WO1999049735A1 - Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur - Google Patents

Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur Download PDF

Info

Publication number
WO1999049735A1
WO1999049735A1 PCT/US1999/006644 US9906644W WO9949735A1 WO 1999049735 A1 WO1999049735 A1 WO 1999049735A1 US 9906644 W US9906644 W US 9906644W WO 9949735 A1 WO9949735 A1 WO 9949735A1
Authority
WO
WIPO (PCT)
Prior art keywords
moat
seq
nucleic acid
sequence
protein
Prior art date
Application number
PCT/US1999/006644
Other languages
English (en)
Inventor
Gary Kruh
Kun Lee
Martin Belinsky
Lisa Bain
Original Assignee
Fox Chase Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fox Chase Cancer Center filed Critical Fox Chase Cancer Center
Priority to US09/647,140 priority Critical patent/US6803184B1/en
Priority to AU32077/99A priority patent/AU3207799A/en
Publication of WO1999049735A1 publication Critical patent/WO1999049735A1/fr
Priority to US10/889,503 priority patent/US7312026B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present invention relates to the fields of medicine and molecular biology. More specifically, the invention provides nucleic acid molecules and proteins encoded thereby which are involved in the development of resistance to pharmacological and chemotherapeutic agents in tumor cells.
  • P-glycoprotein the product of the MDR1 gene, was the first ABC transporter shown to confer resistance to cytotoxic agents.
  • Pgp functions as an ATP-dependent efflux pump that reduces the intracellular concentration of a variety of chemotherapeutic agents by transporting them across the plasma membrane (1) .
  • the multidrug resistance phenotype associated with overexpression of Pgp is of considerable clinical interest because natural product drugs are second only to alkylating agents in clinical utility, and many effective chemotherapeutic regimens contain more than one natural product agent .
  • MRP another ABC family transporter
  • MRP confers a multidrug resistance phenotype that includes many natural product drugs, but is distinct from the resistance phenotype associated with Pgp (2-6) .
  • MRP shares only limited amino acid identity with Pgp, and this is reflected in the different substrate specificities of the two transporters.
  • Pgp MRP can transport a wide range of anionic organic conjugates, including glutathione S-conjugates (7) .
  • Pgp and MRP there may be other transporters that are involved in cytotoxic drug resistance.
  • an isolated nucleic acid molecule which includes a sequence encoding a protein transporter of a size between about 1300 and 1350 amino acids in length.
  • the encoded protein referred to herein as MOAT-B, comprises a multi- domain structure including a tandem repeat of nucleotide binding folds appended C-terminal to a hydrophobic domain that contains several potential membrane spanning helices. conserveed Walker A and B ATP binding sites are present in each of the nucleotide binding folds.
  • an isolated nucleic acid molecule in a preferred embodiment, includes a cDNA encoding a human MOAT-B protein.
  • the human MOAT-B protein has an amino acid sequence the same as Sequence I.D. No. 2.
  • An exemplary MOAT-B nucleic acid molecule of the invention comprises Sequence I.D. No. 1.
  • a second isolated nucleic acid molecule which includes a sequence encoding a transporter between about 1400 and 1450 amino acids.
  • the encoded protein referred to herein as MOAT-C contains a multi -domain structure including a tandem repeat of nucleotide binding folds appended C-terminal to a hydrophobic domain that contains several potential membrane spanning helices. conserveed Walker A and B ATP binding sites are present in each of the nucleotide binding folds. While similar in structure to MOAT-B described above, MOAT-C contains distinct sequence differences.
  • an isolated nucleic acid molecule in a preferred embodiment, includes a cDNA encoding a human MOAT-C protein.
  • the human MOAT-C protein has an amino acid sequence the same as Sequence I.D. No. 4.
  • An exemplary MOAT-C nucleic acid molecule of the invention comprises Sequence I.D. No. 3.
  • an isolated nucleic acid molecule which includes a sequence encoding a protein of a size between about 1500 and 1550 amino acids in length.
  • the encoded protein referred to herein as MOAT-D, contains a multidomain structure including an N-terminal hydrophobic extension which harbors five transmembrane spanning helices.
  • an isolated nucleic acid molecule in a preferred embodiment, includes a cDNA encoding a MOAT-D protein.
  • the human MOAT-D protein has an amino acid sequence the same as Sequence I.D. No. 6.
  • An exemplary MOAT-D nucleic acid molecule of the invention comprises Sequence I.D. No. 5.
  • an isolated nucleic acid molecule which includes a sequence encoding a protein of a size between about 1480 and 1530 amino acids in length.
  • the encoded protein referred to herein as MOAT-E, contains a multidomain structure including an N-terminal hydrophobic extension 'which harbors several transmembrane spanning helices. While similar in structure to MOAT-D described above, MOAT-E contains distinct sequence differences.
  • an isolated nucleic acid molecule in a preferred embodiment, includes a cDNA encoding a MOAT-E protein.
  • the human MOAT-E protein has an amino acid sequence the same as Sequence I.D. No. 8.
  • An exemplary MOAT-E nucleic acid molecule of the invention comprises Sequence I.D. No. 7.
  • an isolated nucleic acid molecule which has a sequence selected from the group consisting of: (1) Sequence I.D. No. 1; (2) a sequence specifically hybridizing with preselected portions or all of the complementary strand of Sequence I.D. No. 1 comprising nucleic acids encoding amino acids 1-1154 of Sequence ID No. 2; (3) a sequence encoding preselected portions of Sequence I.D. No. 1 within nucleotides 1-3462, (4) Sequence I.D. No. 3; (5) a sequence specifically hybridizing with preselected portions or all of the complementary strand of Sequence I.D. No. 3 comprising nucleic acids encoding amino acids 1-442 of Sequence ID No.
  • Sequence I.D. No. 4 a sequence encoding preselected portions of Sequence I.D. No. 3 within nucleotides 1-1326, (7) Sequence I.D. No. 5; (8) a sequence specifically hybridizing with preselected portions or all of the complementary strand of Sequence I.D. No. 5 comprising nucleic acids encoding amino acids 1-1036 of Sequence ID No. 6; (9) a sequence encoding preselected portions of Sequence I.D. No. 5 within nucleotides 1-3108, (1) Sequence I.D. No. 7; (2) a sequence specifically hybridizing with preselected portions or all of the complementary strand of Sequence I.D. No. 7 comprising nucleic acids encoding amino acids 1-998 of Sequence ID No. 8; (3) a sequence encoding preselected portions of Sequence I.D. No. 7 within nucleotides 1-300.
  • nucleic acid sequences encoding natural allelic variants of the nucleic acids of Sequence I.D. Nos., 1, 3, 5 and 7 are also contemplated to be within the scope of the present invention.
  • natural allelic variants will be defined hereinbelow.
  • ком ⁇ онентs immunologically specific for the human MOAT proteins described hereinabove are provided.
  • host cells comprising at least one of the MOAT encoding nucleic acids are provided.
  • Such host cells include but are not limited to bacterial cells, fungal cells, insect cells, mammalian cells, and plant cells.
  • Host cells overexpressing one or more of the MOAT encoding nucleic acids of the invention provide valuable research tools for assessing transport of chemotherapeutic agents out of cells.
  • MOAT expressing cells also comprise a biological system useful in methods for identifying inhibitors of the MOAT transporters .
  • Another embodiment of the present invention encompasses methods for screening cells expressing MOAT encoding nucleic acids for chemotherapy resistance. Such methods will provide the clinician with data which correlates expression of a particular MOAT genes with a particular chemotherapy resistant phenotype.
  • oligonucleotide probes are provided which hybridize to the nucleic acids of the invention. Such probes may be used to advantage in screening biopsy samples for the expression of particular MOAT genes. Once a tumor sample has been characterized as to the MOAT gene(s) expressed therein, inhibitors identified in the cell line screening methods described above may be administered to prevent efflux of the beneficial chemotherapeutic agents from cancer cells.
  • kits The methods of the invention may be applied to kits.
  • An exemplary kit of the invention comprises MOAT gene specific oligonucleotide probes and/or primers, MOAT encoding DNA molecules for use as a positive control, buffers, and an instruction sheet.
  • a kit for practicing the cell line screening method includes frozen cells
  • transgenic knockout mice are disclosed. Mice will be generated in which at least one MOAT gene has been knocked out. Such mice will provide a valuable in biological system for assessing resistance to chemotherapy in an in vivo tumor model .
  • isolated nucleic acid refers to a DNA molecule that is separated from sequences with which it is immediately contiguous (in the 5' and 3' directions) in the naturally occurring genome of the organism from which it originates.
  • isolated nucleic acid may comprise a DNA or cDNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryote or eukaryote .
  • isolated nucleic acid primarily refers to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from RNA molecules with which it would be associated in its natural state (i.e., in cells or tissues), such that it exists in a “substantially pure” form (the term “substantially pure” is defined below) .
  • isolated protein or “isolated and purified protein” is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein which has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in "substantially pure” form.
  • substantially pure refers to a preparation comprising at least 50-60% by weight the compound of interest (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90-99% by weight, the compound of interest. Purity is measured by methods appropriate for the compound of interest (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like) .
  • the term "immunologically specific” refers to antibodies that bind to one or more epitopes of a protein of interest (e.g., MOAT-B, MOAT-C or MOAT-D) , but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
  • a protein of interest e.g., MOAT-B, MOAT-C or MOAT-D
  • the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”) .
  • this term is intended to signify that the double stranded nucleic acid has been subjected to denaturing conditions, as is well known to those of skill in the art.
  • the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence .
  • T m 81.5°C + l ⁇ .SLog [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex
  • the T m is 57°C.
  • the T m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology.
  • targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42 °C.
  • Such sequences would be considered substantially homologous to the nucleic acid sequences of the invention.
  • the nucleic acids, proteins, antibodies, cell lines, methods, and kits of the present invention may be used to advantage to identify targets for the development of novel agents which inhibit the aberrant transport of cytoxic agents out of tumor cells.
  • the transgenic mice of the invention may be used an in vivo model for chemotherapy resistance .
  • Figure 1 shows the predicted structure of MOAT-B and comparison with human MRP.
  • the vertical lines indicate identical amino acids and the vertical dots indicate conserved amino acids .
  • Gaps are indicated by periods .
  • the overbars indicate potential transmembrane spanning segments as predicted by the TMAP program.
  • the first and second nucleotide binding folds (NBF 1 and NBF 2) are indicated by horizontal arrows.
  • the C-terminal 34 amino acids (residues 1291 - 1325) are replaced in the second class of MOAT-B cDNA clones by the following amino acids: ILQKKLSTYWSH.
  • the Alignment was performed using the GAP program (gap weight 3.0, length weight 0.1) in the Genetics Computer Group Package.
  • H. MRP human MRP.
  • FIGS 2A and 2B depict a comparison of the nucleotide binding folds and hydropathy profile of MOAT-B with those of other eukaryotic ABC transporters.
  • Fig. 1A shows the comparison of the nucleotide binding folds of MOAT-B. Amino acids that are identical to those of MOAT-B are shaded, and gaps are indicated by periods. Walker A and B motifs, and the ABC transporter family signature sequence C, are underlined. Amino acid positions are indicated to the right. Amino acid sequences were aligned using the PILEUP program (gap weight 3.0, length weight 0.1) in the Genetics Computer Group Package.
  • Fig. IB shows a comparison of the MOAT-B hydropathy profile. To facilitate comparison, the proteins are aligned so that the N-terminal nucleotide binding folds (NBF) are roughly in register. NBF ' s are indicated by bars. Values above
  • H. MRP human multidrug-associated protein
  • H. MOAT human multispecific organic anion transporter
  • S. YCF1 Saccharomyces cerevisiae yeast cadmium factor 1
  • FIG. 3 is a Northern blot showing the tissue distribution of MOAT-B transcript.
  • Membranes containing poly (A) + RNA prepared from human tissues were hybridized with a radiolabeled MOAT-B or GAPDH probe. Top panels show MOAT-B transcript and bottom panels show the control GAPDH transcript. Arrows indicate the position of MOAT-B transcript. Prolonged exposure of the film revealed a low level signal in liver.
  • Figure 4 shows the chromosomal localization of the gene encoding MOAT-B .
  • Human metaphase spreads were hybridized with a biotin-labeled MOAT-B cDNA probe and detected by FITC-conjugated avidin.
  • Hybridization signals at chromosome 13q32 in two metaphase spreads are indicated by arrows.
  • the inset shows paired hybridization signals at band q32 of chromosome 13 from three other metaphase spreads .
  • Figures 5A and 5B show the predicted structures of MOAT-C and MOAT-D.
  • Fig. 5A presents the structure of
  • FIG. 5B shows the structure of MOAT-D.
  • Numbered overbars indicate potential transmembrane spanning helices.
  • Horizontal arrows indicate the positions of the amino terminal (NBF1) and C-terminal (NBF2) nucleotide binding folds. Walker A and B motifs, and the ABC transporter family signature sequence C are underlined. Bullets indicate the positions of potential N-linked glycosylation sites that are conserved with previously reported N-glycosylation sites in MRP.
  • the indicated MOAT-C transmembrane spanning helices were predicted using the TMAP program and an input alignment of MOAT-B and MOAT-C.
  • the indicated MOAT-D transmembrane helices are based upon inspection of an alignment with MRP.
  • Figures 6A and 6B show a comparison of the nucleotide binding folds and hydropathy profiles of MOAT-C and MOAT-D with those of other related ABC transporters.
  • Fig. 6A depicts the comparison of the nucleotide binding folds. The alignment was produced using the PILEUP command (gap weight 3.0, length weight 0.1) in the Genetics Computer Group Package Version 9.1. Amino acid positions conserved in at least 4 of the 8 proteins are shaded. Periods indicate gaps in the alignment. Walker A and B, and the ABC transporter family signature sequence C are indicated by underbars .
  • Fig. 6A shows the comparison of hydropathy profiles.
  • Figure 7 is a Northern blot showing the tissue distribution of MOAT-C and MOAT-D transcripts. Blots containing poly A+ RNA prepared from various human tissues were hybridized with MOAT-C, MOAT-D and actin probes. Arrows indicate the position of the MOAT-C (top panel) and MOAT-D (middle panel) transcripts. The bottom panel shows the control actin transcript.
  • Figures 8A and 8B show the chromosomal localization of the MOAT-C and MOAT-D genes.
  • Human metaphase spreads were hybridized with a biotin-labeled MOAT-C and MOAT-D cDNA probes and detected by FITC-conjugated avidin.
  • Fig. 8A shows the localization of MOAT-C.
  • Hybridization signals at chromosome 3q27 in two metaphase spreads are indicated by arrows (top) .
  • the inset shows paired hybridization signals at band q27 of chromosome 3 from three other metaphase spreads.
  • Fig. 8B shows the localization of MOAT-D.
  • Hybridization signals at chromosome 17q21-22 in two metaphase spreads are indicated by arrows (top) .
  • the inset shows paired hybridization signals at band q21-22 of chromosome 17 from three other metaphase spreads.
  • Figure 9 shows predicted amino acid sequence of MOAT- E. Also shown are the location of the potential transmembrane helices (overbars) , the potential N- glycosylation site (black dot) and the two nucleotide binding folds (NBF1 and NBF2) . Walker A and B motifs, as well as the signature C motif of ABC transporters, are also indicated.
  • Figure 10 shows a comparison of the hydropathy profile of MOAT-E with other members of the MRP-cMOAT subfamily. The profile reveals that MOAT-E has a hydrophobic N-terminal segment which is absent in MOAT-B and MOAT-C.
  • Figure 11 is a RNA blot which reveals that MOAT-E is expressed only in the liver and the kidney, suggesting that MOAT-E may participate in the excretion of substances into urine and bile.
  • the lower panel shows hybridization of an actin probe to assess RNA loading.
  • Figures 12A-12J show the cDNA (SEQ ID NO : 1) and amino acid sequences (SEQ ID NO: 2) encoded by MOATB .
  • Figures 13A-13K show the cDNA (SEQ ID NO: 3) and amino acid sequences (SEQ ID NO: 4) encoded by MOATC .
  • Figures 14A-14K show the cDNA (SEQ ID NO: 5) and amino acid sequences (SEQ ID NO : 6) encoded by MOATD.
  • Figures 15A-15K show the cDNA (SEQ ID NO: 7) and amino acid sequences (SEQ ID NO: 8) encoded by MOATE.
  • MRP and cMOAT are closely related mammalian ABC transporters that export organic anions from cells. Transfection studies have established that MRP confers resistance to natural product cytotoxic agents, and recent evidence suggests the possibility that cMOAT may contribute to cytotoxic drug resistance as well. Based upon the potential importance of these transporters in
  • MOAT-B novel ABC transporter designated herein as MOAT-B.
  • the MOAT-B gene was mapped using fluorescence in si tu hybridization to chromosome band 13q32. Comparison of the MOAT-B predicted protein with other transporters revealed that it is most closely related to MRP, cMOAT, and the yeast organic anion transporter YCF1.
  • MOAT-B is closely related to these transporters, it is distinguished by the absence of approximately 200 amino acid N-terminal hydrophobic extension that is present in MRP and cMOAT, and which is predicted to encode several transmembrane spanning segments.
  • MOAT-B tissue distribution is distinct from MRP and cMOAT.
  • MRP which is widely expressed in most tissues, including liver
  • cMOAT whose expression is largely restricted to liver
  • the MOAT-B transcript is widely expressed, with particularly high levels in prostate, but is barely detectable in liver.
  • MOAT-C encodes a 1437 amino acid protein that is most closely related to MRP, cMOAT and MOAT-B, among eukaryotic transporters (33% - 37% identity) .
  • MOAT-C is considerably less related to MRP and cMOAT than the latter transporters are to each
  • MOAT-C topology is distinct from that of MRP and cMOAT in that it, like MOAT-B, lacks an N-terminal transmembrane spanning domain.
  • MOAT-D encodes a 1530 amino acid transporter that is highly related to MRP (57% identity) and cMOAT (47% identity) .
  • MOAT-E encodes 1503 amino acid transporter that is highly related to MOAT-D, MRP and cMOAT (39-45% identity) .
  • the topology of MOAT-D and MOAT-E are quite similar to MRP and cMOAT, in that they have an N-terminal hydrophobic extension that is predicted to harbor five transmembrane spanning helices.
  • MOAT-C and MOAT-D were mapped to chromosome bands 3q27 and 17q21-22, respectively, by fluorescence in si tu hybridization.
  • MOAT-C The expression patterns of MOAT-C, MOAT-D and MOAT-E are distinct from those of MRP, cMOAT and MOAT-B.
  • MOAT-C transcript is widely expressed, with highest levels in skeletal muscle, kidney and testis, but is expressed at barely detectable levels in liver and lung.
  • MOAT-D transcript has a more restricted expression pattern, with high levels in colon, pancreas, liver and kidney. Data presented herein reveal that MOAT-E expression is restricted to liver and kidney.
  • the MRP-related transporters fall into two groups, with the first group consisting of MRP, cMOAT, MOAT-D and MOAT-E, and the second group consisting of MOAT-B and MOAT-C.
  • the isolation of MOAT-C, MOAT-D and MOAT-E thus helps to define the MRP/cMOAT subfamily.
  • the high degree of amino acid identity and topological similarity of MOAT-D and MOAT-E to MRP and cMOAT suggest that they function as organic anion transporters, and play a role in cytotoxic drug resistance. In contrast, the lower degree of amino acid identify and distinct topology
  • MOAT-B and MOAT-C suggest the possibility that their substrate specificities and functions may be distinct from that of MRP, cMOAT, MOAT-D and MOAT-E.
  • compositions, methods, kits and transgenic mice of the invention disclosed herein will facilitate the identification of drugs that cripple the ability of MOAT genes and proteins encoded thereby to effect the efflux of clinically beneficial pharmacological agents in malignant cells .
  • Nucleic acid molecules encoding the MOAT proteins of the invention may be prepared by two general methods: (1) synthesis from appropriate nucleotide triphosphates, or (2) isolation from biological sources. Both methods utilize protocols well known in the art.
  • the availability of nucleotide sequence information, such as cDNAs having Sequence I.D. Nos. 1, 3, 5, or 7 enables preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis.
  • Synthetic oligonucleotides may be prepared by the phosphoramidite method employed in the Applied Biosystems 38A DNA Synthesizer or similar devices.
  • the resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC) .
  • HPLC high performance liquid chromatography
  • a DNA molecule of the present invention must be synthesized in stages, due to the size limitations inherent in current oligonucleotide synthetic methods.
  • a 5 kb double-stranded molecule may be synthesized as several smaller segments of appropriate complementarity. Complementary segments thus
  • each segment may be annealed such that each segment possesses appropriate cohesive termini for attachment of an adjacent segment.
  • Adjacent segments may be ligated by annealing cohesive termini in the presence of DNA ligase to construct an entire 5 kb double-stranded molecule.
  • a synthetic DNA molecule so constructed may then be cloned and amplified in an appropriate vector.
  • Nucleic acid sequences encoding the MOAT proteins of the invention may be isolated from appropriate biological sources using methods known in the art.
  • a cDNA clone is isolated from a cDNA expression library of human origin.
  • human genomic clones encoding MOAT proteins may be isolated.
  • cDNA or genomic clones having homology with MOAT-B, MOAT-C, MOAT-D or MOAT-E may be isolated from other species using oligonucleotide probes corresponding to predetermined sequences within the MOAT encoding nucleic acids.
  • nucleic acids having the appropriate level of sequence homology with the protein coding region of Sequence I.D. Nos. 1, 3, 5, and 7 may be identified by using hybridization and washing conditions of appropriate stringency.
  • hybridizations may be performed, according to the method of Sambrook et al . , (supra) using a hybridization solution comprising: 5X SSC, 5X Denhardt ' s reagent, 1.0% SDS, 100 ⁇ g/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide.
  • Hybridization is carried out at 37-42°C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and
  • Nucleic acids of the present invention may be maintained as DNA in any convenient cloning vector.
  • clones are maintained in a plasmid cloning/expression vector, such as pBluescript (Stratagene, La Jolla, CA) , which is propagated in a suitable E. coli host cell.
  • pBluescript Stratagene, La Jolla, CA
  • MOAT-encoding nucleic acid molecules of the invention include cDNA, genomic DNA, RNA, and fragments thereof which may be single- or double-stranded.
  • this invention provides oligonucleotides (sense or antisense strands of DNA or RNA) having sequences capable of hybridizing with at least one sequence of a nucleic acid molecule of the present invention, such as selected segments of the cDNA having Sequence I.D. No. 1.
  • Such oligonucleotides are useful as probes for detecting or isolating MOAT genes.
  • Antisense nucleic acid molecules may be targeted to translation initiation sites and/or splice sites to inhibit the translation of the MOAT-encoding nucleic acids of the invention.
  • Such antisense molecules are typically between 15 and 30 nucleotides and length and often span the translational start site of MOAT encoding mRNA molecules .
  • the term "natural allelic variants" is used herein to refer to various specific nucleotide sequences and variants thereof that would occur in a human population.
  • the usage of different wobble codons and genetic polymorphisms which give rise to conservative or neutral amino acid substitutions in the encoded protein are examples of such variants.
  • the term “substantially complementary” refers to oligo sequences that may not be perfectly matched to a target sequence, but the mismatches do not materially affect the ability of the oligo to hybridize with its target sequence under the conditions described.
  • Full-length MOAT-B, MOAT-C, MOAT-D and MOAT-E proteins of the present invention may be prepared in a variety of ways, according to known methods.
  • the proteins may be purified from appropriate sources, e.g., transformed bacterial or animal cultured cells or tissues, by immunoaffinity purification. However, this is not a preferred method due to the low amount of protein likely to be present in a given cell type at any time.
  • the availability of nucleic acid molecules encoding MOAT proteins enables production of the proteins using in vi tro expression methods known in the art.
  • a cDNA or gene may be cloned into an appropriate in vi tro transcription vector, such as pSP64 or pSP65 for in vi tro transcription, followed by cell-free translation in a suitable cell-free translation system, such as wheat germ or rabbit reticulocytes .
  • vi tro transcription and translation systems are commercially available, e.g., from Promega Biotech, Madison, Wisconsin or Gibco-BRL,
  • larger quantities of MOAT proteins may be produced by expression in a suitable prokaryotic or eukaryotic system.
  • a DNA molecule such as a cDNA having Sequence I.D. No. 1, 3, 5 or 7 may be inserted into a plasmid vector adapted for expression in a bacterial cell, such as E. coli .
  • Such vectors comprise the regulatory elements necessary for expression of the DNA in the host cell positioned in such a manner as to permit expression of the DNA in the host cell.
  • regulatory elements required for expression include promoter sequences, transcription initiation sequences and, optionally, enhancer sequences.
  • the human MOAT proteins produced by gene expression in a recombinant procaryotic or eukaryotic system may be purified according to methods known in the art.
  • a commercially available expression/secretion system can be used, whereby the recombinant protein is expressed and thereafter secreted from the host cell, to be easily purified from the surrounding medium.
  • an alternative approach involves purifying the recombinant protein by affinity separation, such as by immunological interaction with antibodies that bind specifically to the recombinant protein or nickel columns for isolation of recombinant proteins tagged with 6-8 histidine residues at their N-terminus or C-terminus.
  • Alternative tags may comprise the FLAG epitope or the hemagglutinin epitope. Such methods are commonly used by skilled practitioners.
  • the human MOAT proteins of the invention prepared by the aforementioned methods, may be analyzed according to
  • such proteins may be subjected to amino acid sequence analysis, according to known methods .
  • the present invention also provides antibodies capable of immunospecifically binding to proteins of the invention.
  • Polyclonal antibodies directed toward human MOAT proteins may be prepared according to standard methods.
  • monoclonal antibodies are prepared, which react immunospecifically with the various epitopes of the MOAT proteins described herein.
  • Monoclonal antibodies may be prepared according to general methods of K ⁇ hler and Milstein, following standard protocols.
  • Polyclonal or monoclonal antibodies that immunospecifically interact with MOAT proteins can be utilized for identifying and purifying such proteins. For example, antibodies may be utilized for affinity separation of proteins with which they immunospecifically interact.
  • Antibodies may also be used to immunoprecipitate proteins from a sample containing a mixture of proteins and other biological molecules. Other uses of anti-MOAT antibodies are described below.
  • MOAT proteins of the invention play a pivotal role in the transport of molecules across the cell membrane.
  • MOAT nucleic acids, proteins and antibodies thereto may be used as research tools to identify other proteins that are
  • MOAT-encoding nucleic acids may be used for a variety of purposes in accordance with the present invention.
  • MOAT-encoding DNA, RNA, or fragments thereof may be used as probes to detect the presence of and/or expression of genes encoding MOAT proteins.
  • Methods in which MOAT-encoding nucleic acids may be utilized as probes for such assays include, but are not limited to: (1) in si tu hybridization; (2) Southern hybridization (3) northern hybridization; and (4) assorted amplification reactions such as polymerase chain reactions (PCR) .
  • MOAT-encoding nucleic acids of the invention may also be utilized as probes to identify related genes from other animal species.
  • hybridization stringencies may be adjusted to allow hybridization of nucleic acid probes with complementary sequences of varying degrees of homology.
  • MOAT-encoding nucleic acids may be used to advantage to identify and characterize other genes of varying degrees of relation to the MOAT genes of the invention. Such information enables further characterization of transporter molecules which give rise to the chemoresistant phenotype of certain tumors. Additionally, they may be used to identify genes encoding proteins that interact with MOAT proteins (e.g., by the "interaction trap" technique) , which should further accelerate
  • MOAT encoding nucleic acids may also be used to generate primer sets suitable for PCR amplification of target MOAT DNA. Criteria for selecting suitable primers are well known to those of ordinary skill in the art.
  • Nucleic acid molecules, or fragments thereof, encoding MOAT genes may also be utilized to control the production of MOAT proteins, thereby regulating • the amount of protein available to participate in cytotoxic drug efflux.
  • antisense oligonucleotides corresponding to essential processing sites in MOAT-encoding mRNA molecules may be utilized to inhibit MOAT protein production in targeted cells. Alterations in the physiological amount of MOAT proteins may dramatically affect the ability of these proteins to transport pharmacological reagents out of the cell .
  • Host cells comprising at least one MOAT encoding DNA molecule are encompassed in the present invention.
  • Host cells contemplated for use in the present invention include but are not limited to bacterial cells, fungal cells, insect cells, mammalian cells, and plant cells.
  • the MOAT encoding DNA molecules may introduced singly into such host cells or in combination to assess the phenotype of cells conferred by such expression. Methods for introducing DNA molecules are also well known to those of ordinary skill in the art. Such methods are set forth in Ausubel et al . eds . , Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY 1995, the disclosure of which is incorporated by reference herein.
  • MOAT encoding nucleic acids enable the production of strains of laboratory mice carrying part or all of the MOAT genes or mutated
  • mice may provide an in vivo model for development of novel chemotherapeutic agents.
  • the MOAT nucleic acid sequence information provided herein enables the production of knockout mice in which the endogenous genes encoding MOAT-B, MOAT-C, MOAT-D or MOAT-E have been specifically inactivated.
  • Methods of introducing transgenes in laboratory mice are known to those of skill in the art. Three common methods include: 1. integration of retroviral vectors encoding the foreign gene of interest into an early embryo; 2. injection of DNA into the pronucleus of a newly fertilized egg; and 3. the incorporation of genetically manipulated embryonic stem cells into an early embryo.
  • the alterations to the MOAT gene envisioned herein include modifications, deletions, and substitutions. Modifications and deletions render the naturally occurring gene nonfunctional, producing a "knock out" animal. Substitutions of the naturally occurring gene for a gene from a second species results in an animal which produces an MOAT gene from the second species. Substitution of the naturally occurring gene for a gene having a mutation results in an animal with a mutated MOAT protein.
  • a transgenic mouse carrying the human MOAT gene is generated by direct replacement of the mouse MOAT gene with the human gene. These transgenic animals are valuable for use in vivo assays for elucidation of other medical disorders associated with cellular activities modulated by MOAT genes.
  • a transgenic animal carrying a "knock out" of a MOAT encoding nucleic acid is useful for the establishment of a nonhuman model for chemotherapy resistance involving MOAT regulation.
  • mice can be generated that cannot make
  • transgenic animal is any animal containing one or more cells bearing genetic information altered or received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by targeted recombination or microinjection or infection with recombinant virus.
  • transgenic animal is not meant to encompass classical cross-breeding or in vitro fertilization, but rather is meant to encompass animals in which one or more cells are altered by or receive a recombinant DNA molecule.
  • This molecule may be specifically targeted to defined genetic locus, be randomly integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • the term "germ cell line transgenic animal” refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability to transfer the genetic information to offspring. If such offspring in fact, possess some or all of that alteration or genetic information, then they, too, are transgenic animals.
  • the alteration or genetic information may be foreign to the species of animal to which the recipient belongs, or foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene.
  • the altered MOAT gene generally should not fully encode the same MOAT protein native to the host animal and
  • the DNA used for altering a target gene may be obtained by a wide variety of techniques that include, but are not limited to, isolation from genomic sources, preparation of cDNAs from isolated mRNA templates, direct synthesis, or a combination thereof.
  • ES embryonal stem cell
  • ES cells may be obtained from pre-implantation embryos cultured in vitro.
  • Transgenes can be efficiently introduced into the ES cells by standard techniques such as DNA transfection or by retrovirus-mediated transduction.
  • the resultant transformed ES cells can thereafter be combined with blastocysts from a non-human animal .
  • the introduced ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • One approach to the problem of determining the contributions of individual genes and their expression products is to use isolated MOAT genes to selectively inactivate the wild-type gene in totipotent ES cells (such as those described above) and then generate transgenic mice.
  • the use of gene-targeted ES cells in the generation of gene-targeted transgenic mice is known in the art.
  • PCR polymerase chain reaction
  • a positive genetic selection approach has been developed in which a marker gene is constructed which will only be active if homologous insertion occurs, allowing these recombinants to be selected directly.
  • One of the most powerful approaches developed for selecting homologous recombinants is the positive-negative selection
  • PNS Herpes Simplex virus thymidine kinase
  • HSV-TK herpes drugs
  • a “targeted gene” or “knock-out” is a DNA sequence introduced into the germline or a non-human animal by way of human intervention, including but not
  • the targeted genes of the invention include DNA sequences which are designed to specifically alter cognate endogenous alleles.
  • Knockout mice of the invention can be injected with tumor cells or treated with carcinogens to generate carcinomas .
  • Such mice provide a biological system for assessing chemotherapy resistance as modulated by a MOAT gene of the invention. Accordingly, therapeutic agents which inhibit the action of these transporters and thereby prevent efflux of beneficial chemotherapeutic agents from tumor cells may be screened in studies using MOAT knock out mice.
  • MOAT-encoding nucleic acids are also used to advantage to produce large quantities of substantially pure MOAT proteins, or selected portions thereof .
  • Purified full length MOAT proteins, or fragments thereof, may be used to produce polyclonal or monoclonal antibodies which also may serve as sensitive detection reagents for the presence and accumulation of MOAT proteins (or complexes containing MOAT proteins) in mammalian cells. Recombinant techniques enable expression of fusion proteins containing part or all of MOAT proteins.
  • the full length proteins or fragments of the proteins may be used to advantage to generate an array of monoclonal antibodies specific for various epitopes of MOAT proteins, thereby providing even greater sensitivity for detection of MOAT proteins in cells.
  • assays designed to detect and quantitate the proteins.
  • assays include, but are not limited to: (1) flow cytometric analysis; (2) immunochemical localization of MOAT proteins in tumor cells; and (3) immunoblot analysis (e.g., dot blot, Western blot) of extracts from various cells.
  • immunoblot analysis e.g., dot blot, Western blot
  • anti -MOAT antibodies can be used for purification of MOAT proteins and any associated subunits (e.g., affinity column purification, immunoprecipitation) .
  • MOAT-encoding nucleic acids, MOAT expressing vectors, MOAT proteins and anti-MOAT antibodies of the invention can be used to detect MOAT gene expression and alter MOAT protein accumulation for purposes of assessing the genetic and protein interactions involved in the development of drug resistance in tumor cells.
  • MOAT-encoding nucleic acids, MOAT-expressing vectors, MOAT proteins and anti-MOAT antibodies of the invention can be used to detect MOAT gene expression and alter MOAT protein accumulation for purposes of assessing the genetic and protein interactions giving rise to chemotherapy resistance in tumor cells.
  • Exemplary approaches for detecting MOAT nucleic acid or polypeptides/proteins include: a) comparing the sequence of nucleic acid in the sample with the MOAT nucleic acid sequence to determine whether the sample from the patient contains mutations; or b) determining the presence, in a sample from a patient, of the polypeptide encoded by the MOAT gene and,
  • a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
  • specific binding pairs are antigens and antibodies, ligands and receptors and complementary nucleotide sequences. The skilled person is aware of many other examples and they do not need to be listed here. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a large molecule. In embodiments in which the specific binding member and the binding partner comprise a part of a large molecule.
  • 32 binding pair are nucleic acid sequences, they will be of a length to hybridize to each other under conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.
  • the MOAT nucleic acid in biological sample will initially be amplified, e.g. using PCR, to increase the amount of the analyte as compared to other sequences present in the sample. This allows the target sequences to be detected with a high degree of sensitivity if they are present in the sample. This initial step may be avoided by using highly sensitive array techniques that are becoming increasingly important in the art .
  • the identification of the MOAT gene and its association with a particular chemotherapy resistance paves the way for aspects of the present invention to provide the use of materials and methods, such as are disclosed and discussed above, for establishing the presence or absence in a test sample of a variant form of the gene, in particular an allele or variant specifically associated with chemotherapy resistance. This may be done to assess the propensity of the tumor to exhibit chemotherapy resistance.
  • the present invention concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological components.
  • the encoded proteins or peptides of the present invention may be employed to detect antibodies having reactivity therewith, or, alternatively, antibodies prepared in accordance with the present invention, may be employed to detect the encoded proteins or peptides.
  • the steps of various useful immunodetection methods have been
  • the immunobinding methods include obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes .
  • the immunobinding methods include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process.
  • a sample suspected of containing a MOAT gene encoded protein, peptide or a corresponding antibody and contact the sample with an antibody or encoded protein or peptide, as the case may be, and then detect or quantify the amount of immune complexes formed under the specific conditions.
  • the biological sample analyzed may be any sample that is suspected of containing the MOAT antigen, such as a tumor tissue section or specimen, a homogenized tissue extract, an isolated cell, a cell membrane preparation, separated or purified forms of any of the above protein-containing compositions.
  • kits for use in detecting expression of MOAT encoding nucleic acids in biological samples including biopsy samples.
  • a kit may comprise one or more pairs of primers for amplifying nucleic acids corresponding to the MOAT gene.
  • the kit may further comprise samples of total mRNA derived from tissues expressing at least one or a subset of the MOAT genes of the invention, to be used as controls.
  • the kit may also comprise buffers, nucleotide bases, and other compositions to be used in hybridization and/or amplification reactions. Each solution or composition may be contained in a vial or bottle and all vials held in close confinement in a box for commercial sale.
  • the invention encompasses a kit for use in detecting MOAT proteins in chemotherapy
  • 35 resistant cancer cells comprising antibodies specific for MOAT proteins encoded by the MOAT nucleic acids of the present invention.
  • Another aspect of the present invention comprises screening methods employing host cells expressing one or more MOAT genes of the invention.
  • An advantage of having discovered the complete coding sequenced of MOAT B-E is that cell lines that overexpress MOATB C D or E can be generated using standard transfection protocols. Cells that overexpress the complete cDNA will also harbor the complete proteins, a feature that is essential for biological activity of proteins.
  • the overexpressing cell lines will be useful in several ways: l)The drug sensitivity of overexpressing cell lines can be tested with a variety of known anticancer agents in order to determine the spectrum of anticancer agents for which the transporter confers resistance; 2) The drug sensitivity of overexpressing cell lines can be used to determine whether newly discovered anticancer agents are transported out of the cell by one of the discovered transporters; 3) Overexpressing cell lines can be used to identify potential inhibitors that reduce the activity of the transporters. Such inhibitors are of great clinical interest in that they may enhance the activity of known anticancer agents, thereby increasing their effectiveness. Reduced activity will be detected by restoration of anticancer drug sensitivity, or by reduction of transporter mediated cellular efflux of anticancer agents. In vitro biochemical studies designed to identify reduced transporter activity in the presence of potential inhibitors can also be performed using membranes prepared from overexpessing cell lines; and 4) Overexpressing cell lines can also be used to
  • Bacteriophage DNA isolated from a C200 cDNA library prepared in the ⁇ pCEV27 phagemid vector (17) was used as template in PCR reactions containing 250 ng cDNA, 5 ⁇ M primers, 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 3 mM MgCl 2 , .05% gelatin, 0.2 mM dNTP and Taq polymerase (Perkin Elmer Cetus) . Five cycles of PCR were performed as follows: 94°C for 1 inute, 40°C for 2 minutes, 72°C for 3 minutes. Twenty five cycles were then performed as follows: 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute.
  • reaction products were used as template in a second round of PCR, as described above, with nested forward ⁇ CGGGATCC AG(A/G) GA(A/G) AA(C/T) AT(A/C/T) CT (A/G/C/T) TTT GG(A/G/C/T) ⁇ (SEQ ID NO:17) and reverse ⁇ CGGAATTC (A/G/T/OTC (A/G)TC (A/C/TJAG (A/G/C/T)AG (A/G)TA (A/T/G)AT (A/G)TC ⁇ (SEQ ID NO:18) degenerate oligonucleotide primers.
  • PCR reaction products were isolated from an agarose gel and subcloned into the BamHI and EcoRI sites of pBluescript (Stratagene) . Nucleotide sequence analysis
  • Blots containing polyA * RNA isolated from human tissues were prehybridized at 45°C for 8 hours in 50% formamide, 4X SSC, 4X Denhardt ' s solution, 0.04 M sodium phosphate monobasic, pH 6.5 , 0.8% (w/v) glycine, 0.1 mg/ml sheared denatured salmon sperm DNA.
  • Hybridization was performed at 45°C with 32 P-labeled MOAT-B or GAPDH probes in a solution containing 50% formamide, 3X SSC, 0.04 M sodium phosphate pH 6.5, 10% dextran sulfate, 0.1 mg/ml sheared denatured salmon sperm DNA.
  • Blots were washed 2 times for 15 min at 65°C in 2X SSC, 5 mM Tris-HCl pH7.4, 0.5% SDS, 2.5 mM EDTA, 0.1% sodium pyrophosphate pH 8.0, and subsequently washed 2 times for 15 min in 0. IX SSC. Blots were then subjected to autoradiography.
  • MOAT-C and MOAT-D cDNA clones were isolated by plaque hybridization from bacteriophage cDNA libraries using the I.M.A.G.E. clones as the initial probes (ATCC) .
  • Blots containing polyA* RNA isolated from human tissues were purchased from Clontech, and hybridized with radiolabeled MOAT-C, MOAT-D or actin probes according to the manufacturer's directions.
  • the chromosome preparations were counterstained with DAPI and observed with a Zeiss Axiophot epifluorescence microscope equipped with a cooled charge coupled device camera (Photometries, Arlington AZ) operated by a Macintosh computer work station. Digitized images of DAPI staining and fluorescein signals were captured, pseudo-colored and merged using Oncor Image version 1.6 software.
  • PCR approach was used to isolate MRP-related transporters.
  • Degenerate oligonucleotide primers were prepared based upon the N-terminal nucleotide binding folds of MRP and other eukaryotic transporters, and used in conjunction with DNA prepared from an ovarian cancer cell line bacteriophage library. Nucleotide sequence analysis of one of the resulting PCR products indicated that it encoded a segment of a novel nucleotide binding fold that was most closely related to MRP and cMOAT. Overlapping cDNA clones were isolated from ovarian and breast bacteriophage libraries by plaque hybridization using the PCR product as the initial probe. A total of
  • the first class contained an open reading frame of 3975 bp that was bordered by in frame stop codons located at positions -76 and -42 (relative to the putative initiation codon) and 3976, and encoding a predicted protein of 1325 amino acids, which is designated MOAT-B.
  • the open reading frame was followed by approximately 2 kB of 3' untranslated sequences. The most upstream ATG in the open reading frame was located in the sequence context " CAAGATGC +4 .
  • the A at position -3 of the putative translation initiation codon was in agreement with the major feature of the Kozak consensus sequence, but the C at position +4 was divergent from the more usual G.
  • the second class of cDNA clones was identical to the first with the exception of a single nucleotide. These clones harbored an additional T following nucleotide 3872 of the first class of clones, close to the C-terminus of the predicted protein. This additional nucleotide resulted in a frame shift such that the predicted protein of the second class of cDNA clones was 22 residues shorter than that of the first class of cDNA clones, and in which the C-terminal 34 residues of the latter reading frame were replaced by 12 distinct residues. See brief description of Figure 1.
  • the indicated domains are, TM1 : segment containing the transmembrane spanning domain N-terminal to NBFl ; NBFl and NBF2 : nucleotide binding folds 1 and 2 ; Linker region : segment located between NBFl and TM2 ; TM2 : segment containing the transmembrane spanning domain located between the two NBFs ; C-terminus : segment between NBF2 and the C-terminus of the proteins . Sequence alignments were generated using the PILEUP program of the GCC package . Percent amino acid identity with MOAT-B domains are shown .
  • Typical features of eukaryotic ABC transporters were present in the predicted MOAT-B protein . See Figure 1 . Overall the protein was composed of a tandem repeat of a nucleotide binding fold appended C-terminal to a hydrophobic domain that contained several potential transmembrane spanning helices . conserveed Walker A and B ATP binding sites were present in each of the nucleotide binding folds . See Figure 2A. In addition, a conserved C motif , the signature sequence of ABC transporters , was present in each nucleotide binding fold .
  • the degree of similarity of the nucleotide binding folds is considered to be the best indicator of functional conservation.
  • Comparison of the nucleotide binding folds of MOAT-B with other eukaryotic ABC transporters indicated that it was most closely related to MRP, the yeast cadmium resistance protein (YCF1) and cMOAT (Table I) , three transporters that have organic anions as substrates.
  • the MOAT-B NBFl was 55.6, 56.0 and 53.3 percent identical, and the MOAT-B NBF2 was 61.6, 57.2 and 55.3 percent identical to the first and second nucleotide binding folds of human MRP, YCF1 and human cMOAT, respectively.
  • MOAT-B nucleotide binding folds were most closely related to those of CFTR and SUR.
  • the MOAT-B nucleotide binding folds shared significantly less similarity with those of MDR1. Alignment of the MOAT-B nucleotide binding folds with those of other eukaryotic
  • FIG. 43 transporters is shown in Figure 2A. Analysis of the overall amino acid identity of MOAT-B with other ABC transporters also indicated that it was most closely related to MRP, YCFl and cMOAT (Table I) . Overall MOAT-B was 39.2, 38.9 and 38 percent identical to these transporters, respectively. Figure 2B shows a comparison of the hydropathy profiles of MOAT-B with those of other eukaryotic transporters.
  • MOAT-B 1325 amino acids
  • MRP 1531 residues
  • cMOAT 1545 residues
  • YCFl 1515 residues
  • This size difference is largely accounted for by the absence in MOAT-B of an amino terminal hydrophobic extension that is present in MRP, cMOAT and YCFl (22) .
  • This N-terminal hydrophobic segment is predicted to harbor several transmembrane spanning segments, and is also present in SUR. Expression Pattern of MOAT-B in Human Tissues.
  • MOAT-B its expression pattern in a variety of human tissues was examined by RNA blot analysis. As shown in Figure 3, a MOAT-B transcript of approximately 6 kB was readily detected. The isolation of 5.9 kB of MOAT-B cDNA was consistent with this size. MOAT-B expression was detected in each of the 16 tissues analyzed. Transcript levels were highest in prostate and lowest in liver and peripheral blood leukocytes, for which prolonged exposure of film were required to detect expression. Intermediate levels of expression were observed in other tissues. Chromosomal Localization of the MOAT-B Gene.
  • MOAT-B chromosomal localization was determined by fluorescence in si tu hybridization. As shown in Figure 4, hybridization of the MOAT-B probe to metaphase spreads revealed specific labeling at human chromosome band 13q32.
  • the A at position -3 of the putative translation initiation codon was in agreement with the major feature of the Kozak consensus sequence, but the A at position +4 was divergent from the more usual G (37) .
  • the second sequence identified in our data base search (I.M.A.G.E. consortium clone 208097) was 1.2 kb in length, of which 588 bp encoded an MRP-related peptide. A segment of this clone was used as a probe to screen liver and monocyte bacteriophage cDNA libraries, and 5' cDNA segments of the isolated cDNA clones were used in a subsequent round of screening. Together approximately 5.2 kb of cDNA sequence were isolated.
  • Nucleotide sequence analysis revealed an open reading frame of 4570 bp, which is designated MOAT-D herein.
  • the open reading frame was followed by approximately 0.6 kb of 3' untranslated sequences in which a polyadenylation sequence (AAUAAA) was located 12 bp upstream of the poly (A) tail.
  • An upstream in frame stop codon was not present in the MOAT-D cDNA clones, and attempts to obtain additional upstream sequences by RACE using as template cDNA prepared from sources in which MOAT-D is abundant were not successful.
  • MOAT-D In contrast to MOAT-C, hydrophobicity analysis of MOAT-D indicated that it has three membrane spanning domains. Similar to MRP, cMOAT and the yeast cadmium resistance factor 1 (YCFl) , MOAT-D has an additional N-terminal hydrophobic domain that is not present in MOAT-B or MOAT-C (Figs. 5 and 6).
  • MRP yeast cadmium resistance factor 1
  • MOAT-D has an additional N-terminal hydrophobic domain that is not present in MOAT-B or MOAT-C (Figs. 5 and 6).
  • a 5+6+6 configuration of transmembrane spanning helices has been proposed for MRP (38 ) , in which the N-terminal extension harbors 5 transmembrane spanning helices, and 6 transmembrane helices are present in the second and third membrane spanning domain.
  • MOAT-D The alignment of MOAT-D with MRP indicated that an N-terminal (Asn-21) and a distal N-glycosylation sites (Asn-1008/1009) were conserved in analogous positions in MOAT-D. Only the distal N-glycosylation site of MRP is conserved in MOAT-C (Asn890) (Fig. 5) and MOAT-B 4 (Asn746/754) .
  • nucleotide binding folds is considered to be the best indicator of functional conservation. Comparison of the nucleotide binding folds of MOAT-C and MOAT-D with other eukaryotic ABC transporters indicated that they were most closely related to those of human MRP, human cMOAT and yeast YCFl, three transporters that have organic anions as substrates. As shown in Table 2, among the human transporters, the MOAT-C NBFl was about equally related to MOAT-D, MRP and cMOAT (55-61% identity) , and less similar to MOAT-B (49% identity) .
  • MOAT-C NBF2 shared about equal amino acid identity with the five other transporters in this group (59-61% identity) . Overall, the MOAT-C protein was about equally related to the other five transporters in this group, with 33.1-36.5% identity. Aside from these
  • MOAT-C is most closely related to CFTR, with which its NBFs shared 44%/42 % identity, and SUR, with which its NBFs shared 49%/51% identity.
  • MOAT-D NBFs were clearly most closely related to those of MRP and cMOAT, with which they shared considerable amino acid identity (67.3-73.8%). See Table III. Of the latter two transporters, the MOAT-D NBFs were slightly more related to those of MRP. In contrast, the MOAT-D NBFs shared only 55.3-58.9% identity with those of MOAT-C and MOAT-B. Overall, MOAT-D was again most closely related to MRP (57.3%) and cMOAT (46.9%), but significantly more related to MRP. Consistent with the analysis of NBFs, MOAT-D was much less related to MOAT-C and MOAT-B, with which it shared only 33.1% and 35.3% identity, respectively. Alignment of the MOAT-C and MOAT-D nucleotide binding folds with those of other eukaryotic transporters is shown in Fig. 6.
  • MOAT-C and MOAT-D their expression patterns in a variety of human tissues was examined by RNA blot analysis.
  • MOAT-C transcript of approximately 6.6 kB was readily detected in several tissues. MOAT-C transcript levels were highest in skeletal muscle, with intermediate levels in kidney, testes, heart and brain. Low levels were detected in most other tissues, including spleen, thymus, prostate, ovary, and placenta. Prolonged exposures were required for detection in lung and liver. MOAT-D was expressed as an approximately 6 kb transcript (middle panels) . Compared to MOAT-C, the MOAT-D expression pattern was more restricted. MOAT-D was highly expressed in colon and pancreas, with lower levels in liver and kidney. Low levels were detected in small intestine, placenta and prostate. Prolonged exposures were required to detect MOAT- D in testes, thymus, spleen and lung.
  • the MOAT-C and MOAT-D chromosomal localizations were determined by fluorescence in si tu hybridization. As shown in Figure 8, hybridization of the MOAT-C probe to metaphase spreads revealed specific labeling at human chromosome band 3q27. Fluorescent signals were detected on chromosome 3q in each of 22 metaphase spreads scored. Of 75 signals observed, 43 (57%) were on 3q. Paired (on sister chromatids) signals were only seen at band 3q27. Hybridization of the MOAT-D probe revealed specific labeling at human chromosome band 17q21.3. Fluorescent signals were detected on chromosome 17 in each of 21 metaphase spreads scored. Of 83 signals observed, 34 (41%) were on 17q21.3. Paired (on sister chromatids) signals were only seen at band 17q21.3.
  • ara a reported cDNA sequence that encodes a 453 amino acid transporter, revealed that it is a non-physiological sequence representing a combination of 5' MRP sequences fused to an MRP/cMOAT-related transporter.
  • the MRP sequences extend to codon 8 of the reported predicted protein.
  • the MOAT-E cDNA was isolated in three segments. The first segment, spanning residues 1-616, was isolated by PCR using 5' primer ATGGCCGCGCCTGCTGAGC ; (SEQ ID NO: 10) and 3' primer GTCTACGACACCAGGGTCAA (SEQ ID NO: 11) . The second segment, spanning residues 1815-3187, was isolated by PCR using 5' CTGCCTGGAAGAAGTTGACC (SEQ ID NO: 12) and 3' primer CTGGAATGTCCACGTCAACC (SEQ ID NO: 13) .
  • the third segment spanning residues 3158-1503, was isolated by PCR using 5' primer GGAGACAGACACGGTTGACG (SEQ ID NO: 14) and 3 1 primer GCAGACCAGGCCTGACTCC (SEQ ID NO: 15).
  • the primer were designed based upon the nucleotide sequence of human genomic BAC clone CIT987SD-962B4.
  • the template for these reactions was random-primed human kidney cDNA prepared from total RNA. Using this approach the physiological cDNA was isolated which is designated MOAT-E herein and set forth as Sequence I.D. No. 7.
  • MOAT-E encodes a 1503 amino acid transporter.
  • the MOAT-E predicted amino acid sequence is designated Sequence I.D. No. 8. See Figure 9. Also shown is the
  • MOAT-E Comparison of MOAT-E with the other members of the MRP/cMOAT subfamily, which include MRP, cMOAT, MOAT-B, MOAT-C and MOAT-E, is shown in Table IV.
  • MOAT-E is highly related to MOAT-D, MRP and cMOAT, with which it shares 39-45% identity. This high degree of identity is also indicated by the high percent identities of the nucleotide binding folds, which range from 55-61%.
  • MOAT-E is less related to MOAT-B and MOAT-C, with which it shares -31% and 34% identity, respectively.
  • MOAT-E has a hydrophobic N-terminal segment that is present in its closest relatives, MOAT-D, MRP and cMOAT. This structural feature is present in all of the currently known organic anion transporters, and suggests that MOAT-E may share substrate specificity with MRP and cMOAT . MOAT-E may also share the drug resistance activity of the latter two proteins. In contrast, MOAT-B and MOAT-C do not have this hydrophobic N-terminal extension.
  • MOAT-E expression is restricted to liver and kidney, suggesting that MOAT-E may participate the excretion of substances into the urine and bile. See Figure 11.
  • This figure also shows that MOAT-E is expressed as an ⁇ 6 kB transcript. This is in contrast to the ⁇ 2.3 kB transcript that was reported for ara, clearly indicating that the fused ara transcript is unique to the cell line from which it was isolated, and is not a physiological transcript.
  • the isolation of MOAT-E and analysis of its sequence and expression pattern suggest that it may be involved in cellular resistance to drugs and/or the excretion of drugs into the urine and bile.
  • the present invention discloses additional MRP/cMOAT-related transporters which were identified by
  • MOAT-B is a protein whose predicted structure indicates that it is a member of the ABC transporter family. Comparison of the MOAT-B predicted protein with other transporters reveals that it is most closely related to MRP, cMOAT and yeast YCFl, and thus extends the number of known full length MRP-related transporters. The similarity of MOAT-B to these transporters suggest that it shares a similar substrate specificity.
  • Transport assays using membrane vesicle preparations indicate that MRP is capable of transporting diverse organic anions, including glutathione S-conjugates such as LTC 4 , oxidized glutathione, and glucuronidated and sulfated conjugates of steroid hormones and bile salts (7) .
  • glutathione S-conjugates such as LTC 4
  • oxidized glutathione and glucuronidated and sulfated conjugates of steroid hormones and bile salts (7) .
  • membrane vesicle transport assays of substrate specificity using cMOAT-transfected cells have not yet been reported
  • genetic and biochemical studies using TR- and EHBR rat strains which are defective in the hepatobiliary excretion of glutathione and glucuronate conjugates, indicate that it is also an ATP-dependent transporter of organic anions.
  • cMOAT which is primarily expressed in the canalicular membrane of hepatocytes, has been reported to be absent in these rat strains, and hepatocyte canalicular membranes prepared from the mutant rats are deficient in the ATP-dependent transport of glutathione and glucuronate conjugates (23, 24).
  • cMOAT protein has also been reported to be absent in the hepatocytes of patients with Dubin-Johnson syndrome (25) , a disorder manifested by chronic
  • MOAT-C MOAT-D
  • MOAT-E MRP/cMOAT-related transporters. The isolation of these two transporters extends the number of known full length members of this subfamily to six. Based upon the degree of amino acid similarity and overall topology these six proteins fall into two groups. The first group is composed of MOAT-D, MOAT-E, MRP and cMOAT .
  • MOAT-D is more closely related to MRP (57% identity) than is cMOAT (48% identity) , and is therefore the closest known relative of MRP.
  • cMOAT 48% identity
  • the similarity between MOAT-D, MRP and cMOAT also extends to overall topology.
  • MOAT-D and MOAT-E have three membrane spanning domains, including an N-terminal hydrophobic extension that is predicted to harbor ⁇ 5 transmembrane helices, and which is absent in transporters such as CFTR and MDR1.
  • MRP/cMOAT-related transporters is composed of MOAT-B and MOAT-C. These two transporters are distinguished from the first group by their lower level of amino acid similarity and distinct topology. Like MOAT-D and MOAT-E, MOAT-B
  • MOAT-C are more closely related to MRP (39% and 36%, respectively) and cMOAT (37% and 36%, respectively) than to other eukaryotic transporters .
  • MRP MRP
  • cMOAT MOAT-D
  • MOAT-E MOAT-B
  • MOAT-C do not have an N-terminal membrane spanning domain, and their topology is therefore more similar to many other eukaryotic ABC transporters that also have only two membrane spanning domains .
  • MOAT-B, MOAT-C, MOAT-D and MOAT-E Defining the contributions of MOAT-B, MOAT-C, MOAT-D and MOAT-E to cytotoxic drug resistance will facilitate the design of novel chemotherapeutic agents.
  • the multidrug resistance activity of MRP is well described. While the drug sensitivity pattern of cMOAT-transfected cells has not yet been reported, the possibility that it may also confer resistance to cytotoxic drugs is suggested by a recent report in which transfection of a cMOAT antisense vector was found to enhance the sensitivity of a human liver cancer cell line to both natural product drugs and cisplatin. Since MOAT-D and MOAT-E are more closely related to MRP than is cMOAT, the possibility that they will also confer resistance is particularly interesting. The availability of the MOAT-B, MOAT-C, MOAT-D and MOAT-E cDNAs will facilitate the analysis of their possible contributions to cytotoxic resistance .
  • the human multidrug resistance-associated protein MRP is a plasma membrane drug-efflux pump. Proc. Natl. Acad. Sci. U S A, 91 : 8822-6, 1994.
  • yeast cadmium factor protein is a vacuolar glutathione S-conjugate pump. J. Biol. Chem., 271: 6509-17, 1996.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Nouveaux gènes humains MOAT et leurs protéines codées. Les transporteurs ABC apparentés à MRP, codés par les séquences d'acide nucléique décrites, jouent un rôle clé dans le fait que des réactifs bénéfiques sur le plan pharmacologique s'échappent de cellules tumorales. Des gènes MOAT et leurs protéines codées fournissent des cibles thérapeutiques précieuses pour la mise au point d'agents anticancéreux qui inhibent la croissance aberrante des cellules malignes.
PCT/US1999/006644 1998-03-27 1999-03-26 Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur WO1999049735A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US09/647,140 US6803184B1 (en) 1998-03-27 1999-03-26 MPR-related ABC transporter encoding nucleic acids and methods of use thereof
AU32077/99A AU3207799A (en) 1998-03-27 1999-03-26 Mpr-related abc transporter encoding nucleic acids and methods of use thereof
US10/889,503 US7312026B2 (en) 1998-03-27 2004-07-12 MRP-related ABC transporter encoding nucleic acids and methods of use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US7975998P 1998-03-27 1998-03-27
US60/079,759 1998-03-27
US9515398P 1998-08-03 1998-08-03
US60/095,153 1998-08-03

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09647140 A-371-Of-International 1999-03-26
US10/889,503 Division US7312026B2 (en) 1998-03-27 2004-07-12 MRP-related ABC transporter encoding nucleic acids and methods of use thereof

Publications (1)

Publication Number Publication Date
WO1999049735A1 true WO1999049735A1 (fr) 1999-10-07

Family

ID=26762399

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/006644 WO1999049735A1 (fr) 1998-03-27 1999-03-26 Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur

Country Status (2)

Country Link
AU (1) AU3207799A (fr)
WO (1) WO1999049735A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000058471A2 (fr) * 1999-03-31 2000-10-05 St. Jude Children's Research Hospital Proteines associees a la resistance a l"action de plusieurs medicaments et utilisations de celles-ci
WO2002018438A1 (fr) * 2000-08-31 2002-03-07 The Australian National University Proteines modifiees, nouveaux peptides isoles et leur utilisation
WO2003052119A2 (fr) * 2001-12-14 2003-06-26 Incyte Genomics, Inc. Transporteurs et canaux ioniques
EP1361433A2 (fr) * 2002-04-09 2003-11-12 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Méthode de detemination l'efficacité d'une TNF thérapie
US6759515B1 (en) 1997-02-25 2004-07-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
WO2005001092A2 (fr) * 2003-05-20 2005-01-06 Wyeth Compositions et procedes pour diagnostiquer et traiter le cancer
EP2532739A2 (fr) * 2004-05-10 2012-12-12 University Of North Carolina At Chapel Hill Procédé de dépistage de la réceptivité à l'excrétion biliaire sur des composés candidats

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BELINSKY M G, ET AL.: "CHARACTERIZATION OF MOAT-C AND MOAT-D NEW MEMBERS OF THE MRP/CMOAT SUBFAMILY OF TRANSPORTER PROTEINS", JOURNAL OF THE NATIONAL CANCER INSTITUTE, OXFORD UNIVERSITY PRESS, GB, vol. 90, no. 22, 18 November 1998 (1998-11-18), GB, pages 1735 - 1741, XP002921303, ISSN: 0027-8874, DOI: 10.1093/jnci/90.22.1735 *
DATABASE MPSRCH GENBANK 1 January 1900 (1900-01-01), ALLIKMETS R, ET AL: "HUMAN CLONE EST277145 ATP-BINDING CASSETTE TRANSPORTER MRNA SEQUENCE", XP002921197, Database accession no. U66687 *
DATABASE MPSRCH GENBANK 1 January 1900 (1900-01-01), ALLIKMETS R, ET AL: "HUMAN CLONE EST90757 ATP-INDING CASSETTE TRANSPORTER MRNA SEQUENCE", XP002921199, Database accession no. U66674 *
DATABASE MPSRCH GENBANK 1 January 1900 (1900-01-01), HILLIER L, ET AL: "YQ68C10.R1 HOMO SAPIENS CDNA CLONE 200946 5' SIMILAR TO SP:MRP HUMAN P33527 MULTIDRUG RESISTANCE-ASSOCIATED", XP002921200, Database accession no. R97754 *
DATABASE MPSRCH GENBANK 1 January 1900 (1900-01-01), SHIMADA K: "MOUSE EMBRYONAL CARCINOMA F9 CELL CDNA, A4G05, MRNA SEQUENCE", XP002921198, Database accession no. D77412 *
HIROSHI SUZUKI, YUICHI SUGIYAMA: "EXCRETION OF GSSG AND GLUTATHIONE CONJUGATES MEDIATED BY MRP1 AND CMOAT/MRP2", SEMINARS IN LIVER DISEASE, STUTTGART, DE, vol. 18, no. 04, 1 January 1998 (1998-01-01), DE, pages 359 - 376, XP002921304 *
KOJI KOIKE, ET AL.: "A CANALICULAR MULTISPECIFIC ORGANIC ANION TRANSPORTER (CMOAT) ANTISENSE CDNA ENHANCES DRUG SENSITIVITY IN HUMAN HEPATIC CANCER CELLS", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 57, no. 24, 1 December 1997 (1997-12-01), US, pages 5475 - 5479, XP002921301, ISSN: 0008-5472 *
KUN LEE, ET AL.: "ISOLATION OF MOAT-B A WIDELY EXPRESSED MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN/CANALICULAR MULTISPECIFIC ORGANIC ANION TRANSPORTER-RELATED TRANSPORTER", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 58, no. 13, 1 July 1998 (1998-07-01), US, pages 2741 - 2747, XP002921302, ISSN: 0008-5472 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6759515B1 (en) 1997-02-25 2004-07-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
WO2000058471A3 (fr) * 1999-03-31 2001-02-08 St Jude Childrens Res Hospital Proteines associees a la resistance a l"action de plusieurs medicaments et utilisations de celles-ci
WO2000058471A2 (fr) * 1999-03-31 2000-10-05 St. Jude Children's Research Hospital Proteines associees a la resistance a l"action de plusieurs medicaments et utilisations de celles-ci
US6759238B1 (en) 1999-03-31 2004-07-06 St. Jude Children's Research Hospital Multidrug resistance associated proteins and uses thereof
WO2002018438A1 (fr) * 2000-08-31 2002-03-07 The Australian National University Proteines modifiees, nouveaux peptides isoles et leur utilisation
WO2003052119A2 (fr) * 2001-12-14 2003-06-26 Incyte Genomics, Inc. Transporteurs et canaux ioniques
WO2003052119A3 (fr) * 2001-12-14 2004-04-15 Incyte Genomics Inc Transporteurs et canaux ioniques
EP1361433A2 (fr) * 2002-04-09 2003-11-12 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Méthode de detemination l'efficacité d'une TNF thérapie
EP1361433A3 (fr) * 2002-04-09 2005-02-23 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Méthode de detemination l'efficacité d'une TNF thérapie
WO2005001092A2 (fr) * 2003-05-20 2005-01-06 Wyeth Compositions et procedes pour diagnostiquer et traiter le cancer
WO2005001092A3 (fr) * 2003-05-20 2006-06-29 Wyeth Corp Compositions et procedes pour diagnostiquer et traiter le cancer
EP2532739A2 (fr) * 2004-05-10 2012-12-12 University Of North Carolina At Chapel Hill Procédé de dépistage de la réceptivité à l'excrétion biliaire sur des composés candidats
EP2532739A3 (fr) * 2004-05-10 2013-03-27 University Of North Carolina At Chapel Hill Procédé de dépistage de la réceptivité à l'excrétion biliaire sur des composés candidats

Also Published As

Publication number Publication date
AU3207799A (en) 1999-10-18

Similar Documents

Publication Publication Date Title
WO2002000001A2 (fr) Recepteur igpcr20 couple a la proteine g humaine, et utilisations correspondantes
EP1171609A2 (fr) Nouvelles proteines de lipoxygenase et polynucleotides codant pour celles-ci
US6441156B1 (en) Calcium channel compositions and methods of use thereof
EP1056765A1 (fr) Genes humains du canal potassique
WO1999049735A1 (fr) Transporteur abc apparente a mrp codant des acides nucleiques et procede d'utilisation dudit transporteur
US20100273256A1 (en) Human Potassium Channel Genes
Haag et al. Structure of the gene encoding the rat T cell ecto-ADP-ribosyltransferase RT6.
US6361948B1 (en) Prognostic compositions for prostate cancer and methods of use thereof
US7312026B2 (en) MRP-related ABC transporter encoding nucleic acids and methods of use thereof
EP1268776A2 (fr) Essai et modele pour maladie inflammatoire
AU774850B2 (en) Human seven-transmembrane receptors
JP2000245488A (ja) ヒト腸Ｎｐｔ２Ｂ
AU2070701A (en) Novel human membrane proteins and polynucleotides encoding the same
CA2379462A1 (fr) Nouveau recepteur couple a la proteine g humaine
US20030022309A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
US20040242468A1 (en) Gene involved in mineral deposition and uses thereof
JP2002531059A (ja) ラットｍｄｒ１ａをコードするポリヌクレオチド配列およびポリペプチド配列、ならびにそれらのスクリーニング方法
CA2385231A1 (fr) Acide nucleique codant pour transporteur 2 abca (abca2) humain et procedes d'utilisation de cet acide nucleique
US20050215776A1 (en) Novel human 7TM proteins and polynucleotides encoding the same
JP2003529348A (ja) 新規ヒト膜タンパクおよびそれをコードするポリヌクレオチド
US20030219868A1 (en) Isolated nucleic acid molecules encoding membrane polypeptides
US20020192762A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
AU7744900A (en) Novel human membrane proteins
CA2403633A1 (fr) Nouvelles proteines humaines 7tm et polynucleotides codant pour ces proteines
US20020028773A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09647140

Country of ref document: US

122 Ep: pct application non-entry in european phase