EP1214415A4 - Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique - Google Patents

Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique

Info

Publication number
EP1214415A4
EP1214415A4 EP00974068A EP00974068A EP1214415A4 EP 1214415 A4 EP1214415 A4 EP 1214415A4 EP 00974068 A EP00974068 A EP 00974068A EP 00974068 A EP00974068 A EP 00974068A EP 1214415 A4 EP1214415 A4 EP 1214415A4
Authority
EP
European Patent Office
Prior art keywords
abca2
sequence
nucleic acid
human
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00974068A
Other languages
German (de)
English (en)
Other versions
EP1214415A1 (fr
Inventor
Kenneth D Tew
Bojana Vulevic
Zhijian Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fox Chase Cancer Center
Original Assignee
Fox Chase Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fox Chase Cancer Center filed Critical Fox Chase Cancer Center
Publication of EP1214415A1 publication Critical patent/EP1214415A1/fr
Publication of EP1214415A4 publication Critical patent/EP1214415A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present invention relates to the fields of medicine and molecular biology. More specifically, the invention provides nucleic acid molecules and proteins encoded thereby which are involved in the regulated transport of biological and pharmacological molecules across cell membranes.
  • ABC transporters are members of the family of cellular membrane proteins responsible for unidirectional movement of many different substrates across biological membranes in prokaryotes and eukaryotes (Higgins, 1992) . These ABC transporters share structural similarity with most having one or two highly conserved ATP binding cassette (ABC) regions and one or two highly hydrophobic domains often with six transmembrane segments (Luciani et al , 1994) . Commonly, family members have a two plus two structure and are regarded as full-size transporters, as opposed to half transporters which contain one ATP binding cassette and one hydrophobic domain.
  • ABSC highly conserved ATP binding cassette
  • ABC transporters localize to plasma membranes (P- glycoprotein, MRPs) or to the internal membranes of different organelles (ALD, TAP, ABC7 , M-ABC1) .
  • Many ABC transporters play important roles in the cellular efflux of endogenous or xenobiotic substrates, and their biological dysfunction has been implicated in a number of clinical disorders.
  • impaired function of the cAMP activated CFTR chloride channel appears to be the basic defect in epithelial and non- epithelial cells derived from cystic fibrosis patients (Kunzelmann, 1999).
  • ALDP and PMP70 are associated with abnormal peroxisomal beta-oxidation of saturated, very long chain fatty acids giving rise to neurodegenerative disorders such as X-linked adrenoleukodistrophy and Zellweger syndrome (Smith et al . , 1999; Collins and Can, 1999).
  • Aberrant expression of half-transporters such as TAP-transporters (de la Salle et al . , 1994; Cucca et al . , 1994) has been linked to diseases like bare lymphocyte syndrome I and insulin-dependent diabetes mellitus. These proteins localize to endoplasmic reticulum and are involved in antigen processing.
  • the mitochondrial half-transporter, ABC7 has been associated with a range of hereditary diseases in humans (Savary et al., 1997; Shimada et al . , 1998; Csere et al . , 1998; Allik ets et al . , 1999).
  • the mutations in this iron- transporter are responsible for X-linked sideroblastic anemia and ataxia (XLSA/A) .
  • XLSA/A X-linked sideroblastic anemia and ataxia
  • ABCR or ABCA4 the rod photoreceptor ABC transporter has been implicated in a whole spectrum of vision disorders (Evans and Bhattacharya, 1998; Rozet et al . , 1998; Shroyer et al., 1999; Maugeri et al .
  • ABC1 a mammalian homologue of the C. elegans ced-7 gene, has been shown to be required for phagocytosis of both necrotic and apoptotic cells (Luciani and Chimini , 1996; Mounaylt et al . , 1998;) and is involved in macrophage interleukin-1 secretion (Hamon et al . , 1997) .
  • This protein has also been found to function as a cholesterol pump and some mutations in the ABC1 gene are causative for Tangier disease and familial high-density cholesterol deficiency with high predisposition for atherosclerosis (Langmann et al . , 1999; Brooks-Wilson et al . , 1999; Bodzioch et al . , 1999; Rust et al . , 1999.)
  • the mechanism(s) underlying these apparently loosely related functions has yet to be addressed.
  • an isolated nucleic acid molecule which includes a sequence encoding a full length human ABCA2 protein transporter of a size about 2436 amino acids in length.
  • the encoded protein, referred to herein as human ABCA2 comprises a multi-domain structure including a tandem repeat of nucleotide binding folds appended to a hydrophobic domain that contains several potential membrane spanning helices. conserveed Walker A and B ATP binding sites are present in each of the nucleotide binding folds.
  • an isolated nucleic acid molecule includes a cDNA encoding a human ABCA2 protein.
  • the human ABCA2 protein has an amino acid sequence the same as Sequence I.D. No. 2.
  • An exemplary human ABCA2 nucleic acid molecule of the invention comprises Sequence I.D. No. 1.
  • an isolated nucleic acid molecule which has a sequence selected from the group consisting of: (1) Sequence I.D. No. 1; (2) a sequence specifically hybridizing with preselected portions or all of the complementary strand of Sequence I.D. No. 1 comprising nucleic acids encoding amino acids 1-20, 1-35, 1-40, 1-60 and 1-150 of Sequence ID No . 2; (3) a sequence encoding preselected portions of Sequence I.D. No. 1 within nucleotides 1-200.
  • nucleic acid sequences encoding natural allelic variants of the nucleic acids of Sequence I.D. No. 1 are also contemplated to be within the scope of the present invention.
  • natural allelic variants will be defined hereinbelow.
  • antibodies im unologically specific for the human ABCA2 proteins described hereinabove are provided.
  • host cells comprising the human ABCA2 encoding nucleic acid of the invention are provided.
  • Such host cells include but are not limited to bacterial cells, fungal cells, insect cells, mammalian cells, and plant cells.
  • Host cells overexpressing the human ABCA2 encoding nucleic acids of the invention provide valuable research tools for assessing transport of chemotherapeutic agents out of cells.
  • Human ABCA2 expressing cells also comprise a biological system useful in methods for identifying inhibitors of the ABCA2 transporters.
  • Another embodiment of the present invention encompasses methods for screening cells expressing the human ABCA2 encoding nucleic acids for chemotherapy resistance. Such methods will provide the clinician with data which correlates expression of a particular human ABCA2 gene with a particular chemotherapy resistant phenotype .
  • oligonucleotide probes are provided which hybridize to the nucleic acids of the invention. Such probes may be used to advantage in screening biopsy samples for the expression of mutated ABCA2 genes .
  • kits comprising ABCA2 gene specific oligonucleotide probes and/or primers, ABCA2 encoding DNA molecules for use as a positive control, buffers, and an instruction sheet.
  • a kit for practicing the cell line screening method includes frozen cells comprising the human ABCA2 encoding nucleic acid of the invention, suitable culture media, buffers and an instruction sheet.
  • transgenic knockout mice are disclosed. Mice will be generated in which the ABCA2 gene has been knocked out. Such mice will provide a valuable biological system for assessing resistance to chemotherapy in an in vivo tumor model.
  • isolated nucleic acid refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it originates.
  • isolated nucleic acid may comprise a DNA or cDNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryote or eukaryote.
  • isolated nucleic acid primarily refers to an RNA molecule encoded by an isolated DNA molecule as defined above.
  • the term may refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a “substantially pure” form (the term “substantially pure” is defined below).
  • isolated protein or “isolated and purified protein” is sometimes used herein.
  • This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein which has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in “substantially pure” form.
  • substantially pure refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, the compound of interest.
  • the term “immunologically specific” refers to antibodies that bind to one or more epitopes of a protein of interest (e.g., human ABCA2), but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
  • the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”) .
  • this term is intended to signify that the double stranded nucleic acid has been subjected to denaturing conditions, as is well known to those of skill in the art.
  • the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence.
  • T_ 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex
  • T m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology.
  • targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42 °C.
  • Such sequences would be considered substantially homologous to the nucleic acid sequences of the invention.
  • the nucleic acids, proteins, antibodies, cell lines, methods, and kits of the present invention may be used to advantage to identify targets for the development of novel agents which inhibit the aberrant transport of biological and pharmacological agents into and out of cells.
  • the transgenic mice of the invention may be used in an in vivo model for chemotherapy resistance.
  • the human ABCA2 molecules, methods and kits described above may also be used as research tools and will facilitate the elucidation of the mechanism by which cellular transport may be augmented or inhibited.
  • Fig. 1 Diagram showing overlapping clones used to define the full-length cDNA of ABCA2. The white boxes represent the untranslated regions. A 1.75 kb fragment was originally PCR amplified. Clones designated as ⁇ represent clones isolated from oligo(d ⁇ ) and random primed human fetal brain phage library. Other clones were isolated using RACE PCR with human brain Marathon cDNA. The only exception is clone AB028985, which stands for GenBank accession number of brain KIAA1062 protein. The most 5' clones, 65 and 119 contain the ATG start codon designated at position 1 representing a previously described sequence of a brain cDNA (GenBank Accession Number AB028985) .
  • Figs. 2A, 2B, 2C and 2D Primary structure analysis of human ABCA2.
  • Fig. 2A Amino acid sequence predicted from the full length ABCA2 cDNA. The 12 predicted transmembrane-spanning segments are indicated with a heavy bar below the sequence and the corresponding numerals below. The 21 predicted N-glycosylation sites on the extracellular surface are indicated by "*”. Residues comprising the extended ATP-binding cassettes are underlined and indicated by "ATP binding cassette” . The highly hydrophobic domain is underlined and labeled as "HHD" . The nucleotide sequence was deposited in GenBank under accession number AF 178941.
  • Fig. 2B Kyle- Doolittle hydrophobicity analysis of ABCA2 protein. The shaded areas above line are hydrophobic and those below are hydrophilic. Analysis was performed in GCG software.
  • Fig. 2C Schematic showing the predicted topology of ABCA2 in the membrane. The extracellular surface is on the top and the cytoplasmic on the bottom of the figure. The stylized rods on the cytoplasmic loop show N-glycosylation sites.
  • Fig. 2D Dot-matrix plot of human ABCA2 against itself, with PAM 250 matrix and a window of 8 residues, shows little sequence similarity outside the nucleotide folds .
  • Fig. 3 Multialignment of the amino acid sequences of the extended nucleotide binding cassettes from the group of ABCl-similar proteins.
  • Clustal-W analysis was performed in Mac Vector software. Shading highlights the conserved residues.
  • Underlined are ATP binding cassette sequence motifs: WA stands for Walker motif A; WB stands for Walker motif B and ATS corresponds to active transport signature.
  • the reported sequences were extracted from the GenBank database, under the following Accession numbers: ABCA4 (human): NM_000341; ABCA3 (human) : NM_001089; ABCA2 (human) AF178941; ABCAl(human) : AAF86276; abca2 (mouse): CAA53531.
  • Fig. 4 Multiple Northern analysis blot. Blot containing 1 ⁇ g of polyA-f- RNA from each tissue hybridized with an 870 bp ABCA2 probe (top panel) or with a ⁇ -actin probe (bottom panel) .
  • FIG. 5 Tissue distribution of the human ABCA2.
  • a human MTE Array (Clontech, Palo Alto, CA) was probed with a 840 bp biotin labeled fragment of ABCA2 .
  • Al-10 whole brain, cerebral cortex, frontal lobe, parietal lobe, occipital lobe, temporal lobe, cerebral cortex, pons, cerebellum-left, cerebellum-right;
  • Bl-10 corpus callosum, amygdala, caudate nucleus, hippocampus, medulla oblongata, putamen, substantia nigra, accumbens nucleus, thalamus, pituitary gland;
  • Cl-10 spinal cord, heart, aorta, atrium-left, atrium-right, ventricle-left, ventricle-right, interventricular septum, apex of the heart, esophagus;
  • Dl-10 stomach, duodenum, jejunum, ileum, ilocecum, appendix, colon-ascending, colon-transverse, colon-descending, rectum;
  • ABCA2 An isolated human ABCA2 encoding nucleic acid, the protein encoded thereby and antibodies immunologically specific for the ABCA2 protein are provided in the present invention. Based on the degree of amino acid identity ABCA2 can be regarded as an ortholog of mouse ABCA2 (Luciani et al . , 1994) . This protein is closely related to members of ABC1-subfamily of transporters, ABCAl, ABCA4 and ABCA3 and more distantly related to MDRl (Chen et al . , 1986), MRP1 (Riordan et al . , 1989) and CFTR (Zielenski et al . , 1991).
  • ABCA2 The topology of ABCA2 is reminiscent of that observed in ABCA4 (Illing et al . , 1997; Azarian and Travis, 1997; Rozet at al . , 1998; Nasonkin et al . , 1998).
  • the large size of this protein (2436 amino acids and calculated MW ⁇ 270 kDa) makes this protein one of the largest ABC transporters reported to date.
  • the extracellular loop between the first two transmembrane segments together with the regulatory domain account for the size difference compared to other full-size transporters .
  • ABCA2 has a large number of possible sites for both glycosylation and phosphorylation. A total number of 21 putative glycosylation sites, confirms the glycolytic character of the protein and suggests that functional regulation may be accomodated by phosphokinases .
  • the activity of a related abc transporter, ABCAl is upregulated in vitro upon treatment with protein kinase A (Becq et al.,1997), implying a possible similar role in ABCA2.
  • ABCA2 shows prevalence of expression in the central nervous system, brain and spinal cord. This is in agreement with the data of Luciani and colleagues who showed similar tissue distribution of mouse abca2 (Luciani et al . ,
  • ABCA2 may have a similar role in brain. However, although its prevalence in neuronal tissue supports an important role for ABCA2 in this tissue, its presence in other tissues suggests a more pleiotropic role for this transporter. This concept is further supported by the broad expression pattern in the tumor cell lines examined. High ABCA2 levels may be linked to the transformed phenotype or to the physical characteristics of growing cells in vi tro . Expression may also be influenced by maturation and/or hormone changes since transcript levels in mouse uterus increase significantly during pregnancy (Luciani et al . , ) and in adult compared to fetal brain.
  • ABC transporters have been shown to participate in active transport of a variety of drugs, lipids, metabolites and peptides (Endicott and Ling, 1989; Hettema et al . , 1996; Ewart et al . , 1994; Berkow and Michaelis, 1991; Powis et al . , 1992).
  • estramustine-resistance clearly implicate ABCA2 in resistance to this drug in an ovarian carcinoma cell line (Laing et al . , 1998).
  • Estramustine is a synthetic nitrogen mustard derivative of estradiol with an unexpected anti itotic activity.
  • ABCA2 farnesocalins
  • lipocalins are a family of proteins linked to transport of retinoids, steroids (including cholesterol) lipids and bilins (Flower, 1996) . They are characterized by the presence of an eight anti-parallel beta sheet peptide conformation ( - 200 amino acids long) that form a binding site for the hydrophobic substrates. Perhaps not coincidentally, the locus of some members of this family is on 9q34, were ABCA2 resides.
  • ABCA2- similar proteins are involved in the transport of retinoids and cholesterol.
  • steroid, lipid or other similar substrates bind to this lipocalin component of ABCA2 , facilitating their transport.
  • the high CNS expression of the transporter may imply that substrates such as neurotransmitters, ions and/or bioacive peptides or amino acids are transported by ABCA2 protein.
  • Nucleic acid molecules encoding the ABCA2 proteins of the invention may be prepared by two general methods : (1) synthesis from appropriate nucleotide triphosphates, or (2) isolation from biological sources. Both methods utilize protocols well known in the art.
  • the availability of nucleotide sequence information, such as cDNAs having Sequence I.D. No. 1 enables preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis.
  • Synthetic oligonucleotides may be prepared by the phosphoramidite method employed in the Applied Biosystems 38A DNA Synthesizer or similar devices.
  • the resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC) .
  • HPLC high performance liquid chromatography
  • a 5 kb double-stranded molecule may be synthesized as several smaller segments of appropriate complementarity.
  • Complementary segments thus produced may be annealed such that each segment possesses appropriate cohesive termini for attachment of an adjacent segment.
  • Adjacent segments may be ligated by annealing cohesive termini in the presence of DNA ligase to construct an entire 5 kb double-stranded molecule.
  • a synthetic DNA molecule so constructed may then be cloned and amplified in an appropriate vector.
  • Nucleic acid sequences encoding the ABCA2 proteins of the invention may be isolated from appropriate biological sources using methods known in the art.
  • a cDNA clone is isolated from a cDNA expression library of human origin.
  • human genomic clones encoding ABCA2 proteins may be isolated.
  • cDNA or genomic clones having homology with ABCA2 may be isolated from other species using oligonucleotide probes corresponding to predetermined sequences within the ABCA2 encoding nucleic acids.
  • nucleic acids having the appropriate level of sequence homology with the protein coding region of Sequence I.D. Nos. 1 may be identified by using hybridization and washing conditions of appropriate stringency.
  • hybridizations may be performed, according to the method of Sambrook et al . , (supra) using a hybridization solution comprising: 5X SSC, 5X Denhardt ' s reagent, 1.0% SDS, 100 ⁇ g/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide.
  • Hybridization is carried out at 37-42 °C for at least six hours.
  • filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes-1 hour at 37 °C in IX SSC and 1% SDS; (4) 2 hours at 42-65°in IX SSC and 1% SDS, changing the solution every 30 minutes.
  • Nucleic acids of the present invention may be maintained as DNA in any convenient cloning vector.
  • clones are maintained in a plasmid cloning/expression vector, such as pBluescript (Stratagene, La Jolla, CA) , which is propagated in a suitable E. coli host cell.
  • pBluescript Stratagene, La Jolla, CA
  • ABCA2-encoding nucleic acid molecules of the invention include cDNA, genomic DNA, RNA, and fragments thereof which may be single- or double-stranded.
  • this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing with at least one sequence of a nucleic acid molecule of the present invention, such as selected segments of the cDNA having Sequence I.D. No. 1.
  • Such oligonucleotides are useful as probes for detecting or isolating ABCA2 genes.
  • Antisense nucleic acid molecules may be targeted to translation initiation sites and/or splice sites to inhibit the translation of the ABCA2-encoding nucleic acids of the invention.
  • antisense molecules are typically between 15 and 30 nucleotides and length and often span the translational start site of ABCA2 encoding mRNA molecules.
  • Nucleic acid sequences encoding antisense molecules corresponding to amino acids 1-10, 1-45, 1-50, 1-100 and 1-500 of SEQ ID NO: 2 are thus contemplated to be within the scope of the present invention.
  • variants of these sequences exist in the human population, and must be taken into account when designing and/or utilizing oligos of the invention. Accordingly, it is within the scope of the present invention to encompass such variants, with respect to the ABCA2 sequences disclosed herein or the oligos targeted to specific locations on the respective genes or RNA transcripts. With respect to the inclusion of such variants, the term "natural allelic variants" is used herein to refer to various specific nucleotide sequences and variants thereof that would occur in a human population. The usage of different wobble codons and genetic polymorphisms which give rise to conservative or neutral amino acid substitutions in the encoded protein are examples of such variants.
  • substantially complementary or homologous refers to nucleic acid sequences that may not be perfectly matched to a target sequence, but the mismatches do not materially affect the ability of the oligo to hybridize with its target sequence under the conditions described.
  • ABCA2 proteins of the present invention may be prepared in a variety of ways, according to known methods.
  • the proteins may be purified from appropriate sources, e.g., transformed bacterial or animal cultured cells or tissues, by immunoaffinity purification. However, this is not a preferred method due to the low amount of protein likely to be present in a given cell type at any time.
  • the availability of nucleic acid molecules encoding ABCA2 proteins enables production of the proteins using in vi tro expression methods known in the art.
  • a cDNA or gene may be cloned into an appropriate in vi tro transcription vector, such as pSP64 or pSP65 for in vi tro transcription, followed by cell-free translation in a suitable cell-free translation system, such as wheat germ or rabbit reticulocytes .
  • a suitable cell-free translation system such as wheat germ or rabbit reticulocytes .
  • In vitro transcription and translation systems are commercially available, e.g., from Promega Biotech, Madison, Wisconsin or Gibco-BRL, Gaithersburg, Maryland.
  • larger quantities of ABCA2 proteins may be produced by expression in a suitable prokaryotic or eukaryotic system.
  • part or all of a DNA molecule such as a cDNA having Sequence I.D. No.
  • a plasmid vector adapted for expression in a bacterial cell such as E. coli .
  • Such vectors comprise the regulatory elements necessary for expression of the DNA in the host cell positioned in such a manner as to permit expression of the DNA in the host cell .
  • Such regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.
  • the human ABCA2 proteins produced by gene expression in a recombinant prokaryotic or eukaryotic system may be purified according to methods known in the art.
  • a commercially available expression/secretion system can be used, whereby the recombinant protein is expressed and thereafter secreted from the host cell, to be easily purified from the surrounding medium.
  • an alternative approach involves purifying the recombinant protein by affinity separation, such as by immunological interaction with antibodies that bind specifically to the recombinant protein or nickel columns for isolation of recombinant proteins tagged with 6-8 histidine residues at their N-terminus or C-terminus.
  • Alternative tags may comprise the FLAG epitope or the hemagglutinin epitope. Such methods are commonly used by skilled practitioners.
  • the human ABCA2 proteins of the invention prepared by the aforementioned methods, may be analyzed according to standard procedures. For example, such proteins may be subjected to amino acid sequence analysis, according to known methods .
  • the human ABCA2 encoding nucleic acid of the invention may include a sequence that differs slightly from the SEQ ID NO : 1 , yet encodes a polypeptide having the same amino acid sequence.
  • the encoded polypeptide may comprise an amino acid sequence which differs by one or more amino acid residues from those shown in SEQ ID NO: 2.
  • Nucleic acid encoding a polypeptide which is an amino acid sequence mutant, variant or derivative of the sequence shown is further provided by the present invention.
  • Nucleic acid encoding such a polypeptide may show at the nucleotide sequence and/or encoded amino acid level greater than about 60% homology with the relevant coding or encoded sequence shown herein, greater than about 70% homology, greater than about 80% homology, greater than 90% homology and preferably greater than 95% homology to the sequences provided herein.
  • amino acid "homology” this may be understood to be similarity (according to established principles of amino acid similarity), e.g., as determined using the algorithm GAP (Genetics Computer Group, Madison, WI) or identity.
  • GAP uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps.
  • GAP GAP e.g., BLAST (which uses the method of Altschul et al, (1990) J. Mol. Biol . 215: 405- 410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85:2444-2448), or the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol. Biol. 147:195-197), generally employing default parameters.
  • BLAST which uses the method of Altschul et al, (1990) J. Mol. Biol . 215: 405- 410
  • FASTA which uses the method of Pearson and Lipman (1988) PNAS USA 85:2444-2448
  • Smith-Waterman algorithm Smith and Waterman (1981) J. Mol. Biol. 147:195-197
  • homologous recombination merely requires that two nucleotide sequences be sufficiently similar to recombine under the appropriate conditions.
  • the present invention also provides antibodies capable of immunospecifically binding to proteins of the invention.
  • Polyclonal antibodies directed toward human ABCA2 proteins may be prepared according to standard methods.
  • monoclonal antibodies are prepared, which react immunospecifically with the various epitopes of the ABCA2 proteins described herein.
  • Monoclonal antibodies may be prepared according to general methods of K ⁇ hler and Milstein, following standard protocols.
  • Polyclonal or monoclonal antibodies that immunospecifically interact with ABCA2 proteins can be utilized for identifying and purifying such proteins. For example, antibodies may be utilized for affinity separation of proteins with which they immunospecifically interact.
  • Antibodies may also be used to immunoprecipitate proteins from a sample containing a mixture of proteins and other biological molecules. Other uses of anti-ABCA2 antibodies are described below.
  • ABCA2 proteins of the invention play a pivotal role in cellular transport. Additionally, ABCA2 nucleic acids, proteins and antibodies thereto, according to this invention, may be used as research tools to identify other proteins that are intimately involved in the transport of molecules into and out of cells. Biochemical elucidation of molecular mechanisms which govern such transport will facilitate the development of novel anti-transport agents that may, for example, sensitize tumor cells to conventional chemotherapeutic agents.
  • ABCA2-encoding nucleic acids may be used for a variety of purposes in accordance with the present invention.
  • ABCA2-encoding DNA, RNA, or fragments thereof may be used as probes to detect the presence of and/or expression of genes encoding ABCA2 proteins.
  • Methods in which ABCA2-encoding nucleic acids may be utilized as probes for such assays include, but are not limited to: (1) in si tu hybridization; (2) Southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR) .
  • the ABCA2-encoding nucleic acids of the invention may also be utilized as probes to identify related genes from other animal species.
  • hybridization stringencies may be adjusted to allow hybridization of nucleic acid probes with complementary sequences of varying degrees of homology.
  • ABCA2-encoding nucleic acids may be used to advantage to identify and characterize other genes of varying degrees of relation to the ABCA2 genes of the invention. Such information enables further characterization of transporter molecules which give rise to the chemoresistant phenotype of certain tumors. Additionally, they may be used to identify genes encoding proteins that interact with ABCA2 proteins (e.g., by the "interaction trap" technique), which should further accelerate identification of the components involved in transport of biological molecules across cell membranes.
  • the ABCA2-encoding nucleic acids may also be used to generate primer sets suitable for PCR amplification of target ABCA2 DNA. Criteria for selecting suitable primers are well known to those of ordinary skill in the art .
  • Nucleic acid molecules, or fragments thereof, encoding ABCA2 genes may also be utilized to control the production of ABCA2 proteins, thereby regulating the amount of protein available to participate in biological or pharmacological reagent transport.
  • antisense oligonucleotides corresponding to essential processing sites in ABC ⁇ _?-encoding mRNA molecules may be utilized to inhibit ABCA2 protein production in targeted cells. Alterations in the physiological amount of ABCA2 proteins may dramatically affect the ability of these proteins to transport pharmacological reagents out of the cell.
  • Host cells comprising ABCA2-encoding DNA molecules are encompassed in the present invention.
  • Host cells contemplated for use in the present invention include but are not limited to bacterial cells, fungal cells, insect cells, mammalian cells, and plant cells. Methods for introducing DNA molecules are also well known to those of ordinary skill in the art. Such methods are set forth in Ausubel et al . eds . , Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY 1995, the disclosure of which is incorporated by reference herein. The availability of ABCA2-encoding nucleic acids enables the production of strains of laboratory mice carrying part or all of the ABCA2 gene or mutated sequences thereof . Such mice may provide an in vivo model for development of novel therapeutic agents.
  • the ABCA2 nucleic acid sequence information provided herein enables the production of knockout mice in which the endogenous gene encoding ABCA2 has been specifically inactivated.
  • Methods of introducing transgenes in laboratory mice are known to those of skill in the art. Three common methods include: 1. integration of retroviral vectors encoding the foreign gene of interest into an early embryo; 2. injection of DNA into the pronucleus of a newly fertilized egg; and 3. the incorporation of genetically manipulated embryonic stem cells into an early embryo.
  • the alterations to the ABCA2 gene envisioned herein include modifications, deletions, and substitutions. Modifications and deletions render the naturally occurring gene nonfunctional, producing a "knock out" animal. Substitutions of the naturally occurring gene for a gene from a second species results in an animal which produces an ABCA2 gene from the second species . Substitution of the naturally occurring gene for a gene having a mutation results in an animal with a mutated ABCA2 protein.
  • a transgenic mouse carrying the human ABCA2 gene is generated by direct replacement of the mouse ABC2 gene with the human gene.
  • a transgenic animal carrying a "knock out" of an ABCA2- encoding nucleic acid is useful for the establishment of a nonhuman model for chemotherapy resistance involving ABCA2 regulation.
  • mice can be generated that cannot make ABCA2 proteins because of a targeted mutational disruption of the ABCA2 gene.
  • transgenic animal is any animal containing one or more cells bearing genetic information altered or received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by targeted recombination or microinjection or infection with recombinant virus.
  • transgenic animal is not meant to encompass classical cross-breeding or in vitro fertilization, but rather is meant to encompass animals in which one or more cells are altered by or receive a recombinant DNA molecule.
  • This molecule may be specifically targeted to a defined genetic locus, be randomly integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • the term "germ cell line transgenic animal” refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability to transfer the genetic information to offspring. If such offspring in fact, possess some or all of that alteration or genetic information, then they, too, are transgenic animals.
  • the alteration or genetic information may be foreign to the species of animal to which the recipient belongs, or foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient.
  • the altered or introduced gene may be expressed differently than the native gene.
  • the altered ABCA2 gene generally should not fully encode the same ABCA2 protein native to the host animal and its expression product should be altered to a minor or great degree, or absent altogether. However, it is conceivable that a more modestly modified ABCA2 gene will fall within the compass of the present invention if it is a specific alteration.
  • the DNA used for altering a target gene may be obtained by a wide variety of techniques that include, but are not limited to, isolation from genomic sources, preparation of cDNAs from isolated mRNA templates, direct synthesis, or a combination thereof.
  • a preferred type of target cell for transgene introduction is the embryonal stem cell (ES) .
  • ES cells may be obtained from pre-implantation embryos cultured in vitro.
  • Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection or by retrovirus-mediated transduction.
  • the resultant transformed ES cells can thereafter be combined with blastocysts from a non-human animal .
  • the introduced ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • One approach to the problem of determining the contributions of individual genes and their expression products is to use an isolated ABCA2-encoding nucleic acid to selectively inactivate the wild-type gene in totipotent ES cells (such as those described above) and then generate transgenic mice.
  • the use of gene-targeted ES cells in the generation of gene-targeted transgenic mice is known in the art.
  • Nonhomologous plasmid-chromosome interactions are more frequent occurring at levels 10 5 -fold to 10 2 -fold greater than comparable homologous insertion.
  • Non-homologous recombinants are selected against by using the Herpes Simplex virus thymidine kinase (HSV-TK) gene and selecting against its nonhomologous insertion with effective herpes drugs such as gancyclovir (GANC) or (1- (2-deoxy-2-fluoro-B-D arabinofluranosyl) -5-iodouracil , (FIAU) .
  • GANC Herpes Simplex virus thymidine kinase
  • FIAU gancyclovir
  • a “targeted gene” or “knock-out” is a DNA sequence introduced into the germline or a non- human animal by way of human intervention, including but not limited to, the methods described herein.
  • the targeted genes of the invention include DNA sequences which are designed to specifically alter cognate endogenous alleles.
  • Knockout mice of the invention can be injected with tumor cells or treated with carcinogens to generate carcinomas. Such mice provide a biological system for assessing chemotherapy resistance as modulated by an ABCA2 gene of the invention. Accordingly, therapeutic agents which inhibit the action of these transporters and thereby prevent efflux of beneficial chemotherapeutic agents from tumor cells may be screened in studies using ABCA2 knock out mice .
  • ABCA2-encoding nucleic acids are also used to advantage to produce large quantities of substantially pure ABCA2 proteins, or selected portions thereof .
  • ABCA2 Proteins and Antibodies are also used to advantage to produce large quantities of substantially pure ABCA2 proteins, or selected portions thereof .
  • Purified full length ABCA2 proteins, or fragments thereof, may be used to produce polyclonal or monoclonal antibodies which also may serve as sensitive detection reagents for the presence and accumulation of ABCA2 proteins (or complexes containing ABCA2 proteins) in mammalian cells. Recombinant techniques enable expression of fusion proteins containing part or all of ABCA2 proteins.
  • the full length proteins or fragments of the proteins may be used to advantage to generate an array of monoclonal antibodies specific for various epitopes of ABCA2 proteins, thereby providing even greater sensitivity for detection of ABCA2 proteins in cells .
  • Polyclonal or monoclonal antibodies immunologically specific for ABCA2 proteins may be used in a variety of assays designed to detect and quantitate the proteins.
  • Such assays include, but are not limited to: (1) flow cytometric analysis; (2) immunochemical localization of ABCA2 proteins in tumor cells; and (3) immunoblot analysis (e.g., dot blot, Western blot) of extracts from various cells. Additionally, as described above, anti-ABCA2 antibodies can be used for purification of ABCA2 proteins and any associated subunits (e.g., affinity column purification, immunoprecipitation) .
  • ABCA2-encoding nucleic acids, ABCA2 expressing vectors, ABCA2 proteins and anti-ABCA2 antibodies of the invention can be used to detect ABCA2 gene expression and alter ABCA2 protein accumulation for purposes of assessing the genetic and protein interactions involved in the transport of biological and pharmacological reagents across cell membranes.
  • Exemplary approaches for detecting ABCA2 nucleic acid or polypeptides/proteins include: a) comparing the sequence of nucleic acid in the sample with the ABCA2 nucleic acid sequence to determine whether the sample from the patient contains mutations; or b) determining the presence, in a sample from a patient, of the polypeptide encoded by the ABCA2 gene and, if present, determining whether the polypeptide is full length, and/or is mutated, and/or is expressed at the normal level; or c) using DNA restriction mapping to compare the restriction pattern produced when a restriction enzyme cuts a sample of nucleic acid from the patient with the restriction pattern obtained from normal ABCA2 gene or from known mutations thereof; or, d) using a specific binding member capable of binding to a ABCA2 nucleic acid sequence (either normal sequence or known mutated sequence) , the specific binding member comprising nucleic acid hybridizable with the ABCA2 sequence, or substances comprising an antibody domain with specificity for a native or mutated ABC
  • a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
  • specific binding pairs are antigens and antibodies, ligands and receptors and complementary nucleotide sequences. The skilled person is aware of many other examples and they do not need to be listed here. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a large molecule.
  • the specific binding pair are nucleic acid sequences, they will be of a length to hybridize to each other under conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.
  • the ABCA2 nucleic acid in biological sample will initially be amplified, e.g. using PCR, to increase the amount of the analyte as compared to other sequences present in the sample. This allows the target sequences to be detected with a high degree of sensitivity if they are present in the sample. This initial step may be avoided by using highly sensitive array techniques that are becoming increasingly important in the art.
  • the identification of the full-length ABCA2-encoding nucleic acid, and its association with a particular chemotherapy resistance paves the way for aspects of the present invention to provide the use of materials and methods, such as are disclosed and discussed above, for establishing the presence or absence in a test sample of a variant form of the gene, in particular an allele or variant specifically associated with chemotherapy resistance. This may be done to assess the propensity of the tumor to exhibit chemotherapy resistance.
  • ABCA2 mutations may result in aberrant transport of endogenous biological molecules resulting in a pathological condition.
  • endogenous biological molecules resulting in a pathological condition.
  • the present invention concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological components .
  • the encoded proteins or peptides of the present invention may be employed to detect antibodies having reactivity therewith, or, alternatively, antibodies prepared in accordance with the present invention, may be employed to detect the encoded proteins or peptides .
  • the steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al . (1987) .
  • the immunobinding methods include obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes .
  • the immunobinding methods include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process.
  • a sample suspected of containing an ABCA2 gene encoded protein, peptide or a corresponding antibody and contact the sample with an antibody or encoded protein or peptide, as the case may be, and then detect or quantify the amount of immune complexes formed under the specific conditions .
  • the biological sample analyzed may be any sample that is suspected of containing the ABCA2 antigen, such as a tumor tissue section or specimen, a homogenized tissue extract, an isolated cell, a cell membrane preparation, separated or purified forms of any of the above protein-containing compositions.
  • kits for use in detecting expression of ABCA2-encoding nucleic acids in biological samples including biopsy samples.
  • a kit may comprise one or more pairs of primers for amplifying nucleic acids corresponding to the ABCA2 gene.
  • the kit may further comprise samples of total mRNA derived from tissues expressing the ABCA2-encoding nucleic acid of the invention, to be used as controls.
  • the kit may also comprise buffers, nucleotide bases, and other compositions to be used in hybridization and/or amplification reactions. Each solution or composition may be contained in a vial or bottle and all vials held in close confinement in a box for commercial sale.
  • the invention encompasses a kit for use in detecting ABCA2 proteins in chemotherapy resistant cancer cells comprising antibodies specific for ABCA2 proteins encoded by the ABCA2 nucleic acids of the present invention.
  • Another aspect of the present invention comprises screening methods employing host cells expressing an ABCA2-encoding nucleic acid of the invention.
  • An advantage of having discovered the complete coding sequence of ABCA2 is that cell lines that overexpress ABCA2 can be generated using standard transfection protocols. Cells that overexpress the complete cDNA will also harbor the complete proteins a feature that is essential for assessing biological activity of the protein.
  • the overexpressing cell lines will be useful in several ways: l)The drug sensitivity of overexpressing cell lines can be tested with a variety of known anticancer agents in order to determine the spectrum of anticancer agents for which the transporter confers resistance; 2 ) The drug sensitivity of overexpressing cell lines can be used to determine whether newly discovered anticancer agents are transported out of the cell by one of the discovered transporters; 3 ) Overexpressing cell lines can be used to identify potential inhibitors that reduce the activity of the transporters. Such inhibitors are of great clinical interest in that they may enhance the activity of known anticancer agents, thereby increasing their effectiveness. Reduced activity will be detected by restoration of anticancer drug sensitivity, or by reduction of transporter mediated cellular efflux of anticancer agents.
  • This library was chosen because ABCA2 expression in mouse is most pronounced in brain (Luciani et al . , 1994) .
  • the library was probed with a 32 P-labeled (Prime-it II Random Primer Labeling Kit, Stratagene, La Jolla, CA) 490 bp PCR fragment that we amplified from the 5' end of the 1.75 kb ABCA2 fragment. Screening was performed according to the manufacturer's instructions. In brief, XLl-Blue bacteria were incubated with different dilutions of library and plated onto LB plates to titer the library.
  • fragment A fragment A
  • 5 ' CCTCATTTTCCCCTACAACC3 ' fragment A
  • 5 'ACCTGCTCCATCTTGCTGCTGAACAC fragment B
  • fragment B fragment B
  • Fragment C was directly obtained by restriction digest of KIA1065 clone (kindly provided by Dr Takahiro Nagase from Kazusa DNA Research Institute)
  • Fragment D was obtained by PCR from KIA1065 clone using 5 ' CAGCGGCGGCAACAAGCGGAA3 ' (Sequence I.D. No. 17) and
  • pcDNA(3.1+) -ABCA2 That clone has been designated as pcDNA(3.1+) -ABCA2.
  • pEGFP-ABCA2 clone was constructed in the following way: start codon of ABCA2 was modified using PCR (primers used were 5 'TAGTACTCCTTGGGCTTCCTGCACCAGC3 ' (Sequence I.D. No. 19) and 5 ' CCAGGGCAGATGAGGGACCAAAGA3 ' (Sequence I.D. No. 20)), and resulting clone inserted into Seal and
  • 5 ' RACE was used to map the start site of the ABCA2 transcript .
  • Reverse transcription of total brain RNA (Clontech, Palo Alto) was performed using antisense gene specific primer, 5 ' CATCCAGCAGGTCCCCCAGAAGC 3' (Sequence I.D. No. 21) and was followed by RNase H treatment.
  • the first strand synthesis product was subjected to dC tailing reactions with terminal deoxynucleotidyl transferase.
  • the first round of PCR amplification was then performed using 5 ' RACE anchor primer 5'GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG3' (Sequence I.D. No.
  • RNA samples from a selection of NCI panel human tumor cell lines were provided by Dr. Anne Monks (Monks et al . , 1991). 10 ⁇ g samples were fractionated on formaldehyde agarose gels, transferred to nylon membranes (GeneScreen, NEN, Boston, MA) and hybridized by standard protocols. 32 P radioactive labeling of a gel-purified 1.75 kb ABCA2 probe to high specific activity was performed by random priming kit (Prime-It 11 Random Primer Labeling Kit, Stratagene, La Jolla, CA) .
  • a multiple human tissue poly (A) +RNA dot blot (MTE Array, Clontech, Palo Alto, CA) , and Multiple Tissue Northern Blot (MTN, Clontech, Palo, Alto, CA) were hybridized with a 870 bp probe that was PCR amplified using the following primers: 5' AGGGAGCTGGCTACACCGACG 3' (forward; Sequence I.D. No. 26) and
  • Chemiluminescent Detection system (Pierce, Rockford, IL) .
  • the signal intensities were quantified with NIH Image software .
  • Nucleotide sequencing was performed with an ABI 377 DNA sequencer. The sequences were assembled in the Sequencher program (Gene Codes Corporation, Ann Arbor, MI) . Protein computer analyses were performed with the Genetics Computer Group Package version 9.1 (Madison, WI) , and McVector (Oxford Molecular) .
  • the ATP-binding cassettes of ABCA2 contain conserved Walker A and B ATP-binding motifs together with the signature sequence of ABC transporters (Fig. 3) .
  • the amino terminal ABC of ABCA2 is most identical to ABCAl (70.6%) and slightly less to that of ABCA4 (65.2%) and ABCA3 (58.2%).
  • the carboxy-terminal has highest identity with ABCA4 (67.8%) and ABCAl (66.1%) and somewhat less with ABCA3 (60.7%) .
  • the ABCA2 protein is a full-size transporter that contains a tandem repeat of the recognizable hydrophobic domain with six transmembrane helices followed by highly conserved ATP-binding cassettes. Despite the apparent structural symmetry, there is very little sequence homology between the two halves of the predicted ABCA2 protein, as seen by dot matrix analysis (Fig. 2D) . Structurally, the hydrophobic domain spacing is reminiscent of that found in ABCA4 (Figs. 2 B, 2C) . The cytosolic N-terminus is immediately followed by the first transmembrane segment and a long extra-cytosolic loop. The long hydrophilic linker portion of the protein (-700 amino acids) is separated into two halves by a highly hydrophobic domain.
  • This region of the protein may correspond to a putative regulatory domain similar to the one found in CFTR.
  • the potential sites of N-glycosylation are concentrated in two regions, with the first fifteen on the large extracellular loop and the second six between the HHD and the 7th transmembrane segment. While these post-translation modifications are highly probable in the first region, glycosylation at the second region may be more hypothetical, based on the present understanding of ABCl-like proteins (Azarian and Travis, 1997). While some groups (Azarian and Travis, 1997; Rozet et al .
  • HHD highly hydrophobic domain
  • GQSRKLDGGWLKV a lipocalin signature
  • ABCA2 can be regarded as an orthologue of mouse ABCA2 (Luciani et al . , 1994) .
  • This protein is closely related to members of the ABCAl-subfamily of transporters (ABCAl, ABCA4 and ABCA3 ) and more distantly related to MDRl, MRP1 and CFTR.
  • ABCA2 cDNA and its encoded protein facilitate the development of novel therapeutic agents which may be efficacious in the treatment of cancer and other disorders which result from the aberrant transport of molecules across cell membranes.
  • the photoreceptor rim protein is an ABC transporter encoded by the gene for recessive Stargardt ' s disease (ABCR). FEBS Lett. 409, 247-252.
  • the gene encoding ATP- binding cassette transporter 1 is mutated in Tangier disease. Nat. Genet. 22, 347-351.
  • the 220- kDa rim protein of retinal rod outer segments is a member of the ABC transporter superfamily. J. Biol. Chem. 272, 10303-10310.
  • Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nature Genetics 22,352-355.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP00974068A 1999-09-20 2000-08-31 Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique Withdrawn EP1214415A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15483999P 1999-09-20 1999-09-20
US154839P 1999-09-20
PCT/US2000/040789 WO2001021798A2 (fr) 1999-09-20 2000-08-31 Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique

Publications (2)

Publication Number Publication Date
EP1214415A1 EP1214415A1 (fr) 2002-06-19
EP1214415A4 true EP1214415A4 (fr) 2003-09-17

Family

ID=22553022

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00974068A Withdrawn EP1214415A4 (fr) 1999-09-20 2000-08-31 Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique

Country Status (4)

Country Link
EP (1) EP1214415A4 (fr)
AU (1) AU1249501A (fr)
CA (1) CA2385231A1 (fr)
WO (1) WO2001021798A2 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004147502A (ja) * 2000-07-26 2004-05-27 Banyu Pharmaceut Co Ltd ヒト及びラットａｂｃａ２遺伝子
EP1504029A2 (fr) * 2002-05-06 2005-02-09 University of British Columbia Systeme d'expression destine a de grosses proteines fonctionnelles

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001014414A2 (fr) * 1999-08-20 2001-03-01 Activepass Pharmaceuticals, Inc. Nouveau transporteur abc2 et son utilisation
WO2001064875A2 (fr) * 2000-02-29 2001-09-07 Millennium Pharmaceuticals, Inc. Nouveaux transporteurs humains 20685, 579, 17114, 23821, 33894 et 32613
WO2002008424A1 (fr) * 2000-07-26 2002-01-31 Banyu Pharmaceutical Co., Ltd. Genes abca2 humain et de rat

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001014414A2 (fr) * 1999-08-20 2001-03-01 Activepass Pharmaceuticals, Inc. Nouveau transporteur abc2 et son utilisation
WO2001064875A2 (fr) * 2000-02-29 2001-09-07 Millennium Pharmaceuticals, Inc. Nouveaux transporteurs humains 20685, 579, 17114, 23821, 33894 et 32613
WO2002008424A1 (fr) * 2000-07-26 2002-01-31 Banyu Pharmaceutical Co., Ltd. Genes abca2 humain et de rat

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BOYD JONATHAN T ET AL: "Expression and distribution of a novel ABC transporter, ABC2, in drug resistant cells.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL, no. 41, March 2000 (2000-03-01), 91st Annual Meeting of the American Association for Cancer Research.;San Francisco, California, USA; April 01-05, 2000, March, 2000, pages 763 - 764, XP001153151, ISSN: 0197-016X *
DATABASE EBI 13 November 2001 (2001-11-13), GLUCKSMANN: "Amino acid sequence of a human 17114 transporter polypeptide", XP002247555, Database accession no. AAG67160 *
DATABASE EBI 27 May 1994 (1994-05-27), CHIMINI: "Mus musculus mRNA for ABC transporter (ABC2 gene)", XP002245307, Database accession no. X75927 *
DATABASE EBI 31 May 2001 (2001-05-31), LE BIHAN ET AL.: "Human ATP binding cassette 2 (ABC2) transporter protein", XP002247552, Database accession no. AAY72649 *
DATABASE EBI 6 June 2002 (2002-06-06), INAGAKI: "Human ATP binding cassette transporter protein, ABCA2", XP002247553, Database accession no. ABB76715 *
DATABASE EBI 6 June 2002 (2002-06-06), INAGAKI: "Rat ATP binding cassette transporter protein, ABCA2", XP002247554, Database accession no. ABB76716 *
KAMINSKI W E ET AL: "COMPLETE CODING SEQUENCE, PROMOTER REGION, AND GENOMIC STRUCTURE OFTHE HUMAN ABCA2 GENE AND EVIDENCE FOR STEROL-DEPENDENT REGULATION IN MACROPHAGES", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 281, no. 1, 16 February 2001 (2001-02-16), pages 249 - 258, XP000990418, ISSN: 0006-291X *
LAING NAOMI M ET AL: "Amplification of the ATP-binding cassette 2 transporter gene is functionally link with enhanced efflux of estramustine in ovarian carcinoma cells.", CANCER RESEARCH, vol. 58, no. 7, 1 April 1998 (1998-04-01), pages 1332 - 1337, XP001153154, ISSN: 0008-5472 *
LUCIANI M F ET AL: "CLONING OF TWO NOVEL ABC TRANSPORTERS MAPPING ON HUMAN CHROMOSOME 9", GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 21, no. 1, 1 May 1994 (1994-05-01), pages 150 - 159, XP000869719, ISSN: 0888-7543 *
VULEVIC B ET AL: "Characterization of ABC2 as a peroxisomal sequestration transporter.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL, vol. 40, March 1999 (1999-03-01), 90th Annual Meeting of the American Association for Cancer Research;Philadelphia, Pennsylvania, USA; April 10-14, 1999, March, 1999, pages 316, XP001153153, ISSN: 0197-016X *
VULEVIC BOJANA ET AL: "Cloning and characterization of human adenosine 5'-triphosphate-binding cassette, sub-family A, transporter 2 (ABCA2).", CANCER RESEARCH, vol. 61, no. 8, 15 April 2001 (2001-04-15), pages 3339 - 3347, XP002247551, ISSN: 0008-5472 *
VULEVIC BOJANA I ET AL: "Cloning and characterization of a novel human ABC transporter 2 (hABC2).", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL, no. 41, March 2000 (2000-03-01), 91st Annual Meeting of the American Association for Cancer Research.;San Francisco, California, USA; April 01-05, 2000, March, 2000, pages 677, XP001153152, ISSN: 0197-016X *

Also Published As

Publication number Publication date
EP1214415A1 (fr) 2002-06-19
AU1249501A (en) 2001-04-24
CA2385231A1 (fr) 2001-03-29
WO2001021798A2 (fr) 2001-03-29

Similar Documents

Publication Publication Date Title
US20030211517A1 (en) Gp354 nucleic acids and polypeptides
US20090023645A1 (en) AIB1, a novel steroid receptor co-activator
AU747846B2 (en) Human potassium channel genes
US20100273256A1 (en) Human Potassium Channel Genes
US20030149998A1 (en) Genes encoding G-protein coupled receptors and methods of use therefor
EP1214415A1 (fr) Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique
WO1999049735A1 (fr) Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur
CA2251603A1 (fr) Famille genetique associee a des deficiences neuro-sensorielles
CA2379462A1 (fr) Nouveau recepteur couple a la proteine g humaine
US7312026B2 (en) MRP-related ABC transporter encoding nucleic acids and methods of use thereof
AU2001272982B2 (en) GP286 nucleic acids and polypeptides
US20030119726A1 (en) P-glycoproteins and uses thereof
US6998255B1 (en) Human G-protein coupled receptor
JP4224395B2 (ja) ＰａｎＣＡＭ核酸およびポリペプチド
WO1999038975A2 (fr) Sequences polynucleotidiques et polypeptidiques associees a un phenomene de sensibilite aux depresseurs du systeme nerveux central
JP2004500872A (ja) Ｇｐ３５４核酸およびポリペプチド
AU749471B2 (en) MMSC1 - an MMAC1 interacting protein
WO2000029578A9 (fr) Clonage et caractérisation de deux facteurs de transcription de l'arn messager
US20040093626A1 (en) Methods
AU2001270058A1 (en) GP354 nucleic acids and polypeptides
AU2001270058A2 (en) GP354 nucleic acids and polypeptides
JP2005503104A (ja) ヒトの新規なカリウムチャンネルβサブユニット
AU2001272982A1 (en) GP286 nucleic acids and polypeptides
JP2005521424A (ja) 新規パンコルチン−パブロ蛋白相互作用およびそれらの使用方法
US20030082555A1 (en) Haplotypes of the icam2 gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020409

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20030804

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20030909