have demonstrated that these polynucleotides make it possible to reduce the amount of Sbi proteins present in the intracellular medium but also the amount of Sbi proteins released into the extracellular medium and thus to reduce the ability of bacteria of the genus Staphylococcus to interfere with the system. immunity of the host by interacting with some of its components (IgG, C3 protein). These polynucleotides are therefore particularly useful for the prevention and / or treatment of staphylococcal infections, in particular antibiotic-resistant strains. In addition, the polynucleotides according to the invention have the advantage unlike putative treatments, to have a targeted action on bacteria of the genus Staphylococcus thus optimizing their action and limiting the risk of side effects.

Thus, according to a first aspect, the subject of the invention is a first isolated polynucleotide comprising a sequence chosen from the group comprising: the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID NO: 1 and fragments thereof; and the sequence ID No. 2, the derived sequences having at least 70% identity with the sequence SEQ ID No. 2 and the fragments thereof; and the sequence complementary to the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with said complementary sequence and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3. For the purposes of the present invention, the term "polynucleotide" is intended to mean a polymer composed of several nucleotides linked by phosphodiester bonds, such as DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

The polynucleotides according to the invention may be a DNA or an RNA. DNA has the advantage of being more stable than RNA. The sequence ID No. 1 corresponds to the following sequence: embedded image in which the nucleotide at position 23 can be c or t; the nucleotide at position 24 may be c or t; and the nucleotide at position 36 may be a or t. Here is meant by a, t, c, g, u, the nucleotides adenine, thymine, cytosine, guanine and uracil, respectively.

In particular, the first isolated polynucleotide according to the invention comprises a sequence chosen from the group comprising: the sequence SEQ ID No. 1, in which the nucleotides in positions 23, 24 and 36 are t; the sequence SEQ ID No. 1, in which the nucleotides in positions 23 and 24 are c and the nucleotide in position 36 is t; and the sequence SEQ ID No. 1, in which the nucleotides in positions 23, 24 are c and the nucleotide in position 36 is a. The sequence ID No. 2 corresponds to the following sequence: embedded image in which the nucleotide at position 23 can be c or u; the nucleotide at position 24 may be c or u; and the nucleotide at position 36 may be a or u. In particular, the first isolated polynucleotide according to the invention comprises a sequence chosen from the group comprising: the sequence SEQ ID No. 6, the derived sequences having at least 70% identity with the sequence SEQ ID No. 6 and the fragments of these; and the sequence SEQ ID No. 7, the derived sequences having at least 70% identity with the sequence SEQ ID No. 7 and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3.

In particular, the first isolated polynucleotide according to the invention is an RNA comprising a sequence chosen from the group comprising: the sequence SEQ ID No. 2, in which the nucleotides in positions 23, 24 and 36 are u; the sequence SEQ ID No. 2, in which the nucleotides in positions 23 and 24 are c and the nucleotide in position 36 is u; and the sequence SEQ ID No. 2, in which the nucleotides in positions 23, 24 are c and the nucleotide in position 36 is a; and the sequence SEQ ID No. 7, in which the nucleotides at positions 44, 45 and 57 are u; the sequence SEQ ID No. 7, in which the nucleotides at positions 44 and 45 are c and the nucleotide at position 57 is u; and the sequence SEQ ID No. 7, in which the nucleotides at positions 44, 45 are c and the nucleotide at position 57 is a. The first isoform of the sequences SEQ ID No. 2 and SEQ ID No. 7 as defined above (the sequence SEQ ID No. 2, in which the nucleotides in positions 23, 24 and 36 are u and the sequence SEQ ID No. 7, in which the nucleotides at positions 44, 45 and 57 are u) has been identified in particular in S. aureus strain N315. The second isoform of the sequences SEQ ID No. 2 and SEQ ID No. 7 as defined above (the sequence SEQ ID No. 2, in which the nucleotides in positions 23 and 24 are c and the nucleotide in position 36 is and the sequence SEQ ID No. 7, in which the nucleotides at positions 44 and 45 are c and the nucleotide at position 57 is u) has been identified in particular in S. aureus strains MRSA252, Newman. The third isoform of the sequences SEQ ID No. 2 and SEQ ID No. 7 as defined above has been identified in particular in S. aureus strains NCTC8325, Mu50, Mu3, MSSA476, JH1, JH9, MW2, USA300 TCH1516, USA300. FPR3757. The sequence SEQ ID No. 3 corresponds to the following sequence: embedded image The inventors have identified in this sequence SEQ ID No. 3, the first nucleotide corresponding to the 5 'end of the coding mRNA. the Sbi protein, gaaaggg nucleotides localized from position 28 to 34 corresponding to the Shine-Dalgarno sequence predicted to interact with 16S ribosomal RNA and nucleotides Aug located at position 42 to 44 corresponding to the initiation codon of the translation.

For the purposes of the present invention, the term "Sbi protein" is intended to mean the protein of sequence SEQ ID No. 5 and its homologous proteins. Here is meant by homologous protein, the evolutionarily related proteins. Homologous proteins may have structural homology and / or amino acid sequence homology with each other. The amino acid sequences of the homologous proteins may have at least 50% identity with each other, preferably at least 70% identity and most preferably at least 90% identity. The homologous proteins of the Sbi protein may have an amino acid sequence having at least 50% identity, preferably at least 70% identity and most preferably at least 90% identity with the sequence SEQ ID No. 5 . In particular, homologous proteins of the Sbi protein have the ability to bind specifically to complement C3 protein and / or IgG immunoglobulins. As examples of homologous proteins of the Sbi protein, mention may be made of the Efb-C complement inhibitors (Hammel et al., Nat Immunol., 2007), Ehp (Hammel et al., J. Biol Chem., 2007) and SCIN (Rooijakkers et al., 2007). Three-dimensional structure studies by NMR (Nuclear Magnetic Resonance) spectroscopy have shown that the Sbi-IV domain of the Sbi protein of sequence SEQ ID No. 5 has a 3-helix beam conformation similar to that of the complement inhibitors Efb- C, Ehp and SCIN (Upadhyay et al., 2008). Here is meant by homologous sequence, the sequences related in evolution; the homologous sequences may have at least 50% identity between them, preferably at least 70% identity and most preferably at least 90% identity. Bacteria of the genus Staphylococcus within the meaning of the present invention are understood to mean all bacterial strains of the genus Staphylococcus. In particular, the bacteria of the genus Staphylococcus according to the invention are chosen from the group comprising bacterial strains of the genus Staphylococcus, the genome of which contains: a gene encoding the Sbi protein of sequence SEQ ID No. 5 or a homologous protein; and / or a gene encoding an RNA comprising the sequence SEQ ID No. 3 or a sequence homologous to the sequence SEQ ID No. 3 and the fragments thereof; and / or a gene comprising the sequence SEQ ID No. 4 or a sequence homologous to the sequence SEQ ID No. 4 and the fragments thereof. These strains can be easily identified by those skilled in the art, for example, by screening techniques of libraries (genomic DNA or cDNA of bacteria of the genus Staphylococcus) using probes or primers specific to a sequence belonging to bacterial strains of the genus Staphylococcus as defined above. Such probes or primers can be selected from the polynucleotide sequences according to the invention. For example, a probe comprising a sequence as defined according to the first polynucleotide according to the invention may be used. In particular, those skilled in the art can use the method for detecting, in vitro, mRNA of the gene encoding the Sbi protein according to the invention. In particular, the bacteria of the genus Staphylococcus according to the invention are strains of Staphylococcus aureus. The term "complementary sequence" of a second sequence within the meaning of the present invention means a sequence whose set of contiguous nucleotides have the capacity to form Watson-Crick pairings of gc, cg, au, ua, a-t type, ta and possibly wobble pairings of type gu, ug with the set of contiguous nucleotides of the second sequence. The term identity refers to the identity between two polynucleotide sequences. The identity can be determined by comparing the nucleotides present at one position in each of the polynucleotide sequences aligned for that purpose. When, at a given position, a nucleotide is identified as identical on the two aligned sequences, said sequences are said to be identical at this position. The percentage identity between two polynucleotide sequences is a function of the number of identical nucleotides at the different positions on the two aligned nucleotide sequences. Different programs can be used to align polynucleotide sequences and thus calculate the percentage identity between these sequences, such as FASTA or BLAST. Sequence derived from a second sequence is understood to mean a sequence having at least 70% identity, preferably at least 80% identity and most preferably at least 90% identity with a second sequence. The fragments of sequences of the first polynucleotide according to the invention may have a size of between 35 and 53, preferably between 35 and 50, and most preferably between 36 and 45 nucleotides. Preferably, the fragments of sequences of the first polynucleotide according to the invention comprise nucleotides localized from position 14 to position 49 in the sequence SEQ ID No. 1 or the sequence SEQ ID No. 2, said nucleotides corresponding to localized nucleotides. from position 35 to position 70 in the sequence SEQ ID No. 6 or the sequence SEQ ID No. 7.

The specific hybridization ability of a first polynucleotide sequence with a second polynucleotide sequence can be determined in vitro by tests well known to those skilled in the art. By way of example, mention may be made of the test described in C. Pichon & B. Felden (2005, with the example of the regulatory RNA sprA and its mRNA target SA2216), which comprises the following steps: a first sequence polynucleotide is radioactively labeled, purified and increasing amounts of a second unlabeled polynucleotide sequence are added and analyzed by electrophoresis gel under native conditions. Obtaining a migration delay on this gel involves the formation of a complex between these two polynucleotide sequences, by hybridization; the effect of adding an excess of 100 to 2000 times, in molar ratios, of a third polynucleotide sequence (for example a transfer RNA mixture) on the formation of said complex between the first two sequences , is analyzed; the effect of adding an excess of 100 to 2000 times, in molar ratios, of the first unlabeled polynucleotide sequence on the formation of said complex between the first two sequences is analyzed; the hybridization between the first two polynucleotide sequences will be considered specific if (i) said complex preformed between the first two polynucleotide sequences remains stable in the presence of this excess of the third polynucleotide sequence (ex: tRNA) and if ( ii) said preformed complex is destabilized in the presence of small amounts of the first unlabeled polynucleotide sequence. Those skilled in the art can easily determine the derived sequences and the fragments which have the capacity to hybridize specifically to the sequence ID No. 3 according to the first isolated polynucleotide according to the invention, by implementing a specific hybridization test. as described above. In particular, the derived sequences and fragments which have the capacity to hybridize specifically to the sequence ID No. 3 according to the first polynucleotide isolated according to the invention, also have the capacity to negatively regulate the expression of the Sbi protein. . The term reduction or downregulation of protein expression is used herein to refer to a decrease of at least 20%, particularly at least 35% and most preferably at least 50% of the level of protein. expression of a protein with respect to its level of expression in the absence of a first polynucleotide according to the invention. The reduction of the expression of a protein can be determined by techniques well known to those skilled in the art, such as by Western blotting, using at least one antibody specific for said protein. The present invention also encompasses the polynucleotides according to the invention, synthetic, semisynthetic, recombinant and their analogues. The analogs of the first polynucleotide according to the invention have the capacity to hybridize specifically with the sequence SEQ ID No. 3. In particular, the analogs of the first polynucleotide according to the invention also have the capacity to negatively regulate the expression of the Sbi protein. For the purposes of the present invention, the term "analogue" means polynucleotides comprising at least one chemical modification at the level of their sugar, phosphate, their base or their 5 'and 3' ends; said modification can be carried out by chemical or enzymatic synthesis. Indeed, the polynucleotides according to the invention may comprise at least one chemical modification intended in particular to increase their stability, their resistance to degradation by endo and exonucleases, to promote their ability to enter a cell of interest and / or the case of the first polynucleotide according to the invention to increase its capacity to negatively regulate the expression of the protein Sbi. The increase of the capacity of the first polynucleotide according to the invention to negatively regulate the expression of the protein Sbi can be obtained, for example, by a chemical modification allowing the increase of the formation and / or the stability of a protein. complex between the first polynucleotide according to the invention and the sequence SEQ ID No. 3, by specific hybridization. Thus, the polynucleotides according to the invention may comprise modified nucleotides in terms of their sugar, phosphate, base and / or may have modifications, particularly post-transcriptionally, at their 5 'and 3' ends. Such modified nucleotides may be chosen from the group comprising: 2'-O-methylnucleotides, 2'-O-methoxyethylnucleotides, deoxynucleotides such as 2'-deoxynucleotides and 2'-deoxy-2'-fluoronucleotides, nucleotides with peptide bonds, fluorochromes and radioactive elements. The polynucleotides according to the invention may also comprise, at their 5 'and / or 3' ends, structural elements (such as stable helices) reinforcing their stability and / or their resistance to degradation.

The polynucleotides according to the invention can be obtained by methods well known to those skilled in the art, such as by screening methods of libraries (genomic DNA or cDNA of bacteria of the genus Staphylococcus) by probes or primers. specific of said polynucleotides (selected for example from the polynucleotide sequences according to the invention), but also, by chemical syntheses (Beaucage SL., 2008) or by enzymatic reactions (Sherlin LD et al., 2001). The subject of the invention is also a first expression cassette comprising a DNA sequence chosen from the group comprising: the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID No. 1 and fragments thereof; and the sequence SEQ ID No. 6, the derived sequences having at least 70% identity with the sequence SEQ ID No. 6 and the fragments thereof; and a DNA sequence transcribable into a first isolated polynucleotide according to the invention, said polynucleotide being an RNA. An expression cassette within the meaning of the present invention is understood to mean a cassette comprising a promoter and a transcription termination region in which a DNA sequence of interest is operably linked to the promoter in order to allow the transcription of said DNA sequence. It can be any promoter or derived sequence, inducible or not, allowing the transcription of a polynucleotide according to the invention. In particular, the promoter is chosen from promoters allowing the transcription of a polynucleotide according to the invention in at least one bacterial strain of the genus Staphylococcus. By way of example of such promoters, mention may be made of the bacteriophage T7 promoter (Milligan JF et al., 1989). The subject of the invention is also a first recombinant vector comprising a first isolated polynucleotide according to the invention or a first expression cassette according to the invention. The vectors that may be used may be viral vectors, such as bacteriophages, or non-viral vectors, such as plasmid vectors. As examples of plasmid vectors that can be used according to the invention, mention may be made of all the pCN-derived vectors described in Charpentier et al. (2004). Some of these vectors, for example pCN51, allow the transcription of a DNA sequence of interest into RNA through the use of a cadmium inducible promoter. In particular, the plasmid vector may be chosen from the group comprising the plasmids pCN35 and pCN38 described in Charpentier et al. (2004). These plasmids have the advantage of being maintained and thus allow the expression of polynucleotides according to the invention in transformed bacteria of the genus Staphylococcus. Indeed, the inventors have shown that S. aureus bacteria, transformed with the vector pCN38 comprising the sequence SEQ ID No. 6 according to the invention, are capable of maintaining this plasmid during successive bacterial generations after transplanting and thus to allow the expression of a polynucleotide according to the invention.

In particular, the vector according to the invention is a bacteriophage. Preferably, said bacteriophage is capable of infecting at least one bacterial strain of the genus Staphylococcus. Bacteriophage capable of infecting a bacterial strain of the genus Staphylococcus is understood to mean any bacterial virus capable of introducing part of its genetic material into the genome of a bacterial strain of the genus Staphylococcus (prophage) or of allowing transient expression. of this genetic material in the recipient bacterium without chromosomal integration. Staphylococcus bacteria are infected by three types of phages: obligate, temperate and chronic phages (Nicholas H. Mann, 2008). All of these phages can be used as a vector according to the invention.

In the context of the prevention and / or treatment of staphylococcal infection, the phages that can be used as vectors according to the invention are preferably broad-spectrum and capable of infecting as many as possible bacterial strains of the genus Staphylococcus responsible for infections in humans and / or animals. By way of example of such bacteriophages, mention may be made of the obligate lytic phage 11) 812, phages K and ItIMR11.

The use of bacteriophage as a vector according to the invention has the advantage of optimizing the prevention and / or treatment of a staphylococcal infection or a disorder related to at least one bacterium of the genus Staphylococcus. Indeed, in addition to the negative regulatory effect of the first polynucleotide according to the invention on the expression of the Sbi protein in vitro and in vivo, the bacteriophage makes it possible to lyse the bacteria during its lytic cycle. In addition, the use of bacteriophage as a vector according to the invention has the advantage that the bacteriophage used is potentially effective against various bacterial strains of the genus Staphylococcus, even those resistant to antibiotics (Nicholas H. Mann, 2008) and not have side effects, including being devoid of adverse effects on the eukaryotic cells of the infected host.

According to another aspect, the subject of the invention is a first host cell transformed by a first expression cassette according to the invention or a first vector according to the invention. The host cell may be in particular a prokaryote and advantageously a bacteriophage as described above.

The subject of the invention is also a composition comprising at least one component selected from the group comprising a first isolated polynucleotide according to the invention, a first expression cassette according to the invention, a first vector according to the invention and a first cell. host according to the invention.

Said composition may be useful in particular as a tool in biology in order, for example, to select probes or primers specific for the polynucleotides according to the invention or else to identify potential agents capable of modulating (activating or inhibiting) the interaction between the first and the second or third polynucleotides according to the invention. Advantageously, the composition according to the invention is a pharmaceutical composition.

The pharmaceutical compositions according to the invention have the advantage unlike putative drugs to have a targeted action on bacteria of the genus Staphylococcus, including strains resistant to antibiotics, optimizing their action and limiting the risk of side effects. In particular, said components are present in the pharmaceutical composition according to the invention in therapeutic amounts (active and non-toxic amounts). Such therapeutic amounts may be determined by those skilled in the art by routine tests comprising the evaluation of the effect of the administration of said components mentioned above on pathologies and / or disorders that one seeks to prevent and / or to be treated by the administration of said pharmaceutical composition according to the invention, for example a staphylococcal infection and on toxicity. For example, such tests can be implemented by quantitatively and qualitatively analyzing the effect of the administration of different amounts of said aforementioned components on a set of markers (biological and / or clinical) characteristic of these pathologies and / or of these disorders, as well as by bacterial counting in samples of biological samples.

In addition, the therapeutic index of the pharmaceutical composition according to the invention can be determined by tests well known to those skilled in the art. The polynucleotides according to the invention can be administered directly, preferably using a suitable vehicle to facilitate their entry into the cell of interest and / or protect them from degradation by endo- or exo-nucleases . Examples of such usable vehicles include microspheres, liposomes, nanoparticles. The polynucleotides according to the invention may also be administered via a vector such as advantageously a bacteriophage as described above.

The pharmaceutical compositions according to the invention may be administered by different routes compatible with the desired effect and preferably orally, parenterally, subcutaneously, topically, intraocularly, sublingually and most preferably intraocularly. The pharmaceutical compositions according to the invention can be administered in one or more times or in continuous release. The pharmaceutical compositions according to the invention can be in various forms well known to those skilled in the art and adapted to the routes and modes of administration used. In particular, when the pharmaceutical compositions are administered to animals, they may be included in food compositions (for example in the form of powders or granules). According to another aspect, the subject of the invention is also a first isolated polynucleotide according to the invention, or a first expression cassette according to the invention, or a first vector according to the invention or a first host cell according to the invention. for its application as a medicament for the prevention and / or treatment of a staphylococcal infection.

The invention also relates to the use of a component selected from the group comprising a first isolated polynucleotide according to the invention, a first expression cassette according to the invention, a first vector according to the invention, a first cell. host according to the invention, for the preparation of a medicament for the prevention and / or treatment of a staphylococcal infection.

Staphylococcal infections include all infections that cause bacteria of the genus Staphylococcus. These infections include all pathologies and / or disorders that can be improved and / or avoided by reducing the expression of the Sbi protein. In particular, staphylococcal infections include Staphylococcus aureus infections including superficial or deep folliculitis (such as boils, anthrax and staphylococcal sycosis), staphylococcal syndrome of scalded children, wound infections, furuncle, bacteremia, endocarditis, osteomyelitis or septic arthritis. According to another aspect, the subject of the invention is also a product containing: at least one component selected from the group comprising a first isolated polynucleotide according to the invention, a first expression cassette according to the invention, a first vector according to the invention, a first host cell according to the invention; and at least one other antistaphylococcal agent, as a combination product for simultaneous, separate and / or spreading use for the prevention and / or treatment of a staphylococcal infection. For the purposes of the present invention, the term "antistaphylococcal agent" means an agent intended to control at least one bacterial strain of the genus Staphylococcus, in particular against at least one bacterial strain of the genus Staphylococcus selected from the group comprising the bacterial strains of the genus Staphylococcus of which the genome contains: a gene encoding the Sbi protein of sequence SEQ ID No. 5 or a homologous protein; and / or a gene encoding an RNA comprising the sequence SEQ ID No. 3 or a derived sequence having at least 70% identity with the sequence SEQ ID No. 3 and the fragments thereof; and / or a gene comprising the sequence SEQ ID No. 4 or a derived sequence having at least 70% identity with the sequence SEQ ID No. 4 and the fragments thereof; and most particularly against at least one strain of Staphylococcus aureus. The antistaphylococcal agent may be selected from the group consisting of: - antibiotics for preventing and / or treating local infections such as fusidic acid, mupirocin; antibiotics intended to prevent and / or treat systemic infections such as rifampicin, fluoroquinolones, fusidic acid, trimethoprim-sulfamethoxazole, glycopeptides; and bacteriophages such as 11) 812, K and (pMR11.) The combination products according to the invention comprising another antistaphylococcal agent have the advantages of optimizing the prevention and / or treatment of staphylococcal infection and In another aspect, the subject of the invention is a second isolated polynucleotide comprising a sequence chosen from the group comprising: the sequence SEQ ID No. 3, the derived sequences having at least 70% d identity with the sequence SEQ ID No. 3 and fragments thereof, and the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments thereof, said derived sequences and said fragments having the capacity to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2. In particular, the second isolated polynucleotide selo the invention comprises a sequence selected from the group comprising: the sequence SEQ ID No. 8, the derived sequences having at least 70% identity with the sequence SEQ ID No. 8 and the fragments thereof; and the sequence SEQ ID No. 9, the derived sequences having at least 70% identity with the sequence SEQ ID No. 9 and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2. In particular, said derived sequences and said fragments having the capacity to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2, according to the second polynucleotide according to the invention, comprise the nucleotides gaaaggg located at position 28 to 34 (corresponding to the Shine-Dalgarno sequence) and the nucleotides 15a, located at position 42 to 44 (corresponding to the codon for initiation of the translation of the mRNA encoding the Sbi protein) in the sequence SEQ ID No. 3 or SEQ ID No. 4. The fragments of sequences of the second polynucleotide according to the invention may have a size of between 14 and 50, preferably between 20 and 45 and most preferably between 41 and 45. Preferably, the fragments of sequences of the second polynucleotide according to the invention. comprise the 41 nucleotides located from position 1 to position 41 in the sequence SEQ ID No. 3 or the sequence SEQ ID No. 4. The analogues of the second polynucleotide according to the invention have the capacity to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2. The invention also relates to a third isolated polynucleotide, comprising: a sequence containing nucleotides 1 to 41 of one of the sequences SEQ ID No. 3 or SEQ ID No. 4, coupled at its 3 'end to a coding sequence of a gene of interest. For the purposes of the present invention, the term "coupled sequences" means the linking of two sequences by phosphodiester bonds. The binding can be carried out by chemical or enzymatic synthesis or by PCR construction (polymerase chain reaction). In particular, the third polynucleotide according to the invention comprises a coding sequence of a gene of interest coupled at its 5 'end to the 3' end of a sequence containing nucleotides 1 to 41 of one of the sequences. SEQ ID No. 3 or SEQ ID No. 4.

A sequence containing nucleotides 1 to 41 of one of the sequences SEQ ID No. 3 or SEQ ID No. 4 within the meaning of the present invention is understood to mean a sequence containing the 41 nucleotides located from position 1 to position 41 in the sequence SEQ ID No. 3 or the sequence SEQ ID No. 4.

For the purposes of the present invention, the term "coding sequence" is intended to mean a nucleotide sequence which directly defines the amino acid sequence of a protein or fragment of the corresponding protein encoded by a gene of interest. A coding sequence of a gene of interest notably comprises the codons for initiation and termination of the translation of the mRNA of this gene into protein.

Preferably, in the third polynucleotide according to the invention, the 5 'end of the translation initiation codon of the mRNA of the gene of interest is directly linked by phosphodiester bond to nucleotide c located at position 41 in the one of the sequences SEQ ID No. 3 or SEQ ID No. 4. Thus, in the case where the translation initiation codon of the mRNA of the gene of interest is aug, nucleotide a of this initiation codon is linked to nucleotide c at position 41 of one of the SEQ sequences. ID No. 3 or SEQ ID No. 4 to form the sequence of nucleotides caug. The gene of interest may be any gene which encodes a protein or a protein fragment of interest whose expression it is desired to regulate, in particular negatively by the presence of a first polynucleotide according to the invention.

The expression of the protein or protein fragment of interest encoded by the gene of interest according to the third polynucleotide according to the invention can thus be negatively regulated by the presence of a first polynucleotide according to the invention. In particular, a coding sequence of a gene of interest may be a sequence coding for at least one domain of the Sbi protein, said domain being capable of binding specifically to the complement C3 protein and / or to IgG immunoglobulins. The third polynucleotide according to the invention may further comprise at least one non-coding sequence of said gene of interest. The subject of the invention is also a second expression cassette comprising a DNA sequence chosen from the group comprising: the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and fragments thereof; and a DNA sequence that can be transcribed into a second or third polynucleotide according to the invention, said polynucleotide being an RNA. The subject of the invention is also a second recombinant vector comprising a second expression cassette according to the invention.

The subject of the invention is also a second host cell according to the invention transformed by a second expression cassette according to the invention or a second vector according to the invention. The subject of the present invention is also a pharmaceutical composition according to the invention further comprising: a third isolated polynucleotide according to the invention in which said coding sequence is a sequence coding for at least one domain of the Sbi protein, and / or expression vector comprising a third isolated polynucleotide according to the invention wherein said coding sequence is a sequence coding for at least one domain of the Sbi protein, said domain of the Sbi protein being capable of binding specifically to the complement C3 protein and / or IgG immunoglobulins. By domain of the Sbi protein which is capable of binding specifically to the complement C3 protein is meant the Sbi-IV domain as described in Upadhyay et al. (JBC, June 11, 2008), namely the domain including amino acids 198 to 266 of the sequence SEQ ID No. 5, domains derived from the Sbi-IV domain, and fragments thereof. Said domains derived from the Sbi-IV domain, and said fragments having the capacity to bind specifically to the complement C3 protein. By domain of the Sbi protein which is capable of binding specifically to IgG immunoglobulins, is meant the Sbi-I and Sbi-II domains as described in Upadhyay et al. (JBC, June 11, 2008), namely the Sbi-I domain including amino acids 42 to 94 of the sequence SEQ ID No. 5, the Sbi-II domain incorporating amino acids 92 to 156 of the sequence SEQ ID No. 4, domains derived from the Sbi-I and Sbi-II domains, and fragments thereof. Said domains derived from the Sbi-I and Sbi-II domains, and said fragments having the capacity to bind specifically to IgG immunoglobulins.

Such pharmaceutical compositions according to the invention have the advantage of allowing the modulation of the immune system of the host, especially over time. Indeed, the components of such pharmaceutical compositions can be administered simultaneously, separately and / or spread over time in order to modulate the immune system. Such pharmaceutical compositions may make it possible to vary the expression of the Sbi protein as a function of the quantity of the components (first and third polynucleotides according to the invention) and / or as a function of time and thus to vary the response of the immune system. adaptive and / or innate host (IgG, C3 protein). The subject of the present invention is also a method for detecting, in vitro, the presence of bacteria of the genus Staphylococcus in a biological sample, comprising the detection of at least one sequence chosen from the group comprising: the sequences as defined according to the first polynucleotide according to the invention; and the sequences as defined according to the second polynucleotide according to the invention; with at least one appropriate detection means of said sequence. Said means for detecting an appropriate sequence may be any pair of specific primers for the amplification of said sequence (for example by PCR or RT-PCR), or any specific probe of said sequence.

The sequences of the polynucleotides according to the invention may be useful for selecting such primers and probes. In particular, the sequences as defined according to the first polynucleotide according to the invention may be useful for selecting probes allowing the detection of sequences as defined according to the second polynucleotide according to the invention and vice versa.

Thus, according to a particular embodiment of said method for detecting, in vitro, the presence of bacteria of the genus Staphylococcus in a biological sample, the detection of said sequence can comprise the following steps: 1. contacting said biological sample with at least one probe comprising a sequence chosen from the group comprising: the sequences as defined according to the first polynucleotide according to the invention: the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID No. 1 and the fragments thereof; and the sequence ID No. 2, the derived sequences having at least 70% identity with the sequence SEQ ID No. 2 and the fragments thereof; and the sequence complementary to the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with said complementary sequence and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3; and the sequences as defined according to the second polynucleotide according to the invention: the sequence SEQ ID No. 3, the sequences derived having at least 70% identity with the sequence SEQ ID No. 3 and the fragments thereof; this ; and the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2; and 2. detecting the hybridization of said probe with said sequence with at least one appropriate detection means of said hybridization.

According to a particular embodiment of said method for detecting, in vitro, the presence of bacteria of the genus Staphylococcus in a biological sample, the detection of said sequence may comprise the following steps: 1. bringing said biological sample into contact with minus a pair of primers specific for said sequence under conditions allowing hybridization of the primers to said sequence; 2. the amplification of said sequence; and 3. demonstrating the amplification of fragments of said sequence corresponding to the fragment flanked by the primers including these. The primers specific for the sequences as defined according to the first or second polynucleotide according to the invention may be selected by those skilled in the art by routine tests from said sequences. The subject of the present invention is also a method for detecting, in vitro, mRNA of the gene encoding the Sbi protein present in a biological sample, comprising the detection of the sequence SEQ ID No. 3, with at least one appropriate detection means. of said sequence. The in vitro detection method of mRNA of the gene encoding the Sbi protein present in a biological sample according to the invention has the advantage over a detection method of the DNA encoding the Sbi protein to allow the detection of staphylococcal active infections. Indeed, it has been shown that the expression of the Sbi protein is induced by the presence of human IgG (Zhang et al, 2000). The sequences as defined according to the first polynucleotide according to the invention may be used as a probe to detect, in vitro, specifically and directly the mRNA of the gene encoding the Sbi protein present in a biological sample. Thus, according to another aspect, the subject of the invention is a method for detecting, in vitro, mRNA of the gene encoding the Sbi protein present in a biological sample, comprising the following steps: contacting said biological sample with at least one probe comprising a sequence selected from the group consisting of: the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID No. 1 and the fragments thereof; and the sequence ID No. 2, the derived sequences having at least 70% identity with the sequence SEQ ID No. 2 and the fragments thereof; and the sequence complementary to the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with said complementary sequence and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3; and detecting the hybridization of said probe with said mRNA of the gene encoding the Sbi protein with at least one means for detecting said appropriate hybridization. The detection method according to the invention may furthermore comprise, prior to the contacting step, at least one of the following steps: cultivation of the biological sample, optionally after isolation of bacteria of the genus Staphylococcus on a selective medium, under appropriate conditions allowing the culture of bacteria of the genus Staphylococcus; centrifugation of the biological sample; the lysis of bacteria of the genus Staphylococcus; extraction of the polynucleotides present in said sample. The subject of the present invention is also a kit for detecting mRNA of the gene encoding the Sbi protein, comprising: at least one probe comprising a sequence chosen from the group comprising: the sequence SEQ ID No. 1, the sequences derived having at least 70% identity with the sequence SEQ ID No. 1 and fragments thereof; and the sequence ID No. 2, the derived sequences having at least 70% identity with the sequence SEQ ID No. 2 and the fragments thereof; and the sequence complementary to the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with said complementary sequence and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3; and at least one means for detecting the hybridization of said probe with said mRNA of the gene encoding the Sbi protein. Said means of appropriate detection of the hybridization of said probe with a sequence, in particular with said mRNA of the gene encoding the Sbi protein, may be any means allowing the detection of a specific hybridization between two polynucleotides. In particular, said detection means may be based on the marking of the probe. Unmarked sequences can be used directly as probes. However, the sequences may be labeled directly or indirectly by a radioactive element (32P, 35S) or by a non-radioactive molecule (biotin, fluorophore) to obtain probes that can be used in numerous applications, in particular in detection methods as described below. above. The probes can be in solution or immobilized on a support. The sequence SEQ ID No. 3 can also be used to select oligonucleotide primers, in particular for PCR (from genomic DNA) and RT-PCR (from total RNA extract) techniques. These oligonucleotides may be used to detect, in vitro, specifically and in a direct manner, the mRNA of the gene encoding the Sbi protein present in a biological sample. According to another aspect, the subject of the invention is a kit for regulating the expression of a gene of interest comprising: at least one first component selected from the group comprising a second or third isolated polynucleotide according to the invention, a second expression cassette, a second vector and a second host cell according to the invention; and at least one second component chosen from the group comprising a first polynucleotide according to the invention, a first expression cassette, a first vector and a first host cell according to the invention. The subject of the invention is also the use, in particular non-therapeutic, of a first isolated polynucleotide according to the invention for inhibiting the expression of the gene coding for the Sbi protein, in particular for inhibiting the translation of the mRNA encoding the Sbi protein. Sbi protein. The subject of the invention is also the use, in particular non-therapeutic, of a first polynucleotide isolated according to the invention in combination with a second and / or third polynucleotide isolated according to the invention for inhibiting the expression of a gene. of interest, especially for inhibiting the translation of an mRNA encoding a protein of interest. Other advantages and features of the invention will become apparent from the following examples. These examples are given for illustrative and not limiting. For the purposes of the first invention, the term "SprD" means a first polynucleotide according to the invention corresponding to the second isoform of the sequence SEQ ID No. 7 (ie the sequence SEQ ID No. 7, in which the nucleotides at the 44-position , 45 and 57 are u). SprD has been identified in particular in S. aureus strain N315. Figure 1 illustrates the solution sprD structure and its cell location. (A-C): Structural survey of sprD. Autoradiograms of the 5 'lead labeled synthetic 5' dG cleavage products and the S1 and V1 nucleases after long (A) and short (B) electrophoretic migrations. Lanes C, incubation controls; GL tracks, bands obtained by RNase Ti hydrolysis; AL tracks, bands obtained by RNAse U2 hydrolysis; AH tracks, bands obtained by alkaline hydrolysis. The sprD sequence is indexed at the right sides. (C) Secondary sprD structure model of S. aureus strain N315, based on structural mapping, showing survey data. The triangles correspond to cuts by V1; the arrows capped with a circle are cuts by S1, the uncapped arrows are cuts by lead acetate. The intensity of the cuts and cleavages is proportional to the coloring density of the symbols: an empty symbol (without coloration), grayed out and full corresponds to a weak, medium and strong cut, respectively. Structural domains H1-H4 and L1-L4 are indicated. The framed nucleotide corresponds to the experimentally determined 5 'end (RACE) as well as to the transcription initiation site. The 36 nucleotides flanked by the two black hooks were deleted in the sprDA mutant. (D): Cell location of SprD, tRNA, and RNAIII in vivo, by Northern blots of different cell fractions using labeled strand-specific DNA probes that are specific for each RNA. The cytoplasmic fraction (C) contains the tRNAs, the ribosomal fraction (R) contains the three ribosomal RNAs. The membrane fraction (M) contains the ErbS and ATPase proteins, according to immunoblot immunoblot analysis of the immune-blotted C, R, and M cell fractions (immunoblotted) with anti-ErbS and anti-ATPase antibodies. Figure 2 illustrates the regulation of in vivo expression of SprD. Northern blot analysis of SprD expression, using a labeled strand specific DNA probe, in RN4220 and SH1000 bacterial strains, both lacking the sprD gene, transformed with pCN38 or pCN51 vectors allowing expression of DPRS. SprD expression in strain N315 is shown as a positive control. As loading controls, the blots were also probed for 5S rRNA. Figure 3 illustrates the downregulation of sbi protein levels in vivo by sprD. (AT). SDS-PAGE analysis of exoproteins in RN4220 and SH1000 wild type strains and their isogenic sprD mutants prepared from the exponential growth phase (E). The SDS-PAGE gel was stained with Coomassie blue. The arrow highlights the reduced protein levels when sprD is expressed, at a molecular weight of about 45 kD, identified by mass spectrometry as the sbi protein, based on independent peptide sequences. Western immunoblot analysis of the extracellular (B) and intracellular (C) fractions from bacterial strains RN4220 and SH1000 expressing, or not, sprD at both the exponential (E) and stationary (S) phases. 50 g of protein from the cell fractions were loaded onto 15% SDSPAGE, transferred to a polyvinylidene difluoride membrane and immunoblotted with an anti-sbi antibody, followed by chemiluminescence detection. Figure 4 illustrates that SprD is not involved in the induction of sbi protein levels by human serum. (A) Western immunoblot analysis of extracellular fractions from SH1000 and MRSA252 bacterial strains cultured in the presence or absence of human serum. The strain SH1000 expresses sprD (+), or not (-). Expression levels of protein A in each band are provided as an internal loading control. (B) Northern blot analysis of SprD expression using a labeled strand specific DNA probe. As loading controls, blots were also probed for 5S rRNA. Figure 5 illustrates the formation of a complex between SprD and mRNA encoding Sbi protein. (A) The predicted pairing between sprD and sbi mRNA, based on (i) a computational prediction (ii) a mutational and native gel delay analysis (iii) a sprD structural survey within the duplex . Structural domains from sprD that are unfolded during complex formation are indicated. The (-) and (+) signs correspond to nucleotides from sprD that are protected (-) or become cleaved (+) by S1 or V1 ribonucleases when binding to the mRNA encoding the Sbi protein. The black rectangle shows the 5 'end of the sbi mRNA as experimentally determined by RACE. The framed heptanucleotide sequence (GAAAGGG) is the predicted RBS (Ribosome Binding site) and the framed AUG is the initiation codon for translating sbi mRNA into protein. (B) Non-denaturing gel retardation assays of purified labeled RNA corresponding to 179 (sbi mRNA) or 118 (sbi) A61 nucleotides at its 5 'end, both with increasing amounts of purified unlabeled gDG, or with a sprD mutant lacking nucleotides 35-70 (SprD A), or with an excess of 100-2000 folds of purified unclassified total RNA from yeast. Figure 6 shows the mapping of the conformational change induced by the formation of a complex between sbi mRNA and sprD by structural probes. The autoradiograms of the 5'-labeled 5 'dimer cleavage products by S1 and V1 ribonucleases, in the presence (+) or absence (-) of an 8-fold molar excess of sbi mRNA derived from short electrophoretic migrations (left) and long (right). Lanes C, incubation controls; GL tracks, bands obtained by RNase Ti hydrolysis; AL tracks, bands obtained by RNase U2 hydrolysis; the sequence is indexed on the right sides. The area of matching between the two ARNs is indicated, based on mutational and survey data. Figure 7 illustrates the inhibition by sprD of translation initiation of sbi mRNA via 70S ribosomes. The localization by the toeprinting technique of the ribosome on sbi mRNA as described in the Materials and Methods section, hereinafter. + 1 indicates the presence of ribosomes, wild-type sprDs (lanes 2, 5, 6 and 7) or sprD-A (lanes 3, 8, 9 and 10). The concentrations of sprD and sprD-A were 0.4 M (bands 5 and 8), 2 M (bands 6 and 9) and 10 M (bands 7 and 10). The toeprints (forward impressions) determined experimentally are indicated. U, A, G and C refer to sequencing scales of sbi mRNA.

EXAMPLES 1. Materials and Methods 1.1 Strains and Plasmids The strains of S. aureus and the plasmids used in this study are listed in Table 1. Strains of S. aureus were grown in the usual manner at 37 ° C. in a broth. Brain and heart infusion (BHI, Oxoid). If necessary, the inventors used chloramphenicol and erythromycin at the rate of 10 g / ml. The strain DH5a of E. Coli was used as a bacterial host for the construction of the plasmid. Strains of E. Coli were grown in a medium of Luria-Bertani (LB). In plasmid pCN38-SprD, the gene encoding SprD is expressed under the control of its own promoter. To construct this plasmid, sprD with 40 nucleotides upstream and 35 nucleotides downstream was amplified by PCR from genomic RNA of S. aureus strain N315 as a fragment of 217 base pairs with Pst I and EcoR I flanking restriction. The PCR product was cloned between these two sites in the low copy number vector pCN38 (Charpentier et al., 2004). E. coli DH5a Sambrook et al. 1989 S. ureus RN4220 Restricted restriction derivative of 8325-4 Kreiswirth et al. 1983 SH1000 8320-4 rsbU rsbU functional derivative Horsburgh et al. 2002 Plasmids pCN51 Charpentier et al. 2004 pCN38 Charpentier et al. 2004 pCN51-sprD This study pCN38-sprD This study Table 1

1.2 Cell Fractions The cell fractions of S. aureus strain N315 were prepared as described (Chesneau et al., 2005) with some modifications. 300 to 400 ml of bacterial cultures were grown to the exponential phase (OD 600 = 2.0). Protoplasts were collected by lysostaphin lysing of cell walls (100 l of stock solution 1 mg / ml) in 10 ml of Tris-HCl pH = 7.5 with 30% sucrose. Then, the protoplasts were lysed by osmotic shock in 25 mM HEPES pH 7.6, 10 mM MgCl 2, 30 mM NH 4 Cl, 4 mM betamercaptoethanol and 10 mM Vanadyl ribonucleoside complex (BioLabs). Centrifugations were performed at 30,000 g for 30 minutes (P30: membrane fraction) and 100,000 g for 3 hours (P100: ribosomal fraction, 5100: cytoplasmic fraction).

1.3 Protein isolation, mass spectrometry and western immunoblots For the preparation of total protein extracts and extracellular extracts, the bacteria were cultured until the exponential (OD600 = 2.0) or stationary (OD600 = 5) growth phases. , 0) and the cells were removed from the supernatant by centrifugation for 10 minutes at 4 ° C (8000 g). For purification of the extracellular proteins, the supernatants were collected, filtered (0.45 m sterilized filter) and precipitated with 10% trichloroacetic acid. The precipitates were washed with ice-cold acetone and loaded on SDS-PAGE according to the Laemmli method, 1970. For total protein extractions, 2 ml pellets of cultures were washed with TE (50 mM EDTA, 50 mM Tris pH 7.5), and resuspended in 0.2 ml of the same buffer containing 0.1 mg / ml of lysostaphin. After incubation at 37 ° C for 10 minutes, the samples were boiled for 5 minutes in sample buffer, analyzed by SDS-PAGE and stained with Coomassie Blue R-250. The proteins of interest were extracted by 1D SDS-PAGE, digested with trypsin and the resulting peptides identified by Maldi-Toff mass spectrometry and RPHPLC / NanoLC / ESI-MS-MS. For immunoblot analyzes, the proteins were transferred to a PVDF membrane (Immobilon-P, Millipore). Western blots analyzes were performed using a polyclonal anti-Sbi antibody (donated by Dr. van den Elsen, University of Bath, UK) and also anti-EbpS and anti-ATP-ase antibodies, as described in Downer et al. ., (2002). The signals were visualized using a STORM 840 Phosphor-Imager (Molecular Dynamics) imager and quantified using Image-QuantNT 5.2 software. 1.4 Isolation of RNA and Northern blots Total RNAs were prepared from the exponential (OD600 = 2.0) or stationary (OD600 = 5.0) growth phases of various S. aureus strains as described in Oh and So (2003). For 5S-RNA and other RNAs, Northern blots were run with 5 g denatured total RNA and purified on denaturing PAGE 8% gel, as described in Pichon and Felden (2005). For sbi mRNA, Northern blots were performed as described in McCallum et al. (2006).

1.5 '-RACE Assay, In Vitro Transcription and RNA 5' End Marking 5'-RACE assays were performed according to the method of Antal et al., 2005 with the primers described in the table. 2. Wild-type and mutant RNAs for structural probing, gel retardation assays and toeprinting experiments were transcribed from PCR fragments generated from genomic DNA with the primers described in the table. 2. All fragments contain a T7 RNA polymerase promoter sequence. To produce the DNA template encoding the sprD RNA deletion mutant, sprDA, mutagenized oligonucleotides (Table 2) were used in a two-step protocol. First, sprDforTR and T7sprDdelrev DNAs produced an upstream fragment by PCR and both sprDrevTR and T7sprDdelfor DNA generated a downstream DNA fragment. The upstream and downstream fragments overlap partially. The mixture of the two PCR purified fragments (200 ng) was used as a template in a third PCR reaction using both the sprDforTR and sprDrevTR DNA oligonucleotides to produce a fragment encoding sprDA. All RNAs were produced by in vitro transcription using MEGAscript (Ambion). Radiolabeled RNA transcripts were produced by adding [α 32-β] UTP to the transcription reaction mixture. RNA labeling at their 5 'ends was performed as described in Antal et al. (2005). Labeled and unlabeled RNAs were gel purified on 8% PAGE gel, eluted, ethanol precipitated and stored at -80 ° C before use. DNAs sequences uses Antil640 ggcgctccttgaaaacgccc Sprd northern / 5 'Antisprd3 gcccgaaaaggagcaatacat RACE Sbineg5 tcactcgcttttgcttcccca Sprd 5' RACE Sbineg3 tcgcgtaatgttttgatgtattgg sbi 5 'RACE SprD5PstI ttaaatctgcagagataatgcaatagtagccat pCN38-DPRS SprD3EcoRI taaattg ag attccgacataccttattgtatttatag Sprd mRNA sprDforTR transcription sprDrevTR Sbi mRNA T7sprD_delfor transcription T7sprD_delrev SBIforTR SBIrevTR SBIdeltaTR taatacgactcactataggggcgttttcaaggagcgcc aaggtaagcaccgaaatgcttac gcgcctttcattttttatgtttgcgctttccaaatcaa ttgatttggaaagcgcaaacataaaaaatgaaaggcgc taatacgactcactataggcatacaataaatttaatatgtaa gttgttttgagttgtttggtgct taatacgactcactataggcgaagttgctagttggggcagca Table 2 1.6 Tests for delay on. and RNA structure probe in solution Gel delay assays between SprD and sbi mRNA were performed as described in Antal et al. (2005). From the gel retardation assays, 0.4 pmole of 5 'truncated or truncated wild-type sbi mRNA (SbiA61) were incubated with various concentrations (from 1.6 to 20 pmol) of unlabeled or truncated wild type (sprDA). For structural analysis in solution, RNA duplexes between sbi mRNA and sprD were prepared by incubating 0.4 pmol of labeled sprD and 1.6 pmol of sbi mRNA in a buffer containing 10 mM Tris-HCl (pH 7.5), 6 mM NaCl, 10 mM EDTA and 5 mM dithiothreitol for 15 minutes at 25 ° C. Structural analyzes of a renatured 5'-labeled dWG, either alone or in a complex with its target, sbi mRNA, were performed as described in Antal et al. (2005). The digestions were carried out at 25 ° C for 15 minutes in the presence of 2.5 tg of total tRNA yeast with the following enzymes: 0.2 or 1 unit of S1 nuclease and 10-4 or 5.10.5 units of RNase V1. Lead (II) cleavages were performed with 0.2 or 0.4 mM Pb acetate in 25 mM Hepes (pH 7.5), 7 mM Mg acetate, and 1 mM PBS. 35 mM potassium acetate for 10 minutes at 25 ° C. Alkaline hydrolysis bands were obtained by incubating labeled dol labeled in 0.1 M NaOH and 2 mM EDTA at 90 ° C for 3 minutes. The reactions were terminated by ethanol precipitation, the RNA pellets were washed twice in 80% ethanol and dissolved in Ambion II loading buffer. RNA samples were denatured for 5 minutes at 95 ° C before separation on 8% polyacrylamide / 8 M urea sequencing gels in 0.5 X TBE. The gels were dried, exposed and visualized using a STORM 840 Phosphor-Imager imager.

1.7 Toeprinting Tests The toeprinting tests were performed as described in Hartz et al. (1988), with minor modifications. Hybridization mixtures contained 0.2 pmol of unlabeled sbi mRNA and 1 pmol of 5 'end labeled SBIrevTR primer in a buffer containing 10 mM Tris-acetate (pH 7.5) of NH4Cl. mM and 1 mM DTT. For ribbon inhibition assays on sbi mRNA by sprD, different concentrations of wild type or mutant sprD (sprDA) were added before adding the purified 70S subunits from E. Coli. The 70S ribosomes were renatured for 15 minutes at 37 ° C and then diluted in the reaction buffer in the presence of 1 mM MgCl 2 (to promote subunit dissociation). 4 pmoles of 70S ribosomal subunits were added in each assay. incubated for 5 minutes and the concentration of MgCl 2 was adjusted to 10 mM (to promote re-association of the subunits). After 5 minutes of incubation 10 pmol of unfilled tRNAfmEt was added and the incubation was continued for another 15 minutes. CDNA was synthesized with 2 IU AMV RT (Biolabs) per run for 15 minutes. Reactions were terminated by adding 10 L loading buffer II (Ambion). The cDNA products were loaded and separated on 8% polyacrylamide / 8M urea gels. The toeprints (forward imprints) were localized on the sbi mRNA sequence by sequencing the DNA with the same primer. DNA labeled at the 5 'end. The gels were dried and analyzed as described above.

II. Results 11.1 The SprD structure and its cell location are both compatible with a regulation of the target mRNA. At first, the 5 'and 3' ends of sprD were determined. Its 5 'end has been identified using a 5'-RACE. From several DNA clones, the 5 'end of sprD was mapped at position G2007185 of the sequence of S. aureus N315 (Kuroda et al., 2001) extracted from the genome database of European Molecular Biology Laboratory (EMBL, European Molecular Biology Laboratory). Its length was deduced from Northern blots on polyacrylamide gels (see Figure 1D), which led to a predicted nine-base-pair helix ending in a U6 extension acting as a Rho-independent terminator. 3 'end (H4-L4, Figure 1C). SprD RNA contains 142 nucleotides. 12 SprD sequences from the genomes of S. aureus strains N315, MRSA252, Newman, NCTC8325, Mu50, Mu3, MSSA476, JH1, JH9, MW2, USA300 TCH1516 and USA300FPR3757 were aligned and had very high sequence identity, except at positions 44 and 45 (u or c) and 57 (u or a) of the sequence SEQ ID No. 7. Sequence variation is too weak to establish a secondary structure of sprD by phylogenetic analysis. Therefore, its conformation has been analyzed by structural probes in solution, an approach that has contributed to the establishment of the structures of many RNAs (Felden 2007). A gDNA transcript was labeled at its end and its conformation in solution was probed by RNase VI, which cleaves double-stranded RNAs or stacked nucleotides, and by S1 nuclease and lead, both of which cleave single RNAs. strand. The reactivity with respect to its probes has been studied for each nucleotide (the two panels A and B of FIG. 1 are representative). Five independent experiments were carried out and their data are summarized on a model of secondary structure that they support (Figure 1C). Specific double-strand breaks from U28-U30, G39-C40, A54, A62-A64, U79-U80, A89, G91, Al25-Al27, and the absence of S1 nuclease and lead cleavages at Gl-U8, G14-U21, G39-C42, G49-052, G76-U92, U101-U109, G113-U119, G121-U129 and G134-C142 suggest that four RNA helices are formed in solution: 8-bp, a 4-bp H2, a 17-bp H3 and a 9-bp H4 (Figure 1C). The H2 helix could be further extended from 4 to 13 base pairs but its lower portion (U28-U38 / A54-A64) was severely cut by both single-stranded (U28-U38, G55- A64) and double-stranded (U28-U30, A62-A64), which implies significant instability in solution. S1 cleavages at U9-G13 (L1), U44-C48 (L2), A95-U100 (L3), C132-G133 (L4) and lead cleavage at Ali-Al2 (L1), U46-C48 (L2) and U94 (L3) are consistent with the existence of four loops (L 1 -L4) respectively capping helices H1 to H4. Based on the presence of several S1 and lead cleavages and the absence of cleavages by VI, the U22-U27 and U65-C75 nucleotide extensions fold as single strands of RNA in solution. Lead cleavages at U110-U112 support the presence of an internal bulge within H3, with A111 being single stranded. There is no detectable degradation site within the sprD sequence. In summary, the sprD structure consists of two folded 5 '(H1) and 3' (H3-H4) ends, which flank a large (54 nucleotides long corresponding to sequence SEQ ID No. 2) unstable domain. and largely unfolded (with the exception of H2), which may be available for interactions with dedicated mRNA targets (see below). Cell fractionation was performed and the cell location of sprD was analyzed by Northern blots. Cell lysates from cells of S. aureus strain N315 were fractionated by successive centrifugations to obtain membrane (M), cytoplasmic (C) and ribosomal (R) fractions (for details see the Materials and Methods section). Methods). According to immunoblot analysis, fraction M contains two membrane proteins, ErbS and ATPase, while these two proteins are absent from fractions R and C (Figure 1D). The R fraction contains the three ribosomal RNAs (rRNA) and the fraction C contains the transfer RNAs (tRNA, Figure 1D). Transfer-messenger RNA (mtRNA) is responsible for monitoring the translation and release of ribosomes blocked in eubacteria (Moore and Sauer 2007), but this function has not been reported in S. aureus. As shown here, S. aureus mtRNA is present in both the C and R fractions in vivo (Figure 1D), as is expected from RNA that binds to, and releases blocked ribosomes. The effector of the S. aureus, RNAIII, delta-haemolysin agrecosystem, is mainly associated with ribosomes in vivo, with only a minor cytoplasmic fraction that is available for the binding of its dedicated target mRNAs (Boisset et al. , 2007). SprD is predominantly in the cytoplasm, consistent with target mRNA regulatory functions, but a minor fraction is associated with ribosomes (Figure 1D).

I1.2 Activation and Deactivation of In Vivo SprD Expression To study the function of SprD, the inventors took advantage of the lack of expression of sprD in strains RN4220 (laboratory strain, Kreiswirth et al., 1983). ) and SH1000 (virulent strain, Horsburgh et al., 2002), as demonstrated by Northern blots in both the exponential (E) and stationary (S) phases (Figure 2). The sprD gene, with its upstream predicted promoter sequence, was cloned into two low E. coli-S copy vectors. aureus, pCN38 and pCN51 (Charpentier et al., 2004) and transformed into strains RN4220 and SH1000. In both strains, at both E and S phases, these two vectors express in vivo in their expected size and expression levels comparable to their levels of endogenous expression in strain N315 (FIG. 2). In both strains of S. aureus, there are no detectable growth phenotypes regardless of whether or not sprD is produced (the growth curves are superimposable, not shown).

I1.3 SprD downregulates (down) Sbi protein levels in vivo The inventors made a comparison of total protein extracts from S. aureus strains expressing, or not, sprD in order to reveal differences in the expression levels of the selected proteins that could be extracted and identified by mass spectrometry (MS). To this end, total proteins from extracellular and intracellular extracts at both E and S phases were prepared from RN4220 and SH1000 strains expressing or not, sprD. Remarkably, a meticulous comparison of the extracellular protein extracts of the two strains by SDSPAGE reveals a protein band of about 45 kD whose level decreases in the presence of sprD at phase E (FIG. 3A). This result is observed for both the coding vectors for sprD, and for both strains of S. aureus, with a more pronounced reduction in protein levels for the SH1000 strain (Figure 3A). The protein (s) of this band were eluted, a triptych digest was prepared and the protein fragments were subjected to Maldi-Toff Mass Spectrometry. Twenty-five independent peptides were identified, all corresponding to the amino acid sequence of a single Sbi protein (Table 3). A second, independent confirmation of the downregulation of Sbi protein by SprD was obtained by studying endogenous Sbi protein expression in both extracellular (Figure 3B) and intracellular ( FIG. 3C) by Western blots, using a polycolonal antibody against the Sbi protein. As expected from a cell surface protein, sbi is identified in the extracellular fraction, but is also detected in the intracellular medium of the bacteria. The protein is strongly expressed in phase E but is also detected in phase S. When sprD is expressed, in both intra- and extra-cellular media, expression of the sbi protein is significantly reduced both in RN4220 and SH1000 cells and both E and S phases, in agreement with data from SDS-PAGE gels and mass spectrometry.

In phase S, sprD also reduces the level of expression of another extracellular protein band that has an apparent molecular weight of about 80 KD. From the mass spectrometry data, it appears that it contains two proteins, the precursor of extracellular triacylglycerol lipase and intracellular formate acetyltransferase (a contamination of the extracellular fraction by an intracellular protein), respectively eleven and seven peptide sequences have have been detected for these proteins. Observed Mr (expected) Mr (calculated) Peptides 452.2365 902.4584 902.4385 K.YLTDTYK.S 493.2919 984.5692 984.5604 K.QLDALVAQK.D 539.7876 1077.5606 1077.5454 K.AIKDFQDNK.A 542.8126 1083.6107 1083.5964 K.LLGYYQSLK.D 559.8298 1117.6450 1117.6284 K.AFYQVLHLK.G 561.7985 1121.5825 1121.5716 K.VDDKNGYLAK.S 562.8242 1123.6338 1123.6237 K. VEVPQIQ SPK. V 565.8000 1129.5855 1129.5801 R.EVNKAPMDVK.E35 566.2913 1130.5680 1130.5641 R.EVNKAPMDVK.E + Deamidation (NQ) 569.3008 1136.5871 1136.5713 R.AQEVFSESLK.D 589.2702 1176.5259 1176.5127 K.YYYNTYYK.Y 609.3096 1216.6047 1216.6047 K.LNEKDSIENR.R 613.3108 1224.6071 1224.5986 R .NYVTES1NTGK.V 639.8308 1277.6470 1277.6615 K. SAAYEANSKLPK.D 653.3 601 1304.7057 1304.6976 1393.7447 1393.7353 K. SYIQPLKVDDK.N R.VAQQNAFYNVLK.N 697.8796 734.3853 1466.7560 1466.7252 1490.7515 1490.7365 R.SQQVWVESVQSSK.A R.AQEVFSESLKDSK.N 746.3830 773.4359 1544.8572 1544.8409 K. GAIDQTVLTVLGSGSK.S 775.9313 1549.8481 1549.8364 1584.8978 1584.8551 793.4562 R.RVAQQNAFYNVLK.N K.VLYTFYQNPTLVK.T 846.4664 1690.9183 1690.9253 1703.7933 K. VEAPQIQ SPQIEKPK.A 852.9039 919.0168 1836.0191 1835.9992 1703.7863 K.HQTTQNNYVTDQQK.A K.YKGAIDQTVLTVLGSGSK.S 1018.5161 2035.0177 2034.9857 K.NDNLTEQEKNNYIAQIK .E + Table 3 I1.4 SprD is not involved in the regulation of sbi expression levels by human serum The level of prot Sbi on the surface of S. aureus cells is low but increases significantly after growth in the presence of human serum, the serum component responsible for induction of Sbi synthesis being IgG (Zhang et al., 2000). Since sprD downregulates sbi protein levels (FIG. 3), the inventors have assumed that sprD may be involved in the regulation of sbi protein levels by IgG from human serum. A reasonable hypothesis could be that human IgG downregulates, which in turn raises the levels of sbi proteins to act as receptors for environmental detection. In both SH1000 and MRSA252 strains of S. aureus, the presence of human serum increases the level of sbi protein, as shown by immunoblotting analysis using polyclonal antibodies against sbi (Figure 4A). The presence or absence of sprD, however, has no detectable influence on the stimulatory effect of human serum on sbi protein levels (Figure 4A). On the other hand, the levels of sprD RNA are essentially similar in the presence or absence of human serum as shown by Northern blots (Figure 4B). SprD is therefore not involved in the mechanism of induction of sbi expression by human IgG. ILS The regulation of sbi by sprD occurs by a direct interaction between the mRNA encoding the Sbi protein and the ssRNA The inventors have made it possible to answer the following two hypotheses: is the regulation of the levels of the protein sbi by sprD carried out directly or indirectly, through binding to an additional protein or to RNA regulators? Furthermore, does gDp-mediated regulation occur at the mRNA level and / or at the protein level? To distinguish between these hypotheses and to understand regulation at the molecular level, putative pairing interactions between sprD and sbi mRNA were analyzed in silico, focusing on the starting site of the translation of the MRNA encoding the sbi protein. Bacterial RNAs can function as antisense RNAs by base pairing with target mRNAs (Majdalani et al., 2005). Complementary sites between SprD and the 5 'portion of sbi mRNA, including its AUG initiation codon and the upstream Shine and Dalgarno (SD) sequence were detected using FASTA3 (Pearson 2000). The region of sprD predicted to be involved in the pairing is between H1 and H3, involving 43 nucleotides (in bold in Figure 1C, nucleotides of H2, L2, and H1 / H2 and H2 / H3 junctions), predicted for form 6 base pairs GC, 33 base pairs AU and 4 base pairs GU (Figure 5A) with the 5 'end of sbi mRNA. The 5 'end of sbi mRNA was determined experimentally using a 5'-RACE. From several DNA clones, the 5 'end of sprD was mapped at position G2476041 from the sequence of S. aureus N315 (Kuroda et al., 2001) extracted from the genome database of European Molecular Biology Laboratory (EMBL) (box G of Figure 5A). In vitro duplex formation between sprD (a transcript of a length of 142 purified nucleotides) and a synthetic sbi mRNA fragment of a length of 179 nucleotides containing its 5 'UTR sequence (41 nucleotides) followed by 46 codons has been studied by gel retardation tests. Both RNAs were separately and independently folded, cooled to room temperature, and labeled sbi mRNA was incubated with increasing concentrations of unlabeled sprD. The reactions were analyzed by gel electrophoresis using non-denaturing polyacrylamide gels (FIG. 5B). The sbi-sprD mRNA duplex is observed at a molar ratio of 1: 4 and almost all of the sbi protein is in the complex with its RNA regulator at a molar ratio of 1:20. This is why, in vitro, this Sbi-ssRNA mRNA interaction is formed in the absence of the Sm protein-related protein Hfq, known to play a key role in many of these RNA transactions in certain bacteria (Brennan and Link 2007). Hybridization between SprD and the sbi mRNA fragment is specific because a 100 to 2000-fold molar excess of yeast tRNAs does not displace sbi mRNA from a sbi spD-mRNA complex. preformed (Figure 5B). A deletion mutant of sbi mRNA was produced, Sbi A61 which lacks 61 nucleotides at its 5 'end including those predicted to be involved in the interaction with the sprD RNA. This deletion mutant becomes unable to hybridize to the sprD RNA, even at a 1:40 molar ratio between Sbi A61 and SprD, demonstrating that the first 61 nucleotides at the 5 'end of sbi are essential for produce hybridization with sprD, consistent with the proposed pairing between the two RNAs. A mutant sprD containing a deletion of 36 nucleotides in the region predicted to interact with sbi mRNA (sprDA is lacking nucleotides of positions 35 to 70, see Figure 1C for details) was not able to hybridize specifically to sbi mRNA (Figure 5B). It demonstrates the involvement of the H2, L2 and H2 / H3 junction domains from sprD in the recognition and specific hybridization of the mRNA encoding the Sbi protein.

11 .6 Study of the sbi sprD-mRNA complex by structural probes To gain a deeper understanding of the interaction between mRNA of sbi and sprD at a molecular level, a complex between the two RNAs was formed at one ratio. molar ratio of 1:10 between sbi and labeled sprD and cleaved by RNases S1 and V1 (Figure 6). In the presence of sbi mRNA (FIG. 4), cleavages S1 at positions U23-U30 (H1 / H2 and H2 junction), U37-G39 and U56-U61 (H2), U44-C48 (L2 loop) and A68 -U73 (junction H2 / H3) disappear in the sequence sprD, while the cuts S1 appear at the level of C51-U53 (H2). During formation of the complex, cuts V1 at C40 and A54 disappear (the upper part of H2) while two cuts V1 appear at U44-U45 (L2). All of the structurally identified structural changes are in and around the H2-L2 zone of sprD, with no detectable conformational changes for the H1-L1, H2-L2 and H3-L3 loop rods. These structural survey results provide strong experimental support for the secondary structure model of the interaction between the two RNAs shown in Figure 5A. Upon formation of the complex, the unstable H2 stem unfolds, allowing extensive but interrupted pairings from nucleotides 22 to 75. In the complex, the L2 loop folds as an RNA helix, as evidenced by appearance of the cuts V1 (U44-U45) and the disappearance of the cuts S1 (U44-C48). The relative instability in H2 solution in the sprD structure alone is well understood since H2 must unfold for extensive pairing with a complementary sequence from sbi mRNA (U28-C42 and U53-A64 from sprD pairs with A47-C34 and A23-U13 from sbi, respectively, Figure 5A). The specific hybridization of SprD with sbi mRNA leads to an inhibition of the translation initiation of sbi mRNA into sbi protein (see Figure 7).

The sbi sprD-mRNA complex prevents binding of 70S SprD ribosomes, when interacting with sbi mRNA, covers the ribosome binding site (RBS) and the AUG initiation codon (Figure 5A). . Therefore, since the sites of interaction of sprD with sbi mRNA coincide with the mRNA region that is covered by ribosomes during the initiation of translation (Hüttenhofer and Noller 1994), inventors tested whether this complex was able to prevent binding of 70S ribosomes using toeprinting assays. The ternary initiation complex consisting of E 70S ribosomes purified coli, the ssRNA-mRNA initiator and the sbi mRNA blocked the elongation of a cDNA primer by reverse transcriptase (RT) and produced two toeprints of 14 and 17 nucleotides downstream of the initiation codon (FIG. , band 4), which experimentally confirms the positioning of the sbi start codon as shown in Figure 5. The presence of sprD reduces the interaction of 70S ribosomes with sbi mRNA, in a concentration-dependent manner. (Figure 7, lanes 5-7) The addition of increasing amounts of a deletion mutant of sprD, spr-A, which can not complex with sbi mRNA in vitro (Figure 5B), does not occur. does not avoid the interaction of 70S ribosomes with sbi mRNA, therefore, sprD RNA inhibits translation of sbi mRNA by avoiding interaction of ribosomes with mRNA via a pairing interaction direct antisense with target sbi mRNA.

III. Discussion The variety of clinical symptoms of staphylococcal infections depends on the expression of virulence factors that are under the control of specific intracellular regulatory proteins and RNA. The only known and well-characterized RNA regulatory mechanism for the pathogenesis of S. aureus is RNAIII, which controls the expression of a large number of virulence genes (Huntzinger et al., 2005, Boisset et al., 2007). The inventors have demonstrated that there is another RNA expressed in particular by S. aureus, SprD, which is also involved in the regulation of virulence genes. SprD acts as an antisense RNA and causes a direct repression of the translation of the mRNA encoding the sbi protein. The inventors have shown that the expression of the sbi protein is modulated by at least two regulators which are independent of each other (FIG. 4): upregulation (upwards) triggered by human IgG and a downregulation (downward) mediated by sprD, suggesting that the amount and timing of production of the sbi protein is restricted to a narrow window for bacteria of the genus Staphylococcus, including S. aureus, to successfully evade both adaptive immune system and innate immune system during human and animal infections. The inventors have demonstrated the regulatory role and the mechanism of an RNA expressed in particular by S. aureus, SprD, and identified a target mRNA: the mRNA encoding the Sbi protein. SprD has at least one additional target mRNA that will be subjected to additional biochemical characterization by the inventors. The central domain (nucleotides 22-75 of sequence SEQ ID No. 7) of sprD folds as a stem-loop structure flanked by single RNA strands (FIG. 1C) and causes a direct repression of the translation of the Sbi mRNA by extensive pairing with its target mRNA encoding the sbi protein (Figure 5A), forming a long duplex. Of the 142 nucleotides of the SprD sequence, 96 are involved in pairing interactions (Figure 1C), indicating that about 68% of its sequence is not accessible for exonuclease digestion, which accounts for its stability in vivo (Figure 2). The molecular interaction between SprD and mRNA encoding the sbi protein is supported by mutational analysis of the two RNAs (Figure 5B) as well as the use of structural probes in solution (Figure 6). The 5 'leader sequence of sbi mRNA, 41 nucleotides in length (nucleotides 1-41 of sequence SEQ ID No. 3), is crucial for regulation because sprD is unable to interact with the mutant deletion of mRNA, sbi061 (Figure 5B). The H2-L2 hairpin motif from sprD could facilitate the sprD-mRNA interaction of initial sbi, which would then further extend upstream and downstream, in a manner similar to RNAIII-mRNA regulations (Boisset et al., 2007). ). In fact, effective pairings between interacting RNAs initially occur between limited loop-to-loop or unpaired-loop sequence interactions (Wagner et al., 2002). At the same time, the 5 'leader sequence of sbi mRNA and the central domain of sbi mRNA were subjected to strong evolutionary constraints in order to maintain the pairing interaction (the leader nucleotide sequence sbi mRNA is conserved among S. aureus sequences). When this antisense-target RNA complex is formed, ribosomes are unable to bind to the translation initiation region of sbi mRNA (Figure 7). Formation of a complex between SprD and target mRNA increases the amount of sbi mRNA detected in vivo, as evidenced by Northern blots (data not shown). This result could be due either to a direct stimulation of sprD for sbi mRNA transcription or to an indirect consequence of an increase in the stability of the target mRNA due to extensive pairing with its regulatory RNA. Experiments performed by the inventors are under way to try to make a choice between these hypotheses. The formation of a complex between SprD and the mRNA encoding the sbi protein in vitro does not require the presence of the Sm protein-related Hfq protein (Figure 5B), and the in vivo expression levels of SprD are not affected. by the presence or absence of the Hfq protein (data not shown). These results are consistent with previous studies since the Hfq protein is expressed at low levels in S. aureus, with no detectable effect on virulence gene expression (Geisinger et al 2006, Bohn et al., 2007). ) and since Hfq has no major effect on the stability of RNAIII and its mRNA targets in vivo and on the formation of an RNAIII-mRNA complex in vitro (Boisset et al, 2007).

The inventors have thus demonstrated another example of sophisticated regulation of genes coding for virulence factors in bacteria of the genus Staphylococcus, in particular S. aureus, suggesting that the chronology and the amount of synthesis of the virulence factors are precisely controlled during the infectious process.

References Antal, M., Bordeau, V., Douchin, V., and Felden, B. 2005. A small bacterial RNA regulates a putative ABC transporter. J. Biol. Chem. 280: 7901-7908. Atkins, KL, Burman, JD, Chamberlain, ES, Cooper, JE, Poutrel, B., Bagby, S., Jenkins, AT, Feil, EJ, and van den Elsen, JM 2008. S. aureus IgG-binding proteins SpA and Sbi: Host Specificity and Mechanisms of Immune Complex Training. Mol. Immunol. 45: 1600-1611. Beaucage SL. 2008, Solid-phase synthesis of siRNA oligonucleotides, Curr Opin Drug Discov Devel. 11: 203-216 Bohn, C., Rigoulay, C., and Bouloc, P. 2007. No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus. BMC Microbiol. 7:10. Boisset, S., Geissmann, T., Huntzinger, E., Fechter, P., Bendridi, N., Possedko, M., Chevalier, C., Helfer, AC, Benito, Y., Jacquier, A., Gaspin, C., Vandenesch, F., and Romby, P. 2007. Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes Dev. 21: 1353-1366. Brennan, R.G. and Link, T.M. 2007. Hfq structure, function and ligand binding. Curr. Opin. Microbiol. 10: 125-133. Burman, JD, Leung, E., Atkins, KL, O'Seaghdha, MN, Lango, L., Bernado, P., Bagby, S., Svergun, DI, Foster, TJ, Isenman, DE, and van den Elsen , JM 2008. Interaction of 25 human complement with SBI, a staphylococcal immunoglobulin-binding protein: Indications for a novel mechanism of supplementation by Staphylococcus aureus. J. Biol. Chem. 283: 17579-17593. Charpentier, E., Anton, A.I., Barry, P., Alfonso, B., Fang, Y., and Novick, R.P. 2004. Novel cassette-based shuttle vector system for gram-positive bacteria. Appl. About. Microbiol. 70: 6076-6085. Chesneau, O., Ligeret, H., Hosan-Aghaie, N., Morvan, A., and Dassa, E. 2005. Molecular Analysis of Resistance to Streptogramin A Compounds Conferred by the Vga Proteins of Staphylococci. Antimicrob. Agents Chemother. 49: 973-980.

Downer, R., Roche, F., Park, PW, Mecham, RP, and Foster, TJ 2002. The elastin-binding protein of Staphylococcus aureus (EbpS) is expressed in the cell surface as an integral membrane protein. cell wall-associated protein. J. Biol. Chem. 277: 243-250. Felden, B. 2007. RNA structure: experimental analysis. Curr. Opin. Microbiol. 10: 286-291.

Geisinger, E., Adhikari, R.P., Jin, R., Ross, H.F., and Novick, R.P. 2006. Inhibition of rot translation by RNAIII, a key feature of agr function. Mol. Microbiol. 61: 1038-1048. Hammel et al., 2007, A structural basis for complement inhibition by Staphylococcus aureus., Nat. Immunol. 8, 430-437. Hammel et al., 2007, Characterization of Ehp, a secreted complement inhibitory protein from Staphylococcus aureus, J. Biol. Chem., 282, 30051-30061. Hartz, D., McPheeters, D.S., Traut, R., and Gold, L. 1988. Inhibition. Methods Enzymol.164: 419-425. Horsburgh, M.J., Aish, J.L., White, I.J., Shaw, L., Lithgow, J.K., and Foster, S.J. 2002. aB Modulates virulence determinant expression and stress resistance: Characterization of a functional strain derived from Staphylococcus aureus J. Bacteriol. 184: 5457-5467. Huntzinger, E., Boisset, S., Saveanu, C., Benito, Y., Geissmann, T., Namane, A., Lina, G., Etienne, J., Ehresmann, B., Ehresmann, C., et al. 2005. Staphylococcus aureus RNAIII and the endoribonuclease III. EMBO J. 24: 824-835. Hüttenhofer, A. and Noller, H.F. 1994. Footprinting mRNA-ribosome complexes with chemical probes. EMBO J. 13: 3892-3901. Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S., and Novick, R.P. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by prophage. Nature 305: 709-712. Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., Cui, L., Oguchi, A., Aoki, K., Nagai, Y., Lian, J., Ito, T., Kanamori, M., Matsumaru, H., Maruyama, A., Murakami, H., Hosoyama, A., Mizutani-Ui, Y., Takahashi, NK, Sawano, T. , Inoue, R., Kaito, C., Sekimizu, K., Hirakawa, H., Kuhara, S., Goto, S., Yabuzaki, J., Kanehisa, M., Yamashita, A., Oshima, K. , Furuya, K., Yoshino, C., Shiba, T., Hattori, M., Ogasawara, N., Hayashi, H., and Hiramatsu, K. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357: 1225-1240. Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of bacteriophage T4. Nature 227: 680-685. Lowy FD. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339: 520-532. Majdalani, N., Vanderpool, C.K., Gottesman, S. 2005. Bacterial small RNA regulators. Crit.

Rev. Biochem. Mol. Biol. 40: 93-113.

McCallum, N., Karauzum, H., Getzmann, R., Bischoff, M., Majcherczyk, P., Berger-Bchi, B., and Landmann, R. 2006. In vivo survival of teicoplanin-resistant staphylococcus aureus and fitness cost of teicoplanin resistance. Antimicrob Agents Chemother. 50: 2352-2360. Milligan JF, Uhlenbeck OC. 1989, Synthesis of Small RNAs Using T7 RNA Polymerase.Methods Enzymol. ; 1 8 0: 5 1-62. Moks, T., Abrahmsen, L., Nilsson, B., Hellman, U., Sjoquist, J., and Uhlen, M. 1986. Staphylococcal protein A consists of five IgG-binding domains. Eur. J. Biochem. 156: 637-643. Moore, S.D. and Sauer, R.T. 2007. The tmRNA system for translational surveillance and ribosome rescue. Annu. Rev. Biochem. 76: 101-124. Nicholas H. Mann, 2008 The potential of phages to prevent MRSA infections, Research in Microbiology Novick, RP, Ross, HF, Projan, SJ, Kornblum, J., Kreiswirth, B., and Moghazeh, S. 1993. Synthesis of Staphylococcal virulence factors is controlled by a regulatory RNA molecule.

EMBO J. 12: 3967-3975. Pearson, W.R. 2000. Flexible sequence similarity searching for the FASTA3 program package. Methods Mol. Biol. 132: 185-219. Pichon, C. and Felden, B. 2005. Small RNA genes expressed by Staphylococcus aureus genomic and pathogenicity with specific expression among pathogenic strains. Proc.

Natl. Acad. Sci. USA. 102: 14249-14254. Rooijakkers et al., 2007, J. Immunol., 179, 2989-2998 Romby, P., Vandenesch, F., and Wagner, E.G. 2006. The role of RNAs in the regulation of virulence-gene expression. Curr. Opin. Microbiol. 9: 229-236. Sherlin LD, Bullock TL, Nissan TA, Perona JJ, Lariviere FJ, Uhlenbeck OC, 2001 Scaringe SA.Chemical and enzymatic synthesis of tRNAs for high-throughput crystallization.RNA. 7: 1671-1678 Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning - A Laboratory Manual, 2nd Edition. Cold Spring Habour Laboratory Press, New York. Upadhyay, A., Burman, JD, Clark, EA, Leung, E., Isenman, DE, Van den Elsen, JM, and Bagby, S. 2008. Structure-Function Analysis of the C3 Binding Region of Staphylococcus aureus Immune Subversion Protein Sbi. J. Biol. Chem. 283: 22113-22120. Wagner, E.G.H., Altuvia, S., and Romby, P. 2002. Antisense RNAs in bacteria and their genetic elements. Adv. Broom. 46: 361-398. Zhang, L., Jacobsson, K., Vasi, J., Lindberg, M., and Frykberg L. 1998. A second IgG-binding protein in Staphylococcus aureus. Microbiology 145: 985-991.

Zhang, L., Jacobsson, K., Strom, K., Lindberg, M., and Frykberg L. 1999. Staphylococcus aureus expressing cell surface protein that binds both IgG and beta2-glycoprotein I. Microbiology 145: 177-183. Zhang, L., Rosander, A., Jacobsson, K., Lindberg, M., and Frykberg, L. 2000. Expression of S. staphylococcal protein. FEMS Immunol. Med. Microbiol. 28: 211-218.

Claims (17)

REVENDICATIONS1. Isolated polynucleotide characterized in that it comprises a sequence selected from the group comprising: - the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID No. 1 and the fragments of these; and the sequence SEQ ID No. 2, the derived sequences having at least 70% identity with the sequence SEQ ID No. 2 and the fragments thereof; and the sequence complementary to the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with said complementary sequence and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3. 2. isolated polynucleotide according to claim 1, characterized in that it comprises a sequence selected from the group comprising: the sequence SEQ ID No. 6, the derived sequences having at least 70% identity with the sequence SEQ ID N 6 and fragments thereof; and the sequence SEQ ID No. 7, the derived sequences having at least 70% identity with the sequence SEQ ID No. 7 and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID NO: 3. 25 3. isolated polynucleotide according to one of claims 1 or 2, characterized in that it is an RNA. 4. Isolated polynucleotide according to claim 3, characterized in that it is an RNA comprising a sequence chosen from the group comprising: the sequence SEQ ID No. 2, in which the nucleotides in positions 23, 24 and 36 are u; The sequence SEQ ID No. 2, in which the nucleotides in positions 23 and 24 are c and the nucleotide in position 36 is u; and the sequence SEQ ID No. 2, in which the nucleotides in positions 23, 24 are c and the nucleotide in position 36 is a; and the sequence SEQ ID No. 7, in which the nucleotides at positions 44, 45 and 57 are u; the sequence SEQ ID No. 7, in which the nucleotides at positions 44 and 45 are c and the nucleotide at position 57 is u; and the sequence SEQ ID No. 7, in which the nucleotides at positions 44, 45 are c and the nucleotide at position 57 is a. An expression cassette comprising a DNA sequence chosen from the group comprising: the sequence SEQ ID No. 1, the derived sequences having at least 70% identity with the sequence SEQ ID No. 1 and the fragments of these; and the sequence SEQ ID No. 6, the derived sequences having at least 70% identity with the sequence SEQ ID No. 6 and the fragments thereof; and a DNA sequence that can be transcribed into an RNA according to one of claims 3 or 4. A recombinant vector comprising an isolated polynucleotide according to any one of claims 1 to 4 or an expression cassette according to claim 5. 7. Vector according to claim 6, characterized in that it is a bacteriophage. 8. Host cell transformed by an expression cassette according to claim 5 or a vector according to one of claims 6 or 7. A composition comprising at least one component selected from the group consisting of an isolated polynucleotide according to any one of claims 1 to 4, an expression cassette according to claim 5, a vector according to one of claims 6 or 7 and a host cell according to claim 8. 10. Composition according to claim 9, characterized in that it is a pharmaceutical composition. An isolated polynucleotide according to any one of claims 1 to 4, or an expression cassette according to claim 5, or a vector according to one of claims 6 or 7 or a host cell according to claim 8, for its application as a drug for the prevention and / or treatment of a staphylococcal infection. 12. Use of a component selected from the group comprising an isolated polynucleotide according to any one of claims 1 to 4, an expression cassette according to claim 5, a vector according to one of claims 6 or 7, a cell A host according to claim 8 for the preparation of a medicament for the prevention and / or treatment of a staphylococcal infection. 13. Isolated polynucleotide characterized in that it comprises a sequence selected from the group comprising: the sequence SEQ ID No. 3, the derived sequences having at least 70% identity with the sequence SEQ ID No. 3 and the fragments of these; and the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments thereof; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 1 and / or with the sequence SEQ ID No. 2. 14. Isolated polynucleotide, characterized in that it comprises: a sequence containing nucleotides 1 to 41 of one of the sequences SEQ ID No. 3 or SEQ ID No. 4, coupled at its 3 'end to a coding sequence of a gene of interest. 30 15. Isolated polynucleotide according to one of claims 13 or 14, characterized in that it is an RNA. 16. An expression cassette comprising a DNA sequence chosen from the group 5 comprising: the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments; of these; and a DNA sequence transcribable to a polynucleotide according to claim 15. A recombinant vector comprising an expression cassette according to claim 16. A host cell transformed with an expression cassette according to claim 16 or a vector according to the claim 17. A product containing: at least one component selected from the group comprising an isolated polynucleotide according to any one of claims 1 to 4, an expression cassette according to claim 5, a vector according to one of the claims 6 or 7, a host cell according to claim 8; and at least one other antistaphylococcal agent, as a combination product for simultaneous, separate and / or spreading use for the prevention and / or treatment of a staphylococcal infection. 20. The pharmaceutical composition according to claim 10, characterized in that it further comprises: - an isolated polynucleotide according to claim 14 wherein said coding sequence is a sequence coding for at least one domain of the Sbi protein, and / or an expression vector comprising an isolated polynucleotide according to claim 14 wherein said coding sequence is a sequence coding for at least one domain of the Sbi protein, said domain of the Sbi protein being capable of binding specifically to the C3 protein of the complement and / or immunoglobulin IgG. 21. A method for detecting, in vitro, the presence of bacteria of the genus Staphylococcus in a biological sample, characterized in that it comprises the detection of at least one sequence chosen from the group comprising: the sequences as defined according to any one of claims 1 to 4; and the sequences as defined in claim 13; with at least one appropriate detection means of said sequence. 22. A method for detecting, in vitro, mRNA of the gene encoding the Sbi protein present in a biological sample, characterized in that it comprises the following steps: contacting said biological sample with at least one probe comprising a sequence selected from the sequences defined in claim 1; and detecting the hybridization of said probe with said mRNA of the gene encoding the Sbi protein with at least one means for detecting said appropriate hybridization. 23. mRNA detection kit of the gene encoding the Sbi protein, characterized in that it comprises: at least one probe as defined according to claim 22; and at least one means for detecting the hybridization of said probe with said mRNA of the gene encoding the Sbi protein. 24. Kit for regulating the expression of a gene of interest characterized in that it comprises: at least one first component selected from the group comprising a polynucleotide according to any one of claims 13 to 15, a an expression cassette according to claim 16, a vector according to claim 17, a host cell according to claim 18; and at least one second component selected from the group comprising an isolated polynucleotide according to any one of claims 1 to 4, an expression cassette according to claim 5, a vector according to one of claims 6 or 7, a cell Host according to claim 8. 25. Non-therapeutic use of an isolated polynucleotide according to any one of claims 1 to 4 for inhibiting the expression of the gene encoding the Sbi protein. The non-therapeutic use of an isolated polynucleotide according to any one of claims 13 to 15 in combination with an isolated polynucleotide according to any one of claims 1 to 4 for inhibiting the expression of a gene of interest.