EP1196187A1 - Formulations a base de fecteur de croissance keratinocytaire 2 - Google Patents

Formulations a base de fecteur de croissance keratinocytaire 2

Info

Publication number
EP1196187A1
EP1196187A1 EP00941186A EP00941186A EP1196187A1 EP 1196187 A1 EP1196187 A1 EP 1196187A1 EP 00941186 A EP00941186 A EP 00941186A EP 00941186 A EP00941186 A EP 00941186A EP 1196187 A1 EP1196187 A1 EP 1196187A1
Authority
EP
European Patent Office
Prior art keywords
pharmaceutical composition
kgf
polypeptide
concentration
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00941186A
Other languages
German (de)
English (en)
Other versions
EP1196187A4 (fr
Inventor
Reiner L. Gentz
Arvind Chopra
Parveen Kaushal
Thomas Spitznagel
Edward Unsworth
Fazal Khan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP1196187A1 publication Critical patent/EP1196187A1/fr
Publication of EP1196187A4 publication Critical patent/EP1196187A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1825Fibroblast growth factor [FGF]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention is directed to liquid and lyophilized formulations of Keratinocyte Growth Factor-2 (KGF-2) and derivatives thereof.
  • KGF-2 Keratinocyte Growth Factor-2
  • This invention further relates to formulations of KGF-2, especially topical and injectable formulations, that can be employed for therapeutic use in indications requiring soft-tissue growth and regeneration.
  • the fibroblast growth factor family has emerged as a large family of growth factors involved in soft-tissue growth and regeneration. It presently includes several members that share a varying degree of homology at the protein level, and that, with one exception, appear to have a similar broad mitogenic spectrum, i.e., they promote the proliferation of a variety of cells of mesodermal and neuroectodermal origin and/or promote angiogenesis.
  • Keratinocyte growth factor was originally identified as a member of the FGF family by sequence homology or factor purification and cloning. Keratinocyte growth factor (KGF) was isolated as a mitogen from a cultured murine keratinocyte line (Rubin, J.S. et al. , Proc. Natl. Acad. Sci. USA 5(5:802-806 ( 1989)). Unlike the other members of the FGF family, it has little activity on mesenchyme-derived cells but stimulates the growth of epithelial cells. Keratinocyte growth factor is produced by fibroblasts derived from skin and fetal lung (Rubin et al. (1989)).
  • Keratinocyte growth factor mRNA was found to be expressed in adult kidney, colon and ilium, but not in brain or lung (Finch, P. W. et al. Science 245:152-155 (1989)). KGF displays the conserved regions within the FGF protein family.
  • KGF binds to the FGF-2 receptor with high affinity. Impaired wound healing is a significant source of morbidity and may result in such complications as dehiscence, anastomotic breakdown and, non- healing wounds. In the normal individual, wound healing is achieved uncomplicated. In contrast, impaired healing is associated with several conditions such as diabetes, infection, immunosuppression, obesity and malnutrition (Cruse, P.J. and Foord, R., Arch. Surg. 107:206 (1973); Schrock, T.R. et al, Ann. Surg. 777:513 (1973); Poole, G.U., Jr., Surgery 97:631 (1985); Irvin, G.L. et al, Am. Surg. 57:418 (1985)).
  • Wound repair is the result of complex interactions and biologic processes. Three phases have been described in normal wound healing: acute inflammatory phase, extracellular matrix and collagen synthesis, and remodeling (Peacock, E.E., Jr., Wound Repair, 2nd edition, WB Saunders, Philadelphia (1984)). The process involves the interaction of keratinocytes, f ⁇ broblasts and inflammatory cells at the wound site. It is desirable to formulate polypeptides that are capable of promoting and enhancing soft-tissue growth and regeneration in pharmaceutical compositions that (1) are stable over prolonged periods of storage, (2) increase the pharmacological activity or effectiveness of the polypeptide and/or (3) allow facile application or administration of the polypeptide in therapeutic regimens.
  • the present invention is directed to liquid and lyophilized formulations of KGF-2 and deletion or point or substitution mutants thereof (referred to herein as KGF-2 polypeptides).
  • KGF-2 polypeptides referred to herein as KGF-2 polypeptides.
  • This invention further relates to the use of such formulations of KGF-2 polypeptides to promote or accelerate soft tissue growth or regeneration, for example in wound healing, or in treating mucocytis or inflammatory bowel disease.
  • Preferred formulations of the present invention employ novel mutant forms of KGF-2, and in one embodiment employ a deletion mutant referred to herein as KGF2- ⁇ 33.
  • a first aspect of the present invention relates to a formulation comprising a KGF-2 polypeptide and a buffering agent having a buffering capacity of between about pH 5.0 and about pH 8.0.
  • Useful buffers include phosphate, acetate, aconitate, succinate, malate, carbonate and citrate buffers, citrate being preferred.
  • a second aspect of the invention relates to a formulation comprising a
  • KGF-2 polypeptide a lyophilization bulking agent and a buffering agent having a buffering capacity of between about pH 5.0 and about pH 8.0.
  • Useful buffers include phosphate, aconitate, succinate, malate, carbonate and citrate buffers, citrate being preferred.
  • a third aspect of the invention relates to a formulation comprising a KGF-
  • This formulation preferably includes a buffering agent having a buffering capacity of between about pH 5.0 and about pH 8.0.
  • This formulation may also include one or more antioxidants and or one or more metal chelating agents.
  • a fourth aspect of the present invention relates to a formulation comprising a KGF-2 polypeptide, a buffer, and a high molecular weight compound that causes the formulation to gel at a certain predefined temperature.
  • a preferred high molecular weight compound is a Pluronic or Poloxamer polyoxyethylene-polyoxypropylene block copolymer.
  • a thiol-containing compound, such as monothioglycerol, can be included in the formulation to provide added stability to the polypeptide.
  • a fifth aspect of the present invention relates to a formulation comprising a KGF-2 polypeptide, a buffering agent and a thickening agent.
  • Thickening agents are used to increase the viscosity of the formulation.
  • Preferred thickening agents are carboxymethyl cellulose (CMC), hydroxyethyl cellulose (HEC), hydroxypropylmethyl cellulose (HPMC), Natrosol, and Carbomers.
  • the formulations of the present invention may also include metal chelating agents, antioxidants or thiol-containing compounds, such as ascorbic acid ester, monothioglycerol, cysteine, tocopherols, butylated hydroxyanisole, sodium sulphate, sodium bisulfite, and sodium metasulfite and preservatives such as m-cresol, phenol, chlorobutane, chlorobutanol, benzylalcohol, methyl parabens and propyl parabens.
  • Anti-microbial preservatives may decrease the stability of KGF-2 formulations, Surprisingly, a combination of methyl paraben and propyl paraben was found to be suitable for use in KGF-2 formulations.
  • the formulations of the present invention may also have an nitrogen blanket overlay on the head space of the vial. Additionally, the formulations of the present invention may be include purging the formulation buffer with helium, argon, or nitrogen.
  • Figures 1A-1C illustrate the cDNA and corresponding deduced amino acid sequence of KGF-2.
  • the initial 35 or 36 amino acid residues represent the putative leader sequence (underlined).
  • the standard one letter abbreviations for amino acids are used.
  • Sequencing inaccuracies are a common problem when attempting to determine polynucleotide sequences. Sequencing was performed using a 373 Automated DNA sequencer (Applied Biosystems, Inc.). Sequencing accuracy is predicted to be greater than 97% accurate. (SEQ ID NOs:l and 2)
  • Figures 2(A)-2(C) depict stimulation of normal primary epidermal keratinocyte proliferation by KGF-2 polypeptides of the invention.
  • Figure 2(A) shows stimulation of normal primary epidermal keratinocyte proliferation by KGF-2.
  • Figure 2(B) shows the stimulation of normal primary epidermal keratinocyte proliferation by KGF-2 ⁇ 33.
  • Figure 2(C) shows the stimulation of normal primary epidermal keratinocyte proliferation by KGF-2 ⁇ 28.
  • Figure 3 shows bioactivity results for KGF-2 ⁇ 33 liquid formulation, 10 month stability.
  • Figure 4 shows bioactivity results for KGF-2 ⁇ 33 lyophilized preparation, 9 month stability.
  • Figure 5 shows the effect of monothiolglycerol on KGF-2 bioactivity.
  • KGF-2 stimulates the proliferation of epidermal keratinocytes but not mesenchymal cells such as fibroblasts.
  • a polypeptide having KGF-2 protein-like activity includes polypeptides that exhibit the KGF-2 activity, in the keratinocyte proliferation assay set forth below and bind to FGF receptor isoforms
  • the present invention is directed to pharmaceutical and veterinary formulations of KGF-2 polypeptides.
  • the KGF-2 polypeptides are defined herein by reference to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, and include fragments, derivatives and analogs of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA which retain essentially the same biological function as the parent polypeptide.
  • the polypeptides employed in the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.
  • KGF-2 polypeptides exhibit poor activity and stability at a pH of 4.5 or less, or at a pH above about 8.0.
  • the present inventors have discovered that KGF-2 polypeptides oxidize and precipitate. These polypeptides present a difficult challenge when attempting to formulate them for therapeutic purposes.
  • KGF-2 polypeptides can be formulated with antioxidants, such as oxygen scavenging compounds, and/or a protein stabilizer, such as a thiol- containing compound, and/or a metal-chelating agent, such as EDTA.
  • Stabilization refers to the maintenance of both physico-chemical properties and substantial biological activity of the KGF-2 polypeptides over a given time period.
  • the formulations according to the present invention include gel, thickened solution, solution and lyophilized forms. Formulations are also referred to herein as "pharmaceutical compositions" or “compositions.”
  • a first aspect of the present invention is directed to liquid formulations of KGF-2 polypeptides that comprise: a KGF-2 polypeptide and a buffer having a buffering capacity of between about pH 5.0 and about pH 8.0, more preferably pH 5.5 to pH 6.5, most preferably pH 6.2.
  • Useful buffers include buffers derived from phosphate, acetic, aconitic, citric, glutaric, malic, succinic and carbonic acids. Typically employed is an alkali or alkaline earth salt of one of the aformentioned acids. More preferably the buffer will be acetate or citrate, most preferably citrate.
  • the formulation may comprise a composition formed by mixing a buffering amount of citric acid or a pharmaceutically acceptable salt thereof with KGF-2 ⁇ 33 in water.
  • the formulation alternatively may comprise a composition formed by mixing a buffering amount of acetic acid or a pharmaceutically acceptable salt thereof with KGF-2 ⁇ 33 in water.
  • Preferable buffer concentrations are from about 5 mM to about 50 mM. Most preferably the acetate buffer will have a concentration of about 20 mM and the citrate buffer will be about 10 mM to about 20 mM.
  • the formulation may also include NaCl, glycine, sucrose or mannitol, or combinations thereof, as a tonicifier at a concentration of from about 0 mM to about 150 mM, preferably 10 to about 150 mM, most preferably at about 125 mM, and a metal chelating agent, such as EDTA, at a concentration of from about 0 mM to about 10 mM, most preferably at about 1 mM.
  • a liquid formulation of the present invention may also include one or more of (a) a stabilizing amount of an antioxidant, such as ascorbate and/or (b) a protein stabilizing amount a thiol- compound, for example monothioglycerol (MTG).
  • MTG monothioglycerol
  • thiol compounds such as MTG serve to protect free sulfhydryl groups present in the KGF -polypeptides.
  • the storage conditions for the liquid formulation are typically at about 2°C to about 8°C. Alternatively, storage conditions are at or below -20 °C. Most preferably, storage conditions are at about -20 °C. Maintaining a KGF-2 liquid formulation in a frozen state limits the amount of oxidation to the polypeptide which in turn results in a stable polypeptide formulation.
  • a liquid formulation comprises:
  • a therapeutically-effective amount of a KGF-2 polypeptide (1 ) a therapeutically-effective amount of a KGF-2 polypeptide; (2) an effective amount of a buffer having a buffering capacity of between about pH 5.0 and about pH 8.0; and
  • compositions of the present invention are manufactured by admixing the above listed ingredients together, preferably in concentrations and ratios as expressed herein.
  • Antioxidants that can be used in the liquid formulation include sodium bisulfate, cysteine, sodium sulfite, ascorbic acid, tocopherols, and butylated hydroxyanisole.
  • stabilizers that can be used in the liquid formulation also include thiols such as cysteine, methionine and thioglycerols.
  • Chelating agents that can be employed include e hylenediamine tetraacetic acid (EDTA), or diethylenetriamine pentaacetic acid (DPTA), with EDTA being preferred.
  • Formulations of the present invention which include antioxidants or thiols can increase the stability of the KGF-2 polypeptides. This makes it possible to have a pharmaceutical product with a longer shelf life.
  • formulations of the present invention may further include one or more preservatives, such as benzyl alcohol, preferably at a concentration of about 0.5%> to about 1.5%, most preferably at a concentration of about 0.9%; chlorobutanol, preferably at a concentration of about 0.01 % to about
  • preservatives such as benzyl alcohol, preferably at a concentration of about 0.5%> to about 1.5%, most preferably at a concentration of about 0.9%; chlorobutanol, preferably at a concentration of about 0.01 % to about
  • methyl paraben preferably at a concentration of about 0.1%) to about 0.2%, most preferably at about 0.18%; propyl paraben, preferably at a concentration of about 0.01% to about 0.05%, most preferably about 0.02%), m-cresol, preferably at a concentration of about 0.1 % to about 1 %, most preferably about 0.3%; and/or phenol, preferably at a concentration of about
  • methyl paraben and propyl paraben used together; with methyl paraben at a concentration of about 0.1% to about 0.2% and propyl paraben at a concentration of about 0.10%) to about 0.05%.
  • methyl paraben and propyl paraben used together; with methyl paraben at a concentration of 0.18% and propyl paraben at a concentration of 0.02%.
  • More preferred liquid formulations comprise:
  • Useful buffers for the formulations of the present invention include buffers derived from acetic, aconitic, citric, glutaric, malic, succinic, phosphate and carbonic acids. Typically employed is an alkali or alkaline earth salt of one of the aformentioned acids. Acetate and citrate buffers, such as acetic acid or a pharmaceutically acceptable salt thereof, or citric acid or a pharmaceutically acceptable salt thereof, are preferred.
  • the preferable pH ranges for the solution formulation is from about pH 5.0 to about pH 8.0, preferably pH 5.5 to pH 6.5, and most preferably about pH 6.2.
  • Sodium acetate or sodium citrate are the preferred buffering agents, with sodium citrate being most preferred.
  • a chelating agent such as EDTA at a concentration range of about 0.1 mM to about 10 mM, more preferably at about 1 mM
  • a tonicifier such as NaCl, glycine. sucrose or mannitol, or combinations thereof at a concentration range of about 0.01 mM to about 150 mM and more preferably at about 125 mM.
  • a liquid formulation may also include a protein stabilizing amount of a compound selected from the group consisting of: (a) about 0.5% to about 2% w/v glycerol,
  • Preferred embodiments of this aspect of the present invention include a composition formed by mixing: ( 1 ) a KGF-2 polypeptide in a concentration of about 0.02 to about 40 mg/ml (w/v), more preferably about 0.1 to about 20 mg/ml, and most preferably about 0.2 to 4 mg/ml.
  • the solution formulation comprises a composition formed by mixing:
  • the solution formulation comprises a composition formed by mixing:
  • the solution preferably also includes either about 7% sucrose or a combination of 2% glycine and 0.5%> sucrose.
  • the solution formulation comprises a composition formed by mixing:
  • the solution preferably also includes either about 7% sucrose or a combination of 2% glycine and 0.5%) sucrose.
  • KGF-2 polypeptides readily oxidize, aggregate and precipitate out of solution. Although oxidation of KGF-2 does not destroy biological activity, limiting the extent of oxidation of the product leads to a more stable product.
  • the inventors observed that if the liquid formulation is at a pH too low the KGF-2 polypeptide will lose biological activity. Additionally, as the pH of the solution approaches the pi for KGF-2, the protein will precipitate out of solution. Thus, the inventors have determined that liquid formulations should be maintained in the range of about pH 6.0 to about pH 7.0, and that a pH of about 6.2 is most optimal for stabilizing the KGF-2 polypeptide. Moreover, the inventors surprisingly determined that a citrate buffer specifically stabilizes the KGF-2 polypeptides.
  • a citrate buffer having at about pH 6.0-6.2 provides a liquid formulation that reduces aggregation of the KGF-2 polypeptide and increases stability
  • the liquid polypeptide formulation may still be subject to oxidation and precipitation of KGF-2 polypeptides.
  • the inventors developed a lyophilized formulation as set forth below.
  • a second aspect of the present invention is directed to lyophilizated formulations of KGF-2 polypeptides that comprise: a KGF-2 polypeptide and a buffer having a buffering capacity of between about pH 5.0 and about pH 8.0, more preferably pH 5.5 to pH 6.5, most preferably pH 6.2.
  • Useful buffers include buffers derived from phosphate, aconitic, citric, glutaric, malic, succinic and carbonic acids. Typically employed is an alkali or alkaline earth salt of one of the aforementioned acids. More preferably the buffer will be phosphate or citrate, most preferably citrate.
  • the formulation may comprise a composition formed by mixing a buffering amount of citric acid or a pharmaceutically acceptable salt thereof with KGF-2 ⁇ 33 in water.
  • the preferable buffer concentration is from about 5 mM to about 50 mM and more preferably at about 10 mM.
  • the citrate buffer will be added in a concentration of about 10 mM.
  • NaCl as a tonicifier at a concentration of from about 0 mM to about 150 mM, most preferably at about 20 mM and a metal chelating agent, such as EDTA, at a concentration of from about 0 mM to about 10 mM, most preferably at about 1 mM.
  • bulking agents/cryoprotectants such as sucrose, glycine, mannitol, trehalose or other pharmaceutically acceptable bulking agents are included in the formulation.
  • the amount of bulking agent used will be such that the solution is isotonic and is in a range of about 2% to about 10%> w/v. Preferred concentrations are as follows: 5%> mannitol, 7% sucrose, 8%> trehalose, or 2% glycine + 0.5% sucrose. More preferably, sucrose or sucrose/glycine mixture is used.
  • a lyophilized formulation of the present invention may also include one or more of (a) a stabilizing amount of an antioxidant, such as ascorbate or (b) a stabilizing amount of thiol-compound, for example monothioglycerol.
  • Storage conditions for the lyophilized formulation are typically at about 2 ° C to about 25 ° C. More preferably storage conditions are at or below about 2° C to about 8° C.
  • KGF-2 polypeptides are lyophilized at a concentration of about 0.02 mg/ml to about 10 mg/ml of protein in the initial solution
  • the initial lyophilization solution preferably comprises (in addition to the KGF-2 polypeptides):
  • the preferred pH range for the lyophilization buffer is from about 5.5 to about
  • the lyophilization buffer comprises 10 mM sodium citrate, 20 mM sodium chloride, 1 mM disodium EDTA at pH 6.2 and 7% sucrose.
  • the lyophilized KGF-2 polypeptide formulations are reconstituted in sterile water so as to maintain isotonic conditions of about 290 mOsm.
  • the KGF- 2 polypeptides can be reconstituted in sterile water, optionally containing a stabilizing amount of antioxidants comprising: a) about 0.01% to about 2% w/v monothioglycerol, b) about 0.01%> to about 2%> w/v ascorbic acid, c) about 0.01% to about 2%> w/v methionine or d) combinations thereof.
  • a stabilizing amount of antioxidants comprising: a) about 0.01% to about 2% w/v monothioglycerol, b) about 0.01%> to about 2%> w/v ascorbic acid, c) about 0.01% to about 2%> w/v methionine or d) combinations thereof.
  • the present invention includes lyophilization cycles that yield a stable KGF-2 polypeptide formulation.
  • the lyophilization cycle is designed to keep the KGF-2 polypeptide product below its collapse temperature during the primary drying phase. Additionally, the moisture content is targeted to be preferably less than 5%>, and more preferably less than 2%. Such a protocol must be determined for any particular protein on an individual basis.
  • An example lyophilization cycle for the KGF-2 sucrose containing lyophilization formulation according to the present invention was determined to be as follows:
  • the lyophilization formulation of the present invention provides a product with unexpectedly increased stability. Indeed, lyophilized KGF-2 formulations of the present invention are biologically stable for at least 9 months at temperatures of up to 45 ° C. (Figure 4). Reverse-phase HPLC demonstrated that the lyophilized KGF-2 formulations of the present invention retained its physio- chemical properties for up to 8 months at temperatures of at or below 45 ° C and 75% relative humidity. Stability for this length of time at such high temperatures is very unusual for proteins.
  • a third aspect of the invention is directed to thickened or gel formulations for KGF-2 polypeptides.
  • Thickening agents may be added to the above described liquid formulations to increase the viscosity of the resulting formulation.
  • a formulation having an increased viscosity may be beneficial for topical applications where controlled release, adhering to the shape of a wound or avoiding run-off may be important.
  • Such thickened formulations are employed for topical uses such as wound healing, to treat skin disorders or any other use which could be treated via topical application of a KGF-2 pharmaceutical composition.
  • the thickening agent should raise the viscosity to about 50 to about
  • centipoise 10,000 centipoise (cps), more preferably about 50 to about 1,000 cps and most preferably about 200 to about 300 cps. Viscosity is measured using a rotating spindle viscometer. The most preferred concentration of thickening agent is 0 to
  • thickening agents include, but are not limited to water soluble etherified celluloses and carbomer (high molecular weight polymers of acrylic acid cross-linked with either allylsucrose or allyl ethers of pentaerythritol).
  • etherified cellulose are well known in the art (listed in USP) and include alkyl celluloses, hydroxyalkyl celluloses and alkylhydroxyalkyl celluloses e.g., methylcellulose, hydroxyethyl cellulose, hydroxy propyl cellulose, hydroxy propyl methylcellulose, and the like.
  • the topical or incisional gel may comprise about 0 to about
  • a cellulose derivative having a molecular weight of about 50,000 to about 700,000.
  • the cellulose derivative is present at about 2%> to about 8% by weight and has a molecular weight in the range of about 80,000 to about 240,000.
  • Preferred cellulose derivatives are hydroxypropylmethyl cellulose, methyl cellulose, carboxymethyl cellulose, and hydroxyethyl cellulose.
  • salts and buffering agents may be added or removed from the formulation for optimal stability.
  • the citrate concentration may be increased.
  • concentrations for citrate are for example, about 10 mM to about 500 mM citrate, more preferably about 10 mM to about 50 mM citrate and most preferably about 10 mM to about 20 mM citrate.
  • the amount of sucrose may be decreased in the lyophilization formulation to a range from about 0%) to about 5% sucrose.
  • Thickening agents may be added directly to a liquid formulation according to the present invention and then lyophilized.
  • a lyophilized formulation according to the present invention may be reconstituted by adding a suitable diluent, most preferably water having a thickening agent dissolved therein. Such thickened formulations could be administered by spray.
  • An example of a preferred thickened KGF-2 polypeptide solution according to the present invention comprises a product formed by mixing:
  • a topically effective amount of a KGF polypeptide preferably KGF-2 ⁇ 33; (2) about 10 mM to about 500 mM sodium citrate buffer;
  • a pH of such a formulation is most preferably pH 6.2.
  • Another aspect of the present invention is directed to gel formulations for
  • Gelling agents may be added to injectable formulations of the present invention to provide a formulation that remains liquid at room temperature and solidifies when applied to the surface of the skin (at about 37° C). Such formulations may be useful for topical applications where controlled release, adhearing to the shape of a wound or avoiding run-off may be important.
  • Gel formulations for KGF-2 polypeptides according to the present invention comprise:
  • Viscosity of gel formulations of the present invention may be in a range of about 1 to about 10,000 cps at room temperature, most preferred about 20 to about 100 cps at room temperature. Viscosity is measured using a rotating spindle viscometer.
  • Gel forming high molecular weight compounds employed in the present invention are typically water-soluble polymers capable of forming a viscous aqueous solution, or non-water soluble, water-swellable polymers (e.g., collagen) that can also form a viscous solution and that gel upon contact with skin.
  • Useful gel forming high molecular weight compounds may be selected from vinyl polymers, polyoxyethylene-polyoxypropylene copolymers, polysaccharides, proteins, poly(ethylene oxide), acrylamide polymers and derivatives and or salts thereof.
  • Other compounds that can be used to make pharmaceutical gel formulations used in healing wounds can be found in U.S Patent No. 5,427,778, which is herein fully inco ⁇ orated by reference.
  • Useful vinyl polymers include polyacrylic acid, polyme hacrylic acid, polyvinyl pyrrolidone and polyvinyl alcohol.
  • Useful polysaccharides include cellulose derivatives, glycosaminoglycans, agar, pectin, alginic acid, dextran, starch ( ⁇ -amylose or amylopectin), and chitosan.
  • Useful glycosaminoglycans include hyaluronic acid, chondroitin, chondroitin-4-sulfate, heparan sulfate and heparin.
  • the glycosaminoglycans may be used to enhance wound healing in combination with any other gel forming polymer such as, for example, collagen, gelatin, fibronectin.
  • the acrylamide polymers may be polyacrylamide or polymethacrylamide polymers.
  • Preferred high molecular weight gel forming compounds are polyoxyethylene-polyoxypropylene block copolymers, especially those block copolymers that are designated in the trade as PLURONICS (BASF) or POLAXAMERS (BASF).
  • the gel of the present invention may comprise about 10 to about 60%> by weight of a polyoxyethylene- polyoxypropylene block copolymer having an average molecular weight of about 500 to 50,000.
  • the gel of the present invention may comprise about 14 to about 18% by weight of block copolymers having a molecular weight in the range 1,000 to 15,000.
  • Preferred block copolymers of the present invention are Pluronic F108 and Pluronic F127.
  • Polyoxyethylene-polyoxpropylene block copolymers have great potential for use in topical drug delivery systems because they exhibit reverse thermal gelation behavior, have good drug release characteristics as well as lowtoxicity. Gels are formed as the solution is warmed.
  • the gel is a low viscosity aqueous solution at room temperature but when it contacts the mammalian body and is warmed by body temperature the viscosity increases as the solution gels.
  • Pluronic gels can be used for the controlled delivery of KGF-2 polypeptides to, for example, wounds and other such sites where topical delivery is desirable.
  • KGF-2 polypeptides can be combined with the Pluronic in the liquid state and applied to the wound. Gelation occurs and effectively reduces the rate that the polypeptides are released to the wound and thereby permits prolonged contact between the polypeptides and the wound site.
  • the benefits of using such gel formulations include keeping the wound moist and having a pharmaceutical compound that is form-fitting to the wound or other such site where the compound may be applied.
  • the preferred gel formulations for KGF-2 polypeptides according to the present invention comprises citrate buffer and a Pluronic.
  • the formulation may comprise an amount of citric acid or a pharmaceutically acceptable salt, thereof.
  • the gel formulation according to the present invention may also include an chelating agent, a stabilizing amount of antioxidants or thiols.
  • the gel formulation will include a high molecular weight compound, such as a Pluronic, or water-soluble etherified cellulose, and the like in an amount that will form a gel.
  • the KGF-2 polypeptides are preferably in a concentration of about 0.01 mg/ml to about 10 mg/ml.
  • the gel formulations are formed by mixing:
  • a KGF-2 polypeptide preferably KGF-2 ⁇ 33 , in a final calculated concentration of 0.01 mg/ml to about 10 mg/ml;
  • Another preferred gel formulation comprises:
  • sucrose about 0.1 % to about 7% sucrose or about 2.0%> glycine and about 0.5%) sucrose;
  • the gel formulation comprises:
  • KGF-2 polypeptide preferably KGF-2 ⁇ 33, at a concentration range of about 0.01 mg/ml to about 10 mg/ml (w/v), more preferably about 0.1 mg/ml to about 3 mg/ml, and most preferably about 0.2 mg/ml;
  • sodium citrate at a concentration range of about 5 mM to about 20 mM;
  • the gel formulation optionally further includes one or more of the following: (6) EDTA at a concentration range of about 0.1 mM to about 10 mM.
  • the preferred pH ranges for the gel formulation is from about pH 5.0 to about pH 8.0, preferably pH 6.2 and the resulting gel formulation should be isotonic.
  • compositions of the present invention may benefit from from from anti-oxidants, metal chelating agents, thiol containing compounds and other general stabilizing agents.
  • stabilizing agents include, but are not limited to: (a) about 0.5% to about 2%> w/v glycerol,
  • the KGF-2 polypeptide formulations of the present invention may employ suitable pharmaceutical diluents that are known to be useful in pharmaceutical compositions.
  • suitable pharmaceutical diluents include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the pharmaceutical compositions will be formulated according to the present invention, as indicated above. Water is a preferred diluent.
  • the polypeptide having KGF-2 activity may be administered in pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients.
  • the total daily usage of the pharmaceutical compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the type and degree of the response to be achieved; the specific composition, including whether another agent, if any, is employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the composition; the duration of the treatment; drugs (such as a chemotherapeutic agent) used in combination or coincidental with the specific composition; and like factors well known in the medical arts.
  • Suitable formulations, known in the art can be found in Remington 's Pharmaceutical
  • KGF-2 for purposes herein (including a KGF-2 effective amount) is thus determined by such considerations.
  • compositions of the present invention may be administered in a convenient manner such as by the oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarticular, subcutaneous, intranasal, inhalation, intraocular or intradermal routes.
  • Parenteral and topical delivery are the preferred routes of administration.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
  • the KGF-2 dosage is from about 1 ⁇ g/kg to about 30 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • the dosage can be as low as 0.001 ⁇ g/kg.
  • dosages are preferably administered from about 0.01 ⁇ g to 9 mg per cm 2 .
  • dosages are preferably administered from about 0.001 ⁇ g/ml to about 10 mg/ml, and more preferably from about 0.05 mg/ml to about 4 mg/ml.
  • the total pharmaceutically effective amount of the KGF-2 polypeptide administered parenterally will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion.
  • the KGF-2 polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump.
  • An intravenous bag solution or bottle solution may also be employed.
  • a course of KGF-2 polypeptide treatment to affect the fibrinolytic system appears to be optimal if continued longer than a certain minimum number of days
  • the KGF-2 polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting the KGF-2 polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non- aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes. Suitable formulations, known in the art, can be found in Remington 's Pharmaceutical Sciences (latest edition), Mack Publishing
  • KGF-2 polypeptides may also be administered to the eye to treat lacrimal gland injuries, disorders and pathologies in animals and humans as a liquid, drop, or thickened liquid, a gel. KGF-2 polypeptides can also be intranasally administered to the nasal mucosa to treat disorders, injuries and pathologies of the nasal mucosa and sinus epithelia in animals and humans as liquid drops or in a spray form.
  • the formulations are prepared by contacting the KGF-2 polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non- aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes. Suitable formulations, known in the art, can be found in Remington 's Pharmaceutical Sciences (latest edition), Mack Publishing Company, Easton, PA.
  • the carrier may also contain minor amounts of suitable additives such as substances that enhance isotonicity and chemical stability.
  • suitable additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or
  • KGF-2 is typically formulated in such vehicles at a concentration of about
  • KGF-2 to be used for therapeutic administration may be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic KGF-2 compositions may be placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • KGF-2 ordinarily will be stored in unit or multi-dose containers, for example, sealed ampules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 3-ml vials are filled with 1 ml of sterile-filtered 1 % (w/v) aqueous KGF-2 solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized KGF-2 using Water-for-Injection which may optionally include one or more antioxidants.
  • Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an KGF-2 activity in the blood, as determined by an RIA technique, for instance.
  • patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
  • the KGF-2 is also suitably administered by sustained-release systems.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (U. Sidman et al, Biopolymers 22:541-556 (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al, J. Biomed. Mater. Res. 15:161-211 (1981), and R. Langer, Chem. Tech. 72:98-105 (1982)), ethylene vinyl acetate (R. Langer et al, Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
  • polylactides U.S. Pat. No. 3,773,919, EP 58,481
  • copolymers of L-glutamic acid and gamma-ethyl-L-glutamate U. Sidman e
  • Sustained-release KGF-2 compositions also include liposomally entrapped KGF-2.
  • Liposomes containing KGF-2 are prepared by methods known er se: DE 3,218, 121 ; Epstein, etal, Proc. Natl. Acad. Sci. USA 52:3688-3692 (1985); Hwang etal, Proc. Natl Acad. Sci. USA 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641 ; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal KGF-2 therapy.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such containers can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides, agonists and antagonists of the present invention may be employed in conjunction with other therapeutic compounds.
  • the use of monothioglycerol may stabilize the KGF-2 polypeptides and may behave as a potentiating agent for KGF-2 polypeptides in wound healing.
  • the optimal concentration range for the potentiating effect of the monothioglycerol was 0.1% to 2% w/v.
  • KGF-2 stimulates the proliferation of epithelial cells and epidermal keratinocytes but not mesenchymal cells such as fibroblasts.
  • a polypeptide having KGF-2 protein-like activity includes polypeptides that exhibit the KGF-2 activity, in the keratinocyte proliferation assay set forth below and U.S.
  • a polypeptide having KGF-2 protein-like activity exhibits substantially similar activity as compared to the KGF-2 protein (i.e., the candidate polypeptide exhibits greater activity or not more than tenfold less and, preferably, not more than about twofold less activity relative to the reference KGF-2 protein).
  • the KGF-2 polypeptides used in the formulations of the present invention may or may not have the N-terminal methionine, preferably the polypeptide will be lacking the N-terminal methionine.
  • the KGF-2 cDNA clone was deposited as ATCC Deposit No. 75977 on December 16, 1994 at the American Type Culture Collection, Patent Depository, 10801 University Boulevard, Manassas, VA 20110-2209.
  • a cDNA encoding KGF-2 ⁇ 33 inserted into an expression vector, pHE4-5 was deposited at the ATCC on January 9, 1998 as ATCC No. 209575.
  • fragment when referring to the polypeptide, of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non- conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not
  • peptide and “oligopeptide” are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least to amino acids coupled by peptidyl linkages.
  • polypeptide is used herein for chains containing more than ten amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus.
  • polypeptides of the present invention are preferably in an isolated form.
  • isolated polypeptide is intended a polypeptide removed from its native environment.
  • polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention. Also intended are polypeptides that have been purified, partially or substantially, from a recombinant host cell or a native source.
  • the pharmaceutical formulations of the present invention include the KGF-2 polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) and deletion mutants thereof, as well as polypeptides which have at least 90%, 95%, 96%, 97%, 98%, 99% similarity (more preferably at least 90%, 95%, 96%, 97%, 98%o, 99%) identity) to the polypeptide of SEQ ID NO:2 and deletion mutants thereof, and also include portions of such polypeptides with such portion of the polypeptide (such as the deletion mutants described below) generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • similarity between two polypeptides is determined by comparing the amino acid sequence and its conservative amino acid substituted sequence of one polypeptide to the sequence of a second polypeptide.
  • %> similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
  • polypeptide having an amino acid sequence at least, for example,
  • identical to a reference amino acid sequence of a KGF-2 polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the KGF-2 polypeptide.
  • up to 5%> of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5%> of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular polypeptide is at least 90%, 95%>, 96%>, 97%, 98%) or 99% identical to, for instance, the amino acid sequence shown in Figure 1 [SEQ ID NO:2] or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package,
  • Proteins of the invention may be naturally occurring, produced recombinantly, or can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et al, Nature 570:105-111 (1984)).
  • a peptide corresponding to a fragment of the KGF-2 polypeptide of the invention can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the KGF-2 polypeptide sequence.
  • Non-classical amino acids include, but are not limited to, to the D- isomers of the common amino acids, 2,4-diaminobutyric acid, -amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, ⁇ -Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ - alanine, fluoro-amino acids, designer amino acids such as ⁇ -methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general.
  • Non-naturally occurring variants may be produced using art-known mutagenesis techniques, which include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see, e.g., Carter et al, Nucl. Acids Res. 75:4331 (1986); and Zoller et al, Nucl. Acids Res. 70:6487 (1982)), cassette mutagenesis (.see, e.g., Wells et al, Gene 34:315 (1985)), restriction selection mutagenesis (see, e.g. , Wells et al, Philos. Trans. R. Soc. London Ser A 577:415 (1986)).
  • the invention additionally, encompasses KGF-2 polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin; etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends, attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
  • the polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • a detectable label such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
  • the polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 1 1,500, 12,000, 12,500,
  • the polyethylene glycol may have a branched structure.
  • Branched polyethylene gly cols are described, for example, in U.S. Patent No. 5,643,575; Morpurgo et al, Appl. Biochem. Biotechnol. 56:59-12 (1996); Vorobjev et al, Nucleosides Nucleotides 18:2145-2150 (1999); and Caliceti et al, Bioconjug. Chem. 70:638-646 (1999), the disclosures of each of which are incorporated herein by reference.
  • polyethylene glycol molecules should be attached to the protein with consideration of effects on functional or antigenic domains of the protein.
  • attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al, Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • polyethylene glycol may be attached to proteins via linkage to any of a number of amino acid residues.
  • polyethylene glycol can be linked to a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues.
  • One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.
  • specific amino acid residues e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine
  • One may specifically desire proteins chemically modified at the amino acid residues e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof
  • polyethylene glycol As an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected
  • N-terminally pegylated protein The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules.
  • Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • pegylation of the proteins of the invention may be accomplished by any number of means.
  • polyethylene glycol may be attached to the protein either directly or by an intervening linker.
  • Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al, Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et al, Intern.
  • One system for attaching polyethylene glycol directly to amino acid residues of proteins without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (C1S0 2 CH 2 CF 3 ).
  • MPEG monmethoxy polyethylene glycol
  • C1S0 2 CH 2 CF 3 tresylchloride
  • polyethylene glycol is directly attached to amine groups of the protein.
  • the invention includes protein-polyethylene glycol conjugates produced by reacting proteins of the invention with a polyethylene glycol molecule having a 2,2,2-trifluoreothane sulphonyl group.
  • Polyethylene glycol can also be attached to proteins using a number of different intervening linkers.
  • U.S. Patent No. 5,612,460 discloses urethane linkers for connecting polyethylene glycol to proteins.
  • Protein-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the protein by a linker can also be produced by reaction of proteins with compounds such as MPEG-succinimidylsuccinate, MPEG activated with l,l'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG- succinate derivatives.
  • polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in WO 98/32466, the entire disclosure of which is incorporated herein by reference.
  • Pegylated protein products produced using the reaction chemistries set out herein are included within the scope of the invention.
  • the number of polyethylene glycol moieties attached to each protein of the invention i.e., the degree of substitution
  • the pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules.
  • the average degree of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule.
  • Methods for determining the degree of substitution are discussed, for example, in Delgado et al, Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
  • Native KGF-2 is relatively unstable in the aqueous state and it undergoes chemical and physical degradation resulting in loss of biological activity during processing and storage. Native KGF-2 is also prone to aggregation in aqueous solution, at elevated temperatures and it becomes inactivated under acidic conditions.
  • Particularly preferred KGF-2 polypeptides are the deletion mutants shown below (numbering starts with the first amino acid in the protein (Met):
  • Preferred embodiments include the N-terminal deletions Ala (63) — Ser (208) (KGF-2 ⁇ 28) and Ser (69) - Ser (208) (KGF-2 ⁇ 33).
  • Other preferred N- terminal and C-terminal deletion mutants include: Ala (39) ⁇ Ser (208); Pro (47) - Ser (208); Val (77) - Ser (208); Glu (93) - Ser (208); Glu (104) - Ser (208); Val (123) - Ser (208); and Gly (138) - Ser (208).
  • Other preferred C-terminal deletion mutants include: Met (1), Thr (36), or Cys (37) - Lys (153).
  • deletion mutants having amino acids deleted from both the N- terminus and the C-terminus.
  • Such mutants include all combinations of the N-terminal deletion mutants and C-terminal deletion mutants described above, e.g., Ala (39) — His (200), Met (44) - Arg
  • preferred KGF polypeptides for use in pharmaceutical formulations of the present invention comprise N-terminal deletion mutants, including those comprising the amino acid sequence shown in Figure 1 (SEQ ID NO:2) except for a deletion of at least the first 38 N-terminal amino acid residues (i.e., a deletion of at least Met (1) — Gin (38)) but not more than the first 147 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 38 N- terminal amino acid residues (i.e., a deletion of at least Met (1) — Gin (38)) but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 46 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 62 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 68 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 76 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 92 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 103 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the first 122 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the present invention is also directed to a formulation having all combinations of the above described ranges, e.g., deletions of at least the first 62 N-terminal amino acid residues but not more than the first 68 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the first 62 N-terminal amino acid residues but not more than the first 76 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the first 62 N-terminal amino acid residues but not more than the first
  • formulations comprising C-terminal deletion mutants are provided by the present invention.
  • the N-terminal amino acid residue of said C-terminal deletion mutants is amino acid residue 1 (Met), 36 (Thr), or 37 (Cys) of Figure 1 (SEQ ID NO:2).
  • Such formulations comprising mutants include those comprising the amino acid sequence shown in Figure 1
  • the formulation comprises a mutant having a deletion that will include at least the last C-terminal amino acid residue but not more than the last 65 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the last 10 C-terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the last 20 C-terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the last 30 C- terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the last 40 C-terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the formulation comprises a mutant having a deletion that will include at least the last 50 C-terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • the present invention is also directed to a formulation having all combinations of the above described ranges, e.g., deletions of at least the last C-terminal amino acid residue but not more than the last 10 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the last C-terminal amino acid residue but not more than the last 20 C- terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the last C-terminal amino acid residue but not more than the last 30 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the last C-terminal amino acid residue but not more than the last 40 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2); deletions of at least the last 10 C-terminal amino acid residues but not more than the last 20 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2)
  • the KGF-2 polypeptide can be a deletion mutant having amino acids deleted from both the N- terminal and C-terminal residues.
  • Such mutants include all combinations of the N-terminal deletion mutants and C-terminal deletion mutants described above.
  • Such mutants include those comprising the amino acid sequence shown in Figure 1 (SEQ ID NO:2) except for a deletion of at least the first 46 N-terminal amino acid residues but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2) and a deletion of at least the last C-terminal amino acid residue but not more than the last 55 C-terminal amino acid residues of Figure 1 (SEQ ID NO:2).
  • a deletion can include at least the first 62, 68, 76, 92, 103, or 122 N-terminal amino acids but not more than the first 137 N-terminal amino acid residues of Figure 1 (SEQ ID NO:2) and a deletion of at least the last 10, 20, 30, 40, or 50 C-terminal amino acid residues but not more than the last 55 C-terminal amino acid residues of Figure 1. Further included are all combinations of the above described ranges.
  • Useful KGF-2 polypeptides include those having substitution of amino acids.
  • Native mature KGF-2 contains 44 charged residues, 32 of which carry a positive charge.
  • substitution of one or more of these clustered residues with amino acids carrying a negative charge or a neutral charge may alter the electrostatic interactions of adjacent residues and may be useful to achieve increased stability and reduced aggregation of the protein. Aggregation of proteins cannot only result in a loss of activity but be problematic when preparing pharmaceutical formulations, because they can be immunogenic (Pinckard et al. ,
  • Any modification should give consideration to minimizing charge repulsion in the tertiary structure of the protein molecule.
  • substitutions of charged amino acid with another charge and with neutral or negatively charged amino acids results in proteins with a reduced positive charge to improve the characteristics of KGF-2.
  • improvements include increased stability and reduced aggregation of the analog as compared to the native KGF-2 protein.
  • the replacement of amino acids can also change the selectivity of binding to cell surface receptors.
  • KGF-2 molecules may include one or more amino acid substitutions, deletions or additions, either from natural mutation or human manipulation.
  • Examples of some preferred mutations are: Ala (49) Gin, Asn (51) Ala, Ser (54) Val, Ala (63) Pro, Gly (64) Glu, Val (67) Thr, Trp (79) Val, Arg (80) Lys, Lys (87) Arg, Tyr (88) Trp, Phe (89) Tyr, Lys (91) Arg, Ser (99) Lys, Lys (102) Gin, Lys 103(Glu), Glu (104) Met, Asn (105) Lys, Pro (107) Asn, Ser (109) Asn, Leu (111) Met, Thr (114) Arg, Glu(l 17) Ala, Val (120) He, Val (123) He, Ala (125) Gly, He (126) Val, Asn (127) Glu, Asn (127) Gin, Tyr (130) Phe, Met (134) Thr, Lys (136) Glu, Lys (137) Glu, Gly (142) Ala, Ser (143) Lys, Phe (146) Ser, Asn (148) Glu
  • Ala (49) Gin is intended that the Ala at position 49 of Figure 1 (SEQ ID NO:2) is replaced by Gin.
  • Aromatic phenylalanine tryptophan tyrosine
  • the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. Generally speaking, the number of substitutions for any given KGF-2 polypeptide will not be more than 50, 40, 30, 20, 10, 5, or 3, depending on the objective. For example, a number of substitutions that can be made in the C-terminus of KGF-2 to improve stability.
  • Amino acids in KGF-2 that are essential for function can be identified by methods well known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244 : 1081 - 1085 (1989). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro and in vivo proliferative activity. (See, e.g., Example 1). Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labelling. (See for example: Smith et al, J. Mol. Biol, 224: 899-904 (1992); and de Vos et al. Science, 255: 306-312 (1992).)
  • KGF polypeptides include polypeptides having substitutions of serine for cysteine at amino acid positions 37 and 106 and 150.
  • An uneven number of cysteines means that at least one cysteine residue is available for intermolecular crosslinks or bonds that can cause the protein to adopt an undesirable tertiary structure.
  • Novel KGF-2 proteins that have one or more cysteines replaced by serine or e.g. alanine are generally purified at a higher yield of soluble, correctly folded protein.
  • cysteine residue at position 106 is important for function. This cysteine residue is highly conserved among all other FGF family members. Further KGF-2 polypeptides are described in PCT/US95/01790, filed
  • compositions of the present invention can be employed to stimulate epithelial cell proliferation and basal keratinocytes for the pu ⁇ ose of wound healing, and to stimulate hair follicle production and healing of dermal wounds. These wounds may be of superficial nature or may be deep and involve damage of the dermis and the epidermis of skin.
  • KGF-2 is useful for treating a number of diseases and conditions.
  • KGF-2 is active in vitro and in vivo in various wound healing models. See, U.S. Application Nos. 08/910,875, filed August 13, 1997 and 09/023,082 filed February 13, 1998.
  • the individual to which KGF-2 is administered may heal wounds at a normal rate or may be healing impaired.
  • KGF-2 When administered to an individual who is not healing impaired, KGF-2 is administered to accelerate the normal healing process.
  • KGF-2 When administered to an individual who is healing impaired, KGF-2 is administered to facilitate the healing of wounds which would otherwise heal slowly or not at all.
  • afflictions and conditions can result in healing impairment. These afflictions and conditions include diabetes (e.g., Type II diabetes mellitus), treatment with both steroids and non-steroid pharmacological agents, and ischemic blockage or injury.
  • growth factors have been shown to promote wound healing in healing impaired individuals. These growth factors include growth hormone-releasing factor, platelet-derived growth factor, and basic fibroblast growth factors. Thus, the present invention also encompasses the administration of KGF-2 compositions in conjunction with one or more additional growth factors or other agent which promotes wound healing.
  • compositions of the present invention also promote the healing of anastomotic and other wounds caused by surgical procedures in individuals which both heal wounds at a normal rate and are healing impaired.
  • compositions of the present invention may also be employed to stimulate differentiation of cells, for example muscle cells, cells which make up nervous tissue, prostate cells, and lung cells.
  • the compositions of the present invention are clinically useful in stimulating wound healing of wounds including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, and burns resulting from heat exposure to extreme temperatures of heat or cold, or exposure to chemicals, in normal individuals and those subject to conditions which induce abnormal wound healing such as uremia, malnutrition, vitamin deficiencies, obesity, infection, immunosuppression and complications associated with systemic treatment with steroids, radiation therapy, and antineoplastic drugs and antimetabolites.
  • compositions are also useful for promoting the healing of wounds associated with ischemia and ischemic injury, e.g., chronic venous leg ulcers caused by an impairment of venous circulatory system return and/or insufficiency; for promoting dermal reestablishment subsequent to dermal loss; increasing the tensile strength of epidermis and epidermal thickness; and increasing the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
  • wounds associated with ischemia and ischemic injury e.g., chronic venous leg ulcers caused by an impairment of venous circulatory system return and/or insufficiency
  • dermal reestablishment subsequent to dermal loss e.g., chronic venous leg ulcers caused by an impairment of venous circulatory system return and/or insufficiency
  • dermal reestablishment subsequent to dermal loss e.g., chronic venous leg ulcers caused by an impairment of
  • KGF-2 polypeptides include, but are not limited to, for example, to stimulate epithelial cell proliferation and basal keratinocytes for the pu ⁇ ose of treating burns and skin defects such as psoriasis and epidermo lysis bullosa.
  • KGF-2 can be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
  • KGF-2 can also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections.
  • KGF-2 can be used to treat diseases and conditions of the liver, lung, kidney, breast, pancreas, stomach, small intestine, and large intestine.
  • KGF-2 can be used to treat inflamamatory bowel diseases, diabetes, thrombocytopenia, hypofibrinogenemia, hypoalbuminemia, hypoglobulinemia, hemorrhagic cystitis, xerostomia, keratoconjunctivitis sicca.
  • KGF-2 can be used to stimulate the epithelial cells of the salivary glands, lacrimal glands and stimulating re-epithelialization of the sinuses and the growth of nasal mucosa.
  • the present invention is directed to novel liquid and lyophilized formulations of KGF-2 and deletion mutants thereof.
  • This invention further relates to formulations of KGF-2 for therapeutic use.
  • the formulations provide superior stability to the active KGF-2 polypeptides and in some instances, potentiate and dramatically increase the wound-healing activity of the polypeptides.
  • the KGF-2 ⁇ 33 polypeptide used in the formulations of the present invention may or may not have the N-terminal methionine, preferably the polypeptide will be lacking the N-terminal methionine. Stability of the KGF-2 polypeptide formulations of the present invention is determined by proliferation assays, as described herein below.
  • KGF-2 Other therapeutic uses of KGF-2 are described in U.S. Appl. Nos. 60/074,585, filed February 13, 1998, 60/114,484, filed December 30, 1998, and 09/248,998, filed February 12, 1999, the disclosures of all of which are inco ⁇ orated by reference herein.
  • Dermal keratinocytes are cells in the epidermis of the skin. The growth and spreading of keratinocytes in the skin is an important process in wound healing. A proliferation assay of keratinocyte is therefore a valuable indicator of protein activities in stimulating keratinocyte growth and consequently, wound healing.
  • Keratinocytes are, however, difficult to grow in vitro. Few keratinocyte cell lines exist. These cell lines have different cellular and genetic defects. In order to avoid complications of this assay by cellular defects such as loss of key growth factor receptors or dependence of key growth factors for growth, primary dermal keratinocytes are chosen for this assay. These primary keratinocytes are obtained from Clonetics, Inc. (San Diego, CA).
  • the bioactivity of KGF-2 polypeptides can be determined by a cell proliferation assay employing murine BaO 2b cells that have been transfected with the fibroblast growth factor 2iiib receptor (FGFR2iiib). Proliferation of the cells is measured by the inco ⁇ oration of [Methyl - 3 H]-thymidine after the cells have been exposed to the protein as described below.
  • the assay is carried out in a 96 well tissue culture cluster plate with about 22,000 Baf3 2b cells in each well. The cells are exposed to different concentrations of a KGF-2 polypeptide in triplicate and incubated at 37°C in a CO 2 incubator for approximately 48 hours.
  • Alamar Blue is a viable blue dye that is metabolized by the mitochondria when added to the culture media. The dye then turns red in tissue culture supernatants. The amounts of the red dye may be directly quantitated by reading difference in optical densities between 570 nm and 600 nm. This reading reflects cellular activities and cell number.
  • Keratinocytes Normal primary dermal keratinocytes (CC-0255, NHEK-Neo pooled) are purchased from Clonetics, Inc. These cells are passage 2. Keratinocytes are grown in complete keratinocyte growth media (CC-3001 , KGM; Clonetics, Inc.) until they reach 80%> confluency. The cells are trypsinized according to the manufacturer's specification. Briefly, cells are washed twice with Hank's balanced salt solution. 2-3 ml of trypsin is added to cells for about 3-5 min at room temperature. Trypsin neutralization solution is added and cells are collected. Cells are spun at 600 xg for 5 min at room temperature and plated into new flasks at 3,000 cells per square centi-meter using pre- warmed media.
  • Useful deletion mutants for use in compositions of the present invention can be constructed by the following protocol.
  • Deletion mutants were constructed from the 5' terminus and 3' terminus of KGF-2 gene using an optimized KGF-2 construct as a template. The deletions were selected based on regions of the gene that might negatively affect expression in E. coli. For the 5' deletion the primers listed below were used as the 5' primer.
  • KGF-2 FGF- 12
  • Hindlll primer was used for the 3' primer.
  • PCR amplification for 25 rounds was performed using standard conditions.
  • the products for the KGF-2 36aa/208aa deletion mutant were restricted BspHI for the 5' site and Hindlll for the 3' site and cloned into the pQE60 which has bee digested with BspHI and Hindlll. All other products were restricted with Ncol for the 5' restriction enzyme and Hindlll for the 3' site, and cloned into the pQE60 which had been digested with Ncol and Hindlll.
  • KGF-2 (FGF-12) 36aa 153aaand 128aa 3' Hindlll was used as the 3' primer with FGF-12 36aa 208aa as the 5' primer.
  • FGF-12 62aa/153aa 128aa 3' Hindlll was used as the 3' primer with FGF-12 62aa/208aa as the 5' primer.
  • the nomenclature of the resulting clones indicates the first and last amino acid of the polypeptide that results from the deletion.
  • KGF-2 36aa 153aa indicates that the first amino acid of the deletion mutant is amino acid 36 and the last amino acid is amino acid 153 of KGF-2.
  • the construction of these KGF-2 deletion mutants are also described in U.S. Application Nos. 08/910,875, and
  • each mutant has N-terminal Met added thereto.
  • the KGF-2 deletion polypeptides used in the formulations according to the present invention may or may not have the N-terminal methionine, preferably the polypeptide will be lacking the N-terminal methionine.
  • FGF 12 63aa/208aa
  • FGF 12 77aa/208aa 5' Ncol GGACAGCCATGGTTCGTTGGCGTAAACTG (SEQ ID NO:5)
  • FGF 12 93aa 208aa
  • FGF 12 104aa/208aa
  • FGF 12 123aa/208aa 5' Ncol GGACCCCCATGGAGAACTGCCCGTAGAGC (SEQ ID NO:7)
  • FGF 12 123aa/208aa 5' Ncol GGACCCCCATGGAGAACTGCCCGTAGAGC (SEQ ID NO:7)
  • FGF 12 138aa 208aa
  • pQE6 Two oligonucleotide primers (5952 and 19138) complementary to the desired region of KGF2 were synthesized with the following base sequence.
  • Primer 5952 5' GCGGCACATGTCTTACAACCACCTGCAGGGTG 3' (SEQ ID NO: 12)
  • Primer 19138 5' GGGCCCAAGCTTATGAGTGTACCACCAT 3' (SEQ ID NO: 12)
  • Primer 5952 also contains an ATG sequence adjacent and in frame with the KGF2 coding region to allow translation of the cloned fragment in E. coli, while primer 19138 contains two stop codons (preferentially utilized in E. coli) adjacent and in frame with the KGF2 coding region which ensures correct translational termination in E. coli.
  • KGF-2 (aa 36-208) as template.
  • the resulting amplicon was restriction digested with AfHII and Hindlll and subcloned into Ncol/Hindlll digested pQE6 protein expression vector.
  • KGF-2 ⁇ 33 in pHEl To permit Polymerase Chain Reaction directed amplification and subcloning of KGF2 ⁇ 33 into the E.coli expression vector, pHEl, two oligonucleotide primers (6153 and 6150) corresponding to the desired region of KGF2 were synthesized with the following base sequence.
  • Primer6153 5' CCGGCGGATCCCATATGTCTTACAACCACCTGCAGG3' (SEQ ID NO:14)
  • Primer6150 5' CCGGCGGTACCTTATTATGAGTGTACCACCATTGG3' (SEQ ID NO:15)
  • N-terminal primer (6153) In the case of the N-terminal primer (6153), an Ndel restriction site was inco ⁇ orated, while in the case of the C-terminal primer (6150) an Asp718 restriction site was inco ⁇ orated.
  • Primer 6153 also contains an ATG sequence adjacent and in frame with the KGF2 coding region to allow translation of the cloned fragment in E. coli, while primer 6150 contains two stop codons (preferentially utilized in E. coli) adjacent and in frame with the KGF2 coding region which ensures correct translational termination in E. coli.
  • KGF-2 (aa 36-208) as template.
  • the resulting amplicon was restriction digested with Ndel and Asp718 and subcloned into Ndel/Asp718 digested pHEl protein expression vector.
  • amino acids 172-208 were codon optimized to generate KGF2 ⁇ 33(s 172-208). This was achieved by an overlapping PCR strategy.
  • Oligonucleotides PM07 and PM08 (corresponding to amino acids 172-208) were combined and annealed together by heating them to 70 °C and allowing them to cool to 37 °C. The annealed oligonucleotides were then utilized as template for a standard PCR reaction which was directed by primers PM09 and PM 10. In a separate PCR reaction following standard conditions well known to those skilled in the art and using KGF2 ⁇ 33 as template, oligonucleotides PM05 (which overlaps with the Pstl site within coding region of KGF2) and PMl 1 were used to amplify the region of KGF2 corresponding to amino acids 84-172.
  • a third PCR reaction the product of the first PCR reaction (corresponding to codon optimized amino acids 172-208) and the product of the second PCR reaction (corresponding to codon non-optimized amino acids 84- 172) were combined and used as template for a standard PCR reaction directed by oligonucleotides PM05 and PM10.
  • the resulting amplicon was digested with Pstl /Hindlll and sub-cloned into Pstl /Hindlll digested pQE6KGF2 ⁇ 33, effectively substituting the corresponding non codon optimized region, and creating pQE6KGF2 ⁇ 33(sl 72-208).
  • a synthetic gene codon optimized for the region of KGF2 corresponding to amino acids 84- 172 was generated utilizing overlapping oligonucleotides.
  • Four oligonucleotides (PM31 , PM32, PM33 and PM 34) were combined and seven cycles of the following PCR was performed: 94°C, 30 sees; 46.5 °C, 30 sees; and 72°C, 30 sees.
  • a second PCR reaction directed by primers PM35 and PM36 was then performed following standard procedures, utilizing 1 ⁇ l of the first PCR reaction as template.
  • the resulting codon optimized gene fragment was then digested with Pstl/Sall and subcloned into Pstl /Sail digested pQE6KGF2 ⁇ 33(s 172-208) to create a fully optimized KGF2 encoding gene, pQE6KGF2 ⁇ 33s.
  • KGF2 ⁇ 33s was PCR amplified utilising primers PM102 and PM130 on pQE6KGF2 ⁇ 33s.
  • the resulting amplicon was digested with Ndel and EcoRV and subcloned into the pHEl expression vector which had been digested with Ndel and Asp718 (blunt ended) to create pHEl ⁇ 33s.
  • PM35 GCGGCGTCGACCGTTGTGCTGCCAG (SEQ ID NO:28)
  • PM36 GCGGCCTGCAGGGTGACGTTCGTTGG (SEQ ID NO:29)
  • PMl 02 CCGGCGGATCCCATATGTCTTACAACCACCTGCAGG (SEQ ID NO:30)
  • PM130 CGCGCGATATCTTATTAAGAGTGTACCACCATTG (SEQ ID NO:31)
  • KGF-2 ⁇ 33 formulation is a liquid that is stored at -20°C.
  • KGF-2 ⁇ 33 polypeptide 20 mM sodium acetate, 125 mM sodium chloride, 1 mM EDTA, Water, pH 6.2.
  • This formulation retained its in vitro bioactivity for up to 10 months at storage conditions at or below 2 to 8°C.
  • the bioactivity at 10 months is shown in Figure 3.
  • This formulation retained all its physico-chemical properties for up to 11 months at storage conditions at or below
  • Bioactivity was measured using a cell proliferation assay as follows.
  • BaF3 cells were routinely grown and maintained in RPMI 1640 medium containing 10 % NBCS, 10 %> WEHI cell conditioned medium, 2 mM glutamine, 600 ⁇ g/ml GENETICIN, 1 ⁇ l ⁇ mercaptoethanol/500 ml growth medium, 50 units penicillin and 50 ⁇ g/ml streptomycin (Ornitz, D., M. et al (1996) J Biol.
  • the cell plates were incubated in a 37° C, 5 % C0 2 incubator for 36 - 40 hr. and 0.5 ⁇ Ci methyl - 3 H thymidine in 50 ⁇ l basal medium was added to each well.
  • the plates were incubated for another 5 hr. in the incubator and cells were harvested by filtration on a glass fiber filter using a Tomtec Harvester 96. Inco ⁇ orated thymidine was counted on a Wallac ⁇ plate scintillation counter.
  • KGF-2 ⁇ 33 lyophilized formulation. 10 mg/ml KGF-2 ⁇ 33,
  • Example 1 Reverse-phase HPLC demonstrated that the formulation retained its physio-chemical properties for up to 8 months at temperatures of at or below 45 ° C and 75%) relative humidity.
  • This formulation is prepared by adding KGF-2 ⁇ 33 polypeptide to the carboxy methyl cellulose solution.
  • the viscosity of the resulting formulation was about 250 cps as determined by rotating spindle viscometer.
  • the KGF-2 polypeptide retained bioactivity in the presence of carboxy methyl cellulose. Bioactivity of the formulation was assayed using the cell proliferation assay detailed in Example 1.
  • KGF-2 ⁇ 33 is added to a Pluronic solution at about 2°C to about 8°C.
  • the viscosity of the resulting formulation was about 50 cps at 20 °C and solid at about 37°C.
  • KGF-2 retained bioactivity in the presence of Pluronic F127 as measured by the cell proliferation assay detailed in Example 1.
  • KGF-2 ⁇ 33 protein stock formulations (0.1 to 2.0 mg/ml) were prepared with or without monothioglycerol (MTG).
  • the protein formulations were diluted in 1 x phosphate buffered saline (PBS) at pH 7.2 to attain the required concentrations for use in the cell proliferation assays.
  • PBS phosphate buffered saline
  • BaF32b cells were routinely grown and maintained in RPMI 1640 medium containing 10 %> NBCS, 10 %> WEHI cell conditioned medium, 2 mM glutamine, 600 ⁇ g/ml GENETICIN, 1 ⁇ l ⁇ mercaptoethanol/500 ml growth medium, 50 units penicillin and 50 ⁇ g/ml streptomycin (Ornitz, D., M. et al (1996) J. Biol. Chem. 271:15292-15291).
  • BaF32b cells were harvested by centrifugation and washed with Basal medium (this has the same composition as the growth medium, but contains no WEHI conditioned medium and is supplemented with 1 ⁇ g/ml heparin). Following this operation the cells were resuspended in basal medium and 22,000 cells/180 ⁇ l were plated/well in a 96 well cell culture cluster dish. Appropriate dilutions ( 10 X higher than the required final concentration) of KGF 2 were made in PBS in another 96 well plate and added to the cells to a final volume of 200 ⁇ l. The cell plates were incubated in a 37° C, 5 % CO 2 incubator for 36 - 40 hr.
  • the cell proliferation assay was carried out with KGF-2 exposed to different concentrations of monothioglycerol (MTG). Control samples contained no excipient. With MTG, stimulation of KGF-2 activity was observed with various concentrations of MTG is shown in Figure 5. The increase in activity was between 10- 150%> of control depending on the concentration of MTG used. This enhancement of cell proliferation activity was not observed with other members of this growth factor family. From these observations, it was concluded that stimulation of KGF-2 activity by MTG was quite specific.
  • Monothioglycerol appears to specifically stimulate the in vitro cell proliferation activity of KGF-2.
  • KGF-2 a liquid at room temperature and that subsequently gels upon application to skin.
  • the following ingredients were mixed to create a KGF-2 formulation that can gel upon application to skin.
  • KGF-2 ⁇ 33 1 or 2 mg/ml 20 mM sodium citrate, 125 mM sodium chloride, 1 mM disodium EDTA, water.
  • KGF-2 ⁇ 33 was lyophilized in the presence of one of three bulking agents: mannitol, sucrose and trehalose.
  • Formulations A. 10 mM sodium citrate, 20 mM sodium chloride, ImM disodium
  • the concentration of KGF-2 polypeptide was 3 mg/ml and 8 mg/ml. Evaluation parameters were RP-HPLC, SDS-PAGE, appearance, before and following reconstitution with water.
  • the lyophilized products were reconstituted with water or water containing 1%> monothioglycerol.
  • Configurations 1 and 2 are lyophilized KGF-2 alone; configurations 3 and 4 include the thickening agent as part of the lyo cake; and configurations 5-8 include the thickening agent as part of the liquid diluent.
  • KGF-2 used in treating chronic wounds is expected to involve multiple, topical applications of the drug.
  • the lyophilized configuration requires a separate vial of drug product to be reconstituted per application due to the absence of any preservative. This results in a significant amount of drug waste, as well as a more labor-intensive product preparation to be performed at every dosing.
  • the commercial configuration of KGF-2 would involve a single vial of KGF-2 that could be used for multiple applications. To investigate the feasibility of this configuration, the compatibility of KGF-2 with preservatives was examined.
  • Preservatives were selected from a list of FDA approved compounds. The five candidate preservatives selected were based on prevalence in the Physicians Desk Reference (PDR) as well as previous published work with biopharmaceuticals. Since the formulation and dosage form have not been finalized, strong emphasis was not initially placed on compatibility with the elastomeric closure or stability at pH 6.2. Concentrations were selected based on literature values as well as FDA/USP and BP guidelines. The table below presents the five candidate preservatives examined in this study.
  • Parabens is defined in this example as 0.18%o methylparaben and 0.02%) propylparaben.
  • KGF-2 was diafiltered into a base formulation buffer containing one of the following: 0.9%> benzyl alcohol, 0.5%. chlorobutanol, 0.5% phenol, 0.3%> m-cresol, or 0.18% methyl paraben + 0.02% propel paraben ("parabens").
  • Diafiltration was performed in an Amicon stirred-cell with a Biomax lOkD membrane. All processing was carried out at 2-8 °C. A total of 5 buffer exchanges were performed for each diafiltration. Recoveries during diafiltration were > 90%..
  • KGF-2 was diluted to 1.0 mg/mL and filled (1.0 mL) into 2 mL Schott Purform vials, and sealed with a Diakyo D-7771 serum stopper and aluminum crimp seal. Vials were stored at -80 °C, 2-8 °C, and 25 °C/60%> relative humidity. Formulations that contained precipitation were 0.2 ⁇ m filtered prior to further analysis.
  • Tris-glycine Novex gel A total of 2 ⁇ g of KGF-2 was loaded per lane. The gels were run under constant voltage (125 V) for approximately 2 hours. Staining was performed using a Daiichi silver stain kit according to the manufacturer's instructions.
  • Bioactivity of KGF-2 is determined using a murine lymphocyte cell line, BaO 2b, that has been stably transected with the fibroblast growth factor 2iiib receptor. Activity is based on cellular proliferation as measured by the inco ⁇ oration of [mefhyl- 3 H] thymidine after exposure to KGF-2.
  • DSC Differential Scanning Colorimetry
  • RP-HPLC concentration, purity, percent oxidized RP-HPLC was performed on a Waters 2690 Alliance system equipped with a Waters 996 photodiode array detector.
  • a typical chromatogram of the standard is shown below. Two major peaks are separated and have been identified previously as the intact KGF-2 peak and an oxidized form of KGF-2. Percent oxidized is reported as an area percentage of the total area. Percent purity is the area percent attributed to the sum of the intact and oxidized form.
  • Chlorobutanol and parabens show promising compatibility with KGF-2 at 2-8 °C.
  • Benzyl alcohol, m-cresol, and phenol cause rapid aggregation of
  • KGF-2 when stored at 2-8 °C. When stored at 25 °C, all formulations have poor appearance after one week of storage. KGF-2 precipitates out of solution when subjected to freeze/thaw conditions in the presence of m-cresol and phenol.
  • KGF-2 The specific activity of KGF-2 is not affected by the presence of any of the preservatives tested. Although the total activity of the formulations stored at 25 °C does decrease after six weeks storage due to precipitation of KGF-2, the soluble protein in the chlorobutanol, parabens, and benzyl alcohol formulations retained its specific activity.
  • Benzyl alcohol causes rapid oxidation of KGF-2, followed by continued degradation of the oxidized form. This is exhibited by a high initial level of oxidation (formed during diafiltration), followed by a slow transition into further oxidized forms.
  • the remaining formulations When stored at 2-8 °C, the remaining formulations have comparable oxidation rates of approximately 4% per month. When stored at 25 °C, the oxidation rates increase to 30-40% per month.
  • the one containing parabens has the slowest average oxidation rate. Purity is determined as the sum of the main and oxidized form of KGF-2 as a percentage of the total chromatographic area.
  • the formulations containing benzyl alcohol or phenol exhibit an initially low purity, followed by a rise and then gradual loss of purity. This corresponds with a sha ⁇ increase at time zero of a chromatographic peak that appears to correspond with soluble aggregate. As precipitate continues to form, this peak disappears with no subsequent increase in any other peak area.
  • the formulation containing parabens retains the highest purity.
  • SDS-PAGE shows a slight increase in dimer band in the benzyl alcohol containing formulation at time zero as well as six weeks storage. Slight lane streaking and increased levels of dimer are observed in the formulations stored at 25 °C.
  • KGF-2 is incompatible with benzyl alcohol, m-cresol, and phenol under the conditions examined. In these formulations, aggregation followed by precipitation was the primary pathway for degradation. Of the preservatives tested, methyl/propyl paraben has the least impact on the short-term stability of
  • This formulation retained its in vitro bioactivity for up to 12 months at storage conditions at or below 25 °C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des formes liquides et lyophilisées du facteur de croissance kératinocytaire 2 (KGF-2) et de certains de leurs dérivés. L'invention concerne également des formulations à base de KGF-2 à usage thérapeutique, notamment pour favoriser ou accélérer la guérison de blessures.
EP00941186A 1999-06-02 2000-06-02 Formulations a base de fecteur de croissance keratinocytaire 2 Withdrawn EP1196187A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US13744899P 1999-06-02 1999-06-02
US137448P 1999-06-02
US16091399P 1999-10-22 1999-10-22
US160913P 1999-10-22
PCT/US2000/015186 WO2000072872A1 (fr) 1999-06-02 2000-06-02 Formulations a base de fecteur de croissance keratinocytaire 2

Publications (2)

Publication Number Publication Date
EP1196187A1 true EP1196187A1 (fr) 2002-04-17
EP1196187A4 EP1196187A4 (fr) 2003-02-05

Family

ID=26835257

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00941186A Withdrawn EP1196187A4 (fr) 1999-06-02 2000-06-02 Formulations a base de fecteur de croissance keratinocytaire 2

Country Status (9)

Country Link
EP (1) EP1196187A4 (fr)
JP (1) JP2003500456A (fr)
KR (1) KR20020010920A (fr)
CN (1) CN1359299A (fr)
AU (1) AU5593200A (fr)
CA (1) CA2375829A1 (fr)
HK (1) HK1045816A1 (fr)
MX (1) MXPA01012387A (fr)
WO (1) WO2000072872A1 (fr)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6693077B1 (en) 1995-02-14 2004-02-17 Human Genome Sciences, Inc. Keratinocyte growth factor-2
US6077692A (en) 1995-02-14 2000-06-20 Human Genome Sciences, Inc. Keratinocyte growth factor-2
US7232667B2 (en) 1995-02-14 2007-06-19 Human Genome Sciences, Inc. Keratinocyte growth factor-2 polynucleotides
NZ505324A (en) 1997-12-22 2002-11-26 Human Genome Sciences Inc Liquid and lyophilised KGF-2 polypeptide formulations used to accelerate soft tissue growth or regeneration
US6869927B1 (en) 1997-12-22 2005-03-22 Human Genome Sciences, Inc. Keratinocyte growth factor-2 formulations
EP1054900A4 (fr) 1998-02-13 2004-12-22 Human Genome Sciences Inc Utilisations therapeutiques du facteur-2 de croissance de keratinocyte
US6835536B2 (en) 2001-08-21 2004-12-28 Micrologix Biotech Inc. Antimicrobial cationic peptides and formulations thereof
US7053051B2 (en) 2003-10-28 2006-05-30 Medtronic, Inc. Methods of preparing crosslinked materials and bioprosthetic devices
AU2004288854B2 (en) * 2003-11-10 2009-10-01 Arriva-Pharmaceuticals, Inc. Dry recombinant human alpha 1-antitrypsin formulation
CN101084008B (zh) * 2004-12-15 2013-04-10 比奥维特罗姆股份公开公司 角质形成细胞生长因子的治疗制剂
MY142987A (en) 2005-06-08 2011-02-14 Hayashibara Biochem Lab Solution for tissue adhesion prevention and method for tissue adhesion prevention
CN100434117C (zh) * 2006-06-06 2008-11-19 武汉大学 一种治疗慢性宫颈炎的栓剂
PL2047857T3 (pl) * 2006-06-29 2012-05-31 Kyoto Biopharma Inc Środek przeznaczony do wstrzykiwania zawierający antybiotyk i roztwór do wstrzykiwania zawierający środek
CA2708716A1 (fr) * 2007-12-21 2009-07-02 Glaxosmithkline Biologicals S.A. Vaccins anti-malaria
CN101642576B (zh) * 2008-08-05 2011-08-17 温州医学院 Kgf-2的聚乙二醇修饰物及其制备方法
CN101537172B (zh) * 2008-08-14 2010-06-30 温州医学院 一种含有重组人角质细胞生长因子-2滴眼液及其制备方法
WO2011011808A1 (fr) * 2009-07-30 2011-02-03 Roman Buga Composition cosmétique comprenant du chlorure de sodium en combinaison avec et/ou au moins une protéine, un collagène, une gélatine, un acide aminé
CN102727890A (zh) * 2012-07-05 2012-10-17 吉林农业大学 抗重组人角质细胞生长因子-2抗体的应用
WO2016138362A1 (fr) * 2015-02-26 2016-09-01 The Board Of Trustees Of The University Of Arkansas Vaccin de traitement pour le cancer de la prostate
CN106377760A (zh) * 2016-10-26 2017-02-08 李天学 一种含有角质细胞生长因子‑2(kgf‑2)的制剂在缓解糖尿病溃疡的应用
CN108338967B (zh) * 2017-09-15 2020-11-20 浙江唯美生物科技有限公司 一种含有成纤维细胞生长因子10的胶原缓释水凝胶
CN112512504A (zh) * 2018-06-22 2021-03-16 温州医科大学 一种水凝胶、含其的药物组合物及其应用

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518697A2 (fr) * 1991-06-14 1992-12-16 Amgen Inc. Pellicule en collagène pour la libération soutenue de protéines
EP0619115A1 (fr) * 1993-04-01 1994-10-12 Amgen Inc. Récipient avec une valve de dosage et contenant des microparticules d'un médicament pour le traitement topique de maladies cutanées
US5580856A (en) * 1994-07-15 1996-12-03 Prestrelski; Steven J. Formulation of a reconstituted protein, and method and kit for the production thereof
WO1998006844A1 (fr) * 1996-08-13 1998-02-19 Human Genome Sciences, Inc. Facteur de croissance des keratinocytes (kgf2 ou facteur de croissance des fibroblastes 12, fgf 12)
WO1998016243A1 (fr) * 1996-10-15 1998-04-23 Amgen Inc. Utilisations du facteur-2 de croissance de keratinocyte
WO1998016642A1 (fr) * 1996-10-15 1998-04-23 Amgen Inc. Produits a base du facteur de croissance 2 des keratinocytes
US5814605A (en) * 1993-03-26 1998-09-29 Amgen Inc. Therapeutic uses of keratinocyte growth factor
WO1999032135A1 (fr) * 1997-12-22 1999-07-01 Human Genome Sciences, Inc. Formulations du facteur-2 de croissance des keratinocytes

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518697A2 (fr) * 1991-06-14 1992-12-16 Amgen Inc. Pellicule en collagène pour la libération soutenue de protéines
US5814605A (en) * 1993-03-26 1998-09-29 Amgen Inc. Therapeutic uses of keratinocyte growth factor
EP0619115A1 (fr) * 1993-04-01 1994-10-12 Amgen Inc. Récipient avec une valve de dosage et contenant des microparticules d'un médicament pour le traitement topique de maladies cutanées
US5580856A (en) * 1994-07-15 1996-12-03 Prestrelski; Steven J. Formulation of a reconstituted protein, and method and kit for the production thereof
WO1998006844A1 (fr) * 1996-08-13 1998-02-19 Human Genome Sciences, Inc. Facteur de croissance des keratinocytes (kgf2 ou facteur de croissance des fibroblastes 12, fgf 12)
WO1998016243A1 (fr) * 1996-10-15 1998-04-23 Amgen Inc. Utilisations du facteur-2 de croissance de keratinocyte
WO1998016642A1 (fr) * 1996-10-15 1998-04-23 Amgen Inc. Produits a base du facteur de croissance 2 des keratinocytes
WO1999032135A1 (fr) * 1997-12-22 1999-07-01 Human Genome Sciences, Inc. Formulations du facteur-2 de croissance des keratinocytes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO0072872A1 *

Also Published As

Publication number Publication date
EP1196187A4 (fr) 2003-02-05
KR20020010920A (ko) 2002-02-06
HK1045816A1 (zh) 2002-12-13
CN1359299A (zh) 2002-07-17
CA2375829A1 (fr) 2000-12-07
JP2003500456A (ja) 2003-01-07
MXPA01012387A (es) 2002-08-23
WO2000072872A1 (fr) 2000-12-07
AU5593200A (en) 2000-12-18

Similar Documents

Publication Publication Date Title
US6653284B2 (en) Keratinocyte growth factor-2 formulations
WO2000072872A1 (fr) Formulations a base de fecteur de croissance keratinocytaire 2
US10774124B2 (en) Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
AU736067B2 (en) Erythropoietin derivatives
US7582607B2 (en) Muteins of fibroblast growth factor 21
US20110251267A1 (en) Methods of using polynucleotides encoding truncated glial cell line-derived neurotrophic factor
EP0816381A1 (fr) Facteur de croissance des hepatocytes modifie a l'aide de polyethylene glycol
MX2011003788A (es) Mutantes fgf21 y uso de los mismos.
US6191106B1 (en) Muteins of epidermal growth factor exhibiting enhanced binding at low pH
US6869927B1 (en) Keratinocyte growth factor-2 formulations
CA2202390C (fr) Analogues du facteur de croissance des keratinocytes
JPH06228199A (ja) 血液脳関門通過可能なペプチド結合体
US5824647A (en) Chemotactic wound healing peptides
NZ521590A (en) Liquid and lyophilised formulations of KGF-2 and deletion or point or substitution mutants thereof used to accelerate soft tissue growth or regeneration
MXPA00006154A (en) Keratinocyte growth factor-2 formulations
EP0557319A1 (fr) Utilisation therapeutique du facteur de croissance de fibroblaste.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011218

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20021219

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20040624

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1045816

Country of ref document: HK