EP1209968A1 - Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur - Google Patents

Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur

Info

Publication number
EP1209968A1
EP1209968A1 EP00961450A EP00961450A EP1209968A1 EP 1209968 A1 EP1209968 A1 EP 1209968A1 EP 00961450 A EP00961450 A EP 00961450A EP 00961450 A EP00961450 A EP 00961450A EP 1209968 A1 EP1209968 A1 EP 1209968A1
Authority
EP
European Patent Office
Prior art keywords
cells
mammal
human
mouse
rag
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00961450A
Other languages
German (de)
English (en)
Inventor
Manley A. Huang
Fiona A. Harding
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danisco US Inc
Original Assignee
Genencor International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genencor International Inc filed Critical Genencor International Inc
Publication of EP1209968A1 publication Critical patent/EP1209968A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0271—Chimeric vertebrates, e.g. comprising exogenous cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • C07K14/522—Alpha-chemokines, e.g. NAP-2, ENA-78, GRO-alpha/MGSA/NAP-3, GRO-beta/MIP-2alpha, GRO-gamma/MIP-2beta, IP-10, GCP-2, MIG, PBSF, PF-4, KC
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/53—Colony-stimulating factor [CSF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/53—Colony-stimulating factor [CSF]
    • C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5403—IL-3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5412—IL-6
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5415—Leukaemia inhibitory factor [LIF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5418—IL-7
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/01—Animal expressing industrially exogenous proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0381—Animal model for diseases of the hematopoietic system

Definitions

  • hematopoietic stem cells or mature circulating lymphocytes are transferred into naturally occurring strains of immunodeficient mice. Although better than their forerunners in certain respects, these models fail to reproduce many of the functional properties of human cells that are critical for unraveling disease processes. On a more basic level, even attempts to transplant hematopoietic stem cells between individuals of the same species have produced allogeneic chimeras that are functionally impaired. The reasons for this are unclear, but involve the inability of the donor stem cells to differentiate properly in the mature lymphoid tissues of the new host.
  • the present invention provides for a recipient mammal comprising exogenous cytokines capable of maintaining an immune system; and cells derived from donor-specific cells with hematopoietic stem cell properties (HSC); wherein the recipient mammal is capable of facilitating production of donor-specific functional immunity.
  • the mammal is a mouse.
  • the cytokines are from the same species as the cells derived from donor-specific cells with hematopoietic stem cell properties.
  • the cytokines are selected from the group consisting of interleukin 3, (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), macrophage-colony stimulating factor (M-CSF), granulocyte-colony stimulating factor (GM-CSF), stem cell factor (SCF), leukemia inhibitory factor (LIF) and oncostatin M (OM).
  • the cytokines comprise IL-3, IL-6, IL-7, M-CSF, GM-CSF and SCF.
  • the cytokines are introduced into the mammal transgenically.
  • the cells derived from cells with hematopoietic stem cell properties are xenogeneic to the mammal.
  • the cells are human cells.
  • the cells are hematopoietic stem cells.
  • the hematopoietic stem cells are derived from umbilical cord blood.
  • the cells are derived from bone marrow, mobilized peripheral blood, embryonic stem cells, or other source of HSC.
  • the cells derived from cells with hematopoietic stem cell properties are differentiated.
  • the differentiated cells are of lymphoid, myeloid, or of an erythroid lineage.
  • a method of making a mammal with a donor immune system comprises the steps of introducing transgenes into an immunodeficient mammal, wherein the transgenes encode cytokines necessary for the maintenance and maturation of donor-derived hematopoietic cells; and introducing cells with hematopoietic stem cell properties into the mammal.
  • the donor immune system is a xenogeneic immune system.
  • the donor immune system is a human immune system.
  • the introduction of transgenes is through transfection of embryonic stem cells.
  • the introduction of transgenes is through pronuclear transfer.
  • the introduction of the transgenes is through breeding the mammal with a mammal that comprises the transgenes.
  • the mammal is a RAG-1 or a RAG-2 mutant mouse.
  • the mammal is a RAG-1 or RAG-2 mutant mouse expressing human leukocyte antigen (HLA) Class I and/or Class II genes.
  • the mammal is a SCID mouse expressing HLA Class I and/or Class II genes.
  • the mammal is an immunocompetent mouse expressing HLA Class I and/or Class II genes and rendered immunodeficient by, e.g., irradiation conditioning.
  • the donor-derived hematopoietic cells are from a xenogeneic mammal.
  • the donor-derived hematopoietic cells are from a human.
  • Transgenic chimeric mammals are immunized with proteins, peptides, cells or other sources of antigens, to determine epitopes involved in donor cell-derived immune responses. These include, but are not limited to, antigen-specific immunoglobulin production, Theip er responses, T cyt oto x i c responses, cellular proliferation responses, innate allogeneic or xenogeneic responses, and natural killer cell activity.
  • Theip er responses include, but are not limited to, antigen-specific immunoglobulin production, Theip er responses, T cyt oto x i c responses, cellular proliferation responses, innate allogeneic or xenogeneic responses, and natural killer cell activity.
  • Figure 1 demonstrates that allogeneic bone marrow engrafted RAG mice are tolerant to donor and host MHC, but responsive to third party alloantigens.
  • CD4 + T cells were isolated by cytotoxic elimination of class II + and CD8 + cells from the lymph nodes of a syngeneic engrafted RAG mouse (RAG-(syn), (A); an allogeneic engrafted RAG mouse
  • RAG-(allo), B a syngeneic engrafted SCID mouse (SCID-(syn), C); an allogeneic engrafted SCID mouse (SCID-(allo), D); and a RAG mouse, E) engrafted with the same bone marrow preparation as placed in the SCID-(allo) mouse shown in panel D, as a positive control for the bone marrow inoculum.
  • CD4 + T cells were co-cultured with irradiated LPS-induced splenic blasts from
  • FIG. 2A control Balb/c mice (open triangles), RAG-(allo) mice (closed squares; mouse #30), RAG-(syn) mice (open squares; mouse RN003), and SCID-(allo) mice (closed circles; two animals, SN005 and SN006, are shown) were immunized in the hind foot pads with a total of 50 ⁇ g hen egg white lysozyme (HEL) emulsified in complete Freund's adjuvant (CFA). Two weeks later, animals were boosted i.p. with the same amount of HEL in incomplete Freund's adjuvant (IF A).
  • HEL hen egg white lysozyme
  • the plain bars on the graph represent individual control mice: (C57B 1/6x129) FI mice are represented by the open bars, and Balb/c mice by the gray bars.
  • the y axis indicated the OD 415- 9 o x 1000 for a 1:1000 dilution of serum.
  • the x axis represents days post-primary immunization. Specificity was tested by ELISA on HEL coated plates; no cross-reactivity was seen.
  • FIG. 3 represents that antigen specific T cell proliferative responses are restricted to both donor and host MHC in neonatally constructed RAG-(allo) chimeras.
  • RAG- (allo) mice #135 (A) and 136 (B) were immunized in the hind foot pad with KLH in CFA. Ten days later, draining lymph nodes were removed and depleted of B cells and macrophages by cytotoxic elimination. The resulting lymph node T (LNT) cells were co-cultured for three days with a 2:1 ratio of Mitomycin C-fixed, antigen-pulsed LPS-blasts from Balb/c and C57B1 6 mice. Proliferative responses were quantitated using a colorometric assay (CellTiter;
  • mice possess CD4 + T cells in the periphery that exhibit donor MHC restricted antigen-specific responses. These results have not been seen in either neonatally or adult constructed SCID chimeras. This suggests that hematopoietic cells are capable of positively selecting CD4 + T cells in the thymus, and present antigen receptor recombination-deficient strains of mammals as a unique model system which may support T cell development more closely resembling normal ontogeny.
  • RAG-2 recombination activation gene-2
  • cytokine transgenic (CTG) mammals engrafted with xenogeneic hematopoietic stem cells (HSC) develop a functional immune system capable of donor MHC-restricted antigen-specific responses.
  • CCG cytokine transgenic
  • HSC xenogeneic hematopoietic stem cells
  • MHC major histocompatibility complex
  • HLA human leukocyte antigen
  • MHC restriction refers to the recognition of peptides by T cells in the context of particular allelic forms of MHC molecules.
  • Cells that are "allogeneic" to a mammal are cells that are from an individual of the same species as the mammal but, because of differences in expression of major and minor histocompatibility molecules between the cell donor and the host mammal, are recognized by the host mammal as non-self.
  • Cells that are "xenogeneic" to a host mammal are cells that are from an individual of a different species as the mammal. Due to significant genetic differences, they are recognized by the host mammal as non-self.
  • bone marrow refers to the red marrow of the bones of the spine, sternum, ribs, clavicle, scapula, pelvis and skull. This marrow contains hematopoietic stem cells.
  • umbilical cord blood refers to whole blood obtained from the umbilical cord of a newborn. This blood also contains hematopoietic stem cells.
  • mobilized peripheral blood refers to peripheral blood isolated from individuals treated with recombinant growth factors, e.g., granulocyte colony stimulating factor (GM-CSF) and stem cell factor (SCF), for the purpose of increasing the proportion of hematopoietic stem cells in the circulation.
  • GM-CSF granulocyte colony stimulating factor
  • SCF stem cell factor
  • cytokines refers to proteins that are commonly referred to as cytokines as well as other proteins, such as growth factors, interleukins, immune system modulators, and other types of proteins necessary to maintain an immune system.
  • cytokines encompasses the interleukins, stem cell factors, colony stimulating factors and other factors known to those of skill in the art.
  • Exogenous cytokines refers to cytokines that are not naturally occurring in the recipient mammal. These cytokines can be species homologs of naturally occurring cytokines or cytokines that do not have naturally occurring homologs in the recipient mammal.
  • immunodeficiency refers to a lack of antigen-specific immunity in a mammal. In these mammals, B and T lymphocytes fail to mature properly and are unable to recognize and respond to antigens.
  • RAG recombination activation genes
  • RAG-1 and RAG-2 genes that are involved with initiating the rearrangement of B and T cell antigen receptors.
  • the genetic recombination at the V, D and or J gene segments is necessary to produce B and T-cell receptors. Mutations in the RAG-1 an RAG-2 genes prevent early steps in this process, and result in a blockade of B cell development in the bone marrow and thymocyte development in the thymus (Mombaerts, et al, Cell 68:869-77 (1992); Shinkai, et al, Cell 68:855-867 (1992)).
  • donor-specific cells with hematopoietic stem cell properties refer to cells from a donor species that exhibit hematopoietic stem cell properties. The most obvious candidates are hematopoietic stem cells. However, other cells are envisioned, including but not limited to, cells that differentiate into HSC, such as embryonic stem cells.
  • donor immune system refers to complete or partial immune function that is not naturally found in a host mammal.
  • cytokines necessary for the maintenance of a functional immune system as well as donor-specific immune cells are introduced into an immunodeficient mammal, either through introduction of transgenes that encode the cytokines or, less preferably, through the addition of cytokines to the animal.
  • Donor cells are the source of the recipient mammal's immune system (and typically, but not necessarily, the cytokine).
  • the donor immune system it is not necessary that the donor immune system be fully functional, i.e., exhibit all functions of a mammalian immune system found in nature.
  • the donor immune system at least comprise donor T and B lymphocytes, and antigen presenting cells such as macrophages and dendritic cells.
  • embryonic stem cells refers to cells that will grow continuously in culture and retain the ability to differentiate to all cell lineages, including but not limited to, hematopoietic cells.
  • differentiate or “differentiated” refers to the process of becoming a more specialized cell type.
  • hematopoietic stem cells differentiate into cells of the "lymphoid", “erythroid” and “myeloid” lineages.
  • Lymphoid cells are cells that mediate the specificity of immune responses. They are divided into two main groups, T and B lymphocytes, and include a small population of large granular lymphocytes, or natural killer cells.
  • Erythroid cells are erythroblasts and erythrocytes.
  • Cells of the myeloid lineage include platelets, neutrophils, basophilic, eosinophils and monocytes.
  • the phrase "facilitating production of donor-specific functional immunity” refers to the ability of the recipient mammal to develop and maintain a functional donor- derived immune system.
  • the immune system comprises hematopoietic cells that are specific to a donor as well as cytokines and other ancillary compounds that are necessary, or even desired, to allow the hematopoietic cells to be functional, e.g., bind to antigen, recognize an antigen as foreign or self, communicate with other cells of the immune system so that other cells, e.g., monocytes and macrophages, are activated, or cytokines, as defined herein, are released.
  • human cells for purposes of this invention are cells that are derived from a human.
  • the derivation can be direct, i.e., primary cultures obtained from a human, or indirect, e.g., culture lines derived from primary cultures obtained from a human.
  • introduction refers to the addition of exogenous compounds, particularly cytokine genes, to the recipient mammals of this invention.
  • the compounds can be introduced into the recipient mammals of this invention in a variety of methods, including but not limited to, introduction of the genes that encode the compounds.
  • Introduction of the genes that encode the compounds can be through gene transfer into a non-fetal mammal or transgenically into a gamete or an embryonic mammal.
  • the genetic material can be introduced into a recipient mammal through breeding or cloning, e.g., the introduction of the genes that encode the compounds into the germline of an offspring from a transgenic parent.
  • the phrase "maintaining an immune system” refers to the ability of exogenous cytokines to support a donor-derived immune system in a recipient mammal that otherwise would not support such an immune system.
  • the exogenous cytokines are naturally found in the same species as the donor.
  • required interactions between the cells of the donor-derived immune system and cytokines naturally found in the donor to maintain the immune system are supplied in the recipient mammal.
  • the phrase "maintenance and maturation of donor-derived hematopoietic cells” refers to providing cytokines necessary to allow hematopoietic stem cells and other immature cell types to mature into functional cells, e.g., of the immune system, and providing necessary cytokines so that the cells, once mature, survive to function.
  • hematopoietic cells e.g., erythrocytes, platelets, other lymphoid tissue (for example, the gut-associated immune system which consists of Peyer's patches, villi containing intraepithelial lymphocytes, and lymphocytes scattered throughout the lamina propria, and the connective tissue beneath the surface epithelium.
  • lymphoid tissue for example, the gut-associated immune system which consists of Peyer's patches, villi containing intraepithelial lymphocytes, and lymphocytes scattered throughout the lamina intestinal, and the connective tissue beneath the surface epithelium.
  • making a mammal refers to the manipulation of the physical characteristics of a mammal so the mammal, after the manipulation, comprises a donor immune system.
  • a human mammal cannot be made or produced.
  • the manipulation of the physical characteristics can be through transgenic technology, gene transfer, or other manipulations of the genotype of the mammal, or manipulation can be through the introduction of cells, proteins or other compounds that affect the physical characteristics of the mammal.
  • a “mammal” is a warm blooded vertebrate of the class Mammalia.
  • a “recipient mammal” is a mammal that, because of the presence of exogenous transgenes and donor cells with hematopoietic stem cell properties, is capable of facilitating production of a donor-specific immune system.
  • a recipient mammal is not a human.
  • mice refers to a mammal of the species Mus musculus.
  • Mice encompassed by this invention include all mice, but in particular, mice of the, or derived from the RAG-1 and RAG-2 mutant strains. Because of the severe immunodeficiency of the mice of this invention, it is unlikely they are found in nature.
  • the mice of this invention are laboratory strains of mice, such as the RAG-1, RAG-2 or SCID mice.
  • transgenically refers to the introduction of exogenous genetic material, or transgenes, into the genome of a gamete or an embryo.
  • the genetic material encodes proteins and the introduction is into a fetal mammal.
  • Transgenes refer to nucleic acids that comprise a protein coding region and regulatory elements, e.g., promoters and termination sequences, if desired.
  • a transgene can comprise a single copy of a coding sequence or multiple copies of a coding sequence. If multiple copies are present, the coding regions can be partial coding regions.
  • the coding regions can be separated by regulatory elements or may be arranged in a 5' to 3' or in a 5' to 5' or 3' to 3' orientation.
  • Multiple transgenes, representing independent coding and regulatory sequences may be present, most preferably, in a contiguous fashion in the same region, or dispersed elsewhere in the recipient mammal's genome.
  • Cells that are "xenogeneic" to a host mammal are from a different species as the host mammal.
  • the host mammal normally recognizes xenogeneic cells as non-self.
  • the recipient mammals of this invention are immunodeficient.
  • the naturally occurring immune systems of the mammals should be inactivated. Inactivation can take place by removing or disrupting multiple immune system-related activities or by removing or disrupting just one activity.
  • immune function can be disrupted by many different mechanisms, e.g., spontaneous mutation, irradiation and antisense technology, in a preferred embodiment, immune function is disrupted by knocking out by e.g., homologous recombination or spontaneous mutation, one or more gene functions necessary for maturation and maintenance of the immune system. Generation of knock out mammals
  • Homologous recombination may be employed for gene replacement, inactivation or alteration of genes.
  • a number of papers describe the use of homologous recombination in mammalian cells. See, for example, Thomas & Capecchi, Cell 51:503
  • the recipient mammals of this invention which lack necessary endogenous gene(s) necessary for the maturation of lymphocytes, can be made using homologous recombination to effect targeted gene replacement.
  • a specific DNA sequence of interest is replaced by an altered DNA.
  • the genome of an embryonic stem (ES) cell from a desired mammalian species is modified (Capecchi, Science 244:1288 (1989) U.S. Patent No. 5,487,992).
  • the gene to be replaced by homologous recombination is one that is activated early in lymphocyte development. Without being bound by any particular theory, it is believed the desired gene is activated while the thymocyte is in the CD4 " and CD8 " state (double negative) or the CD44 Iow and CD25 + state, and the B lymphocyte is in the
  • T and B cell receptor rearrangement occurs, it is believed the genes that encode proteins that modulate the VDJ recombination are likely targets for replacement. Examples of these genes are the RAG-1 and RAG-2 genes, the T cell receptor (TCR) and immunoglobulin (Ig) genes, the CD3 genes, the pre-T cell receptor, and the SCID gene. Additional types of genes that regulate the survival and differentiation of lymphocyte precursors are also potential targets, e.g., the ikarus transcription factor, the common gamma chain subunit, IL-7, and the IL-7 receptor, among others.
  • the homologous sequence for targeting the construct may have one or more deletions, insertions, substitutions or combinations thereof.
  • the RAG-2 gene may include a deletion at one site and/or an insertion at another site.
  • the presence of an inserted positive marker gene will result in a defective inactive protein product insertion as well as a gene that can be used for selection.
  • deletions are employed.
  • an inserted gene of particular interest is a gene which provides a marker, e.g., antibiotic resistance such as neomycin resistance, including G418 resistance.
  • the deletion should be at least about 50 base pairs, or more usually at least about 100 base pairs, and generally not more than about 20,000 base pairs, where the deletion will normally include at least a portion of the coding region including a portion of or one or more exons, a portion of one or more introns, and may or may not include a portion of the flanking non-coding regions, particularly the 5 '-non-coding region (transcriptional regulatory region).
  • the homologous region may extend beyond the coding region into the 5'-non- coding region or alternatively into the 3'-non-coding region. Insertions should generally not exceed 10,000 base pairs, usually not exceed 5,000 base pairs, generally being at least 50 base pairs, more usually at least 200 base pairs.
  • the homologous sequence should include at least about 100 base pairs, preferably at least about 150 base pairs, and more preferably at least about 300 base pairs of the target sequence and generally not exceeding 20,000 base pairs, usually not exceeding 10,000 base pairs, and preferably less than about a total of 5,000 base pairs, usually having at least about 50 base pairs on opposite sides of the insertion and/or the deletion in order to provide for double crossover recombination.
  • Upstream and/or downstream from the desired DNA may be a gene which provides for identification of whether a double crossover has occurred.
  • the herpes simplex virus thymidine kinase gene may be employed, since the presence of the thymidine kinase gene may be detected by the use of nucleoside analogs, such as Acyclovir or Gancyclovir, for their cytotoxic effects on cells that contain a functional HSV-tk gene.
  • nucleoside analogs such as Acyclovir or Gancyclovir
  • the absence of sensitivity to these nucleoside analogs indicates the absence of the thymidine kinase gene and, therefore, where homologous recombination has occurred, that a double crossover event has also occurred.
  • the presence of the marker gene inserted into the RAG-2 gene of interest establishes the integration of the targeting construct into the host genome.
  • DNA analysis might be required in order to establish whether homologous or non-homologous recombination occurred. This can be determined by employing probes for the target DNA sequence that hybridize to the 5' and 3' regions flanking the insert.
  • the presence of an insert, deletion, or substitution in the targeted gene can be determined using restriction endonucleases that distinguish the size of a targeted allele from a wild type allele.
  • the polymerase chain reaction may also be used in detecting the presence of homologous recombination (Kim & Smithies, Nucleic Acid Res. 16:8887-8903 (1988); and Joyner, et al, Nature 338:153-156 (1989)).
  • Primers may be used which are complementary to a sequence within the construct and complementary to a sequence outside the construct and at the target locus. In this way, one can only obtain DNA duplexes having both of the primers present in the complementary chains if homologous recombination has occurred. By demonstrating the presence of the primer sequences or the expected size sequence, the occurrence of homologous recombination is supported.
  • the construct may further include an origin of replication which is functional in the mammalian host cell.
  • these replication systems will involve viral replication systems, such as Simian Virus 40, Epstein-Barr virus, papilloma virus, adenovirus and the like.
  • a marker gene may have the wild-type transcriptional regulatory regions, particularly the transcriptional initiation regulatory region or a different transcriptional initiation region. Whenever a gene is from a host where the transcriptional initiation region is not recognized by the transcriptional machinery of the mammalian host cell, a different transcriptional initiation region will be required. This region may be constitutive or inducible, preferably inducible.
  • promoters A wide variety of transcriptional initiation regions have been isolated and used with different genes.
  • promoters are the promoters of metallothionein-I and II from a mammalian host, thymidine kinase, beta-actin, immunoglobulin promoter, human cytomegalovirus promoters, phosphoglycerate kinase (PGK) and SV40 promoters.
  • the wild-type enhancer may be present or an enhancer from a different gene may be joined to the promoter region.
  • the construct may further include a replication system for prokaryotes, particularly E. coli, for use in preparing the construct, cloning after each manipulation, allowing for analysis, such as restriction mapping or sequencing, followed by expansion of a clone and isolation of the construct for further manipulation.
  • a different marker may be employed for detecting bacterial transformants.
  • the DNA construct is now ready to be introduced into the target stem cells.
  • Methods of introducing the desired DNA into stem cells include, but are not limited to calcium phosphate/DNA coprecipitates, microinjection of DNA into the nucleus, electroporation, bacterial protoplast fusion with intact cells, lipofection, or the like.
  • the DNA may be single or double stranded, linear or circular, relaxed or supercoiled DNA.
  • target cells After transformation of the target cells, many target cells are selected by means of positive and/or negative markers, as previously indicated, neomycin resistance and Acyclovir or Gancyclovir resistance. Those cells which show the desired phenotype may then be further analyzed by restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction or the like. By identifying fragments which show the presence of the mutations at the target gene site, one can identify cells in which homologous recombination has occurred to inactivate the target gene.
  • positive and/or negative markers as previously indicated, neomycin resistance and Acyclovir or Gancyclovir resistance.
  • Those cells which show the desired phenotype may then be further analyzed by restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction or the like.
  • Cells in which only one copy of the, e.g., RAG-2, gene have been inactivated still retain a single unmutated copy of the target gene.
  • these cells can be expanded and subjected to a second transformation with a vector containing the desired DNA.
  • the mutation within the desired DNA may be the same or different from the first mutation. If a deletion, or replacement mutation is involved, a second mutation may overlap at least a portion of the mutation originally introduced.
  • a different positive selection marker can be used in this transformation. If a different marker is used, cells with both mutations can be selected in double selection media. Alternatively, to determine if the cells comprise mutations in both copies of the transformed cells, the cells can be screened for the complete absence of the functional protein of interest.
  • chimeric mammals can be developed from transformed stem cells (see, infra) and animals with one mutated sequence can be bred to other mammals with one or two mutated sequences and offspring that contain mutations in both copies (homozygotes) selected as recipient mammals of this invention.
  • recipient mammals developed from chimeric mammals from transformed cells with two mutated genes can be bred to produce more recipient mammals.
  • the stem cells containing either one or two copies of the replacement DNA are inserted into recipient mammal embryos to produce chimeric mammals. Typically, this is done by injecting stem cell clones into mammalian blastocysts. The blastocysts are then implanted into pseudopregnant females. The offspring derived from the implanted blastocysts are test-mated to animals of the parental line to determine whether the offspring comprise a chimeric germ line. Chimeras with germ cells derived from the altered stem cells transmit the modified genome to the offspring of the test matings, yielding mammals heterozygous for the target DNA (contain one target DNA and one replacement DNA). The heterozygotes are then bred with each other to create homozygotes for replacement DNA.
  • the recipient mammals of this invention are immunodeficient, it may be necessary to maintain them in a germ free environment.
  • Such environments are well known to those of skill in the art and techniques for maintaining immunodeficient mice can be found in Immunodeficient rodents : a guide to their immunobiology, husbandry, and use, Committee on Immunologically Compromised Rodents, Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council. Washington, D.C. : National Academy Press, 1989.
  • the immunodeficient mammals of this invention are commercially available.
  • mice with a RAG-2 mutation are available from Taconic, RAG-1 and TCRbeta/delta mutant mice from Jackson Laboratory, or SCID mice from Jackson and Taconic.
  • transcriptionally active transgenes e.g., a truncated forms of rearranged antigen receptors or human CD3 epsilon
  • introduction of transcriptionally active transgenes are examples of achieving lymphocyte deficiencies. It is desireable to screen the recipient mammals for the presence of the knocked out gene. Screening can be done phenotypically or genotypically. Phenotypic screening includes, but is not limited to, the absence of mature T and B cells and other phenotypic changes that correlate with the absence of mature T and B cells, such as the absence of serum immunoglobulins. However, if the mutated gene presents as a dominant phenotype, animals that are heterozygous at that gene will present with the same phenotypic characteristics as the desired homozygotes.
  • DNA screening is well known to those of skill in the art and can be found in, for example, Ausubel and Sambrook. Briefly, cells containing DNA are removed from the test animals. In mice, this can be done by removing the tip of the tail and isolating cells. The genomic DNA is isolated from the cells and cut into manageable size by restriction endonucleases. The cut genomic DNA is electrophoresed in an agarose gel and then probed with a labeled nucleic acid that can distinguish the wild type from the modified DNA fragment. Binding of the labeled probe to the genomic DNA depends on the ability of the probe to remain hybridized to the genomic DNA under the wash conditions used.
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formalin with 1 mg of heparin at between 40 and 50°C, preferably 42°C, with the hybridization being carried out overnight.
  • An example of highly stringent wash conditions is 0.15M NaCl at from 70 to 80°C with 72°C being preferable for about 15 minutes.
  • An example of stringent wash conditions is 0.2x SSC wash at about 60 to 70°C, preferably 65°C for 15 minutes ⁇ see, Sambrook, supra for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 40 to 50°C, preferably 45°C for 15 minutes.
  • An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 35 to 45°C, with 40°C being preferable, for 15 minutes.
  • a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. After removal of unbound probe, the label is detected and the presence or absence of the desired DNA in the genome of the mammals determined.
  • a leaky phenotype is one where a few thymocytes and/or pro-B cells undergo functional receptor rearrangement and mature into T and B cells, respectively.
  • a SCID mouse exhibits a leaky phenotype. This phenotype can be detected by monitoring the development of host T and B cells and/or serum immunoglobulin in the recipient mammals throughout the life of the animal.
  • Transgenic Mammals The differentiation of hematopoietic cells is a highly regulated process that involves the coordinate expression of many factors, including cytokines, adhesion molecules, and chemokines, among others.
  • cytokines are powerful signaling molecules that work in close proximity to their origin, in low concentrations, and synergistically with one another, systemic delivery of exogenous cytokines is unlikely to provide the physiological levels necessary for normal development.
  • the preferred method of providing human-specific factors to the host is via transgenesis, whereby copies of genomic DNA encoding the desired factors are incorporated into the genome of the host.
  • the DNA should include tissue-specific regulatory sequences and any introns and exons required for normal RNA processing, including alternatively spiced variants.
  • tissue-specific regulatory sequences and any introns and exons required for normal RNA processing including alternatively spiced variants.
  • the latter may be particularly important when the proteins present themselves as both membrane bound and soluble forms having different physiological effects.
  • the recipient mammals of this invention are produced by introducing transgenes into the germline of a non-human animal.
  • Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell.
  • the zygote is the best target for micro-injection.
  • the male pronucleus of the zygote reaches approximately 20 micrometers in diameter. At this size, reproducible injections of 1-2 pL of DNA solution can be performed.
  • the use of zygotes as a target for gene transfer has another major advantage in that, in most cases, the injected DNA will be incorporated into the host genome before the first cleavage (Brinster, et al. Proc.
  • intracytoplasmic sperm injection can be used to introduce transgenes into metaphase oocytes. See, Perry, et al, Science 284:1180 (1999). Briefly, sperm heads and linearized DNA are incubated for a short period of time and co-injected into an oocyte. Improved rates of transgenesis are seen when the sperm heads have undergone membrane disruption prior to incubation with the DNA.
  • Retroviral infection can also be used to introduce a transgene into a recipient mammal.
  • the developing embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres are then targets for retroviral infection (Jaenisch, Proc. Nat'l Acad. Sci USA 73: 1260-1264 (1976)).
  • Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan, et al., MANIPULATING THE MOUSE EMBRYO, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1986)).
  • the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner, et al.
  • founders will be mosaic for the transgene since incorporation occurs only in a subset of the cells which form the recipient mammal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germ line, albeit with low efficiency, by intrauterine retroviral infection of the idgestation embryo (Jahner, D. et al. supra).
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans, et al. Nature 292:154-156 (1981); Bradley, et al. Nature 309:255-258 (1984); Gossler, et al Proc. Natl. Acad. Sci USA 83:9065-9069 (1986); and Robertson, et al. Nature 322:445-448 (1986)).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction. Such transformed ES cells can thereafter be combined with blastocysts from a nonhuman animal.
  • the ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric recipient mammal.
  • the actual transgenes of this invention include the coding sequences for proteins necessary for the maturation and maintenance of a donor- specific functional immune system.
  • cytokines include but are not limited to, IL-6, IL-7, GM-CSF and SCF, LIF, M-CSF, and OM.
  • MHC genes from the same species and haplotype as that of the donor HSC may be introduced into the recipient mammal and expressed in tissues that endogenously express MHC molecules. In this case, donor thymocytes become "restricted" during development in the recipient's tissues, particularly the thymus, via interaction with the transgenic MHC molecules.
  • transgenic MHC molecules For example, human HLA -DR, -DQ, and or -DP genes of the same haplotype as the HSC donor are expressed in the mouse tissues.
  • the expression of transgenic MHC expression is most beneficial in mouse strains other than those with mutations in the RAG-2 or RAG-1 genes.
  • the cytokine genes are derived from a human being or a human cell line.
  • other mammalian sources such as pig, sheep or rat.
  • mammals of the same species but allogeneic to the donor are the source of the cytokines.
  • DNA may be isolated from a genomic or cDNA library using labeled oligonucleotide probes having sequences complementary to known cytokine sequences.
  • full-length cDNA probes may be used, or oligonucleotide probes consisting of subsequences of the known sequences may be used.
  • probes can be used directly in hybridization assays to isolate DNA encoding cytokines.
  • probes can be designed for use in amplification techniques such as PCR, and DNA encoding cytokines may be isolated by using methods such as PCR.
  • mRNA is isolated from a source tissue or cells.
  • 11-7 is expressed by bone marrow stroma, thus, these cells would be a suitable source of mRNA that encodes 11-7.
  • cDNA is reverse transcribed from the mRNA according to procedures well known in the art and inserted into bacterial cloning vectors. The vectors are transformed into a recombinant host for propagation, screening and cloning. Methods for making and screening cDNA libraries are well known. See, Gubler & Hoffman, Gene 25:263- 269, (1983) and Sambrook, et al.
  • Libraries containing genomic DNA sequences greater than 50kb are prepared using various cloning vectors, e.g., YAC, BAC, PI, and PAC vectors. Techniques for generating these libraries are well known. See, Markie, ed. (for YACS) Methods in Molecular Biology 54 (1997), Ramsay (for YACS), Mol Biotechnol 1(2): 181-201 (1994), Monaco et al, Trends Biotechnol 12:280-6 (1994), and Shepherd et al, Genet Eng (NY) 16:213-28 (1994).
  • Hybridization probes useful in this invention include known sequences that encode for the cytokines of interest or sequences that encode homologous cytokines from another species, for example a probe derived from a murine sequence to probe a human cDNA library for a homologous sequence.
  • a probe derived from a murine sequence to probe a human cDNA library for a homologous sequence.
  • homologous sequences are used as probes, the stringency of the wash conditions should be lowered.
  • many of the nucleic acids that encode the necessary cytokines of this invention are commercially available. Such resources include R&D Systems, Genetic Systems, and CEPH.
  • the preferred method of making transgenic mammals that express the necessary cytokines is as follows. From both animal and in vitro studies, IL-3, IL-6, IL-7, M-CSF, GM- CSF, stem cell factor, LIF and oncostatin M appear to either play a role in hematopoiesis, are expressed in the bone marrow or thymus, or the murine proteins show specificity for murine vs. human cells, thus suggesting that human HSC engrafted in a recipient mammal may not recognize the native mammalian cytokine. Genomic clones for these human genes can be obtained and transfected into ES cells. The ES cells can be introduced into blastocysts to transfer the donor transgenes into the germline of a recipient mammal. Isolation of genomic clones.
  • PCR primer sets are designed against either the 5' or the 3' end of genomic sequences so that constructs containing the genes can be identified by PCR.
  • these primer sets can be designed to distinguish between mouse and human genes so that the native mammalian genes are not mistakenly identified during a genomic or transcriptional screen of the transfected ES cells or suspected recipient mammals.
  • Human genomic libraries are screened using gene specific primer sets (See Example 2 and Ausubel for a general description of genomic library screening). If desired, positive clones can be further confirmed by either other primer sets for the same gene or by Southern blot analysis. Depending on the size of the gene, different types of cloning vectors and libraries are readily available. Genes up to approximately 15kb may be obtained from lambda libraries. Those up to 50kb may be identified from cosmid libraries. Larger genes over 50kb can be isolated from BAC, PAC, PI, YAC, MAC, or other such libraries. Demonstration of in vitro transcription from the genomic constructs.
  • transgenes will be expressed in mammalian hosts, it may be desirable to determine the ability of the human sequences to be transcribed by mammalian cells other than human, preferably murine before transfection into possibly rare ES cells.
  • Undigested or digested genomic constructs can be transfected by lipofection into a murine cell line that expresses the endogenous form of each cytokine.
  • Commercial lipofection reagents are widely available and may require optimization for a particular cell type to obtain adequate transfection efficiencies in a transient assay. The mRNA from the transfected cells is then analyzed for transcription of the contruct.
  • the mRNA can be electrophoresed according to standard procedures and then probed in a northern blot, or first strand cDNA can be synthesized by standard reverse transcription methods. The resulting cDNA can then be analyzed by labeled probe and Southern blot or by PCR methods. Selection ofES clones that contain human cytokine genes.
  • Two equally preferred embodiments can be used to combine all of the desired genes into one strain.
  • groups of transgenes are co-transfected into ES cells along with a selectable marker for neomycin resistance.
  • one group of genes can contain IL-7, SCF, and LIF constructs, and the second contain GM-CSF, M-CSF, and IL6 constructs.
  • all desired genes are co-transfected together. If all of the necessary transgenes are not present in the germline of one transgenic mammal, that mammal can be mated to a mammal comprising, in its germline, the necessary transgene to create offspring with all necessary transgenes.
  • the DNA constructs are digested with a desired restriction endonuclease that linearizes the DNA, if circular. Within each group, it is preferred that DNA constructs are mixed in equal molar ratio. However, one of skill will recognize that if more copies of one gene is desired, DNA constructs of that gene should be over-represented. For positive selection, a marker-containing plasmid can be mixed with these DNAs at molar ratio of about 4: 1. The DNA can then be introduced ES cells by lipofection or another suitable technique. The preferred transfection protocol is similar to that provided by the manufacturer of the lipofection reagent and is described in detail in Example 2.
  • PCR can be used to detect genomic DNA or cDNA made from RNA transcripts
  • ELISA and other antibody-based assays can be used to determine whether the gene product of the transgenes are synthesized in ES cells or are present extracellularly, and if such an assay is available, a functional assay can be used to detect the gene product.
  • mice A common method for studying the biology of human hematopoietic stem cells is to transfer them into immunocompromised mice.
  • the advent of gene targeting has led to a large variety of immunodeficient animals that are presently under evaluation for this purpose.
  • the animals are usually conditioned by sublethal irradiation, and are often supplemented with injections of human growth factors to augment the level of bone marrow engraftment and expansion of progenitor and/or mature cells.
  • mice with the SCID mutation In studies with mice with the SCID mutation, it appears that a dominant genotype present in the B6/129 mouse, if the mutation is placed in this mouse, serves to nullify some of the phenotypes observed with the mutation. Fewer effects are seen on a Balb/c background. Even fewer effects are seen on a NOD background. Thus, the preferred murine background for the RAG mutation may be NOD/SCID. It is not well understood why particular genetic backgrounds perform better than others, or if supplemental growth factors are beneficial. For example, transgenic SCID mice that express human genes for stem cell factor, GM-CSF, and IL-3, engraft more efficiently than non-transgenic SCID mice, but not any better than NOD/SCID mice. The human genes were driven by a viral promoter rather than the endogenous regulatory sequences, and most likely had abnormal patterns and levels of expression (Bock, et al J. Exp. Med. 182:2037-2043).
  • Sources of hematopoietic stem cells include, but are not limited to, umbilical cord blood (CB), bone marrow (BM) and mobilized peripheral blood (MPB).
  • CB umbilical cord blood
  • BM bone marrow
  • MPB mobilized peripheral blood
  • Human CB can be obtained, for example, from Advanced Bioscience Resources Inc (ABR), Alameda, CA, or Purecell, San Mateo, CA. CB is collected by ABR from local hospitals within 24 hours of shipping and is processed on site. Alternatively, human BM, CB, and/or MPB cells are obtained from Purecell as either fresh or frozen cells, and fractionated or unfractionated cells. Before use, all samples are tested for Hepatitis B and C, and HIV. Any experimental materials involving samples found to be virus positive are discarded immediately and animals removed, marked and disposed of in accordance with procedures for disposing contaminated animal carcasses.
  • ABR Advanced Bioscience Resources Inc
  • the haplotype of the donor hematopoietic stem cells may be selected on the basis of the test population of interest in order to determine the responsiveness of particular individuals to specific antigens, e.g., for the purpose of determining the allergenicity of proteins or peptides within the population.
  • lymphocytes from a source of hematopoietic stem cells are isolated, preferably by density separation and counted.
  • adult mice can receive from 0.1-10 x 10 7 total cells.
  • animals may also be transplanted with CD34 + cells purified from, for example, cord blood using, e.g., the Dynal Detach-a-Bead research grade separation system or by FACS sorting. Purified CD34 + cells from cord blood are then injected into neonatal or adult animals. In mice, approximately 10 5 cells are injected per pup, or about 5 x 10 5 cells per adult.
  • HSC-populations can be injected intravenously (iv).
  • adult mammals may be treated on day minus- 1 with rabbit polyclonal anti-asialo GM antibodies to reduce the activity of NK cells.
  • recipient mammals in particular mice, may be crossed onto a background deficient in NK cell function, such as perforin-deficient mice. Neonatal animals have little to no NK activity and, therefore, it is not necessary to treat them.
  • mice are the recipient mammals. They are injected into the tail vein by standard procedures. They may also be injected via the retro-orbital sinus, in which case animals are anesthetized first. Typically, a mixture of ketamine and xylazine delivered intraperitoneally or intramuscularly is used. Animals should be kept warm and eyes moistened during the procedure and monitored until they recover.
  • To inject cells into the retro-orbital sinus of neonatal mice pups are held below a light source to better visualize the eye vein. The needle is held parallel to the vein and inserted by aiming just below the surface of the skin. Cells are slowly injected while watching to determine that blood is cleared downstream of the needle point, and that swelling around the vein does not occur. After injection the needle is held in place for a short period to allow the cells to enter the circulation. If necessary, pups may be chilled briefly on ice to reduce their activity.
  • the recipient mammals may receive gamma- irradiation conditioning according to established experimental protocols (Bix, et al. Nature 349:329-331 (1991); Markowitz, et al Proc. Natl. Acad. Sci. 90: 2779-2783 (1993)).
  • a Mark I Model 30 sealed Cs-irradiator or similar instrument is used to administer doses ranging from 100-1000 cGy/animal according to manufacturer's protocol.
  • a lethal level of radiation may be administered as a split dose ⁇ e.g., 2 x 500R for Balb/c mice) for improved reduction of natural killer cells. Radiation is performed from 2-24 hours prior to injecting human hematopoietic cells.
  • lymphocytes from the recipient mammals are removed and investigated for the presence of human cell surface antigens.
  • CD45 is preferred. This detection it typically done by staining cells with a dye conjugated to an antibody that binds to human CD45, which is found on both B and T lymphocytes, and not murine CD45. See, Colas, et al, Transplantation 67:984 (1999). Other methods include PCR amplification of human DNA sequences from lymphocytes.
  • the mammals of this invention have a variety of uses.
  • the recipient animals of this invention cab be used as a model for determining the allergenicity of non-donor, e.g., non-human, macromolecules.
  • macromolecules include proteins, carbohydrates lipids, and other compounds. Proteins include but are not limited to commercially important enzymes such as bacterial proteases, fungal cellulases and the like.
  • the animals can be exposed to the test compounds and the immune response of the animals monitored. Based on the response in the animal model, the compounds can be modified so that the immune response is lessened, for example to decrease allergenicity, or increased, for example, if the compound is to be used as a vaccine.
  • the model of this invention can be used to determine the effect compounds have on a human immune system.
  • experimental compounds cannot be used on human subjects.
  • a mouse with a functional human immune system allows this more relevant preclinical testing to be done.
  • the recipient mammals generate fully human polyclonal or monoclonal antibodies to specific antigens.
  • no genetic manipulation of antibodies of other species, e.g., humanization would be needed, and would not pose the same biological hazard as purified antibodies from humans with accidental exposure to antigens possess.
  • the mouse of the instant invention can be used to determine whether humanized or other monoclonal antibodies will raise a response in a human immune system.
  • the mouse of this invention can be used to investigate the human cell mediated response to pathogens and other immunomodulatory compounds.
  • T cell epitopes present in proteins present in pathogens can be determined.
  • other proteins, such as proteins involved in an autoimmune response can be examined for the presence of T cell epitopes.
  • factors involved in regulating the development and function of human hematopoietic cells can be determined. These factors can serve to both identify the biological properties of these factors and to test their effectiveness as therapeutic molecules in preclinical models.
  • factors that augment hematopoietic reconstitution ⁇ e.g., after bone marrow transplantation or other states of immunodeficiency
  • mice were engrafted intravenously with 10 7 T-cell depleted BM cells approximately 72 hours after birth.
  • RAG mice were engrafted with syngeneic (H-2 b ) C57B1 6 or (129xC57B 6)Fl BM (RAG-(syn); H-2 b -> H-2 b ) or with fully allogeneic Balb/c BM (RAG- (allo); H-2 d -> H-2 b ).
  • SCID mice were engrafted with syngeneic Balb/c BM (SCID-(syn); H-
  • Hind leg bones (femur and tibia) were taken from euthanized 4 to 8 week old healthy donor mice and flushed using a 25 gauge needle attached to a 3 ml syringe filled with cold DPBS to obtain cells in a single cell suspension. Cells were washed with DPBS and pelleted. Since bone marrow preparations contain functionally mature T cells, T cells were depleted using 10 ⁇ g/ml anti-Thy-1 mAb (30H12) at 2-5 x 10 7 cells/ml for 30 minutes on ice. Cells were then centrifuged, resuspended in anti-rat IgG (MAR 18.5) culture supernatant at approximately 2-5xl0 7 cells/ml.
  • MAR 18.5 anti-rat IgG
  • Guinea pig and rabbit complement were then added to 1:20 v:v each and incubated at 37° for 45 minutes.
  • Viable cells were collected from the interface, washed in 2% FCS/DPBS, counted and resuspended in DPBS to a concentration of 3xl0 8 cells/ml with no FCS
  • mice were anesthetized using an injectable ketamine/xylazine (100 and 20 mg/kg, respectively) (-200 ⁇ l for average mouse) solution.
  • 3xl0 7 (100 ⁇ l) T-depleted bone marrow cells were injected intravenously via the retro-orbital sinus into the appropriate donor (same sex, 5 to 6 weeks of age).
  • Neonatal mice received no more than 50 ⁇ l of injectate containing 10 bone marrow cells via the retro-orbital vein with no injectable anesthetic, just reduction of body temperature with ice. Both syngeneic (same MHC haplotype) and allogeneic (MHC haplotype mismatched) mice were transplanted.
  • mice were left for 8 weeks to allow bone marrow to engraft at which time the mice (usually 3 in each group) were euthanized and organs removed for study.
  • T cells, B cells, and granulocytes were assessed in these areas using fluorescence- conjugated cell type-specific antibodies. See Table 1.
  • Table 1 Cell numbers and percentages for spleen, lymph node and thymus for representative 7 to 8 week old neonatally engrafted animals.
  • SCID animals tended to engraft higher percentages of B cells than RAG animals. This was found to be true over a number of different time points. Thymuses of eight week old animals engrafted well, and exhibited normal percentages of CD4 + and CD8 + single positive cells. Additionally, thymus flow cytometric profiles are comparable, including the percentage of CD3 + cells.
  • the RAG (allo) chimera depicted had slightly more immature double negative (DN) thymocytes; however, an enrichment for DN thymocytes was not a reproducible finding over the X number of RAG-(allo) mice examined during the course of this study.
  • mice of successful chimera studies were then immunized with 50 ⁇ g
  • FIG. 1A and C depict proliferative responses of RAG-(syn) (A) and SCID-(syn) (C) CD4 T cells to LPS-induced splenic blasts from C57B1/6, Balb/c and third party H-2 expressing mice. Both RAG-(syn) and SCID-(syn) were tolerant to self, but were responsive to alloantigens.
  • RAG-(allo) mice were tolerant to both C57B1/6 and Balb/c and were responsive to third party H-2 k alloantigens.
  • SCID-(allo) was functionally compromised in that a small response was mounted to Balb/c derived stimulators, indicating incomplete tolerance to self MHC.
  • the response to third party H-2 k expressing stimulators was impaired.
  • a control RAG-(syn) created with the same BM inoculum as injected into the SCID-(allo) is shown in panel D.
  • RAG-(allo) mice were found to be tolerant to both donor and host MHC, and were responsive to third party, but SCID-(allo) was functionally impaired.
  • RAG-(allo) splenocytes responded normally to the T cell mitogen PHA, while SCID-(allo) T cells were hyporesponsive. All engrafted animals' splenocytes showed control level responses to LPS.
  • RAG-(allo) animals were immunized in the hind foot pads, then CD4 T cells were purified from draining lymph nodes. Primed CD4 + T cells were co-cultured with antigen-pulsed LPS-induced splenic blasts, and proliferation was assessed.
  • Figure 3 shows the proliferative responses of KLH- primed draining CD4 + T cells from two different RAG-(allo) animals.
  • the response to KLH pulsed C57B1/6 stimulators was found to dominate, indicating preferential selection of CD4 + T cells to recognize antigen in the context of the thymic epithelium MHC.
  • an antigen-specific response to KLH-pulsed Balb/c blasts represented approximately 30% of the control response.
  • T cells had been demonstrated to occur on transfected fibroblasts injected intrathymically.
  • Selection of MHC class II restricted cells was demonstrated when the thymocytes shared MHC haplotypes with both the thymic epithelium and the injected fibroblasts. This constraint was not evident for the selection of MHC class I restricted cells. While thymic positive selection by BM cells for CD4 + T cells did not occur in BM engrafted irradiated adult MHC class Il-deficient mice, others have demonstrated functional restriction to donor MHC using parental into FI bone marrow chimeras.
  • the results presented here suggest that the RAG2 "/_ mutant strain is unique because it provides an environment that allows for BM derived cell selection events to occur efficiently and in the absence of haplotype sharing by the thymic epithelium.
  • the uniqueness of the RAG mouse may be due to the non-leaky nature of the mutation.
  • the SCID mouse is well known to occasionally develop cells with functional antigen receptors. The development of even a few antigen-receptor positive cells may be enough of a signal to the thymic microenvironment to induce functional changes which preclude the recruitment and/or functionality of donor BM-derived cells capable of positive selection. Both neonatal and adult SCID mice were used in these experiments and neither exhibited the capacity to support donor allogeneic BM restriction.
  • RAG mice may represent a model whose lymphopoietic microenvironments are functionally frozen at a fetal developmental stage, as has been suggested by thymocyte phenotype. If RAG mice represent a "fetal" model, then selection onto BM derived cells may be a normal event in the thymus, and this phenomenon may not have been routinely detected in other systems due to the use of the SCID mouse, or due to secondary effects of irradiation.
  • Example 2 Development of transgenic mice expressing human cytokine genes. Based on both animal and in vitro studies, the following set of transgenes either play a role in hematopoiesis, are expressed in the bone marrow or thymus, and/or the murine proteins show specificity for murine vs. human cells: IL-3, IL-6, IL-7, M-CSF, GM-CSF, stem cell factor, LIF and oncostatin M. Genomic clones for this set of human genes were obtained and used to select ES cell clones to derive transgenic mice. Isolation of genomic clones.
  • PCR primer sets were designed against either the 5' or the 3' end of genomic sequences so that constructs containing the genes could be readily identified by PCR. In addition, these primer sets were designed to distinguish between mouse and human genes. The following primers and conditions were used to identify the human clones: human IL-7
  • 3181-SP6-R2 5' GGACAGCATGAAAGAGATTGGAGC 3' (SEQ ID NO:2) product size: 121bp annealing temperature: 60°C
  • human SCF 20180-T7-F 5' ATGCAAGCTTGATTCATCCTC 3' (SEQ ID NO:3)
  • 20180-T7-R 5' CGTGGTTTTTATTCGAAATGC 3' (SEQ ID NO:4) product size: 176bp annealing temperature: 60°C
  • human LIF hLIF-3F 5' TTCCTCTGGGTAAAGGTCTGTAAG 3' (SEQ ID NO:5)
  • hLIF-3R 5' TCCACTTGTAACATTGTCGACTTC 3' (SEQ ID NO:6)
  • product size 388bp annealing temperature: 60°C
  • GMCSF2/3F 5' CTCAGAAATGTTTGACCTCCAG 3' (SEQ ID NO:7)
  • GMCSF2/3R 5' GTCTGTAGGCAGGTCGGCTC 3' (SEQ ID NO: 8) product size: 729 bp Annealing temperature: 60°C
  • 31HU-MCSF-F 5' GAAGACAGACCATCCATCTGC 3' (SEQ ID NO:9)
  • 31HU-MCSF-R 5' TGTAGAACAAGAGGCCTCCG 3' (SEQ ID NO: 10) product size: 401 bp
  • 51-BSF2-F 5' TGGTGAAGAGACTCAGTGGC 3' (SEQ ID NO: 11)
  • 51-BSF2-R 5' TACTTCAAGGCGTCTCCAGG 3' (SEQ ID NO: 12) product size: 225 bp annealing temperature: 60°C Human genomic PI (for IL-6, M-CSF, and LIF), BAC(for IL-7 and SCF), and PAC(for GM-CSF) libraries (Genome Systems, Inc.) were screened using the gene specific primer sets, above. IL-3 and OM are closely lined to GM-CSF and LIF, respectively, and were not screened for in the first round. Positive clones were further confirmed by either other primer sets for the same gene or by southern blot. The following primers were used for PCR confirmation:
  • 51 IL7F 5' GGCGTTGAGAGATCATCTGG 3' (SEQ ID NO: 13)
  • 51 IL7R 5' TGCAGCTGGTTCCTCTTACC 3' (SEQ ID NO: 14) product size: 342 bp Annealing temperature: 60°C
  • FIL7 5' CATACAGCATTACAAATTGC 3' (SEQ ID NO: 15)
  • RIL-7 5' TGTAGATTCTGGCCTGC 3' (SEQ ID NO: 16) product size: 322 bp annealing temperature: 60°C
  • human SCF SCF-DF 5' CCAAACTTCTGGGGCATTTA 3' (SEQ ID NO: 17)
  • SCF-DR 5' CTCTCCACTGTCCCTGCTTC 3' (SEQ ID NO: 18) product size: 220 bp annealing temperature: 60°C
  • SCF-3F2 5' GCATGGAGCAGGACTCTATT 3' (SEQ ID NO: 19)
  • SCF-3R4 5' AGTTTGTATCTGAAGAATAAAGCTAGG 3' (SEQ ID NO:
  • human LIF hLIF-3F 5' TTCCTCTGGGTAAAGGTCTGTAAG 3' (SEQ ID NO:21)
  • hLIF-3R 5' TCCACTTGTAACATTGTCGACTTC 3' (SEQ ID NO:22) product size: 388bp annealing temperature: 60°C
  • human OM OSM5F1 5' CCTAAAGTGAGGTCACCCAGAC 3' (SEQ ID NO:23)
  • OSM5R1 5' CTCTGTGGATGAGAGGAACCAT 3' (SEQ ID NO:24) product size: 456 bp annealing temperature: 60°C
  • OSM3F1 5' GAGATCCAGGGCTGTAGATGAC 3' (SEQ ID NO:25)
  • OSM3R1 5' GATGCTGAGAAGGGGAGAGAG 3' (SEQ ID NO:26) product size: 384 bp annealing temperature: 60°C
  • GMCSF1/2F 5' AGCCTGCTGCTCTTGGGCAC 3' (SEQ ID NO:27)
  • GMCSF1/2R 5' CTGGAGGTCAAACATTTCTGAG 3' (SEQ ID NO:28) product size: 282 bp annealing temperature: 60°C
  • GMCSF3/4F 5' ATGGCCAGCCACTACAAGCAG 3' (SEQ ID NO:28A)
  • GMCSF3/4R 5' GGTGATAATCTGGGTTGCACAG 3' (SEQ ID NO:29) product size: 878 bp annealing temperature: 60°C
  • IL-3F 5' CGTCTGTTGAGCCTGCGCAT 3' (SEQ ID NO:29A)
  • IL-3R 5' AAATCTCCTGCCATGTCTGCC 3' (SEQ ID NO:29B) product size: 298 bp annealing temperature: 60°C
  • human M-CSF HUM-CSF-5F1 5' GAGGGAGCAAGTAACACTGGAC 3' (SEQ ID NO:30)
  • HUM-CSF-5R1 5' CGTCTTCCTAGTCACCCTCTGT 3' (SEQ ID NO:31) product size: 322 bp annealing temperature: 60°C
  • IL6-3F 5' CTAGATGCAATAACCACCCCTG 3' (SEQ ID NO:32)
  • IL6-3R 5' CAGGTTTCTGACCAGAAGAAGG 3' (SEQ ID NO:33) product size: 217 bp annealing temperature: 60°C
  • Plasmid DNA from PI, BAC, or PAC clones was prepared using the KB-100 Magnum columns (Genome Systems, Inc.). Detailed experimental procedures were described in detail in the user's manual supplied by the manufacturer. To quantify DNA concentrations, DNA constructs were digested with EcoRI, followed by electrophoresis on 0.8% agarose gel along with DNA standards with known concentration. Plasmid DNA concentrations were determined by comparison with the standards.
  • IL-7 BAC20854 (lOOkb), BAC2267C7 (1 lOkb), PAC24404 (90kb)
  • GM-CSF PAC21689 (150kb), PAC21691 (194kb) M-CSF: Pl-3882 (55kb)
  • the sizes of the clones were determined by restriction digestion with Notl followed by pulse-field gel electrophoresis.
  • the gel running conditions were set as followed: initial switch time: 1 sec final switch time: 6 sec total run time: 12 hrs voltage: 6 v/cm angle: 120° Demonstration of in vitro transcription from the genomic constructs
  • MM54 cells a murine cell s line that expresses the endogenous form of each cytokine, ATCC # 6434-CRL
  • Tfx50 Promega
  • the cells were harvested 48 hours later for mRNA analysis.
  • Total RNA was prepared using the UltrspecTM RNA isolation system (Biotecx). lOmg of gelatin carrier protein was added prior to ethanol precipitation to enhance RNA yield.
  • First strand cDNA was synthesized by standard reverse o transcription methods.
  • RNA was resuspended in 29.5 ml of H 2 O, and mixed with 10 ml 5x first strand buffer, 2.5 ml lOmM dNTP, 5 ml 0.1M DTT, 1 ml 0.5mg/ml random primer, and 2 ml M-MLV reverse transcriptase (Life Technologies). The reaction was incubated at 37°C for 1 hour, and the cDNA was purified by Phenol/Chloroform extraction. The resulting cDNA was then resuspended in 20 ml of H 2 O. Human specific transcripts were s analyzed by nested-PCR methods.
  • CTIL-7F 5' ATGTTCCATGTTTCTTTTAGGTATATCT 3' (SEQ ID NO:35)
  • CTIL-7R 5' TGCATTTCTCAAATGCCCTAATCCG 3' (SEQ ID NO:36) 5 product size: 681 bp annealing temperature: 60°C 2 nd round primers:
  • ML-7F1 5' GCATCGATCAATTATTGGACAGC 3' (SEQ ID NO:37)
  • WL-7R1 5' CTCTTTGTTGGTTGGGCTTCAC 3' (SEQ ID NO: 38) o product size: 280 bp annealing temperature: 60°C
  • human SCF 1 st round primers hSCF5F3: 5' CACTGTTTGTGCTGGATCGCAG 3' (SEQ ID NO:39)
  • hSCFB-R 5' TGAGACACGTGCTTTCTCTTCC 3' (SEQ ID NO:40) product size: 1173 bp annealing temperature: 60°C
  • hSCF3Fl 5' CAGCCAAGTCTTACAAGGGCAG 3' (SEQ ID NO:41)
  • hSCFA-R 5' AGACCCAAGTCCCGCAGTCC 3' (SEQ ID NO:42) product size: 364 bp annealing temperature: 60°C
  • CT-hGMCSF-F 5' ATGTGGCTGCAGAGCCTGCTGC 3' (SEQ ID NO:47)
  • CT-HGMCSF-R 5' CTGGCTCCCAGCAGTCAAAGGG 3' (SEQ ID NO:48) product size: 424 bp annealing temperature: 60°C 2 nd round primers: hGMCSF-Fl: 5' CGTCTCCTGAACCTGAGTAGAG 3' (SEQ ID NO:49)
  • hGMCSF-Rl 5' CAAGCAGAAAGTCCTTCAGGTTC 3' (SEQ ID NO:50) product size: 276 bp annealing temperature: 60°C
  • CT-ML6F 5' ATGAACTCCTTCTCCACAAGCGC 3' (SEQ ID NO:51)
  • CT-ML6R 5' GAAGAGCCCTCAGGCTGGACTG 3' (SEQ ID NO:52) product size: 628 bp annealing temperature: 60°C
  • ML6-F2 5' TGGGGCTGCTCCTGGTGTTGC 3' (SEQ ID NO:53)
  • ML6-R2 5' CAGGAACTCCTTAAAGCTGCG 3' (SEQ ID NO:54) product size: 560 bp annealing temperature: 60°C
  • human M-CSF 1 st round primers: hMCSF-F: 5' CTCTCCCAGGATCTCATCAGCG 3' (SEQ ID NO:55) hMCSF-Rl: 5' CAGGATGGTGAGGGGTCTTAG 3' (SEQ ID NO:56) product size: 492 bp annealing temperature: 60°C 2 nd round primers: hMCSF-F: 5' CTCTCCCAGGATCTCATCAGCG 3' (SEQ ID NO:57) hMCSF-R2: 5' TTGCTCCAAGGGAGAATCCGCTC 3' (SEQ ID NO:58) product size: 410 bp annealing temperature: 60°C
  • genomic clones produced human-specific transcripts and were chosen for use in ES cell transfection:
  • IL-7 BAC20854
  • ES cells were transfected with 3 sets of genes of human hematopoietic growth factors.
  • the liposome reagent, Tfx-50 (Promega) was used according to the manufacturer's instructions.
  • Each set of genes contained equal molar concentration of 3 linearized growth factor DNA.
  • the first DNA set (GM-CSF set) contained GM-CSF, M-CSF and IL-6.
  • the second DNA set (IL-7 set) contained IL-7, SCF and LIF.
  • the third DNA set contained all 6 transgenes. Plasmid
  • PGK-Hyg for RAG"'" ES cells
  • PGK-Neo for 129Sv/J wild type ES cells
  • the growth factor DNA was linearized by digestion with Notl .
  • the growth factor D ⁇ A mixtures (2.18 ⁇ g) and linearized selectable marker D ⁇ A (0.42 ⁇ g) was mixed in 1 ml serum free Opti-MEM media and incubated with 170.6 ⁇ g (97.5 ⁇ l) Tfx-50 for 15 minutes at room temperature.
  • the molar ratio of marker versus D ⁇ A mixture was 4:1 and the ratio of Tfx-50 versus total D ⁇ A (marker and growth factor D ⁇ A) was 25: 1.
  • G418 400 ⁇ g/ml selection was started 24 hrs post transfection. Drug resistant ES colonies were picked after 10 to 14 days of selection.
  • human LIF The 388bp PCR fragment(hLIF-3F/hLIF-3R) was subcloned and used as the probe (hLIF-3F/hLIF-3R; SEQ ID NO:21 and 22).
  • human GM-CSF The 424 cDNA fragment was generated by PCR with primer set CT-hGMCSF-F/CT-hGMCSF-R (SEQ ID NO:47 and 48) from human 293 cell cDNA samples.
  • human M-CSF The 400bp probe was generated with PCR primer set 31HU- MCSF-F/31HU-MCSF-R (SEQ ID NO:9 and 10).
  • human IL-6 The 298bp probe was generated with primer set 51 -BSF2-F/51-
  • BSF2-R (SEQ ID NO: 11 and 12).
  • ES cell clones were analyzed by Southern blotting to confirm the presence of genomic sequences and to determine relative copy number in comparison to human DNA controls. 10 » g of DNA from each ES cell clones was digested with either EcoRI (for IL-7 and SCF), BamHI (for LIF and IL-6), or Hindlll (for GM-CSF and M-CSF) and resolved on 1 % agarose gel. The DNA was transferred to a nylon membrane by alkaline transfer (user's manual, Genescreen Plus). The membranes were then prehybridized over night at 420C with standard formamide containing buffer (Ausubel). Each probe was labeled using the Prime-It II Kit (Stratagene) and then added to the membrane.
  • EcoRI for IL-7 and SCF
  • BamHI for LIF and IL-6
  • Hindlll for GM-CSF and M-CSF
  • the hybridizations were carried out overnight with rotation at 420C.
  • the membranes were washed two times at room temperature with the low stringency buffer (2xSSC, 0.1% SDS) for 10 min each, and two more times at 500C for 10 min each.
  • the membranes were then dried by blotting in between two layers of Whatman paper, and exposed to phospho screens (Molecular Dynamics).
  • the image was quantified by the STORM System (Molecular Dynamics). The copy number for each transgene was derived by comparison with the human control.
  • the copy number for the same gene varied among different clones. For example, clone 6 had one copy of IL-6 gene whereas clone 15 had two copies of the same gene. On the other hand, within the same clone, the copy number of one gene varied from the other gene. For example, clone 18 had one copy of IL-7 gene, two copies of SCF gene, and three copies of LIF gene. Generation of transgenic mice
  • ES cell clones containing the human cytokine genes are used to derive transgenic mice as described in Robertson (ed), Teratocarcinomas and embryonic stem cells - a practical approach (1987), IRL Press.
  • ES cells are injected into 3.5 day p.c. C57BL/6 embryos and implanted into the uterus of pseudopregnant females and allowed to develop to birth. Male chimeras are mated with wild type C57B1/6 females to obtain germline transgenic lines. Identification of mice with human transgenes
  • mice that have incorporated human transgenes There are two ways to identify mice that have incorporated human transgenes: Southern Blot and PCR analysis. It is preferable to use PCR to genotype the mice due to its speed and ease of experimental procedure. However, whenever there is concern about the validity of PCR results, Southern Blot should be carried out to confirm the results. Briefly, DNA samples were isolated from the tips of mice tails following standard protocols (Qiagen manual, DNeasy 96 Tissue Kit). PCR analysis using human-specific primer sets (see Isolation of genomic clones) was performed for each transgene. A positive control sample containing human DNA and a negative control sample containing mouse DNA were also carried out at the same time to ensure the specificity of the PCR products. Only mice that contain the expected human transgenes were selected for further breedings and experiments.
  • RNA samples were prepared (RNeasy Midi Kit, Qiagen) from nine tissues of each transgenic mouse, including spleen, thymus, liver, kidney, heart, muscle, lung brain, and bone marrow.
  • Total cDNA was prepared as previously described (see Demonstration of in vitro trascription from the genomic constructs).
  • Gene expression analysis for each transgene was carried out by nested-PCR (see above). To ensure the reproducibility of the results, at least two mice from each genotype were analyzed by this method.
  • mice from clone 71 which have human IL-6, M-CSF, and GM-CSF, showed expression of all three transgenes in different tissues.
  • Human IL-6 was mainly expressed in the spleen and thymus.
  • Human GM-CSF expression was restricted in the thymus.
  • human M-CSF has a much wider tissue distribution, with transcripts in the spleen, thymus, liver, kidney, heart, muscle, lung, and brain.
  • Mice from clone 75 which have human IL-7, SCF, and LIF, also showed expression of all three transgenes in tissues.
  • Human IL-7 and SCF seem to have a wide distribution pattern similar to M-CSF, whereas human LIF expression was restricted to the brain.
  • mice from other ES clones that contain either IL-6, M-CSF, and GM-CSF, or IL-7, SCF, and LIF were also analyzed by the same method. Although the expression pattern vary in certain tissues, the overall pattern was similar. This variation may be attributed to the difference in the insertion site of the transgenes and the copy numbers for each gene. The murine endogenous genes were also analyzed by nested-PCR. Despite differences in certain specific tissues, the expression pattern largely agrees with that of the human transgenes.
  • a monolayer of bone marrow stromal cells will form and adhere to the bottom of flasks.
  • Hematopoietic stem/progenitor cells then adhere to the stromal layer.
  • the cell number of differentiated cells can be counted and stained to determine the extent of proliferation and differentiation of the hematopoietic stem cells.
  • the cultures were irradiated to eliminate murine hematopoiesis and to stop proliferation of stromal cells.
  • Irradiation maintained the ability of the stromal cells to support human hematopoiesis in vitro.
  • human cord blood mononuclear cells were added to the culture. Cell counts were made weekly, as was a 50% change in media. Every week, the non-adherent cells were counted and analyzed by FACS.
  • Stromal cells from clone 71 transgenic mice supported human hematopoiesis in vitro better than clone 12 and clone 75.
  • Non-adherent cells harvested from transgenic co- cultures were greater in number than wild type co-cultures established from clone 71 littermates.
  • Mixtures of stromal cells from clone 71 and 75 transgenic mice supported human hematopoiesis in vitro better than stromal cells from either clone 71 or clone 75 alone, in terms of non-adherent cellularity.
  • Example 3 Ability of irradiated H-2 d -> H-2 b C1D RAG-2 and H-2 b C2D/RAG-2 bone marrow chimaeras to support functional engraftment.
  • MHC class I deficient (ClD)/RAG-2 and class II deficient (C2D)/RAG-2 mice were tested to assess whether MHC was necessary to facilitate alloengraftment.
  • Unirradiated allogeneic ClD/RAG-2 chimeras produced antigen specific IgG antibody when chimeras contained greater than 10% donor B lymphocytes in the peripheral blood.
  • irradiation (800 rads) of ClD/RAG-2 hosts led to a relative increase in the levels of donor cell engraftment, with a higher percentage of B cells in peripheral blood. All of these chimeras produced good antigen specific IgG antibody to KLH.
  • radiation conditioning was not found to be an absolute requirement for the functional engraftment of allogeneic ClD/RAG-2 chimaeras, irradiated hosts supported more extensive cellular and functional engraftment.
  • the first set of chimeras (i-iv) were designed to determine whether RAG-2 mutant mice on an H-2d background have the ability to support allogeneic donor-specific immunity. All of these chimeras supported functional engraftment.
  • the second set of chimeras (v-vi) were prepared to test the ability of SCID mutant mice, on an H-2b background, to support allogeneic donor-specific immunity.
  • the allogeneic chimeras engrafted very poorly relative to the syngeneic group (thymuses were too small to sample) which is very similar to the H-2 d into H-2 b SCID results reported. These results suggest there is a significant difference between the SCID and RAG-2 mutations to support the cellular development of T lymphocytes independent of MHC haplotype.
  • RAG-2 mice appeared to be unique relative to other immunodeficient strains in supporting donor-restricted immunity until transplantation studies in RAG-1 and TCR ⁇ / ⁇ (with irradiation to eliminate host B cells) mice were performed. Although unirradiated RAG- 1 chimaeras did not support engraftment from allogeneic donors, irradiated (800 rads) RAG-1 mice supported functional engraftment. Both RAG-1 and RAG-2 genes are required to initiate T and B lymphocyte receptor rearrangements. In addition, studies showed that irradiated TCR ⁇ / ⁇ mice also supported donor-derived immunity.
  • SJL- TgN(TcrAND)53Hed mice were obtained from Jackson Laboratory and backcrossed onto AKR (H-2 k ) mice to provide the appropriate MHC Class II molecule (I-E k ) for positive selection of TCR- transgenic (TCR-tg) T cells (which recognize cyt-c in the context of I-E ).
  • Bone marrow from these mice was used to engraft H-2 b RAG-2 mice which do not express the cognate MHC Class II receptor for the transgenic T cells. This created a host environment for the transgenic bone marrow cells that is functionally equivalent to a Class II knockout background. Donor T cell development would therefore be dependent on donor-derived antigen presenting cells to positively select TCR-tg T cells.
  • TCRtgxAKR -> RAG-2 chimaeras The percentages of thymocytes in TCRtgxAKR -> RAG-2 chimaeras were similar to that of wild type AKR->RAG-2 mice. Both of these chimeras have overall lower percentages of T cells in comparison to TCRtgxAKR donor mice consistent with other haplotype combinations of allogeneic RAG-2 chimaeras. The level of B cell reconstitution was relatively high (greater than 10%). Both the TCRtgxAKR -> RAG-2 and AKR->RAG-2 were immunized with cytochrome c to determine their ability to produce antigen-specific IgG antibody.
  • An alternative embodiment of the invention involves the expression of human HLA Class II molecules in MHC Class II-bearing tissues of the mouse.
  • donor HSC are introduced that express the same HLA haplotype(s) as the transgemc HLA Class II molecules.
  • This combination provides cognate interactions between donor T lymphocytes, which develop in the context of the transgenic HLA Class II molecules expressed on the host tissues (in particular the thymus), and donor-derived B lymphocytes.
  • the methods for making transgenic mice that express human HLA Class II molecules of the DR3 haplotype are taught, these methods can be applied to any desired HLA haplotype, including those for Class I genes, for the purpose of evaluating responses representing other individuals in the population.
  • YAC 4D1 spans approximately 550kb of the HLA Class II region (Ragoussis et al. Nucleic Acids Research, 20:3135-3138 (1992), and Ragoussis, et al in Tsuji, et al. (eds.) HLA 1991, Oxford Univ. Press (1992)). It is bordered on one end by the RING3 gene, and the opposite end by DRa. It contains the DRa, DRb, DQa, and DQb chains of the DR3 haplotype. Yeast cultures containing the 4D1 YAC were grown in AHC media.
  • Agarose blocks were formed in 1% low melting temperature agarose containing approximately 3xl0 9 cells/ml.
  • the YAC was separated from yeast chromosomes by pulse-field gel electrophoresis in a 1% low melting temperature agarose gel. Running conditions were: 200V, 40 hours duration, with a 50 second switch time. After electrophoresis, the gel was cut lengthwise at the outer edges and in the middle. The three slices were stained with ethidium bromide to visualize the position of the 4D1 YAC vis a vis the host chromosomes. The position of the 4D1 YAC was marked with notches and the marker pieces realigned with the unstained gel sections. A horizontal band containing the 4D1 YAC was excised based on the position of the notches.
  • the 4D1 gel slices were equilibrated twice for one hour/each in IX gelase buffer (Epicentre Technologies) on a rotating platform. The buffer was changed after the second rinse and left at 4°C overnight. Based on the input amount of yeast DNA, the estimated amount of 4D1 DNA in the entire gel was approximately 8 mg. The following day, the gel slices were cut into 20 blocks weighing approximately one gram each, and placed into individual tubes. The gel fragments were melted at 70°C for 20 minutes and then equilibrated at 45°C for 15 minutes. Ten units of Gelase (Epicenter Technologies, lunit/ml) was added per tube and incubated at 45°C for 45 minutes. The gelase step was then repeated. Transfection of YAC DNA into ES cells Each agarose block contained approximately 400 ng of YAC DNA, or
  • ES cells had been split 1:2 the day before and seeded onto 100mm plates. The cells were trypsinized on the day of transfection and resuspended at 3xl0 6 cells/ml in serum-free ES media. One ml of the ES cells was placed into 60mm dishes with eight ml of serum-free ES media.
  • DNA lipid mixture was added and the cells were incubated at 37°C for 4 hours. Afterward, the lipofection/ES cell mixture was plated onto feeder cells at lxlO 6 ES cells per 100mm dish. G418 [400 mg/ml] was added to the media the following day and changed every other day for 9-12 days until clones appeared. Individual clones were picked and grown in 96 wells. The cells were split 1:2 into duplicate 96 well plates. One plate was frozen in situ and the other was harvested for DNA analysis.
  • 1231 F GCG GAG AGA CCT GGA ACG (SEQ ID NO:61) 1231 R: TCA GCA TCA GCA TCT GCA (SEQ ID NO:62)
  • GH26 GTG CTG CAG GTG TAA ACT TGT ACC AG (SEQ ID NO:63)
  • GH27 CAC GGA TCC GGT AGC AGC GGT AGA GTT G (SEQ ID NO:64)
  • GH28 CTC GGA TCC GCA TGT GCTACTTCA CCA ACG (SEQ ID NO:65)
  • GH29 GAG CTG CAG GTA GTTGTGTCTGCA CAC (SEQ IDNO:66)
  • DR ⁇ R ATA GCC CATGATTCCTGA GC (SEQ ID NO:68)
  • GH46 CCG GAT CCTTCGTGT CCC CAC AGC ACG (SEQ ID NO:69)
  • GH50 CTC CCC AAC CCC GTA GTT GTGTCT GCA (SEQ ID NO:70)
  • ES cells were injected into 3.5 days p.c. C57BL/6 embryos and implanted into the uterus of pseudopregnant females and allowed to develop to birth. Chimeric males were mated with wild type C57B1/6 females to obtain germline transgenic lines. Antibody response of transgenic mice
  • mice Four D1/C2D/RAG-2 (HLA- transgenic) mice were bled and their sera tested for I-Ealpha, I-Ebeta and DRalpha expression using FACS analysis. Mice that were confirmed to express surface DR but not I-Ealpha were chosen for functional testing. These mice were immunized via the footpad with 50 ⁇ g/mouse. Three proteins were used as an immunogen. Two were fungal proteases and the third was a hybrid of the two proteins which has been found to be of reduced allergenicity in an in vitro human T cell epitope assay. The proteins were emulsed with CFA for total volume of 100 ⁇ l per footpad and boosted 2 weeks later with the same concentration in IFA in the other footpad.
  • mice were bled 1 week later and sera samples were tested for antibodies to the appropriate protein by ELISA.
  • a second set of animals were immunized for antibody responses but using a different protocol which is as follows: mice were immunized intraperitoneally with 50 ⁇ g/mouse of the same three proteins emulsed with CFA for total volume of 100 ⁇ l per mouse and boosted ip 2 weeks later with the same concentration in IFA. Mice were bled 1 week later and sera samples were tested for antibodies.
  • mice To assess whether the T cells in these transgenic mice were functioning normally, a positive control immunogenic peptide known to be a major T cells epitope (HSP65 1-20) was used. Mice were immunized according to a previously reported protocol by Geluk et. al. Popliteal lymph nodes were taken and T cell proliferation assessed using a T cell proliferastion assay (also reported by Geluk et. al.)
  • Example 5 Engraftment of transgenic immunodeficient mice with human hematopoietic stem cells.
  • Transgenic immunodeficient mice that express human IL-3, IL7, SCF, LIF, IL6, M-CSF, OM, and GM-CSF are engrafted with a source of human hematopoietic stem cells.
  • the age for engraftment is approximately 72 hours after birth.
  • the preferred source of donor cells is umbilical cord blood.
  • the haplotype of the donor cells is selected on the basis of the test population of interest in order to determine the responsiveness of particular individuals to specific antigens, e.g., for the purpose of determining the allergenicity of proteins or peptides within the population.
  • Source material for transplantation Human cord blood (CB) is obtained from Advanced Bioscience Resources Inc.
  • ABR Alameda
  • CA Purecell, San Mateo, CA.
  • CB is collected by ABR from local hospitals within 24 hours of shipping and is processed on site.
  • human bone marrow (BM), CB, and/or MPB cells is obtained from Purecell as either fresh or frozen cells, and fractionated or unfractionated cells. All samples are tested for Hepatitis B and C, and HIV. Any experimental materials involving samples found to be virus positive are discarded immediately and animals removed, marked and disposed of in accordance with procedures for disposing contaminated animal carcasses. Throughout the course of the experiment, all samples are treated under the assumption that they may be contaminated with human blood borne pathogens (Biosafety Level 2, BL-2). All personnel handling mice with human blood cells should receive the hepatitis B vaccine.
  • CB-17/SCID and NOD/SCID mice are engrafted as experimental controls, as they are currently the strains of choice for investigators working in the field (Bhatia et al, Proc. Nat'l Acad. Sci. 94:5320-5325 (1997), Cashman et al Blood 89: 4307-4316 (1997), Hogan, et al Blood 90(l):85-96 (1997), Vormoor, et al Blood 83:2489-2497 (1994), and Wang, et al. Blood 89:3919-3924 (1994)).
  • human HLA DR transgenic mice expressing human cytokine genes are engrafted.
  • mice HSC-enriched populations are injected intravenously (i.v). Neonatal mice should receive no more than 50 ⁇ L of cells. Pups are held below a light source to better visualize the eye vein. The needle is held parallel to the vein and inserted by aiming just below the surface of the skin. Cells are slowly injected while watching to determine that blood is cleared downstream of the needle point, and that swelling around the vein does not occur. After injection the needle is held in place for 10-30 seconds to allow the cells to enter the circulation. The animals are kept warm and the eye moistened until recovery. If necessary, pups may be chilled briefly on ice to reduce their activity. Analysis of mice
  • mice are analyzed for reconstitution of human immune cells.
  • Peripheral blood is drawn from the orbital sinus or tail vein and analyzed by to flow cytometry using monoclonal antibodies specific for human hematopoietic cells. Animals are sacrificed and their peripheral immune system organs examined for the presence of human cells by flow cytometry (Pflumio, et al. Blood 88:3731- 3740 (1996); Dick, et al Stem Cells 15 Suppl 1:199-203 (1997); Ramirez, et al. Exp. Hematol. 26:332-344 (1998); Hogan, et al.
  • human HSC chimeras Four types are envisioned by the invention.
  • the strains of host mice all contain human growth factor transgenes that provide the necessary species-specific factors for supporting the human donor HSCs.
  • the host strains vary in the nature of their immunodeficiency, and whether they include the transgenic expression of HLA molecules.
  • the first type of chimeras consists of RAG-1 or RAG-2 mutant mice that contain human CTG.
  • allogeneic RAG chimeras display the ability to support donor-restricted immune responses.
  • human CTG RAG mice are engrafted with human HSC from umbilical cord blood, and develop human T and B lymphocytes which function to provide antigen-specific T and B cell responses.
  • RAG mice support the development of donor haplotype-restricted T cells
  • the major developmental pathway for thymocytes involves positive selection in the context of MHC molecules expressed on thymic epithelial cells.
  • the second type of chimeras thus consists of human CTG RAG mice that also express human HLA genes in host tissues that endogenously express MHC molecules. This provides an additional pathway for the donor human HSC to develop in the RAG-mutant host, and results in some mature T cells that are restricted to the HLA haplotype of the transgenes. It is preferable to match the HLA haplotype of the donor HSC to that of the transgenic HLA molecules such that the mature T cells can subsequently interact with donor-derived B lymphocytes through cognate T cell receptor: HLA interactions.
  • the third type of chimeras are prepared in mice that are genetically immunodeficient by means other than a mutation in the RAG genes, and express human HLA transgenes of the same haplotype as the source of donor HSC.
  • human GFTG SCID mice are mated with DR3 Class II transgenic mice and used to engraft HLA DR3 haplotype HSC.
  • Some of the human T lymphocytes are positively selected in the context of HLA DR3 Class II molecules and are capable of interacting with DR3+ donor B lymphocytes to produce antigen-specific antibodies.
  • the fourth type of chimeras are prepared in immunocompetent human CTG mice that express human HLA transgenes of the same haplotype as the source of donor HSC.
  • these hosts In order to engraft human HSC, these hosts must be depleted of their endogenous immune system, e.g., with a lethal dose of irradiation or other method.
  • the pattern of lymphocyte development is then similar to that of the third type of chimeras, above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des modèles transgéniques de mammifère non humain de maladies humaines, des procédés de fabrication de ces modèles ainsi que de procédés d'utilisation de ces modèles pour évaluer l'efficacité de traitements thérapeutiques prophylactiques, pour évaluer le potentiel antigénique de composés, entre autres.
EP00961450A 1999-08-31 2000-08-30 Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur Withdrawn EP1209968A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15168899P 1999-08-31 1999-08-31
US151688P 1999-08-31
PCT/US2000/023971 WO2001015521A1 (fr) 1999-08-31 2000-08-30 Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur

Publications (1)

Publication Number Publication Date
EP1209968A1 true EP1209968A1 (fr) 2002-06-05

Family

ID=22539848

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00961450A Withdrawn EP1209968A1 (fr) 1999-08-31 2000-08-30 Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur

Country Status (5)

Country Link
EP (1) EP1209968A1 (fr)
JP (1) JP2003508038A (fr)
AU (1) AU7340000A (fr)
CA (1) CA2382383A1 (fr)
WO (1) WO2001015521A1 (fr)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030028911A1 (en) * 1999-08-31 2003-02-06 Manley Huang Transgenic mammal capable of facilitating production of donor-specific functional immunity
GB0329449D0 (en) * 2003-12-19 2004-01-28 Omnicyte Ltd Stem cells
EP1887859B1 (fr) 2005-05-17 2012-12-05 Universität Leipzig Modele animal pour le systeme immunitaire humain et procede de production dudit modele
US8541646B2 (en) 2009-10-06 2013-09-24 Regeneron Pharmaceuticals, Inc. Genetically modified mice and engraftment
RU2577978C2 (ru) * 2011-02-15 2016-03-20 Ридженерон Фармасьютикалз, Инк. Гуманизированные m-csf мыши
US8962913B2 (en) 2012-06-18 2015-02-24 Regeneron Pharmaceuticals, Inc. Humanized IL-7 rodents
KR102594390B1 (ko) 2012-09-07 2023-10-27 예일 유니버시티 유전적으로 변형된 비-인간 동물 및 이것들의 사용 방법
EP4389764A2 (fr) 2012-11-05 2024-06-26 Regeneron Pharmaceuticals, Inc. Animaux non humains génétiquement modifiés et leurs procédés d'utilisation
KR102627332B1 (ko) 2014-05-19 2024-01-26 리제너론 파마슈티칼스 인코포레이티드 인간 epo를 발현하는 유전자 변형된 비-인간 동물
KR102656470B1 (ko) 2014-12-10 2024-04-09 리전츠 오브 더 유니버스티 오브 미네소타 질환을 치료하기 위한 유전적으로 변형된 세포, 조직 및 장기
PT3282835T (pt) 2015-04-13 2023-07-25 Univ Yale Ratinhos knockin de sirpa-il15 humanizadas e métodos de utilização dos mesmos
CN105994125B (zh) * 2015-04-15 2019-05-17 中国科学院广州生物医药与健康研究院 一种评价免疫缺陷小鼠模型的免疫缺陷程度的方法
US20190320633A1 (en) * 2016-11-30 2019-10-24 The Jackson Laboratory Humanized mouse model with improved human innate immune cell development

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH03244333A (ja) * 1990-02-22 1991-10-31 Yoshitomi Pharmaceut Ind Ltd Ｈｌａ―ｄｐ遺伝子導入マウス、その作製法およびその使用方法
JP2647292B2 (ja) * 1990-11-26 1997-08-27 イエダ リサーチ アンド デベロツプメント カンパニー リミテツド 非ヒトキメラ哺乳動物
WO1993018144A1 (fr) * 1992-03-05 1993-09-16 The Trustees Of Columbia University Of The City Of New York Animal presentant une deficience en gene activateur de recombinaison

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0115521A1 *

Also Published As

Publication number Publication date
JP2003508038A (ja) 2003-03-04
WO2001015521A1 (fr) 2001-03-08
CA2382383A1 (fr) 2001-03-08
AU7340000A (en) 2001-03-26

Similar Documents

Publication Publication Date Title
Renshaw et al. Humoral immune responses in CD40 ligand-deficient mice.
US5574205A (en) Homologous recombination for universal donor cells and chimeric mammalian hosts
AU2002246733B2 (en) Transgenic animals comprising a humanized immune system
US5413923A (en) Homologous recombination for universal donor cells and chimeric mammalian hosts
EP1573314B1 (fr) Souris transgeniques exprimant le cd20 humain
US5434340A (en) Transgenic mice depleted in mature T-cells and methods for making transgenic mice
WO1992022645A1 (fr) Animaux transgeniques non humains presentant une deficience immunitaire
US7161058B2 (en) Animal model for identifying agents that inhibit or enhance CTLA4 signaling
US6552246B1 (en) Transgenic mice comprising CD45 knockout
AU2002246733A1 (en) Transgenic animals comprising a humanized immune system
WO1991001140A1 (fr) Recombinaison homologue pour cellules donneuses universelles et hotes mammiferes chimeriques
WO2001015521A1 (fr) Mammifere transgenique capable de faciliter la production d'immunite fonctionnelle specifique de donneur
US20030028911A1 (en) Transgenic mammal capable of facilitating production of donor-specific functional immunity
JP2023533979A (ja) ヒト自然免疫機能を支えるトランスジェニックマウスモデル
AU1075895A (en) Sepsis model
Senn Generation and analysis of T1-deficient and T1-Fc-transgenic mice

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020315

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050202

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050613