WO2013086331A1 - High efficiency di-nucleotide cyclase - Google Patents

Abstract

The present invention provides for a novel family of enzymes that can synthesis cyclic di-nucleotides. The enzyme is easily purified, highly active and converts ATP/GTP to the respective cyclic di-nucleotide with >95% efficiency in a short reaction time. More specifically, these enzymes can synthesis c-di-AMP, c-di-GMP, and a previously undiscovered c-AMP-GMP hybrid molecule, from ATP and GTP precursors.

Description

HIGH EFFICIENCY DI-NUCLEOTIDE CYCLASE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional

Application No. 61/567,889 filed December 7, 2011, the contents of which are incorporated herein by reference in its entirety.

GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant AI-018045 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD

[0003] The present embodiments provide for a novel family of enzymes that synthesize cyclic di-nucleotides, such as c-di-AMP, c-di-GMP and a previously undiscovered c-AMP-GMP hybrid molecule, from NTP precursors.

BACKGROUND

[0004] Cyclic di-nucleotides are being used increasingly for numerous applications such as, for example, stimulators of the innate immune response, adjuvants, modulators of microbial signaling, and as molecular probes. Chemical synthesis of these molecules is quite expensive, however, thus there remains a need for alternative, efficient, and affordable approaches for cyclic di-nucleotide production.

SUMMARY

[0005] The present invention provides for a novel family of enzymes that can synthesis cyclic di-nucleotides. The enzyme is easily purified, highly active and converts ATP/GTP to the respective cyclic di-nucleotide with >95% efficiency in a short reaction time. More specifically, these enzymes can synthesis c-di-AMP, c-di-GMP, and a previously undiscovered c-AMP-GMP hybrid molecule, from ATP and GTP precursors.

[0006] An aspect of the present invention provides for a purified di-nucleotide cyclase enzyme (DncV) or an analog, homolog, derivative, variant, or portion thereof. The DncV can be purified from Vibrio; or the DncV can be a recombinant DncV. The isolated DncV proteins can either be immobilized or transferred to an additional or subsequent support. Supports can be solid supports, such as flat slides, or chips, beads or fibers, or semi-solid supports, such as gel matrices.

[0007] Another aspect provides for a cyclic di-nucleotide produced by use of a purified

DncV. For example, the c-di-NMP can be c-di-AMP, c-di-GMP and/or c-AMP-GMP. The isolated c-di-NMP can either be immobilized or transferred to an additional or subsequent support. Supports can be solid supports, such as flat slides, or chips, beads or fibers, or semisolid supports, such as gel matrices. C-di-NMPs can be transferred by, among other methods, directly contacting supports.

[0008] Yet another aspect provides for an adjuvant comprising the cyclic di-nucleotide produced by use of the purified DncV.

[0009] Still another aspect provides for a cyclic di-nucleotide produced by use of the purified DncV, further comprising a label, such as biotin.

[00010] Another aspect provides for a purified c-AMP-GMP hybrid molecule.

[00011] Another aspect provides for a method of manufacturing a cyclic di-nucleotide comprising the steps of contacting a c-di-NMP-precursor (NTP) with DncV under conditions in which the DncV catalyzes the conversion of the nucleotide to a c-di-NMP.

[00012] A different aspect provides for a target for inhibiting Vibrio infection, wherein the target is DncV. For example, an aspect provides for a vaccine against Vibrio, comprising an immunogenic DncV protein or portion thereof; or vaccine comprising a live attenuated Vibrio that lacks a DncV gene or expresses a defective DncV gene. Alternatively, an aspect provides for a method of treating Vibrio infection comprising administering antigen-binding molecules that bind DncV. The antigen-binding molecule can be a small molecule, an aptamer, an antibody or portion thereof.

[00013] Yet another aspect of the present invention provides for a purified nucleic acid molecule that encodes DncV. A related aspect is recombinant vector that comprises the nucleic acid molecule; and/or a host cell that comprises the recombinant vector.

DESCRIPTION OF THE DRAWINGS

[00014] Figure 1 shows schematic outlining ToxT regulon. Major regulatory targets grouped by functional class are shown. Solid arrows denote direct ToxT regulation identified by integrated ChlP-seq and RNA-seq analysis. Dashed arrows denote indirect ToxT regulation identified by RNA-seq alone. Green indicates positive gene expression, red indicates negative gene expression. Specific pathways are indicated beside their functional group and colored to indicate the direction of their regulation. [00015] Figure 2A shows a schematic of the 6th ToxT ChlP-peak site in the Tcp island between VC0845 and VC0846. The heat map shows enrichment (red) of sequenced reads at ToxT ChlP-peak. Below, alignment of RNA-seq reads shows the predicted sRNA outlined by the black box. RNA-seq reads colored red align to the reverse strand of the genome while reads colored green align to the forward strand. The predicted sequence of the sRNA is shown at the top in upper case font from 5' to 3'. The nucleotides in bold highlight a rho-independent hairpin terminator predicted by the ARNold program server.

[00016] Figure 2B shows ToxT ChIP enrichment of the promoter regions of ctxA, tcpA and 6th ToxT ChIP peak were determined by qPCR relative to sample DNA input. Enrichment of a non ToxT-dependent promoter of VC1141 is shown as a control. Significance was determined by t-test relative to the VC1141 promoter; *** p < 0.001; **** p < 0.0001.

[00017] Figure 2C is a Northern blot of RNA from indicated strains probed for the presence of the sRNA (TarB) as predicted by RNA-seq alignment (top panel). The size markers of a ssRNA ladder are indicated. The same samples were probed for 5S rRNA as a loading control (bottom panel).

[00018] Figure 2D is qPCR analysis of the effect of TarB on VC0177 (VspR) expression levels in V. cholerae wild type strains C6706 and E7946 following expression of ToxT from a plasmid. Expression for each sample was determined relative to 16S rRNA and at least three independent replicates tested. Fold changes are normalized relative to expression in the wild type strain. Significance was determined by t-test relative to the wild type strain; ** p < 0.01; **** p < 0.0001.

[00019] Figure 3A illustrates expression analysis of VSP-1 genes in WT and VC0177::Tn

C6706 strains. The expression of each gene was determined relative to total 16S rRNA. 8 replicates were sampled for each gene. Significance was determined by t-test; * p < 0.05; ** p < 0.01; **** p < 0.0001.

[00020] Figure 3B shows VC0177 (VspR) ChIP enrichment of the 5'UTR regions of

VC0176, VC0178, VC0179 and VC0180 was determined by qPCR relative to sample DNA input. Enrichment of the promoter region of non VSP-1 gene VC1141 is shown as a control. Significance was determined by t-test relative to control enrichment; * p < 0.05; ** p < 0.01

[00021] Figure 3C relates in vivo competition experiments measuring the ability of mutant strains to colonize the infant mouse intestine compared with the parental strain. Significance was determined by t-test relative to colonization ratio of parental strains wild type C6706 vs. C6706 AlacZ; **** p < 0.0001.

[00022] Figure 4 presents di-nucleotide cyclase activity of VC0179 (DncV).

Figure 4A: 50 ng of purified wild type or mutated VC0179 was incubated with 1 mM ATP and 10 μθ α-Ρ32 ATP for the indicated time (t in min) and the products (PI) separated by denaturing PAGE. Figure 4B: The product from the reaction between VC0179 and ATP (PI) was incubated with calf intestinal phosphatase (CIP) or snake venom phosphodieasterase (SVPD) for 30 min and separated by denaturing PAGE. Figure 4C: 50 ng of purified wild type VC0179 was incubated with 1 mM GTP and 10 μθ a-P32GTP for the indicated time (t in min) and the products (P2) separated by denaturing PAGE. Figure 4D: 50 ng VC0179 was incubated with ATP or GTP as described above or with 1 mM GTP and 10 μθ α-Ρ32ΑΤΡ and the products (Pl-3) separated by denaturing PAGE. Figure 4E: 50 ng of purified wild type VC0179 were incubated with ImM GTP and 10 μθ α-Ρ32ΑΤΡ for the indicated time (t in min) and the products (P3) separated by denaturing PAGE. PI, c-di-AMP; P2, c-di-GMP; P3, c-AMP-GMP.

[00023] Figure 5 shows the HPLC analysis of commercial standards and VC0179 (DncV) reaction products. Figure 5 A: Commercial standards of ATP, GTP, c-di-AMP and c-di-GMP were fractionated on a CI 8 column by HPLC using a gradient of 10 mM ammonium acetate (pH 5.5) and methanol. The peaks are labeled by their respective compound. A reaction of 50 ng of VC0179 incubated with 2mM ATP (5B), 2mM GTP (5C), ImM ATP + ImM GTP (5D), or ImM of each of the 5 NTPs (5E) for 30 min at 37 °C was fractionated on a CI 8 column by HPLC using a gradient of 10 mM ammonium acetate (pH 5.5) and methanol. Product elution was monitored at 254 nm.

[00024] Figure 6A illustrates functional categories of differentially expressed genes in response to expression of DncV. The number of genes induced or repressed in response to DncV expression is presented. Green indicates genes in the respective category are induced > 2 fold, red indicated genes in respective category are repressed > 2 fold (FDR corrected p-value < 0.01). Figure 6B shows examination of chemotactic behavior of wild type, ADncV mutant, and ADncV mutant expressing wild type and D131A/D131A mutant DncV from an arabinose inducible plasmid, with and without induction by arabinose.

[00025] Figure 7 presents a model for ToxT-dependent TarB-mediated control of VSP-1.

(1) Host signals induce ToxT activity resulting in transcription of TarB from the Tcp Island.

(2) Stabilized by Hfq, TarB downregulates expression of transcriptional repressor VC0177 (VspR) resulting in de-repression of VSP-1 genes including VC0179 (DncV). (3) DncV activity increases cellular concentration of c-di-nucleotides that affects chemotactic behavior and other metabolic aspects of 7th pandemic V. cholerae.

[00026] Figure 8 is the computational prediction using RNA hybrid of the interactions between TarB and the 5'UTR of (A) VspR and (B) TcpF. TarB is shown in green. The arrows indicate the ATG start codon of VspR and TcpF mRNA. Free energy of hybridization is shown. [00027] Figure 9 shows the sequence alignment of VC0179 and human oligo adenylate synthetase (OAS) based on HHPRED analysis. Catalytic residues of OAS aligning with identical residues in VC0179 are shown in black boxes. The nucleotidyl transferase superfamily consensus sequence in underlined in grey (G[G/S]x9-13Dx[D/E]). Red asterisks mark the residues in VC0179 mutated to alanine (D131A and D133A). Alignment of VC0179 homologs was performed using ClustalW. Matrix, BLOSUM; Open gap penalty, 10; Extending gap penalty, 0.05; End gap penalty, 10; Separation gap penalty 0.05.

[00028] Figure 10 presents LCMS analysis of (10A) c-di-GMP , (10B) VC0179 + GTP reaction product, (IOC) c-di-AMP, (10D) VC0179 + ATP reaction product and (10E) VC0179 + ATP +GTP reaction product.

[00029] Figure 11A illustrates the molecular structures, exact masses and MS/MS fragmentation pattern of c-di-AMP, c-di-GMP and c-AMPGMP. MS/MS analysis of: (11B) c- di-GMP , (11C) VC0179 + GTP reaction product, (1 ID) c-di-AMP, (HE) VC0179 + ATP reaction product and (11F) VC0179 + ATP +GTP reaction product.

[00030] Figure 12. Tree guide of ClustalW alignment of homologs that are at least 20% similar to DncV and have the conserved G[G/S]X9-I3D_X[D/E] motif. The position of 7th pandemic V. cholerae El Tor strains is indicated with by the asterisk. Matrix, BLOSUM; Open gap penalty, 10; Extending gap penalty, 0.05; End gap penalty, 10; Separation gap penalty 0.05.

DETAILED DESCRIPTION

[00031] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[00032] As used herein and in the claims, the singular forms include the plural reference and vice versa unless the context clearly indicates otherwise. Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about."

[00033] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[00034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains. Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are described herein.

[00035] All pandemic strains of Vibrio cholerae possess the TCP island and filamentous phage CTX; however, unique to 7th pandemic strains is the poorly understood V. cholerae pandemic island-1 (VSP-1). ChlP-seq and RNA-seq to map the regulon of the master virulence regulator ToxT facilitated the present identification of a TCP island-encoded sRNA that reduces the expression of a previously unrecognized VSP-1 transcription factor; VspR. VspR modulates the expression of VSP-1 genes, including one that encodes a novel class of di-nucleotide cyclase (DncV) described herein. DncV can synthesize cyclic di-AMP, cyclic di-GMP, and a new hybrid cyclic AMP-GMP molecule. Furthermore, DncV is required for intestinal colonization and down-regulates chemotaxis in V. cholerae, a phenotype previously associated with hyperinfectivity. This pathway couples the actions of previously disparate genomic islands, defines VSP-1 as a pathogenicity island in V. cholerae and implicates its occurrence in 7th pandemic strains as a benefit for host adaptation through the production of a novel regulatory cyclic di-nucleotide.

[00036] Recent deadly outbreaks in Haiti and Africa highlight the continuing impact of cholera on global health. Enserink, 330 Sci. 730 (2010). The causative agent of cholera, V. cholerae, requires a multifaceted regulatory network involving a hierarchy of transcription factors (TF), small RNAs and signaling molecules to ensure the proper spatial and temporal activation of virulence factor expression. Childers & Klose, 2 Future Microbiol. 335 (2007); Ritchie & Waldor, 337 Curr. Top. Microniol. Immunol. 37 (2009). At the core of the virulence regulatory network, transcription factors ToxR and TcpP cooperate to stimulate expression of ToxT. Often referred to as the master virulence regulator, ToxT directly activates expression of several essential virulence genes including those that encode cholera toxin and an essential colonization factor, the toxin co-regulated pilus (TCP). Lowden et al., 107 PNAS 2860 (2010). Although ToxT is essential for V. cholerae pathogenesis, the complete spectrum of genes it regulates is unknown. DiRita et al., 88 PNAS 5403 (1991); Weber & Klose, 133 Indian J. Med. Res. 201(2011). [00037] ToxT is encoded on the TCP island, a chromosomal segment that encodes many virulence associated genes found in all pandemic strains of V. cholerae. Faruque & Mekalanos, 11 Trends Microbiol 505 (2003). All pandemic strains also carry the CTX prophage encoding the genes for cholera toxin (ctxAB) as well as the genomes for satellite phages. Hassan et al., 467 Nature 982 (2010). Two V. cholera biotypes account for the majority of all recorded cholera pandemics. The classical biotype is thought to have caused the first six pandemics (Kaper et al., 8 Clin. Microbiol. Rev. 48 (1995); Pollitzer, Cholera (WHO, Geneva, 1959)), but was replaced by the 7th pandemic El Tor biotype approximately 50 years ago. Faruque & Mekalanos, 2003. The 7th pandemic El Tor strains are genetically distinguishable from classical strains by the presence of two genomic islands, VSP-1 and VSP-2. Dziejman et al., 99 PNAS 1556 (2002). These islands are consistently found in clinical El Tor isolates and are thought to be responsible, at least in part, for the success of the 7th pandemic clone. (Dziejman et al., 2002; Grim et al., 14 OMICS 1 (2010); Rahman et al., 27 DNA Cell Biol. 347 (2008); Taviani et al., 308 FEMS Microbiol. Lett. 130 (2010). Validation of predicted functions for most ORFs on these islands, however, or evidence for the contribution of VSP-1 or VSP-2 to environmental or host adaptation, are lacking. Dziejman et al., 2002. Furthermore, it is unknown how VSP-1 and VSP-2 genes are regulated and whether their products act as isolated modules or integrate into pathways with the ancestral genome or accessory encoded elements such as the TCP island of CTX prophage.

[00038] Di-cyclic nucleotides act as intracellular signals, modulating a range of cellular activities (Gomelsky, 2011). In Gram-negative bacteria cyclic-di-GMP (c-di-GMP) is a major regulator of biofilms (Hengge, 7 Nat. Rev. Nicorbiol. 263 (2009); Tischler & Camilli, 53 Mol. Nicrobiol. 857 (2004)), and flagellum biosynthesis (Lim et al., 189 J. Bact. 717 (2007); Paul et al., 38 Mol. Cell 128 (2010)). Coordination between c-di-GMP and transcription was clearly shown in V. cholerae where c-di-GMP directly binds to and modulates the activity of transcriptional regulator VpsT (Krasteva et al., 2010) and up-regulates another virulence regulator AphA. Srivastava et al., 262 J. Biol. Chem. 535 (2011). In addition to c-di-GMP, Gram-positive bacteria also produce cyclic di-AMP (c-di-AMP). Listeria monocytogenes secretes cyclic di-AMP (c-di-AMP) and this serves as a recognition signal for the mammalian innate immune system. Woodward et al., 328 Sci. 1703 (2010). Staphylococcus aureus uses c- di-AMP to manage cell membrane stress. Corrigan et al., 7 PLoS Path. E1002217 (2011). Surprisingly, cyclic di-nucleotides other than c-di-GMP have not been reported in Gram- negative bacteria, including V. cholerae.

[00039] The present invention harnessed massively parallel DNA sequencing technologies to identify the complete regulon of ToxT. Combining transcriptome profiling (RNA-seq) with binding location analysis (ChlP-seq) identified all genes directly regulated by ToxT in vivo, as well as several pathways regulated indirectly. ChlP-seq analysis identified a TCP-encoded small RNA (sRNA) that down-regulates expression of a novel VSP-1 -encoded transcription factor, which in turn controls the expression of several VSP-1 genes, including one required for efficient intestinal colonization by V. cholerae. The gene product that stimulates intestinal colonization encodes a novel di-nucleotide cyclase that produces cyclic di-NMPs and a novel cyclic AMP-GMP hybrid. Furthermore, the activity of this enzyme strongly influences the chemotaxtic behavior of V. cholerae, thereby associating the action of this enzyme with a process known to influence infectivity and the intestinal colonization process.

[00040] ToxT expression directly activates genes only within the TCP island of CTX prophage, and indirectly regulates several other metabolic pathways. ToxT expression increases 500- to 1000-fold when V. cholerae colonizes a mammalian host. Mandlik et al., 10 Cell Host Microbe 165 (2011). To simulate this expression change, ToxT was cloned into a plasmid under the control of an inducible promoter in V. cholerae El Tor strain C6706, an isolate from the 7th pandemic that extended into Peru in 1991. Mandlik et al., 2011. This system increased ToxT expression -1000 fold following induction (Table 1).

[00041] A method to perform chromatin immunoprecipiation in combination with massively parallel sequencing (ChlP-seq), identifying genome wide binding locations of transcription factors in V. cholera, was described previously. Davies et al., 108 PNAS 12467 (2011). This method allowed for the present identification of all ToxT binding locations (ChlP- peaks) in the V. cholerae genome under test conditions (Figure 1; Table 1).

[00042] From each ChIP sequencing run, an average of 1,400,000 short -36 base reads were aligned to the published N16961 V. cholerae genome. Heidelberg et al., 406 Nature 477 (2000). The alignments gave a total average coverage of 13-fold for chromosome 1, and 8-fold coverage of chromosome 2. This depth of coverage allowed us to use a low false discovery rate (FDR) cut-off of 0.001% to call ToxT ChIP peaks. ChIP peaks are designated when the sequence coverage of a given genomic region in the experimental sample exceeds the control sample at a rate specified by the FDR (see Examples). The peak lists generated from all four samples were compared and a limit set such that a peak must be called in all experiments to be considered a ToxT binding site. Handstad et al., 6 PLoS One el8430 (2011). A ToxT peak was then associated with a gene if the peak overlapped the first codon of the respective gene (Figure 1; Table 1).

[00043] To validate ToxT transcriptional control of associated genes, ToxT expression was induced briefly (10 minutes), then total mRNA isolated and sequenced (RNA-seq), and the transcriptome profile compared with a control strain carrying an empty expression vector. Direct regulatory targets of ToxT should show the most rapid transcriptional response to brief ToxT induction. Comparison of the transcriptome response with ChlP-seq analysis uniformly showed strong transcriptional upregulation of the same genes we had associated with ToxT ChlP-peaks supporting the conclusion that these genes are directly activated by ToxT (Figure 1; Table 1). These results provide the first detailed in vivo map of ToxT binding locations in conjunction with ToxT driven expression alteration.

[00044] A ToxT binding motif (Toxbox) had been proposed previously, based on the sequences of all known ToxT binding sites. Withey & DiRita, 59 Mol. Microbiol. 1779 (2006). This Toxbox consensus matches to thousands of potential sites across the V. cholerae genome. Thus, it was surprising when the present analysis identified only six ToxT ChlP-peaks (Table 1). Interestingly all ToxT ChlP-peaks are located in the TCP island and CTX prophage. Importantly, five of the six ChlP-peaks identified overlap all ToxT binding sites previously identified by direct in vitro ToxT foot printing assays or inferred from genetic analysis, validating our technique to identify authentic ToxT binding locations. Three ToxT ChIP peaks lay between divergently transcribed gene pairs aldA-l/tagA, tcpI/tcpP and acfA/acfD. Each of these genes is known to have its own associated ToxT binding motif(s), but resolving closely spaced binding sites using ChlP-seq is challenging and often results in one overlapping ChIP peak. See Richard et al., 78 Mol. Microbiol. 1171 (2010); Withey & DiRita, 56 Mol. Microbiol. 1962 (2005a); Withey & DiRita, 1878 J. Bact. 7890 (2005b), Withey & DiRita, 59 Mol. Microbiol. 1779 (2006). The confinement of ToxT binding to the TCP island and CTX prophage, despite its predicted statistically common consensus binding motif, suggests factors in addition to nucleotide sequence may influence the stringency of DNA binding selection by ToxT in vivo.

[00045] Several additional genes were identified that were not directly associated with

ToxT ChlP-peaks that were differentially regulated following ToxT induction (Figure 1;

Table SI). These genes encode components of pathways involved in iron transport, amino acid metabolism, transcriptional regulation, pilus assembly and carbon transport and metabolism

(Figure 1). Interestingly, while direct regulatory targets of ToxT were strongly upregulated, the majority of these indirectly regulated genes were downregulated. Among the pathways impacted, iron transport exhibited the largest concerted effect with nineteen genes down regulated > 5-fold (Figure 1; Table SI). This includes pathways for the production of vibriobactin, hemin and iron III transporters as well as TonB, a protein that supports transport.

Conversely, the largest upregulation was from genes involved in maltose transport (Figure 1 and

Table SI). Specifically the maltose ABC transporter and the maltoporin (ompS) all showed increased expression > 12-fold (Table SI). It is unclear how ToxT indirectly impacts the expression of these genes. ToxT does directly increase expression of the transcription factor TcpP encoded by the TCP island, thus it is possible that TcpP directly affects some genes including the 8 additional transcription factors indirectly affected by ToxT (Figure 1; Table 1). TcpP and these transcriptional regulators may drive changes observed in the ToxT transcriptome profile.

[00046] Additionally, ToxT directly regulates the expression of the TCP Island encoded small RNA TarB. A sixth ToxT ChIP peak located in an intergenic region of the Tcp island between genes VC0845 and VC0846 was identified (Figure 2A). Quantitative PCR (qPCR) validated the sequencing data showing the enrichment of ToxT ChIP DNA at this intergenic site was similar to that of ToxT binding sites upstream of ctxA and tcpP (Figure 2B). Alignment of RNA-seq reads from ToxT expressing V. cholerae with the region between VC0845 and VC0846 revealed a putative small RNA (sRNA) on the reverse strand overlapping the new ToxT binding site (Figure 2A). The sRNA had a clear 5 'start at coordinate 911308 and appeared to terminate at coordinate 911239 following a predicated rho independent hairpin terminator (Figure 2A). Northern blotting using a probe against this region identified a sRNA that was strongly induced by ToxT (Figure 2C). The sRNA migrated slightly below the 80 nucleotides (nt) ssRNA marker agreeing with the 69 nt size predicted from RNA-seq read alignments. An identical sRNA has recently been identified (Bradley et al., 2011) and thus this sRNA was called "ToxT- activated sRNA B" (TarB). TarB has also been shown to be strongly upregulated in V. cholerae during infection of an animal model. Mandlik et al., 2011.

[00047] Furthermore, TarB represses the expression of a V. cholerae VSP-1 gene. The small regulatory protein Hfq binds sRNAs; stabilizing and assisting them for targeting and promoting degradation of specific mRNAs. Brennan & Link, 10 Curr. Opin. Micro. 125 (2007).

TarB levels were greatly decreased in a V. cholerae C6706 hfq::Tn mutant (Figure 2C) suggesting that TarB likely interacts with Hfq and thus may help to negatively regulate target mRNAs. If TarB negatively regulated a gene, the expression of the target gene should be higher in a AtarB strain compared with the wild type when ToxT is expressed. A genetic approach identified potential mRNA targets of TarB by using RNA-seq to compare the expression profiles of wild-type and AtarB strains expressing ToxT. Only two genes, VC0177 and VC2706, had significantly increased expression levels in the AtarB strain, suggesting that expression of TarB may decrease their stability (VC0177 expression AtarB/WT = 21.5 fold, p < le-5; VC2706 expression AtarB/WT = 4.5 fold, p < le-5). Interestingly, the most strongly up-regulated gene in the AtarB mutant, VC0177, is part of V. cholerae 7th pandemic island -1, VSP-1. qPCR confirmed the RNA-seq analysis showing that VC0177 expression was significantly higher in the AtarB strain than the wild type (Figure 2D). Also, this pathway was active in a second clinical El Tor strain, E7946 (Figure 2D). This indicates that the ToxT-TarB-VC0177 pathway is not strain specific. TarB does appear to have a more profound effect on VC0177 in strain C6706 compared with E7946, however, suggesting some variability in the magnitude of the effect of this pathway in different strains.

[00048] The interaction between TarB and VSP-1 encoded VC0177 is reminiscent of the coordinated control of the TCP island and prophage CTXO. Both VSP-1 and prophage CTXO are acquired horizontally and separately from the TCP island, yet genes from both VSP-1 and phage CTXOare ultimately regulated by TCP island encoded ToxT. VC0177 expression formally joins the ToxT regulon through its dependence on ToxT regulated TarB induction. This association suggests that the co-occurrence of at least VSP-1 in 7th pandemic strains of V. cholerae may have been driven by its regulatory integration with other accessory elements (TCP and CTX) encoding pathogenic adaptation.

[00049] Additionally, the present work found that VC0177 is a transcription factor that represses several VSP-1 genes. Annotated as a hypothetical protein, VC0177 does not share sequence homology with known proteins by basic alignment searches (BLAST). Interestingly, HHPRED analysis (Biegert et al., 2006), which uses protein structure prediction, indicates that VC0177 shares structural homology with metallo-regulator repressor proteins. Because ToxT directly regulates genes located predominantly in the island in which it is encoded, VC0177 might have similar restrictions and repress genes within VSP-1, which spans loci VC0175 - VC0185. Agreeing with the predicted transcription repressor role for VC0177, expression of four VSP-1 genes was significantly increased in a VC0177::Tn mutant (Figure 3A).

[00050] Whether VC0177 was directly involved in the regulation of these genes was tested by ChIP analysis with VC0177 and assayed for enrichment in regions directly upstream of VC0177 repressed genes by qPCR. We identified enrichment of 5'UTR regions directly upstream of VC0176, VC0178, VC0179 and VC0180 supporting a direct role for VC0177 as a transcriptional repressor of these genes (Figure 3B). Therefore, the product of VC0177 was called the V. cholerae 7th pandemic regulator (VspR).

[00051] Further, the TarB regulatory circuit and VSP-1 ORF VC0179 influence

V. cholerae intestinal colonization. Whether the novel TarB-VspR regulatory circuit identified is involved in pathogenesis was tested in an infant mouse model that measured V. cholerae intestinal colonization. The effect of genes in VSP-1 on intestinal colonization has not been investigated previously. The V. cholerae C6706 AtarB mutant showed a significant decrease in ability to colonize the small intestine compared with the wild type strain in competition assays (Figure 3C). [00052] Combining the AtarB deletion with a VC0177::Tn mutant rescued the AtarB- dependent colonization defect (Figure 3C). This suggests that TarB likely influences colonization by down-regulation of the VC0177 encoded regulator VspR. Because expression of VC0178, VC0179 and VC0180 increased in the V. cholerae VC0177::Tn VspR mutant strain, V. cholerae transposon mutants disrupted in these genes were tested for intestinal colonization defects. Remarkably, only disruption of VC0179 caused a significant defect in intestinal colonization (Figure 3C). An in-frame deletion mutant of VC0179 (AVC0179) also showed a similar in vivo colonization defect (Figure 3C). These results identify VC0179 as a direct target of VspR repression in VSP-1, and thus an indirect target of TarB mediated induction.

[00053] TarB is well conserved among all sequenced strains of V. cholerae including the classical strain 0395 even though classical strains lack VSP-1 and therefore lack VspR. Northern blots show that ToxT also induces TarB in an 0395 strain (Figure 2C); however, we did not anticipate a critical in vivo role for TarB 0395 due to the lack of VSP-1. Indeed, deletion of TarB does not affect 0395 colonization of the infant mouse intestine in competition assays (Figure 3C). TarB may regulate additional genes in 0395 strains that do not influence intestinal colonization.

[00054] Recently, another group published the presence of TarB in a different El Tor strain, E7946, as part of a genome-wide study identifying ToxT-induced sRNAs. Bradley et al., 2011. Although agreeing with the present observation, Bradley et al. also reported a variable colonization phenotype for a AtarB mutant in strain E7946 that depended on initial growth conditions of the bacterium. A consistent intestinal colonization defect of an E7946 AtarB mutant with the present growth conditions (Figure 3C) was found. This defect was less severe than in strain C6706, which may be due to the difference in down-regulation of VspR by TarB between these strains (Figure 2D). Using a computational approach to identify TarB mRNA targets, Bradley et al. reported the most significant effect of TarB is a ~2 fold repression of colonization factor TcpF mRNA. The authors noted that repression of a colonization factor by a ToxT activated sRNA was counterintuitive. In contrast, the present analysis did not detect an effect on TcpF expression in the genetic approach to identify TarB targets, but did show that TarB down regulates VspR expression ~12-fold in strain E7946 indicating the ToxT-TarB-VspR pathway is active in E7946 and not specific to strain C6706 (Figure 2D). Computational prediction indicates that TarB has a more favorable and a simpler base paring configuration with the 5 'untranslated region of VspR than TcpF providing an explanation as to why TarB regulates VspR more strongly (Figure 8).

[00055] Importantly, VC0179 is the first member of a new family of di-nucleotide cyclases (DncV). Disruption of VSP-1 encoded VC0179 caused a significant defect in intestinal colonization (Figure 3C). VC0179 was previously considered a hypothetical protein that does not share overall sequence homology with known proteins. HHPRED analysis shows that VC0179 shares spatial alignment of key active site residues found in 2'-5'-oligoadenylate synthetases (OASl) and polyA polymerase both of which are part of the nucleotidyl transferase superfamily (Figure 9). See Holm & Sander, 20 Trends Biochem. 345 (1995). The placement of these active site residues in VC0179 match the consensus sequence (G[G/S]x9-13Dx[D/E]) of the nucleotidyl transferase superfamily (NTS). Holm & Sander, 1995. OASl and polyA polymerase catalyze the polymerization of oligoadenylates from ATP. Hartmann et al., 12 Mol. Cell 1173 (2003). The structural similarity with OASl and polyA polymerase suggested that VC0179 might act catalytically on ATP.

[00056] VC0179 was purified, incubated it with a-P32 ATP and separated the products on a denaturing polyacrylamide gel. VC0179 produced a single product that migrated slightly above the ATP precursor (Figure 4A). As a control, the aspartate residues of the predicted VC0179 Dx[D/E] catalytic center were mutated to alanine residues (D131A and D133A - Figure 9) and purified the mutant protein. When incubated with ATP, the D131A/D133A VC0179 mutant protein did not produce the VC0179 product from ATP (Figure 4 A) indicating activity from the WT protein is dependent upon the predicted NTS catalytic residues and is not due to a contaminate.

[00057] The product produced from ATP by VC0179 is insensitive to calf intestinal phosphatase (CIP) indicating that it does not contain 5' or Ύ terminal phosphate groups

(Figure 4B). The product is sensitive to snake venom phosphodiesterase and nuclease PI indicating that it contains 3 '-5 'phosphate linkages (Figure 4B). These results suggested that the

VC0179 product was a cyclic nucleotide. HPLC analysis showed that the VC0179 product eluted with the same retention time as a commercial cyclic di-AMP (c-di-AMP) standard

(Figures 5A; 5B). Furthermore, LCMS and MS/MS analysis showed that the VC0179 product and c-di-AMP have identical molecular masses and fragmentation fingerprint (Tables 2, 3;

Figures 10, 11), confirming that VC0179 synthesizes c-di-AMP. To our knowledge this is the first report of c-di-AMP synthesis by a Gram-negative bacterium and the first adenylate cyclase based on a non-DU147 protein domain structure. See Romling, 1 Sci. Signal pe39 (2008).

[00058] The catalytic ability of VC0179 was tested with additional nucleotides. VC0179 is not active against dATP. When incubated with GTP, VC0179 produces cyclic di-GMP (c-di-

GMP) (Figure 4C) that was confirmed by HPLC, LCMS and MS/MS comparison with a commercial c-di-GMP standard (Figures 5A, 5C, 10, 11; Tables 2, 3). Interestingly, both PAGE and HPLC analysis indicated more c-di-AMP production than c-di-GMP per unit time suggesting VC0179 synthesis c-di-AMP more efficiently than c-di-GMP. Prior to these results, only proteins containing GGDEF domains were thought to be able to produce c-di-GMP in bacteria. Ryjenkov et al., 187 J. Bact. 1792 (2005). Whether VC0179 could enzymatically modify TTP, UTP and CTP was tested, but significant activity was not detected, suggesting VC0179 preferentially uses purine nucleotide triphosphates as substrates in the present experimental conditions.

[00059] Because VC0179 can use ATP and GTP substrates, but appears to be more effect in its use of ATP, whether it preferred one substrate to the other when, given the option, was tested. VC0179 was incubated with equal molar amounts of GTP and ATP and analyzed the products by PAGE, HPLC, LCMS and MS/MS. Remarkably we found the dominant reaction product migrated between c-di-AMP and c-di-GMP by PAGE (Figures 4D, E). This new product was observed in much greater amounts than either c-di-AMP or c-di-GMP as confirmed by HPLC (Figures 5A, 5D). This suggested that VC0179 preferentially synthesizes a hybrid c- AMP-GMP molecule from ATP and GTP. High resolution LCMS analysis confirmed that the mass of the VC0179 reaction product incubated with ATP and GTP was in agreement with a c- AMP-GMP molecule (Figure 10; Table 2). MS/MS was used to fragment this product into masses accurate for AMP and GMP further confirming the hybrid structure (Figure 11; Table 3).

[00060] Given that in metabolically active cells there is a mixture of all NTPs, the preference of VC0179 in a mixture that included equal amounts of all 5 NTPs was observed. Again, VC0179 produced substantially more of the hybrid c-AMP-GMP molecule than any other cyclic-dinucleotide (Figure 5E). This is the first report of an enzyme that can produce a hybrid cyclic di-nucleotide and the first enzyme capable of producing three different cyclic di- nucleotides. Therefore, the product of the VC0179 gene was named "di-nucleotide cyclase 1" or "DncV". BLAST and ClustalW identified and aligned homologs that were at least 20% similar to DncV and had the conserved G[G/S]x9-13Dx[D/E] motif (Figure 12). DncV homologs can be identified in a wide range of bacteria, several of which are pathogenic.

[00061] Interestingly, DncV activity modulates V. cholerae chemotaxis and does not affect c-di-GMP-dependent regulation. A significant growth difference between wild type and

ADncV mutant in rich or minimal medium was not observed. The biological effects of DncV expression was determined using RNA-seq to compare the transcriptome profiles of a ADncV mutant and a ADncV mutant in which DncV expression was induced from a plasmid for 15 min.

This analysis coordinated differential expression of groups of genes that clustered into four biological processes (Figure 6A; Table S2). The largest concerted regulatory effect showed that many chemotactic genes were down-regulated following DncV induction. Signal-transducing chemotactic proteins are known to bind purines (Stock et al., 1987), suggesting the products of

DncV could interact directly and modulate the activity of these proteins. The chemotactic abilities of the wild type, ADncV mutant and ADncV mutant expressing DncV from a plasmid, were analyzed using semisolid agar chemotaxis plates, in which increased expression of DncV severely inhibited V. cholerae chemotaxis (Figure 6B). Expression of the D131A/D133A DncV allele did not affect chemotaxis, indicating the catalytic activity of DncV is required for this phenotype (Figure 6B).

[00062] Although we did not observe any changes in the expression of flagellum biogenesis genes, it is possible that the effect we observed on the semisolid agar were due to defects in flagellum biogenesis or function. To test this possibility, wild type + vector and ADncV mutant + pDncV were extracted from the plate containing arabinose, shown in Figure 6B, and checked for motility. Phase contrast microscopy showed that increased expression of DncV did not change overall motility of V. cholerae agreeing with the transcriptome analysis that expression of flagellum components were unaffected. Remarkably, repressing chemotaxis has been shown to significantly enhance V. cholerae intestinal colonization. Butler et al., 60 Mol. Microbiol 417 (2006). Thus, expression of VC0179 may enhance colonization by suppressive chemotactic behavior.

[00063] Because DncV can produce c-di-AMP, c-di-GMP and c-AMP-GMP, it was initially uncertain which molecule(s) was responsible for phenotypic and transcriptional effects following DncV expression. The transcriptome results were compared with recently published microarray analysis of the regulatory effects of increased c-di-GMP production in V. cholerae. Beyhan et al., 188 J. Bact. 36000 (2006). The most prominent regulatory effects of increased c- di-GMP levels included increased expression of MSHA, the extracellular protein secretion system (EPS) and Vibrio polysaccharide (VPS) biogenesis genes, as well as decreased expression of flagellum biogenesis genes. In contrast the transcriptome analysis of DncV induction showed decreased expression of MSHA biosynthesis genes and no effect on EPS, VPS or flagellum biogenesis genes (Table S2). Furthermore, increased c-di-GMP levels were shown to drastically reduce the number of motile bacterium and increase biofilm production (Beyhan et al., 2006), whereas expression of DncV does not affect V. cholerae motility or biofilm production. The lack of gene regulatory and phenotypic overlap between increased DncV expression and increased c-di-GMP levels suggest that DncV mediated effects are not due to c- di-GMP production and therefore more likely due to synthesis of c-di-AMP and/or c-AMP- GMP.

[00064] The present Examples demonstrate the power and speed of modern sequencing techniques to expose novel regulatory pathways in bacteria. ChlP-seq is particularly useful for studying transcriptional regulators since it provides information about direct regulatory targets.

Coupling ChlP-seq with RNA-seq data allows rapid analysis of the magnitude of direct regulatory activity. The application of ChlP-seq to ToxT showed that, despite a weak consensus- binding motif, ToxT binds to only a small and tightly clustered number of genomic sites located in the TCP island and CTX prophage. These observations suggest that DNA sequence alone cannot dictate binding sites selection by ToxT.

[00065] The VSP islands are the most pronounced genetic difference between classical and El tor strains of V. cholerae (Dziejman et al.,2002), however any fitness benefit they offered El tor strains was unknown. The present results describe a multifaceted regulatory cascade driven by ToxT and mediated through the TCP island encoded sRNA, TarB, that down-regulates expression of VSP-1 transcription factor VspR (Figure 7). Loss of VspR derepresses VSP-1 genes, including VC0179, which encodes a novel di-nucleotide cyclase, DncV, that is required for efficient V. cholerae intestinal colonization and regulates the colonization influencing process of chemotaxis.

[00066] It was shown previously that VC0179 expression was up-regulated in the rabbit intestine, supporting a role for VC0179 in intestinal colonization. Xu et al., 100 PNAS 1286

(2003). The connection between induction of the master virulence regulator ToxT and VSP-1 regulation strongly suggested that genes encoded by VSP-1 were expressed in vivo and likely contribute to pathogenesis or other virulence associated properties ( e.g. transmission or infectivity). The association of VSP-1 with V. cholerae colonization offers the first evidence that the evolutionary success of V. cholerae El Tor strains carrying VSP-1 islands may have been driven by increased fitness within the host and thus implies that VSP-1 is indeed a pathogenicity island. It is possible VSP-1 contributes to properties that might improve the fitness of 7th pandemic El Tor strains V. cholerae in the aquatic environment since some VSP-1 genes have been found recently in environmental non-Ol, non-0139 V. cholerae strains. Grim et al., 2010.

VSP-1 was universally present in TCP+ 01 and 0139 strains (Grim et al., 2010; Rahman et al.,

2008), however, suggesting that the regulatory linkage of the TCP and VSP-1 islands documented here may be selecting for their co-inheritance in pathogenic 7th pandemic strains.

[00067] Comparative genome analysis shows that DncV homologs are found in pathogenic islands of other disease causing bacteria including the High Pathogenicity Island

(HPI) of Enterobacteriaceae strains. Paauw et al., 5 PLoS One e8662 (2010); Schubert et al., 51

Mol. Microbiol. 837 (2004). Interestingly, DncV homologs in HPI are often found associated with the closely neighboring VSP-1 gene VC0181. VC0181 is annotated as an integrative and conjugative element suggesting it may help DncV recombine into new genomes and genomic islands. There are additional VSP-1 genes that did not appear in the current network that may also influence V. cholerae colonization. These genes might still be regulated by VspR but our conditions may not have favored their expression. VspR might also play a regulator role outside of VSP-1 that future ChlP-seq analysis will illuminate. The neighboring gene, VC0176, is annotated as a putative Cl/Cro like regulator. Because VspR appears to affect VC0176 expression there may be regulatory interplay between these two factors that modulates VSP-1 activity or other genes outside of the island. Further characterization of the hypothetical proteins encoded in VSP-1 and VSP-2, may offer significant insights into differences into host adaptation of the 7th pandemic El Tor lineage of V. cholerae.

[00068] DncV is the first reported enzyme capable of synthesizing c-di-AMP in Gram- negative bacteria and the first enzyme capable of synthesizing the hybrid c-AMP-GMP which has never been documented as a biological product from any organism. DncV shares the fingerprint of the nucelotidyl transferase superfamily, although its overall homology is otherwise extremely weak. In bacteria, c-di-GMP is synthesized by proteins containing a GGDEF motif, which are found in the majority of bacterial genomes. Hengge, 2009; Ryjenkov et al., 2005. c- di-AMP is synthesized in gram-positive bacteria by proteins containing the unrelated DUF147 domain. Witte et al., 30 Mol. Cell 167 (2008). Remarkably, the active site of DncV is able to produce both c-di-AMP and c-di-GMP cyclic compounds as well as a hybrid c-AMP-GMP. While a thorough biochemical analysis will yield more definitive results, our initial analysis suggests that DncV has a strong product preference for synthesis of c-AMP-GMP followed by c- di-AMP and c-di-GMP. Future structural analysis of DncV will be particularly interesting to determine its mode of substrate selection and catalytic action. Although DncV appears to have a product preference in the present assay conditions, the balance of product it produces would be heavily influenced by its local intracellular NTP concentration. If DncV is localized to a specific area of the cell it may have restricted access to only ATP or GTP and these local pools will likely influence its product production. Furthermore, energetic shifts that alter the cytosolic ATP concentration could also impact DncV product production.

[00069] Cyclic nucleotides act as intracellular signals, modulating a range of cellular activities. Gomelsky, 2011. In Gram-negative bacteria c-di-GMP is a major regulator of biofilms

(Hengge, 2009; Tischler & Camilli, 2004), and flagellum biosynthesis (Lim et al., 2007; Paul et al., 2010), and in Gram-positive bacteria, c-di-AMP reports on DNA integrity and cell membrane stress (Corrigan et al., 2011; Woodward et al., 2010). Because DncV can produce both molecules, its activity may influence all of these processes. The hybrid c-AMP-GMP molecule may function in both c-di-GMP and c-di-AMP pathways and/or completely new processes specific to a hybrid interaction. Expression comparison showed that regulatory events mediated by DncV induction are not likely due to increased c-di-GMP levels. Increased expression of DncV strongly inhibits V. cholerae chemotaxis but the bacteria are still highly motile. Interestingly, V. cholerae shed from humans also show decreased chemotaxis and normal motility. Merrell et al., 417 Nature 642 (2002). It is thought that the repression of chemotaxis contributes to a hyperinfectious state of V. cholerae and indeed repressing chemotaxis has been shown to significantly enhance V. cholerae intestinal colonization Butler et al., 2006. These observations suggest a mechanism for the necessity of DncV for efficient V. cholerae intestinal colonization. The in vivo environment may well induce ToxT activity which in turn results in derepression of DncV via the TarB-VspR pathway and an inhibition of chemotaxis via the accumulation of di-cyclic nucleotides. Reduced chemotaxis might not only stimulate colonization but also influence infectivity long after V. cholerae exits the ToxT inducing environment of the small intestine. Butler et al., 2006; Merrell et al., 2002.

[00070] Interestingly, increased DncV expression significantly altered the expression of genes involved in fatty acid metabolism. Specifically DncV expression induced fatty acid catabolism and repressed fatty acid biosynthesis. Metabolomic analysis of cecal fluid harvested from V. cholerae infected rabbits has recently revealed that the intestinal milieu contains high levels of long chain fatty acids compared with laboratory medium. Mandlik et al., 2011. Fatty acids were recently shown modulate ToxT activity and indeed a 16-carbon fatty acid cis- palmitoleate, crystallizes with ToxT when expressed and purified from E. coli (Lowden et al., 2010). It will be interesting to investigate if DncV activity creates regulatory signals that modulate ToxT activity in vivo by specifically stimulating the breakdown of host lipids and transport of fatty acids. A role for di-cyclic nucleotides in regulating fatty acid metabolism has not yet been demonstrated in V. cholerae.

[00071] The association of DncV expression with ToxT activity suggests that the cellular concentration of c-di-AMP, c-di-GMP and/or c-AMP-GMP may increase significantly when

V. cholerae enters the host intestinal environment. Alterations of c-di-GMP has been linked to several in vitro regulatory and phenotypic pathways in V. cholerae including biofilm formation, motility/chemotaxis and virulence. Bordeleau et al., 12 Environ. Microbio. 510 (2010); Fong &

Yildiz, 190 J. Bact. 6646 (2008); Krasteva et al., 2010; Pratt et al., 191 J. Bact. 6632 (2009);

Srivastava et al., 2011. Surprisingly, c-di-AMP has only been identified in Gram-positive bacteria (Corrigan et al., 2011; Woodward et al., 2010), and cyclic AMP-GMP is a completely novel metabolite and is first described here. Interestingly, c-di-AMP has recently been shown to be secreted by multidrug efflux pumps from L. monocytogenes (Woodward et al., 2010). In the context of L. monocytogenes infection, c-di-AMP alters the mammalian host immune response

(Woodward et al., 2010), and recently cyclic di-nucleotides have been identified as key agonists of the STING innate immune signaling pathway. Burdette et al., 60 Mol. Micro. 417 (2011).

Purinergic receptors known to modulate pH and electrolyte secretion are found extensively on the apical membrane of intestinal epithelial cells where V. cholerae colonizes. Dho et al., 262 Am. J. Physiol. C67 (1992); Kaunitz & Akiba, 327 Sci. 866 (2011). Whether V. cholerae may also secrete c-di-AMP and/or c-AMP-GMP is of interest, as these cyclic di-nucleotides could interact with the host cell receptors to modulate intestinal cell electrophysiology or innate immunity. Such an effect could be beneficial to a range of intestinal pathogens that carry DncV homologs. Thus, secreted c-di-AMP and/or c-AMP-GMP could act as bacterial toxins that affect disease progression. The discovery of DncV produced cyclic di-nucleotides adds another layer of complexity to V. cholerae pathogenesis and implicates these novel small molecules in the disease process.

[00072] Thus, an aspect of the present invention provides for an isolated and/or purified di-nucleotide cyclase enzyme (DncV) or an analog, homolog, derivative, variant or portion thereof.

[00073] The isolated DncV proteins can either be immobilized or transferred to an additional or subsequent support. Supports can be solid supports, such as flat slides, or chips, beads or fibers, or semi-solid supports, such as gel matrices (e.g., polyacrylamide), or semi-solid supports combined with solid supports, e.g., glass coated with polyacrylamide material. Different methods are known for attaching proteins to solid supports involving chemically linking such proteins to the solid support directly or via a linker molecule. See generally, Affinity Techniques, Enzyme Purification: Part B, in Meth. Enz. (Jakoby & Wilchek, eds., Acad. Press, N.Y. 1974); Immobilized Biochemicals andAffinity Chromatography, Adv. Exp. Med. Biol. (Dunlap, ed., Plenum Press, N.Y.1974), U.S. Patent No. 4,681,870 describes a method useful for covalently linking a protein to a surface of asilica matrix. U.S. Patent No. 4,937,188 describes the use of RNA attached to a solid support where the nucleic acid is reacted to a protein. U.S. Patent No. 5,011,770 describes binding proteins that can be attached to a solid support. Example supports can be essentially non-compressible and lacking pores containing liquid. A rigid or solid support can further be thin and thermally conductive, such that changes in thermal energy, e.g., characteristic of PCR thermal cycling.

[00074] The DncV may be a wild-type DcvV, having the amino acid sequence presented in Figure 9. A "wild type" DncV refers to the native DncV obtained from Vibrio sp., such as that obtained from V. cholerae. The native DncV and its corresponding gene (gene) are described herein. Persons skilled in the art can readily obtain the nucleic acid sequences of the wild-type penicillin from Figure 9. The DncV can be purified from Vibrio, or the DncV can be a recombinant DncV, e.g., as described herein. The DncV can be wild-type or mutant, as desired.

For example, wild-type DncV may be used in the production of c-di-NMPs, and mutant DncV may be used as an immunogen. A variant, analog or homolog of DncV can be produced by mutation, e.g., as shown herein, or through chemical synthesis. For example, chemical synthesis may be favored when only a portion of the DncV polypeptide is required, e.g., a peptide, for example, when used as an immunogen. In that regard, the description of DncV herein allows for the generation antibodies and the identification of antigens and epitopes of DncV, that can be useful, for example, in vaccines.

[00075] The terms "polypeptide" and "protein", used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; fusion proteins with detectable fusion partners, e.g., fusion proteins including as a fusion partner a fluorescent protein, β-galactosidase, luciferase, etc.; and the like. Polypeptides may be of any size, and the term "peptide" typically refers to polypeptides that are 8-50 residues (e.g., 8-20 residues) in length. In general, the peptides described herein do not encompass the full-length DncV polypeptide, and can be about 4, 6, 10 20, 30, 40, 50, 60 or more amino acids in length, with peptides of from about 4 to about 47, from about 6 to about 34, and from about 6 to about 20 amino acids being of particular interest.

[00076] Further regarding DncV, in certain aspects of the invention the isolated DncV may have the amino acid sequence presented in Figure 9, or may have an amino acid sequence that is, for example, 70%, 80%, 90%, or at least about 95% identical to the amino acid sequence presented in Figure 9. The skilled artisan can determine which algorithm can be used to determine how similar sequences are to each other. Many algorithms assign different values for gaps in sequences that can affect the overall percent score in a variety of ways. Thus, the DncV described herein can be modified by amino acid insertion, deletion, addition, or substitution, with the proviso that the modified peptide exhibits functionality (discussed further, below). The amino acid substitutions may be of a conserved or non-conserved nature. Conserved amino acid substitutions involve replacing one or more amino acids of the peptide sequences described herein with amino acids of similar charge, size, and/or hydrophobicity characteristics, such as, for example, a glutamic acid (E) to aspartic acid (D) amino acid substitution. Non-conserved substitutions involve replacing one or more amino acids with amino acids possessing dissimilar charge, size, and/or hydrophobicity characteristics, such as, for example, a glutamic acid (E) to valine (V) substitution. Amino acid additions include additions to the N-terminus, the C- terminus and/or a region between the N- and C-terminus.

[00077] The level of identity may also reflect the intended use of the DncV, e.g., as an immunogen vs. an active enzyme for production of c-di-NMPs. Procedures for making proteins, polypeptides and peptide with amino acid substitutions, deletions, insertions and/or additions are routine in the art; but when cyclase activity is to be maintained, structural reference to (G[G/S]x9-13Dx[D/E]) should be made. For example, a D131E substitution is a conservative substitution.

[00078] Conversely, if the DncV variant is enzymatically inactive (e.g., for use as an immunogen or in a live attenuated vaccine), then the different amino acid(s) in the catalytic site are selected more especially to modify the structure or the interaction of the protein with the phosphate, the nucleic base and/or the sugar of the NTP, so that the catalytic activity or the control of this activity of the site is destroyed. For example, hydrophobic amino acids may be charged with hydrophilic amino acids of the same size or vice versa or amino acids having differing electrical charge may be used, or alternatively amino acids of different size which prevent the introduction of the substrate NTP. An example of an inactive variant is provided herein, produced via site-directed mutagenesis in which positions in 131 and 133 in VC0179 mutated from asparagine to alanine (D131A and D133A) (see Example 5). An enzymatically functional equivalent of the mutated DncV may contain further amino acid mutations (e.g., deletions, additions or substitutions) located at positions other than those described herein (i.e., at positions 131 and 133), wherein said further amino acid mutations result in silent changes and thus do not substantially affect the function (e.g., enzyme activity) of the mutated DncV.

[00079] Thus, in particular aspects, the isolated DncV according to the invention can have one or more amino acid substitutions, deletions, insertions and/or additions (e.g., fusions) to the amino acids depicted in Figure 9. The different amino acids replacing the wild type amino acids may also be selected from among amino acid analogues which can be incorporated by the translation machine, if necessary, chemically modified. As examples, mention should be made of flourophenylalanine, bromotryptophan, or nor-leucine. Further examples of amino acid analogs are available to the skilled artisan. See, e.g., Encyclopedia of Amino Acids & Chiral

Building Blocks (PepTech Corp., Burlington, MA, 2003-2004) (available on-line).

[00080] A different aspect provides for a target for inhibiting Vibrio infection, wherein the target is DncV. For example, an aspect provides for a vaccine against Vibrio, comprising an immunogenic DncV protein or portion thereof; or vaccine comprising a live attenuated Vibrio that lacks a DncV gene or expresses a defective DncV gene. For use as an immunogen, the

DncV variant can be a peptide comprising at least one neutralizing epitope. The peptides of the invention may be prepared by recombinant or chemical synthetic methods, which techniques are well known in the art. See, e.g., Creighton, Proteins: Structures & Molecular Principles (W. H.

Freeman & Co., N.Y., 1983). Short peptides, for example, can be synthesized on a solid support or in solution. Longer peptides may be made using recombinant DNA techniques. Here, the nucleotide sequences encoding the peptides of the invention may be synthesized, and/or cloned, and expressed according to techniques well known to those of ordinary skill in the art. See, e.g., Sambrook, et al., Molecular Cloning, Lab. Manual (Cold Spring Harbor Press, N.Y., 1989). Additionally, the peptides of the invention, while described herein as being composed of naturally occurring, L-amino acids, are not limited to such. The peptides described herein may be modified at the amino and/or carboxy termini; modified to contain the D-isomer rather than the normal L-isomer; modified chemically to have different substituents or additional moieties; and the like, with the proviso that these modifications do not eliminate or otherwise adversely affect the peptides ability to present a functional DncV epitope, particularly a neutralizing epitope of DncV. Exemplary chemical modifications of the peptides include acylation, alkylation, esterification, amidification, etc., to produce structural analogs.

[00081] When administered to a subject for a vaccine, the DncV of the invention comprise at least one neutralizing epitope and elicits an immune response (e.g., a protective or therapeutic immune response). Polypeptides of the invention include, but are not necessarily limited to, native DncV protein, polypeptide fragments (e.g., immunogenic, immunoprotective fragment thereof, (e.g., a fragment of a DncV polypeptide comprising a neutralizing domain that, upon administration to a host, can elicit an immune response), a recombinant form of a DncV peptide (e.g., a product of expression in a prokaryotic or eukaryotic recombinant host cell), a synthetically produced DncV peptide, a modified recombinant or synthetic DncV peptide (e.g., DncV neutralizing epitope peptide provided as a fusion protein), a DncV peptide variant or analog that retains antigenicity or immunogenicity of native DncV fragments having a neutralizing domain (e.g., an immunogenically similar or identical DncV-derived amino acid sequence), and the like. DncV peptides of interest are generally from at least about 4 amino acids to about fragments of about 60 amino acids, usually at least about 6 amino acids, more usually at least about 10 amino acids, and generally at least about 15 to 50 amino acids. For example, the PorB polypeptides have an amino acid sequence that provides for at least one neutralizing epitope domain.

[00082] The DncV of the invention can be formulated in a variety of ways. In general, the compositions of the invention are formulated according to methods well known in the art using suitable pharmaceutical carrier(s) and/or vehicle(s). An exemplary suitable vehicle is sterile saline. Other aqueous and non-aqueous isotonic sterile injection solutions and aqueous and nonaqueous sterile suspensions known to be pharmaceutically acceptable carriers and well known to those of skill in the art may be employed for this purpose. Optionally, a composition of the invention may be formulated to contain other components, including, e.g., adjuvants, stabilizers, pH adjusters, preservatives and the like. Such components are well known to those of skill in the art. The compositions can be administered in any suitable form that provides for administration of the DncV peptides in an amount sufficient to elicit an immune response (e.g., humoral response, cellular response, and the like). For example, the composition can be administered as a liquid formulation or as a slow-release formulation (e.g., in a suitable solid (e.g., biodegradable) or semi-solid (e.g., gel) matrix that provides for release of the DncV peptide or DncV peptide- encoding nucleic acid over time). The composition can be administered in a single bolus, can be administered in incremental amounts over time, or any suitable combination. In addition, it may be desirable to administer one or more booster doses of the DncV peptides, which boosters may contain the same or different amounts of DncV peptide (or DncV peptide-encoding nucleic acid).

[00083] As noted, a DncV having a neutralizing epitope can be delivered to the host in a variety of ways. For example, DncV according to the invention can be provided and administered as an isolated or substantially purified protein preparation. Alternatively or in addition, the DncV peptides can be administered in the form of nucleic acid (usually DNA) encoding one or more, usually at least 2, 4, 6, 8, 9, 10 or more, DncV peptides having at least one neutralizing epitope (e.g., by genetic immunization techniques known in the art), by delivery of shuttle vector (e.g., a viral vector (e.g., a recombinant adenoviral vector), or a recombinant bacterial vector (e.g., a live, attenuated heterologous bacterial strain, e.g., live, attenuated Salmonella) that provides for delivery of DncV-encoding nucleic acid for expression in a subject cell. Where nucleic acid encoding a DncV polypeptide is used in the immunogenic composition, the nucleic acid (e.g., DNA can be operably linked to a promoter for expression in a cell of the subject. Where two or more DncV peptides are administered in the form of DncV-encoding nucleic acid, the DncV peptides can be encoded on the same or different nucleic acid molecules.

[00084] DncV immunogenic composition is administered in an "effective amount," that is, an amount of DncV polypeptide or DncV polypeptide-encoding nucleic acid that is effective in a route of administration to elicit a desired immune response, e.g., to elicit anti-DncV antibodies, e.g., to elicit anti-DncV antibody production and/or to elicit an immune response effective to facilitate protection of the host against infection by Vibrio. For example, where DncV polypeptide is delivered using a nucleic acid construct or a recombinant virus, the nucleic acid construct or recombinant virus is administered in an amount effective for expression of sufficient levels of the selected gene product to elicit production of anti-DncV antibodies, and/or to provide a vaccinal benefit, e.g., protective immunity.

[00085] Conventional and pharmaceutically acceptable routes of administration include intranasal, intramuscular, intratracheal, subcutaneous, transdermal, subdermal, intradermal, topical, rectal, oral and other parental routes of administration. Routes of administration may be combined, if desired, or adjusted depending upon the immunogen or the disease. As noted above, the DncV composition of the invention can be administered in a single dose or in multiple doses, and may encompass administration of booster doses, to elicit antibodies and/or maintain immunity. Methods and devices for accomplishing delivery are well known in the art. For example for administration through the skin, any of a variety of transdermal patches can be used to accomplish delivery.

[00086] The amount of DncV polypeptide, DncV polypeptide-encoding nucleic acid, or

DncV polypeptide recombinant virions in each dose is selected as an amount which induces an immune response (particular an immunoprotective immune response) without significant, adverse side effects. Such amount will vary depending upon which specific immunogen is employed, whether or not the immunogenic composition is adjuvanted, and a variety of host- dependent factors. Where DncV-neutralizing epitope polypeptide is delivered directly, it is expected that each does will comprise 1-1000 μg of protein, generally from about 1-200 μg, normally from about 10-100 μg. An effective dose of a DncV nucleic acid-based immunogenic composition will generally involve administration of from about 1-1000 μg of nucleic acid. An optimal amount for a particular immunogenic composition can be ascertained by standard studies involving observation of antibody titres and other responses in subjects. Where the immunogenic composition is administered as a prophylactic or therapeutic vaccine, the levels of immunity provided can be monitored to determine the need, if any, for boosters. Following an assessment of antibody titers in the serum, optional booster immunizations may be desired. The immune response to the protein of this invention is enhanced by the use of adjuvant and or an immunostimulant.

[00087] Alternatively, an aspect provides for a method of treating Vibrio infection comprising administering, to a subject in need thereof, antigen-binding molecules that bind DncV. The antigen-binding molecule can be a small molecule, an aptamer, an antibody or portion thereof. The terms "subject," "patient," and "individual" are used interchangeably herein to refer to any mammalian subject for whom diagnosis or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.

[00088] The term antibody includes antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non- antibody protein. The antibodies may be detectably labeled, e.g., with a radioisotope, an enzyme which generates a detectable product, a fluorescent protein, and the like. The antibodies may be further conjugated to other moieties, such as members of specific binding pairs, e.g., biotin (member of biotin-avidin specific binding pair), and the like. The antibodies may also be bound to a solid support, including, but not limited to, polystyrene plates or beads, and the like. Also encompassed by the term are Fab', Fv, F(ab')2, and or other antibody portions that retain specific binding to antigen or epitope, and monoclonal antibodies.

[00089] Yet another aspect of the present invention provides for an isolated nucleic acid molecule that encodes DncV. The nucleic acid may encode a wild-type DncV, or a mutated DncV. The isolated nucleic acid molecule of the invention can be obtained by site-directed mutagenesis of the wild-type DncV as described herein (see Example 5). Additional conventional mutation-inducing technics are well known in the art, such as irradiation of with gamma rays or ultraviolet light or treatment with a mutagen, such as hydroxylamine and ethylmethane. Persons skilled in the art can choose a suitable mutagenesis technology to obtain a mutated nucleic acid molecule. The mutated nucleic acid molecules can be further cloned and selected for their biological activities.

[00090] According to the invention, the isolated nucleic acid may be inserted into a vector to form a recombinant vector. The term "vector" used herein means a nucleic acid molecule, which is capable of carrying and transferring a nucleic acid segment of interest into a host cell for the purpose of expression or replication of the same. In particular, a vector refers to a plasmid, cosmid, bacteriophage or virus. Typically, the nucleic acid segment of interest is operatively linked to a regulatory sequence such that, when introducing into a host cell, for instance, the nucleic acid segment can be expressed in the host cell under the control of the regulatory sequence. The regulatory sequence may comprise, for example, a promoter sequence

(e.g., cytomegalovirus (CMV) promoter, simian virus 40 (SV40) early promoter and T7 promoter), replication origin and other control sequences (e.g., Shine-Dalgano sequences and termination sequences). The nucleic acid segment of interest may be connected to another nucleic acid fragment such that a fused polypeptide (e.g., His-tag fused polypeptide) is produced and beneficial to the subsequent purification procedures (see Example 5). The method for identifying and selecting the regulatory sequences are well known to the skilled persons and widely described in the literatures. The skilled persons can readily construct the recombinant vector of the invention according to the specification and the well-known technologies.

[00091] In a further aspect, the recombinant vector of the invention can be introduced into host cells to produce the DncV or mutated DncV. Accordingly, recombinant cells transformed with the recombinant vector are within the scope of the invention. Such recombinant cells can be prokaryotic (e.g., bacteria) or eukaryotic (e.g., fungi, animal and plant cells). A number of transformation technologies, such as a calcium chloride treatment, Calcium- PEG procedure, electroporation, DEAE-dextrin-mediated transfection, lipofection and microinjection are well described in many literatures. The skilled persons can choose a proper technology depending on the nature of the host cells and the vector to be introduced in the host cells.

[00092] A method for producing the DncV is also provided in the invention. The recombinant cells described above can be cultured in a suitable condition to express the DncV, and then the expressed DncV is recovered and purified. Those skilled in this art will appreciate that the recovering and purifying method is widely described in many references and is not limited, for example, by various chromatographies (e.g., HPLC or affinity columns).

[00093] Another aspect provides for a method of manufacturing a cyclic di-nucleotide comprising the steps of contacting a c-di-NMP-precursor (NTP) with DncV under conditions in which the DncV catalyzes the conversion of the nucleotide to a c-di-NMP. The DncV described herein can synthesis c-di-AMP, c-di-GMP and a previously undiscovered c-AMP-GMP hybrid molecule from ATP and GTP precursors. The enzyme is easily purified, highly active and converts ATP/GTP to the respective cyclic di-nucleotide with >95% efficiency in a short reaction time. Coupling enzyme synthesis with HPLC purification of the cyclic di-nucleotides allows for a rapid lower cost alternative to the production of these increasingly important biological compounds. Current chemical synthesis methods for producing these products require multiple steps and end with relatively low overall efficiency. Hyodo et al., 62 Tetrahedron 3089 (2006). This results in significant product cost of $4000/mg for c-di-AMP and $400/mg for c-di- GMP. In contrast, assuming current reagent costs, the present invention allows for the synthesis of c-di-AMP, c-di-GMP or c-AMP-GMP for ~$20/mg.

[00094] Cyclic di-nucleotides are being increasingly recognized for their important role in bacterial signaling. For more than a decade, cyclic di-GMP (c-di-GMP) has been shown to regulate several bacterial behaviors. Hengge, 2009. Recently Gram-positive bacteria were shown to synthesis cyclic di-AMP (c-di-AMP) in response to DNA damage. Witte et al., 30 Mol. Cell 167 (2008). c-di-AMP has also been shown to be directly recognized by and activate the innate immune system. Woodward, 2010. The discovery of these compounds spurred immunological interest with c-di-AMP being shown to be a potent mucosal vaccine adjuvant. Ebensen 29 Vaccine 5210 (2011); Madhun et al., 29 Vaccine 4973 (2011). Thus, as aspect of the present invention provides for a cyclic di-nucleotide produced by use of an isolated and/or purified DncV. Additionally, the c-di-NMP can be c-di-AMP, c-di-GMP and/or c-AMP-GMP. The isolated c-di-NMP can either be immobilized or transferred to an additional or subsequent support. Supports can be solid supports, such as flat slides, or chips, beads or fibers, or semisolid supports, such as gel matrices. C-di-NMPs can be transferred by, among other methods, directly contacting supports. Supports have been further described elsewhere herein. [00095] Yet another aspect provides for an adjuvant comprising the cyclic di-nucleotide produced by use of the isolated and/or purified DncV as described herein. See generally Chen et al., 28 Vaccine 3080 (2010). For example, intranasal c-di-GMP-adjuvanted vaccine can induce strong mucosal and systemic humoral immune responses against plant-derived H5 influenza. Madhun et al., 2011. Additionally, sublingual immunization with influenza H5N1 virosomes (haemagglutinin) in combination with c-di-GMP adjuvant effectively induced local and systemic H5Nl-specific humoral and cellular immune responses. Pedersen et al., 6 PLoS One e26973 (2011). In a murine model, vaccination with two different S. aureus antigens, clumping factor A or a nontoxic mutant staphylococcal enterotoxin C, each adjuvanted with c-di-GMP, provided strong antigen- specific antibody responses to subsequent challenge with viable methicillin- resistant S. aureus in a systemic infection model. Hu et al., 30 Vaccine 4867 (2009). Also, using a murine model of bacterial pneumonia, intranasal or systemic subcutaneous administration of c- di-GMP prior to intratracheal challenge with Klebsiella pneumoniae stimulated protective immunity against infection. Karaolis et al., 75 Infect. Immun. 4942 (2007). Hence, c-di-NMPs like c-di-GMP may be used clinically in humans and animals as an immunomodulator, immune enhancer, immunotherapeutic, immunoprophylactic, or vaccine adjuvant.

[00096] Still another aspect provides for a cyclic di-nucleotide produced by use of the purified DncV, further comprising a label, such as biotin. For example, the DncV described herein can also synthesize c-di-AMP, c-di-GMP and c-AMP-GMP with substituted with biotin tags for in cell localization or immunoprecipitation. Another aspect provides for an isolated/and or purified c-AMP-GMP hybrid molecule.

EXAMPLES

Example 1. Bacteria and genetic manipulation

Bacterial Strains and plasmids are listed in Table S3:

Table S3. Strains, plasmids, and sources thereof

Strain/Plasmid Relevant genotype and property Source

Strain

SMl( ir thi thr leu tonA lacY supE recA.vRP4-2-Tc::Mu Miller and Mekalanos, 1988) pirR6K Kim

C6706 V. cholerae El Tor biotype, SmR Roberts et al., 1992

C6706 lac- V. cholerae El Tor biotype, SmR , lacZ- Lab Stock

E7946 V. cholerae El Tor biotype, SmR Lab Stock

E7946 Zoc.-. n V. cholerae El Tor biotype, SmR , lacZ Lab Stock

0395 V. cholerae classical biotype, SmR Lab Stock

BDJM21 C6706 AtarB This study

BDJM22 E7946 AtarB This study

BDJM23 0395 AtarB This study

EC13568 C6706 VC0177:Tn Cameron et al., 2008

BDJM24 EC13568 AtarB This study EC18160 C6706 VC0178::Tn Cameron et al., 2008

EC7466 C6706 VC0179::Tn Cameron et al., 2008

BDJM25 C6706 AVC0179 This study

EC24301 C6706 VC0180::Tn Cameron et al., 2008

BDJM26 C6706 pToxT This study

BDJM27 BDJM21 pToxT This study

BDJM28 E7946 pToxT This study

BDJM29 BDJM22 pToxT This study

BDJM30 0395 pToxT This study

BDJM31 BDJM23 pToxT This study

BDJM32 EC13568 pVC0177 This study

BL21 DE3 Inducible T7 promoter Lab Stock

Plasmid

pBAD18-Cm arabinose inducible promoter, catR (Guzman et al., 1995) pToxT pBAD18 expressing ToxT with N-terminal This study

3X V5 epitope tag

pVC0177 pBAD18 expressing VC0177 with C-terminal This study

3X V5 epitope tag

Cameron et al., 105 PNAS 8736 (2008); Guzman et al., 177 J. Bacteriol. 4121 (1995);

Miller & Mekalanos 170 J. Bacteriol. 2575 (1988); Roberts et al., Cholera vaccines strains derived from a 1991 Peruvian isolate of Vibrio cholerae & other El Tor strains, Proc. 28th Joint Conf., U.S. -Japan Cooperative Med. Sci. Prog. Cholera & Related Diarrheal Diseases (1992).

[00097] Antibiotic concentrations used were streptomycin (Sm: 100 pg/ml), kanamycin

(Kan: 50 pg/ml), chloramphenicol (Cm: 2.5 pg/ml for C6706 and 10 pg/ml for E. coli DH5a pir) and carbenicillin (Carb: 75 pg/ml). LB contained 10 g/liter of tryptone (Bacto), 5 g/liter of yeast extract (Bacto), and 5 g/liter of NaCl, and was supplemented with 16 g/liter of agar (Bacto) for growth on plates. Arabinose was used at 0.1% unless otherwise stated. X-gal was used at 40 pg/ml.

[00098] DNA Manipulations: For pToxT, toxT was amplified from C6706 chromosomal

DNA and cloned into plasmid pBAD18 carrying a N-terminal 3X V5 epitope tag after digestion with Kpnl and Sail. For pVC0177, VC0177 was amplified from C6706 chromosomal DNA and cloned into plasmid pBAD18 carrying a C-terminal 3X V5 epitope tag after digestion with Kpnl and Sail. VC0179 was amplified with a C-terminal 6X-His tag from C6706 chromosomal DNA and cloned into plasmid pETDUET after digestion with Kpnl and Ndel for overexpression and purification. All cloned products were sequence-verified. Primers are listed in Table S4:

Table S4: Primers and Probes

Probes for Northerns:

TarB probe 1 : ccgcagtgcgccaaaaagtgcttaatcgtcagc

5SrRNApl : cccacactaccatcgacgctgtttgctttcacttctgagttc

Primers for ToxT and VC0177 3X V5:

ToxT 5' ataggtaccatgattgggaaaaaatcttttcaaactaatgtatatagaatg

ToxT Y atagtcgacttatttttctgcaactcctgtcaacataaataaatattcacttgg

VC0177 5' ataggtaccaggaggaaagcatgagacgttctatgaagatcagtgcagag

VC0177 Y atagtcgactgtcctttcaaaaagcaaggccttagttttgaac

Primers for VC0179 in pBAD18 and pETDUET: VC01796Xhis 5' ataccatgggcgtgagaatgacttggaactttcaccagtac

VC01796Xhis Y ataggatcctcagtggtgatgatggtgatgaccaccgccacttaccattgtgctgctgat

VCO 179pB AD 18 5' ataggtaccaggaggaaacgatgagaatgacttggaactttcaccagtac

VC0179pBAD18 Y atagtcgactcagccacttaccattgtgctgctg

Primers for VC0179 site direct mutagenesis:

VC0179SDM 5' ccgtttcagcctggtcaagaaatggctattgctgatggaacctatatgccaatg

VCO 179SDM 3 ' cattggcatataggttccatcagcaatagccatttcttgaccaggctgaaacgg

Primers for TarB and VC0179 clean deletion constructs:

TaiBU 5' atagggcccgttggtgctgcacactctggctatccg

TarBU Y catgggttggtaaagcgagcacatagggaataactgtactaatgttgtgtaacac

TarBD 5' gtgttacacaacattagtacagttattccctatgtgctcgctttaccaacccatg

TarBD Y atactcgagcacaaattgccatcgcaacatgacgcc

VC0179U 5' atagggcccgatagccagtatggtaggagaagagag

VCO 179U 3 ' cctgcttacctttcagccacttaccatccaagtcattctcactctcctctaaga

VCO 179D 5 ' tcttagaggagagtgagaatgacttggatggtaagtggctgaaaggtaagcagg

VC0179D Y atactcgagacaatgtgttgtaattgacacttcttgcag

Primers for ChIP qPCR validation:

tcpA 5 ' tgcacgtgtttctttcaac

tcpA 3 ' aggaaatgcattgcttggtc

ctxA 5 ' gctccctttgtttaacagaaaaa

ctxA 3 ' tcgagctaccgctacaaggt

tarB 5 ' catgaggtaaccg

tarB 3 ' aagaggccaagttcagcgta

VC0176 5' tgcttctttgagacgcagtg

VCO 176 Y tgagccataagtgtcattcca

VC0178 5' ccacagtgggtgtgttatatg

VC0178 Y aatcgttgggggttttcttt

VCO 179 5' tctgcaagctcgctcagta

VCO 179 Y cttaaatttgcgggcaggtac

VCO 180 5' ccgatgaaaagccactcttc

VCO 180 Y agaatctctggcaaacgctcta

Primers for mRNA qPCR validation:

VCO 176 5' aatcccactgcgtctcaaagaa

VCO 176 Y acgtactcccaaggctttct

VCO 177 5' cgttctatgaagatcagtgcagaca

VCO 177 3' aaaccgtaagatttgccgataa

VC0178 5' agagcgaatcatcgaggaa

VC0178 Y ttccataagccaaacccaaag

VCO 179 5' gcacctttctgacagcgaacaa

VCO 179 3' ctaacgtgcatcatcatcca

VCO 180 5' ccgtttggcaggtgtaaac

VCO 180 Y agagagtaaccgtccgagcat

VC0181 5' tcgtcaaggtgcagattg

VC0181 3' caaaggcctcattcactcgtg

VCO 182 5' cgcgtagatcctgcaaggaag

VCO 182 Y tttcggtgagttccggatag

VC0183 5'gcagcgaggtatctccccatac

VC0183 Y tgagtctggtcggaattgcat

VCO 184 5'gcggaaaatgatttcttgt

VCO 184 Y ttgggttaccaagcatttcc

Example 2. Chromatin Immunoprecipitation Sequencing (ChlP-seq) [00099] ChIP was performed as previously described (Davies et al., 2011). 50 ml of exponentially growing culture in LB was induced with 0.1% arabinose for 30 min at 37°C. Formaldehyde was added to 1% final concentration and incubated at 25°C for 20 minutes with occasional swirling. Crosslinking was quenched by adding glycine to 0.5 M. Cell pellets were washed in IX TBS and resuspended in lysis buffer (10 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% DOC, 0.5% N-lauroylsarcosine) + protease inhibitor cocktail (Sigma) and 1 mg/ml lysozyme and incubated at 37°C for 30 min. The cells were sonicated IX 30sec with a needle sonicator and unlysed debris pelleted by centrifugation. The lysate was sonicated for 20 min with a 10 sec on/ 10 sec off cycle (Mixsonix). A sample was taken as an input control for sequencing. Following clarification by centrifugation, 1/10 volume of 10% triton X-100 in lysis buffer was added to each sample followed by 100 μΐ of Dynal-Protein G beads coated with anti-V5 monoclonal antibody (Sigma) and incubated overnight with rotation. The beads were washed five times with ChIP RIPA buffer [50 mM HEPES pH7.5, 500 mM LiCl, 1 mM EDTA, 1% NP40, 0.7% DOC], then once in TE + 50 mM NaCl and resuspended in 100 μΐ elution buffer [50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% SDS]. Samples were incubated at 65°C for 30 min and the beads pelleted by centrifugation. Supernatants were incubated at 65°C overnight to reverse crosslinks. Samples were incubated with 8 μΐ of 10 mg/ml RNase A for 2h at 37°C, then 4 μΐ of 20 mg/ml proteinase K at 55°C for 2 hr, then purified with Qiagen mini reaction clean up kit and quantitated with Pico green kit (In vitro gen). Experiments were repeated in quadruplicate. Sample preparation and sequencing was performed as previously described (Davies et al., 2011). 1-3 ng of each sample was processed for sequencing by the addition of a polyA tail as described by Helicos protocols (available on the internet at, e.g., http://www.helicosbio.com/). Samples were sequenced using the HeliScope™ Single Molecule Sequencer at the Molecular Biology Core Facility in the Dana-Farber Cancer Institute.

[000100] Data processing for ChlP-seq was performed as previously described Davies et al., 2011. Briefly, data from each sequencing run was processed using Helisphere openware to generate fasta format sequence reads. The sequence reads were aligned to the V. cholerae

N16961 genome using CLC genomic workbench software. CLC genomic workbench ChlP-seq software was used to compare control and experiment alignments to identify peak enrichment.

A 100 bp sliding window and 0.001% FDR cut-off was applied to identify peaks. Peaks that were called in all four experimental samples were scored as real ToxT ChIP peaks. ChIP peak length is dictated by DNA shear size. Our average DNA shear size from sonication is 250 bp.

Shearing is random, so ToxT can be located anywhere along the 250 bp average length including the extreme termini. Since sequencing of ChIP DNA occurs from both ends this results in a ~500bp ChIP peak. For RNA-seq data analysis, sequencing data was aligned to the V. cholerae N16961 genome using CLC genomic workbench software using RPKM for expression values. RPKM values were normalized by scaling.

[000101] The statistical test performed was a Baggerley's test on proportion of counts in each group of samples to generate a p-value associated with the weighted proportion fold change between experiment and control groups for each gene. The result is a weighted t-type test statistic. Cut-off of 4-fold weighted proportions absolute change with a false-discovery rate; corrected p-value of <0.01.

[000102] For ChlP-seq peak validation, relative abundance qPCR was performed with Kapa Biosystems Fast Sybr green mix using 16S and 5S rDNA targets as internal relative standards. Relative target levels were calculated using the AACt method, with normalization of ChIP targets tol6S rDNA signal. Livak & Schmittgen, 25 Method. Meths. 402 (2001). For gene expression analysis, relative expression qPCR was performed with Applied Systems RNA-Ct one step system. Relative expression levels were calculated using the AACt method, with normalization of gene targets tol6S rRNA signal. Id.

Example 3. Transcriptome profiling (RNA-seq) and Northern blots

[000103] For ToxT expression studies, 0.1 % arabinose was added to mid exponential phase cultures for 10 min to induce ToxT expression. RNA was extracted using RiboPure Kit (Ambion). rRNA was removed using MICROBExpress RNA removal kit (Ambion). DNA contamination was removed using TURBO DNase (Ambion). First strand cDNA synthesis was performed using ImProm-II™ Reverse Transcription System (Promega A3800). Sample preparation and sequencing was performed as described for ChlP-seq.

[000104] For VC0179 expression studies 0.1 % arabinose was added to mid exponential phase cultures for 15 min to induce VC0179 expression. RNA was extracted using RiboPure Kit (Ambion). rRNA was removed using MICROBExpress RNA removal kit (Ambion). RNA samples were then processed for Illumina multiplex sequencing as described by the manufacturer. Samples were sequenced for 50 cycles on an Illumina HiSeq instrument.

[000105] For Northern blots, RNA was prepared from logarithmic cultures in triplicate using Ambion RiboPure Kit. Equal amounts of total RNA were separated on a 6% TBE-urea gel and transferred to Hybond N membrane. After crosslinking and prehybridization, membranes were incubated with 100 pmol of 32 P labeled probe. Washed membranes were exposed to film overnight. Probes are listed in Table S4. Example 4. Infant mouse colonization assays

[000106] A modified version of the protocol of Baselski and Parker (Baselski & Parker, 21 Infect. Immun. 518 (1978)), was performed for infection and recovery of all strains. Strains were grown on LB-agar plates with Sm overnight at 37°C. Wild type and mutant strains were mixed together in LB. 50 μΐ of this competition mixture (~ 50 000 bacteria) was inoculated into a 5-day-old CD1 mouse pup (Charles River Company). One strain carried an active lacZ allele. Serial dilutions of the competition mixture were plated in LB + SmlOO + X-gal and enumerated to determine the input ratio of wild type and mutant strain. After incubation at 30°C for 18 hr, the mouse pups were sacrificed and small intestines were removed and homogenized in 10 ml of LB. Serial dilutions were plated in LB + SmlOO + Xgal and enumerated to determine the output ratio of wild type and mutant strain. The competitive index for each mutant is defined as the input ratio of mutant/wild type strain divided by the output ratio of mutant/wild type strain. Statistical significance was determined by comparing the resulting ratio to the ratio of WT vs. WT lacZ.

Example 5. Protein mutagenesis, purification, di-nucleotide cyclase assay, c-di-NMP analysis

[000107] Site directed mutagenesis of VC0179 was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Strategene 200521). Primers are listed in Table S4. 6XHis C- terminal tagged VC0179 expressed in BL21 E. coli was purified by affinity chromatography with a Co2+ NTA resin (Thermo Scientific) according to manufacture protocol. After elution the protein was dialyzed against 25 mM Tris pH 7.5, 300 mM NaCl, 5mM Mg(OAc)2, 10% glycerol and 2mM DTT and stored in aliquots at -80°C. The enzymatic reaction contained 20 mM Tris pH 8.0, 20 mM Mg(OAc)2, 0.1 mg/ml BSA, 10% glycerol, 1 mM DDT and the indicated NTPs. To this was added buffer, 50 ng VC0179-6XHis or 50 ng D131A/D133A mutant VC0179-6XHis. The reaction was incubated at 37°C for 15 min. Samples were mixed with loading buffer, separated by PAGE using 12% denaturing gels and exposed to film.

[000108] Reverse-phase high performance liquid chromatography (RP-HPLC) was performed as previously described. Oppenheimer-Shaanan et al., 12 EMBO Rep. 594 (2011). Briefly, 10 μΐ of sample was fractionated using Beckman System Gold HPLC system equipped with a RP-C18 column (5 μπι, 4.6 x 250 mm, Phenomenex). Phase A consisted of 10 mM ammonium acetate (pH 5.5) and Phase B was 100% methanol. The column was equilibrated in 95% A + 5% B with a 1 ml/min flow rate. Samples were eluted using a linear gradient from 5% to 50% B over 45 min. Elution of samples was monitored by UV absorbance at 254 nm.

[000109] High resolution LCMS analysis was performed on an Agilent 6520 Accurate- Mass Q-TOF mass spectrometer using an electrospray (ESI) ionization source in negative mode. Ionization source parameters were set to: capillary voltage, 3500 kV; fragmentor voltage, 250 V; drying gas temperature, 350°C. A Gemini-NX C18 reverse phase column (5 μπι, 110 A, 2 x 50 mm, Phenomenex) was used to separate analyte with a water/acetonitrile (0.1% formic acid) gradient (0-100% acetonitrile over 12 min). Tandem MS/MS analysis was performed using collision induced dissociation (CID). Ions were selected using a medium iso width (approx 4 m/z) and CID energy set to 20. Parent masses and fragment ions are listed in Tables 1 and 2.

Table 1. ChlP-seq and RNA-seq identify ToxT genomic binding

Table 2. Masses of commercial and VC0179-generated c-di-NMPs from LCMS analysis

Table 3. Masses from MS/MS fragmentation: commercial vs. VC0179-generated c-di-NMPs

Claims

1. An isolated, purified di-nucleotide cyclase enzyme (DncV) or a homolog thereof.

2. The DncV of claim 1, wherein said DncV is purified from Vibrio.

3. The DncV of claim 1, wherein said DncV is a recombinant DncV.

4. An isolated DncV having the amino acid residues as shown in SEQ ID NO:_.

5. The isolated DncV of any of the preceding claims, immobilized to a support.

6. A cyclic di-nucleotide (c-di-NMP) produced by use of an isolated DncV.

7. The cyclic di-nucleotide produced by use of the isolated DncV, further comprising a label.

8. The cyclic di-nucleotide of claim 7, wherein the label is biotin.

9. The cyclic di-nucleotide of claim 6, wherein said cyclic di-nucleotide is c-di-AMP, c-di-GMP, and/or c-AMP-GMP.

10. The isolated c-di-NMP of any one of claims 6-9, immobilized to a support.

11. The isolated c-di-NMP of claim 10, wherein said support is a bead or matrix.

12. An adjuvant comprising a cyclic di-nucleotide produced by use of purified DncV.

13. An isolated or purified c-di-AMP-GMP hybrid molecule.

14. A method of manufacturing a cyclic di-nucleotide comprising the steps of contacting a c-di- NMP-precursor (NTP) with DncV under conditions in which the DncV catalyzes the conversion of the nucleotide to a c-di-NMP.

15. A target for inhibiting Vibrio infection, wherein the target is DncV.

16. A vaccine against Vibrio, comprising an immunogenic DncV protein or portion thereof.

17. A live attenuated Vibrio vaccine comprising a Vibrio that expresses a defective DncV gene or has the DncV gene deleted from its genome.

18. A method of treating Vibrio infection comprising administering an antigen-binding molecule that binds DncV.

19. The method of claim 18, wherein the antigen-binding molecule is selected from a small molecule, an aptamer, an antibody or portion thereof.

20. An isolated nucleic acid molecule that encodes DncV of claim 1 or claim 4.

21. An isolated nucleic acid molecule having the nucleotide sequence shown in Figure 9.

22. A recombinant vector that comprises the nucleic acid molecule of claim 20 or claim 21.

23. A host cell that comprises the recombinant vector of claim 20.