EP1194577A1

EP1194577A1 - Identification and overexpression of a dna sequence coding for 2-methyl-6-phytylhydroquinone-methyltransferase in plants

Info

Publication number: EP1194577A1
Application number: EP00942130A
Authority: EP
Inventors: Karin Herbers; Ralf Badur; Irene Kunze; Michael Geiger; Hans-Peter Mock
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 1999-07-09
Filing date: 2000-06-23
Publication date: 2002-04-10
Also published as: AU5685800A; DE19931834A1; CA2378657A1; WO2001004330A1

Abstract

A method for the prdouctin of plants with an increased tocipherol and tocotrienol content by overexpression of a gene coding for 2-methyl-6-phytylhydroquinone-methyltransferase.

Description

Identification and overexpression of a DNA sequence coding for a 2-methyl-6-phytylhydroquinone methyltransferase in plants

description

The invention relates to a DNA coding for a polypeptide with 2-methyl-6-phytylhydroquinone-methyltransferase activity. In addition, the invention relates to the use of DNA sequences coding for a polypeptide with 2-methyl-6-phytylhydroquinone methyltransferase activity for the production of plants with an increased content of tocopherols and tocotrienols, especially the use of the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or with these hybridizing DNA sequences or homologous to the overall sequence or partial sequences, a process for the production of plants with an increased content of tocopherols and tocotrienols, and the plant itself prepared in this way.

An important goal of planting genetic genetic work so far is the production of plants with an increased content of sugars, enzymes and amino acids. However, the development of plants with an increased vitamin content, such as e.g. the increase in tocopherol and tocotrienol levels.

The eight naturally occurring compounds with vitamin E activity are derivatives of 6-chromanol (Ulimann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, vitamin E ). The first group (la-d) is derived from tocopherol, the second group consists of derivatives of tocotrienol (2ad):

R3

la, α-tocopherol Rl = R2 = R3 ₌ H ₃ lb, ß-tocopherol [148-03 -81: R ¹ = R ³ = CH ₃ , R ² = H lc, γ-tocopherol [54-28-41: Rl = H, R2 = R3 = CH ₃ id, δ-tocopherol [119-13-11: Rl = R2 = H, R ³ = CH ₃

R3

2a, α-tocotrienol [1721-51-3]: R ^l = R ² = R ³ = CH ₃

2b, β-tocotrienol [490-23-3]: R = R ³ = CH ₃ , R ² = H 2c, γ-tocotrienol [14101-61-2]: R ¹ = H, R ² = R ³ = CH ₃

2d, δ-tocotrienol [25612-59-3]: R ^l = R ² = H, R ³ = CH ₃

Α-Tocopherol is of great economic importance.

There are limits to the development of crops with an increased content of tocopherols and tocotrienols through classic breeding methods.

A sensible alternative is the genetic engineering procedure, for example to isolate the essential biosynthesis genes coding for the tocopherol synthesis performance and to transfer them specifically in crop plants. This method assumes that biosynthesis and its regulation are known and that genes that influence biosynthesis performance are identified.

Isoprenoids or terpenoids consist of different classes of lipid-soluble molecules and are partially or completely formed from Cs-isoprene units. Pure prenyl lipids (e.g. carotenoids) consist of carbon skeletons that are exclusively based on isoprene units, while mixed prenyl lipids (e.g. chlorophylls, tocopherols and vitamin K) have an isoprenoid side chain that is linked to an aromatic nucleus.

The starting point for the biosynthesis of prenyl lipids are 3 x acetyl-CoA units, which are converted via ß-hydroxymethylglutaryl-CoA (HMG-CoA) and mevalonate into the starting isoprene unit (C5), the isopentenyl pyrophosphate (IPP). It has recently been shown by in vivo feeding ^experiments with C ¹³ that in various eubacteria, green algae and plant chloroplasts a Mevalonate-independent path to the formation of IPP is followed. In this process, hydroxyethylthiamine, which is formed by decarboxylation of pyruvate, and glyceraldehyde-3-phosphate (3-GAP) in a "transketolase" reaction mediated by the l-deoxy-D-xylulose-5-phosphate synthase are initially in 1- Deoxy-D-xylulose-5-phosphate converted (Lange et al, 1998; Schwender et al, 1997; Arigoni et al, 1997; Lichtenthaler et al, 1997; Sprenger et al, 1997). This is then converted into 2-C-methyl-D-erythritol-4-phosphate by an intramolecular rearrangement and then to IPP (Arigoni et al, 1997; Zeidler et al, 1998). Biochemical data indicate that the mevalonate route operates in the cytosol and leads to the formation of phytosterols. The antibiotic mevinolin, a specific inhibitor of mevalonate formation, only inhibits sterol biosynthesis in the cytoplasm, while prenyllipid formation in the plastids is unaffected (Bach & Lichtenthaler, 1993). The mevalonate-independent route, on the other hand, is localized plastidically and leads primarily to the formation of carotenoids and plastidic prenyl lipids (Schwender et al, 1997; Arigoni et al, 1997).

IPP is in equilibrium with its isomer, dimethylallyl pyrophosphate (DMAPP). A condensation of IPP with DMAPP in

Head-to-tail attachment produces the monoterpene (CIO) geranyl pyrophosphate (GPP). The addition of further IPP units leads to the sesquiterpene (C15) farnesy pyrophosphate (FPP) and to the diterpene (C20) geranyl-geranyl pyrophosphate (GGPP). Linking two GGPP molecules leads to the formation of the C40 precursors for carotenoids.

In mixed prenyl lipids, the isoprene side chain of various lengths is linked to non-isoprene rings, such as a porphyrin ring in chlorophyll a and b. The chlorophylls and phylloquinones contain a C20 phytyl chain in which only the first isoprene unit contains a double bond. GGPP is transformed by geranylgeranyl pyrophosphate oxidoreductase (GGPPOR) into phytyl pyrophosphate (PPP), the starting material for the further formation of tocopherols.

The ring structures of the mixed prenyl lipids that lead to the formation of vitamins E and K are quinones, the starting metabolites of which come from the Shikimate pathway. The aromatic amino acids phenylalanine and tyrosine are converted into hydroxyphenyl pyruvate, which is converted into ho-gentisic acid by dioxygenation. The chorismate is based on erythrose-4-phosphate and phosphoenolpyruvate (PEP) by their condensation to 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) via the intermediate stages of the shikimate pathway 3 'dehydroquinate,

3 ^x -dehydroshikimate, shikimate, shikimate-3-phosphate and 5 ^l -enolpyruvylshikimate-3-phosphate were formed. The erythrosis-4-phosphate is formed by the calvin cycle and the PEP is provided by the glycolysis. The homogentisic acid described above is then bound to phytyl pyrophosphate (PPP) or geranyl geranyl pyrophosphate in order to produce the precursors of α-tocopherol and α-tocotrienol, 2-methyl-6-phytylhydroquinone and that Form 2-methyl-6-geranylgeranyl hydroquinone. Methylation steps with S-adenosylmethionine as the methyl group donor initially produce 2,3-dimethyl-6-phytylquinol, then cyclization of α-tocopherol and repeated methylation of α-tocopherol (Richter, Biochemie der Pflanzen, Georg Thieme Verlag Stuttgart , 1996).

In the literature there are examples which show that manipulation of an enzyme can have a directional influence on the metabolite flow. In experiments with a modified expression of the phytogen synthase, which links two GGPP molecules to 15-cis-phytoene, a direct influence on the carotenoid amounts of these transgenic tomato plants could be measured (Fray and Grierson, Plant Mol. Biol. 22 (4), 589-602 (1993); Fray et al., Plant J., 8, 693-701 (1995)). As expected, transgenic tobacco plants with reduced amounts of phenylalanine ammonium lyase show reduced amounts of phenylpropanoid. The enzyme phenylalanine ammonium lyase catalyzes the breakdown of phenylalanine, i.e. it removes it from phenylpropanoid biosynthesis (Bäte et al., Proc. Natl. Acad. Sei USA 91 (16): 7608-7612 (1994); Howles et al., Plant Physiol. 112, 1617-1624 (1996)).

Little is known about the increase in the metabolite flow to increase the tocopherol or tocotrienol content in plants through overexpression of individual biosynthetic genes. Only WO 97/27285 describes a modification of the tocopherol content by increased expression or by downregulation of the enzyme p-hydroxyphenylpyruvate dioxygenase (HPPD). WO 99/04622 describes a gene sequence coding for a γ-tocopherol methyl transferase from a photosynthetically active organism.

WO 99/23231 shows that the expression of a geranylgeranyl reductase in transgenic plants results in an increased tocopherol biosynthesis.

The object of the present invention was to develop a transgenic plant with an increased content of tocopherols and tocotrienols.

The object was surprisingly achieved by overexpressing a 2-methyl-6-phytylhydroquinone-methyltransferase gene in plants.

For this purpose, the activity of 2-methyl-6-phytylhydroquinone methyltransferase (MPMT) in transgenic plants was overexpressed by the MPMT gene from Synechocystis spec. PCC 6803 increases. In principle, this can be achieved by expressing homologous or heterologous MPMT genes.

In Example 2, the cloning of an MPMT DNA sequence (SEQ ID No. 1) from Synechocystis spec. PCC 6803. In order to ensure plastid localization, the MPMT nucleotide sequence from Synechocystis is preceded by a transit signal sequence (Fig. 3, Fig. 4). Also suitable as an expression cassette is a DNA sequence which codes for an MPMT gene which hybridizes with SEQ ID No. 1 or which is homologous to the entire sequence or to partial sequences and which originates from other organisms or from plants.

The 2, 3-dimethyl-6-phytylhydroquinone that is now increasingly available due to the additional expression of the MPMT gene is further converted towards tocopherols and tocotrienol (Figure 1) •

The transgenic plants are produced by transforming the plants with a construct containing the MPMT gene. Arabidopsis thaliana, Brassica napus and Nicotiana tabacum were used as model plants for the production of tocopherols and tocotrienols.

Measurements on MPMT-Synechocystis knock out mutants showed a drastic decrease in the content of tocopherols and tocotrienols. This demonstrates the direct influence of plastid plant MPMT on the synthesis of tocopherols and tocotrienols.

The invention relates to the use of a DNA sequence SEQ ID No. 1 from Synechocystis spec. PCC 6803, which codes for an MPMT or its functional equivalents, for the production of a plant with an increased content of tocopherols and tocotrienols. The nucleic acid sequence can e.g. be a DNA or cDNA sequence. Coding sequences suitable for insertion into an expression cassette are, for example, those which code for an MPMT and which give the host the ability to overproduce tocopherols and tocotrienols.

The expression cassettes also contain regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette upstream, ie at the 5 'end of the coding sequence, comprises a promoter and downstream, ie at the 3' end, a polyadenylation signal and, if appropriate, further regulatory elements which are associated with the intermediate sequence for the MPMT gene are operatively linked. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence. The sequences preferred but not limited to the operative linkage are targeting sequences to ensure the subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the nucleus, in oil bodies or other compartments and translation enhancers such as the 5 'guiding sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

For example, the plant expression cassette can be installed in a derivative of the transformation vector pBin-19 with 35s promoter (Bevan, M., Nucleic Acids Research 12: 8711-8721 (1984)). Figure 4 shows a derivative of the transformation vector pBin -19 with seed-specific Legumin B4 promoter.

In principle, any promoter which can control the expression of foreign genes in plants is suitable as promoters of the expression cassette. A plant promoter or a promoter which originates from a plant virus is preferably used. The CaMV 35S promoter from the cauliflower mosaic virus is particularly preferred (Franck et al., Cell 21 (1980), 285-294). As is known, this promoter contains different recognition sequences for transcriptional effectors, which in their entirety lead to permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).

The expression cassette can also contain a chemically inducible promoter, by means of which the expression of the exogenous MPMT gene in the plant can be controlled at a specific point in time. Such promoters as e.g. the PRPl promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a promoter inducible by salicylic acid (WO 95/19443), one inducible by benzenesulfonamide (EP-A 388186 ), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2, 397-404), one that can be induced by abscisic acid (EP-A 335528) or one that can be induced by ethanol or cyclohexanone (WO 93 / 21334) Promoter can include be used.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of tocopherol or its precursor fen takes place. Promoters that ensure leaf-specific expression should be mentioned in particular. These are the

Promoter of potato cytosolic FBPase or ST-LSI

Potato promoter (Stockhaus et al., EMBO J. 8 (1989), 2445-245).

With the help of a seed-specific promoter, a foreign protein could be stably expressed up to a proportion of 0.67% of the total soluble seed protein in the seeds of transgenic tobacco plants (Fiedler and Conrad, Bio / Technology 10 (1995), 1090-1094). The expression cassette can therefore, for example, be a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995)), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.

An expression cassette is produced by fusing a suitable promoter with a suitable MPMT-DNA sequence and preferably a DNA inserted between the promoter and MPMT-DNA sequence, which codes for a chloroplast-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Inquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

Sequences which ensure targeting in the plastids are particularly preferred.

Expression cassettes can also be used, the DNA sequence of which codes for an MPMT fusion protein, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chloroplasts, which are cleaved enzymatically from the MPMT part after translocation of the MPMT gene into the chloroplasts. The transit peptide which is derived from the plastic Nicotiana tabacum Transketolase or another transit peptide (for example the transit peptide of the small subunit of Rubisco or the ferredoxin NADP oxidoreductase) or its functional equivalent is particularly preferred. DNA sequences from three cassettes of the

Plastid transit peptide of tobacco plastid transketolase in three reading frames as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI

pTPlO

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI

pTPll

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI

The inserted nucleotide sequence coding for an MPMT can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural DNA components, as well as consist of different heterologous MPMT gene sections of different organisms. In general, synthetic nucleotide sequences are generated with codons that are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species. When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments. The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette contains in the 5 '-3' transcription direction the promoter, a DNA sequence which codes for an MPMT gene and a region for the transcriptional termination. Different termination areas are interchangeable.

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as Transitions and trans versions can be used in viüro mutagenesis, "primer pair", restriction or ligation. With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be provided for the ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

The fused expression cassette which codes for an MPMT gene is preferably cloned into a vector, for example pBin19, which is suitable for transforming Agrobacterium tumefaciens. Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, such as, for example, tobacco plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media. The transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38. Transgenic plants can be regenerated in a known manner from the transformed cells of the wounded leaves or leaf pieces . which contain a gene integrated into the expression cassette for the expression of an MPMT gene.

To transform a host plant with a DNA coding for an MPMT, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulation signals, for example sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and cloning techniques cited above, the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli. Suitable cloning vectors include pBR332, pUC series, M13mp series and pACYC184. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

Another object of the invention relates to the use of an expression cassette containing a DNA sequence SEQ ID No. 1 or a DNA sequence hybridizing therewith for transforming plants, cells, tissues or parts of plants. The aim of the use is preferably to increase the tocopherols and tocotrienols content of the plant.

Depending on the choice of the promoter, the expression can take place specifically in the leaves, in the seeds, petals or other parts of the plant. Such transgenic plants, their reproductive material and their plant cells, tissue or parts are a further subject of the present invention.

The expression cassette can also be used to transform bacteria, cyanobacteria, yeast, filamentous fungi and algae with the aim of increasing the tocopherol and tocotrienol content.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and Agrobacterium mediated gene transfer. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Acade ic 5 Press (1993), 128- 143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 10 12 (1984), 8711).

Agrobacteria transformed with an expression cassette can also be used in a known manner to transform plants, in particular crop plants, such as cereals, corn, oats, soybeans,

15 rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa, lettuce and the various tree, nut and wine species can be used, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media. 0

Function-equivalent sequences which code for an MPMT gene are those sequences which, despite a different nucleotide sequence, still have the desired functions. Functional equivalents thus include naturally occurring variants of the sequences described here 5 as well as artificial, e.g. Artificial nucleotide sequences obtained by chemical synthesis and adapted to the codon use of a plant.

A functional equivalent is understood to mean, in particular, natural or artificial mutations of an originally isolated sequence coding for an MPMT, which furthermore show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, for example, 5 such nucleotide sequences are also encompassed by the present invention, which are obtained by modification of the MPMT nucleotide sequence. The aim of such a modification can e.g. further narrowing down the coding sequence contained therein or e.g. also be the insertion of further restriction enzyme interfaces. 0

Example 8 describes a deletion clone of the MPMT gene, see SEQ ID No. 7)

Functional equivalents are also those variants whose function is weakened or enhanced compared to the original gene or gene fragment. In addition, artificial DNA sequences are suitable as long as, as described above, they impart the desired property, for example to increase the tocopherol content in the plant by overexpressing an MPMT gene in crop plants. Such artificial DNA sequences can be determined, for example, by back-translation of proteins constructed using molecular modeling, which have MPM activity, or by in vitro selection. Coding DNA sequences which are obtained by back-translating a polypeptide sequence according to the codon usage specific for the host plant are particularly suitable. The specific codon usage can easily be determined by a person skilled in plant genetic methods by computer evaluations of other, known genes of the plant to be transformed.

Other suitable equivalent nucleic acid sequences are sequences which code for fusion proteins, part of the fusion protein being an MPMT polypeptide or a functionally equivalent part thereof. The second part of the fusion protein can e.g. be another polypeptide with enzymatic activity or an antigenic polypeptide sequence that can be used to detect MPMT expression (e.g. myc-tag or his-tag). However, this is preferably a regulatory protein sequence, such as e.g. a transit peptide that directs the MPMT protein into the plastids.

Increasing the content of tocopherols and tocotrienols in the context of the present invention means the artificially acquired ability of an increased biosynthetic performance of these compounds by functional overexpression of an MPMT gene SEQ-ID No. 1 or SEQ-ID No. 7 in the plant compared to the non-genetically modified Plant for at least one generation of plants.

Both the tocopherols and tocotrienols content can be increased. The tocopherol content is preferably increased. But it is also possible under certain conditions to preferably increase the tocotrienol content.

The biosynthetic site of tocopherols, for example, is the leaf tissue, so that leaf-specific expression of the MPMT gene is useful. However, it is obvious that the tocopherol biosynthesis need not be restricted to the leaf tissue, but can also be tissue-specific in all other parts of the plant - especially in fatty seeds. In addition, constitutive expression of the exogenous MPMT gene is advantageous. On the other hand, inducible expression may also appear desirable.

The effectiveness of the expression of the transgenically expressed MPMT gene can be determined, for example, in vitro by multiplication of the shoot meristem. In addition, a change in the type and level of expression of the MPMT gene and its effect on the tocopherol biosynthesis performance on test plants can be tested in greenhouse experiments.

The invention also relates to transgenic plants, transformed with an expression cassette containing the sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence hybridizing with it or homologous to the overall sequence or to partial sequences, and transgenic cells , Tissue, parts and propagation material of such plants. Transgenic crop plants, such as e.g. Barley, wheat, rye, corn, oats, soy, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa, tagetes, lettuce and the various tree, nut and wine species.

Plants in the sense of the invention are mono- and dicotyledonous plants.

The invention furthermore relates to photosynthetically active organisms transformed with an expression cassette containing the sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence which hybridizes with it or is homologous to the overall sequence or to partial sequences. Photosynthetically active organisms are next to plants, for example cyanobacteria, mosses and algae.

Since this biosynthetic pathway is a strictly localized metabolic pathway, it offers optimal target enzymes for the development of inhibitors. Since, according to the current state of the art, there is no enzyme identical or similar to the Synechocystis MPMT in human and animal organisms, it can be assumed that inhibitors should have a very specific effect on plants.

As already mentioned, the MPMT is a potential target for herbicides. In order to be able to find efficient MPMT inhibitors, it is necessary to provide suitable test systems with which inhibitor-enzyme binding studies can be carried out. For this purpose, for example, the complete cDNA sequence of the MPMT from Synechocystis is cloned into an expression vector (pQE, Qiagen) and overexpressed in E. coli. The MPMT protein expressed with the aid of the expression cassette according to the invention is particularly suitable for the detection of inhibitors specific for the MPMT.

For this purpose, the MPMT can be used, for example, in an enzyme test in which the activity of the MPMT is determined in the presence and absence of the active substance to be tested. By comparing the two activity determinations, a qualitative and quantitative statement can be made about the inhibitory behavior of the active substance to be tested.

With the help of the test system according to the invention, a large number of chemical compounds can be checked quickly and easily for herbicidal properties. The method makes it possible to selectively reproducibly select those with great potency from a large number of substances, in order to subsequently carry out further in-depth tests known to the person skilled in the art.

The invention further relates to herbicides which can be identified using the test system described above.

By overexpressing the gene sequence coding for an MPMT SEQ ID No. 1 or SEQ ID No. 7 in a plant, an increased resistance to inhibitors of MPMT is achieved. The transgenic plants produced in this way are also the subject of the invention.

The MPMT protein produced using the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 is also suitable for carrying out biotransformations to provide larger amounts of 2,3-dimethyl-6-phytylhydroquinone. 2-Methyl-6-phytylhydroquinone is converted to 2,3-dimethyl-6-phytylhydroquinone in the presence of the enzyme MPMT and the cosubstrate S-adenosyl-L-methionine. The biotransformation can in principle be carried out with whole cells which express the enzyme MPMT or cell extracts from these cells or with purified or highly pure MPMT in the presence of S-adenosyl-L-methionine.

Further objects of the invention are:

Process for transforming a plant, characterized in that expression cassettes containing a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence hybridizing with it or homologous to the overall sequence or to partial sequences into a plant cell or protoplasts WO 01/04330 "__ PCT / EP00 / 05862

15 of plants and regenerates them into whole plants.

Use of the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 5 or a DNA sequence hybridizing therewith for the production of plants with an increased content of tocopherols and tocotrienols by expression of an MPMT DNA sequence in plants.

10 The invention is illustrated by the following examples, but is not limited to these:

Sequence analysis of recombinant DNA

15 The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from Licor (sales by MWG Biotech, Ebersbach) according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977) , 5463-5467).

20 Example 1

Identification of a 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803.

25 The cloning and identification of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803 was done as follows:

Using a sequence motif preserved in S-adenosyl-L-methionine methyltransferase, which was used for the binding of the

S-adenosyl-L-methionine (SAM) (C.P. Joshi and V.L. Chiang. PMB. 37: 663-374, 1998), a genomic DNA database was created by Synechocystis spec. PCC 6803 screened (Kaneko et al., DNA Res. 34: 109-136, 1996). The hypothetical proteins identified in the screening 35, which had the SAM binding motif, were compared with the primary sequences of the Synechocystis spec. PCC 6803 γ-tocopherol methyl transferase (referred to as slr0089) and the Arabidopsis thaliana γ-tocopherol methyl transferase (David Shintani and Dean DellaPenna. Sience. 40 282: 2098-2100, 1998) were compared.

It was possible to identify a hypothetical protein (designated sll0418 SEQ. ID No. 2) which had little agreement in the amino acid sequence with the γ-tocopherol methyltransferases 45 from Synechocystis spec. PCC 6803 and Arabidopsis thaliana (36% and 28% identity, respectively). O

Further studies of the primary sequence of the hypothetical protein sll0418 confirmed the presence of a putative prokaryotic signal sequence within the first 20 amino acids (PSIGNAL, PC / GENE ™ IntelliGenetics, Ine © 1991). Such a sequence could also be found in Synechocystis spec. PCC 6803 γ-tocopherol methyl transferase (slr0089) can be identified (D. Shintani and D. DellaPenna. Sience. 282: 2098-2100, 1998) and indicates an identical localization of the two proteins.

The predicted molecular weight of the unprocessed protein is 34.9 kDa and is therefore in a range that is also for the Synechocystis spec. PCC 6803 γ-tocopherol methyl transferase (David Shintani and Dean DellaPenna, Sience. 282: 2098-2100, 1998) and the γ-tocopherol methyl transferase purified from paprika fruits (d'Harlingue and Camara, plastid enzymes of terpenoid bio-synthesis: Purification of γ -Tocopherol methyltransferase from Capsicum Chromoplasts, Journal of Biological Chemistry, Vol. 269 No.28, 15200-152003, 1985).

Taking the facts into account, we concluded that the hypothetical protein sll0418 could be a tocopherol methyltransferase.

Example 2

Amplification and cloning of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803

The DNA coding for the ORF (open reading frame) sll0418 was obtained by means of polymerase chain reaction (PCR) from Synechocystis spec. PCC 6803 according to the method according to Crispin A. Howitt (BioTechniques 21: 32-34, July 1996) using a sense-specific primer (sll04185 'Seq. No. 5) and an antisense-specific primer (sll04183' Seq. No. 6) amplified.

The PCR conditions were as follows:

The PCR was carried out in a 50 μl reaction mixture which contained:

-5μl of a Synechocystis spec. PCC 6803 cell suspension -0.2 mM dATP, dTTP, dGTP, dCTP -1.5 mM Mg (0Ac) ₂ -5μg bovine serum albumin -40pmol S1104185 '-40pmol S1104183' -15μl 3.3x rTth DNA polymerase XL buffer (PE Applied Biosystems) -5U rTth DNA Polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

Step 1: 5 minutes 94 ° C (denaturation)

Step 2: 3 seconds at 94 ° C

Step 3: 2 minutes 58 ° C (annealing)

Step 4: 2 minutes 72 ° C (elongation)

40 repetitions of steps 2-4

Step 5: 10 minutes 72 ° C (post-elongation)

Step 6: 4 ° C (holding pattern)

10

The amplicon was cloned into the PCR cloning vector pGEM-T (Promega) using standard methods. The identity of the amplicon generated was confirmed by sequencing using the M13F (-40) primer.

15

Example 3

Generation of a sll0418 knock out mutant

20 A DNA construct for generating a deletion mutant of ORF sll0418 in Synechocystis spec. PCC 6803 was created using standard cloning techniques.

The vector pGEM-T / sll0418 was constructed using the restriction

25 onenzyme ball digested. The presence of two ball interfaces within the sll0418 sequence (position Bp 109 or Bp 202) resulted in the loss of an internal fragment comprising 93 bp. The aminoglycoside-3 'phosphotransferase of the transposon Tn903 was clo-

30 kidney. For this purpose, the Tn903 was isolated as an EcoRI fragment from the vector pUC4k (Vieira, J and Messing, J Gene: 19, 259-268, 1982), the protruding ends of the restriction digest were converted into smooth ends according to standard methods and vector pGEM- cut into the ball. T / sll0418 ligated. The ligation approach became

35 transformation of E.coli Xll blue cells used. Transformants were selected using kanamycin and ampicillin. A recombinant plasmid (pGEM-T / sll0418:: tn903) was isolated and used to transform Synechocystis spec. PCC 6803 according to the Williams method (Methods Enzymol. 167: 776-778,

40 1987) used.

Synechocystis spec. PCC 6803 transformants were selected on kanamycin-containing (kan) BG-11 solid medium (Castenholz, Methods in Enzymology, pages 68-93, 1988) at 28 ° C. and 30 μmol 45 photons x (m ² xs) ^_ i. Four independent knock out mutants were able to after five rounds of selection (passages from individual colonies onto fresh BG-11kn medium).

The complete loss of the sll0418 endogen or the exchange for the recombinant S110418:: tn903 DNA was confirmed by PCR analyzes.

Example 4

Comparison of tocopherol production in Synechocystis spec. PCC 6803 wild-type cells and the knock-out mutants of ORF sll0418.

The cells of the four independent Synechocystis spec. Cultivated on the BG-llkan agar medium. PCC 6803 knock out mutants of ORF sll0418 and untransformed wild type cells were used to inoculate liquid cultures. These cultures were cultivated at 28 ° C. and 30 μmol photons x (m ² xs) ^_1 (30 μm) for about 3 days. After determining the OD ₇₃ o of the individual cultures, the OD _{30 of} all cultures was synchronized by appropriate dilutions with BG-11 (wild types) or BG-llkan (mutants). These cultures, synchronized to cell density, were used to inoculate three cultures per mutant or the wild-type controls. The biochemical analyzes could therefore be carried out using three independently grown cultures of a mutant and the corresponding wild types. The cultures were grown to an optical density of OD ₃ o = 0.3. The medium of the cell culture was removed by centrifugation twice at 14000 rpm in an Eppendorf table centrifuge. The subsequent digestion of the cells was carried out by four incubations in an Eppendorf shaker at 30 ° C., 100 orpm in 100% methanol for 15 minutes, the supernatants obtained in each case being combined. Further incubation steps resulted in no further release of tocopherols or tocotrienols.

In order to avoid oxidation, the extracts obtained were analyzed immediately after the extraction using a Waters Allience 2690 HPLC system. Tocopherols and tocotrienols were separated on a reverse phase column (ProntoSil 200-3-C30, Bischoff) with a mobile phase of 100% methanol and identified using standards (Merck). The fluorescence of the substances (excitation 295nm, emission 320 nm) was used as the detection system, which was detected with the aid of a Jasco FP 920 fluorescence detector. In the Synecchocystis spec. PCC 6803 knock out mutants of ORF sll0418 no tocopherols and tocotrienols were found. Tocopherols and tocotrienols, however, were found in Synecchocystis spec. PCC 6803 wild type cells measured.

The loss of the ability to produce tocopherols and tocotrienols within the knock out mutants of ORF sll0418 compared to the Synechocystis spec. PCC 6803 wild-type cells show that the gene sll0418 codes for a 2-methyl-6-phytylhydroquinone methyltransferase.

Example 5

Functional characterization of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803 by heterologous expression in E. coli.

The hypothetical protein sll0418 from Synechocystis spec. PCC 6803 was identified by functional expression in E. coli as 2-methyl-6-phytylhydroquinone methyl transferase.

The from Synechocystis spec. PCC 6803 amplified gene sll0418 was subcloned in the correct reading frame into the expression vector pQE-30 (Qiagen). The amplification of OFR sll0418 from Synechocystis spec. PCC 6803 primers sll04185 'and sll04183' (sequence ID no. 5 and 6) used were constructed in such a way that restriction sites were added to the 5 'end and the 3' end of the amplicon, see sequence ID no. 3. The sll0418 Fragment was isolated from the recombinant plasmid pGEM-T / sll0418 using these flanking BamHI restriction sites and ligated into a BamHI cut pQE-30 using standard methods. The ligation approach was used to transform M15 E. coli cells and kanamycin and ampicillin resistant transformants were analyzed. Kanamycin resistance is mediated by the pREP-4 plasmid contained in the M15 cells. A recombinant plasmid (pQE-30 / sll0418) which carried the sll0418 fragment in the correct orientation was isolated. The identity and orientation of the insert was confirmed by sequencing.

The recombinant plasmid pQE-30 / sll0418 was used to transform M15 E. coli cells to produce recombinant sll0418 protein. Using a colony that emerged from the transformation, an overnight culture in Luria

Broth medium inoculated with 200μg / ml ampicillin (Amp) and 50μg / ml kanamycin (Kan). Based on this culture was the closest Inoculated tomorrow with a 100ml Luria Broth culture (Amp / Kan). This culture was incubated at 28 ° C. on a shaking incubator until an OD ₆ oo: 0.35-0.4 was reached. The production of the recombinant protein was then induced by adding 0.4 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The culture was shaken for a further 3 hours at 28 ° C. and the cells were then pelleted by centrifugation at 8000 g.

The pellet was resuspended in 600 μl lysis buffer (approx. 1-1.5 ml / g pellet wet weight, 10 mM HEPES KOH pH 7.8, 5 mM dithiothreitol (DTT), 0.24 M sorbitol). Then PMSF (phenyl methyl sulfonate) was added to a final concentration of 0.15 mM and the mixture was placed on ice for 10 minutes. The cells were disrupted by a 10-second ultrasound pulse using an ultrasound rod. After adding Triton X100 (final concentration 0.1%), the cell suspension was incubated on ice for 30 minutes. The mixture was then centrifuged at 25,000 × g for 30 minutes and the supernatant was used for the assay.

The activity of the 2-methyl-6-phytylhydroquinone methyl transferase is determined by detecting the radioactively labeled reaction product 2, 3-dimethyl-6-phytylhydroquinone.

For this purpose 135μl of the enzyme (approx. 300-600μg) together with 20μl substrate (2-methyl-6-phytylhydroquinone) and 15μl (0.46 mM SAM ¹⁴ C) methyl group donor were added in the following reaction buffer: 200μl (125mM) tricine-NaOH pH 7 , 6, 100 μl (1.25 mM) sorbitol, 10 μl (50 mM) MgCl ₂ and 20 μl (250 mM) ascorbate for 4 hours at 25 ° C. in the dark.

The reaction was stopped by adding 750 μl chloroform / methanol (1: 2) + 150 μl 0.9% NaCl. The mixed batch was centrifuged briefly and the upper phase was discarded. The lower phase is transferred to a new reaction vessel and evaporated under nitrogen. The residues were taken up in 20 μl ether and applied to a thin-layer plate for chromatographic separation of the substances (solid phase: HPTLC plates: silica gel 60 F ₂₅₄ (Merk), liquid phase: toluene). The radioactively labeled reaction product is detected using a phosphoimager.

These experiments confirmed that the gene S110418 (SEQ ID No. 1) from Synechocystis spec. PCC 6803 encoded protein is a 2-methyl-6-phytylhydroquinone methyltransferase because it has the enzymatic activity to convert Has 2-methyl-6-phytylhydroquinone in 2, 3-dimethyl-6-phytylhydroquinone.

Figure 2 shows a sequence comparison at the amino acid level between the γ-tocopherol methyl transferases from Synechocystis spec. PCC Synechocystis spec. PCC 6803 (slr0089) and A. thaliana (arat t) with the 2-methyl-6-phytylhydroquinone methyltransferase (sll04189) from Synechocystis spec. PCC 6803. Agreement with the γ-tocopherol methyltransferases from Synechocystis spec. PCC 6803 and Arabisopsis thaliana are 36 and 28% identity, respectively.

Example 6

Substrate specificity of 2-methyl-6-phytylhydroquinone methyltransferase

Enzymatic tests as carried out in Example 5 show that the enzyme MPMT - encoded by the gene sll0418 (SEQ ID No. 1) from Synechocystis spec. PCC 6803 - 2-methyl-6-phytylhydroquinone converted into 2, 3-dimethyl-6-phytylhydroquinone.

In addition, the enzyme MPMT has a 2-methyl-6-geranylgeranyl-hydroquinone-methyltransferase activity, whereas a γ-tocopherolmethyltransferase activity could not be detected. It is thus proven that the enzyme 2-methyl-6-phytylhydroquinone methyltransferase is involved in the biosynthesis of the tocotrienols, since it converts 2-methyl-6-geranylgeranylhydroquinone to 2,3-dimethyl-6-geranylgeranyl hydroquinone. This clearly shows the difference in the enzyme activity of the 2-methyl-6-phytylhydroquinone-methyltransferase compared to the γ-tocopherol methyltransferase.

Example 7

Production of expression cassettes containing the MPMT gene

Transgenic plants were generated which contain the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC6803 on the one hand under the control of the constitutive 35S promoter of the CaMV (cauliflower mosaic virus) (Franck et al., Cell 21: 285-294, 1980) and on the other hand under the control of the seed-specific promoter of the legumin gene from Vicia faba (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986). The basis for the constitutive expression of the 2-methyl-6-phytylhydroquinone methyl transferase from Synechocystis spec. Plasmid generated by PCC 6803 was pBinAR-TkTp-9 (Ralf Badur, dissertation University of Göttingen, 1998). This vector is a derivative of pBinAR (Höfgen and Willmitzer, plan to be. 66: 221-230, 1990) and contains the CaMV (cauliflower mosaic virus) 35S promoter (Franck et al., 1980), the octopine synthase gene termination signal (Gielen et al., EMBO J. 3: 835-846 , 1984) and the DNA sequence coding for the transit peptide of the plastid Nicotiana tabacum Transketolase (Ralf Badur, dissertation Universität Göttingen, 1998). The cloning of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec., Taking into account the correct reading frame. PCC6803 in this vector produces a translation fusion of the 2-methyl-6-phytylhydroquinone-methyltransferase with the plastid transit peptide. This transports the transgene to the plastids.

To create this plasmid, the sll0418 gene was isolated from the plasmid pGEM-T / sll0418 using the flanking BamHI restriction sites. This fragment was ligated into a BamHI cut pBinAR-TkTp-9 using standard methods (see Figure 3). This plasmid (pBinAR-TkTp-9 / sll0418) was used to generate transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum. Fragment A (529 bp) in Figure 3 contains the 35S promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (245 bp) encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (977Bp) encodes ORF sll0418 from Syn echoeystis spec. PCC 6803, fragment D (219 bp) codes for the termination signal of the octopine synthase gene.

To generate a plasmid which the seed-specific expression of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803 enabled in plants, the seed-specific promoter of the Legumin B4 gene (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986) was used. The 2.7 Kb fragment of the legumin B4 gene promoter was isolated from the plasmid pCR-Script / lePOCS using the EcoRl 5 'flanking the promoter and the Kpnl 3' flanking interfaces. The plasmid pBinAR-TkTp-9 / sll0418 was also treated with the restriction enzymes EcoRI and Kpnl. As a result, the CaMV 35S promoter was separated from this plasmid. The promoter of the legumin gene was then cloned into this vector as an EcoRI / Kpnl fragment, producing a plasmid which placed the expression of the sll0418 gene under the control of this seed-specific promoter, see Figure 4. This plasmid (pBinARleP-TkTp-9 / sll0418) was used to produce transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum plants. Fragment A (2700 bp) in Figure 4 contains the promoter of the legumin B4 gene from Vicia faba, fragment B (245 bp) encodes the transit peptide of the Nicotina tabacum transketolase, fragment C (977 bp) encodes the ORF sll0418 from Synechocystis spec. PCC 6803, fragment D (219 bp) for the termination signal of the octopine synthase gene.

Example 8

Production of expression cassettes containing a deletion clone of the MPMT gene

A putative prokaryotic secretion signal was identified in the primary sequence of ORF sll0418 based on computer analysis. In order to ensure that this does not have a negative influence on the import of the protein into the plastids when expressed in plants, a derivative of the sequence of sll0418 was generated in which the putative secretion signal was deleted (sequence ID No. 7). This deletion was carried out using PCR technology. The primers used (sll0418DSp5 ', sequence ID No. 9 and sll0418DSp3', sequence ID No. 10) added an EcoRV restriction interface to the 5 'end of the sequence and a SalI restriction interface to the 3' end, through which directional cloning into the vector pBinAR-TkTp-9 was made possible. The resulting plasmid pBinAR-TkTp-9 / sll0418ΔSP is described in Figure 5. Fragment A (529 bp) in Figure 5 contains the 35S promoter of the CaMV (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (245 bp) fragment encodes the transit peptide of the Nicotiana tabacum transketolase, fragment C (930Bp) ORF sll0418ΔSP from Synechocystis spec , PCC 6803 fragment D (219 bp) for the termination signal of the octopine synthase gene.

To generate a plasmid which expresses the seed-specific expression of the deletion clone of 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC6803 enabled in plants, the previously described seed-specific promoter of the legumin B4 gene (Kafatos et al., Nuc. Acid. Res., 14 (6): 2707-2720, 1986) was also used. The 2.7 Kb fragment of the legumin B4 gene promoter was isolated from the plasmid PCR-Script / lePOCS using the EcoRl 5 'flanking the promoter and the 3' flanking Kpnl cleavage sites. The plasmid pBinAR-TkTp-9 / sll0418ΔSP was also treated with the restriction enzymes EcoRI and Kpnl. As a result, the CaMV 35S promoter was separated from this plasmid. The promoter of the legumin gene was then cloned into this vector as an EcoRI / Kpnl fragment, resulting in a WO 01/04330 ". PCT / Epoo / 05862

24

Plasmid was generated which placed the expression of the deletion clone of the gene sll0418 under the control of this seed-specific promoter, see Figure 6. Fragment A (2700 bp) in Figure 6 contains the promoter of the legumin B4 gene from Vicia 5 faba, fragment B (245bp) Fragment encodes the transit peptide of Nicotiana tabacum transketolase, fragment C (930Bp) ORF S110418ΔSP from Synechocystis spec. PCC 6803 fragment D (219 bp) for the termination signal of the octopine synthase gene.

10 This plasmid (pBinARleP-TkTp-9 / sll0418ΔSP) was used to generate transgenic Arabidopsis thaliana, Brassica napus and Nicotiana tabacum plants.

An increase in the tocopherol and tocotrienol content was also measured by expression of the DNA sequence SEQ-ID No. 7 in transgenic 15 plants.

Example 9

20 Production of transgenic Arabidopsis thaliana plants

Wild-type Arabidopsis thaliana plants (Columbia) were transformed with the Agrobacterium tumefaciens strain (EHA105) based on a modified vacuum infiltration method (Steve

25 Clough and Andrew Bent, Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 16 (6): 735-43, 1998; Bechtold, N., Ellis, J. and Pelltier, G., in: Planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sei Paris, 1993.

30 1144 (2): 204-212). The Agrobacterium tumefaciens cells used had previously been transformed with the plasmids pBinARleP-TkTp-9 / sll0418 and pBinAR-TkTp-9 / sll0418 (Figures 3 and 4).

35 seeds of the primary transformants were selected on the basis of antibiotic resistance. Antibiotic-resistant seedlings were planted in soil and used as fully developed plants for biochemical analysis.

40 Example 10

Production of transgenic Brassica napus plants

The production of transgenic oilseed rape plants was based on a protocol by Bade, JB and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Ma- nual, Springer Verlag, 1995, 30-38), in which the composition of the media and buffers used is also given.

The transformations were carried out with the Agrobacterium tumefaciens 5 strain EHA105. The plasmids pBinARleP-TkTp-9 / sll0418 and pBinAR-TkTp-9 / sll0418 were used for the transformation. Brassica napus var. Westar seeds were surface sterilized with 70% ethanol (v / v), washed in water for 10 minutes at 55 ° C., in 1% hypochlorite solution (25% v / v tea pol, 0.1% v / v Tween 20) for

Incubated for 10 to 20 minutes and washed six times with sterile water for 20 minutes each. The seeds were dried on filter paper for three days and 10-15 seeds were germinated in a glass flask with 15 ml of germination medium. The roots and apices were removed from several seedlings (approx. 10 cm in size) and the remaining

15 end hypocotyledons cut into pieces about 6 mm long. The approximately 600 explants obtained in this way were washed for 30 minutes with 50 ml of basal medium and transferred to a 300 ml flask. After adding 100 ml of callus induction medium, the cultures were incubated for 24 hours at 100 rpm. 0

An overnight culture of the Agrobacterium strain was set up at 29 ° C. in Luria Broth medium with kanamycin (20 mg / l), of which 2 ml in 50 ml Luria Broth medium without kanamycin for 4 hours at 29 ° C. up to an OD ₆₀₀ ^v ° ⁿ 0.4-0.5 incubated. After pelleting the 5 culture at 2000 rpm for 25 min, the cell pellet was resuspended in 25 ml of basal medium. The concentration of the bacteria in the solution was adjusted to an ODeoo of 0.3 by adding further basal medium.

The callus induction medium was removed from the oilseed rape explants using sterile pipettes, 50 ml of Agrobacterium solution were added, mixed gently and incubated for 20 min. The Agrobacteria suspension was removed, the oilseed rape explant was washed for 1 min with 50 ml callus induction medium and then 100 ml callus 5 induction medium was added. The co-cultivation was carried out on a rotary shaker at 100 rpm for 24 h. The co-cultivation was stopped by removing the callus induction medium and the explants were washed twice for 1 min with 25 ml and twice for 60 min with 100 ml washing medium at 100 rpm. The washing medium with the explants was transferred to 15 cm petri dishes and the medium was removed with sterile pipettes.

For regeneration, 20-30 explants were each transferred to 90 mm Petri dishes which contained 25 ml shoot induction medium with kanamycin. The petri dishes were closed with 2 layers of leucopor and at 25 ° C and 2000 lux with photoperiods of 16 Hours of light / 8 hours of darkness. The developing calli were transferred to fresh petri dishes with shoot induction medium every 12 days. All further steps for the regeneration of whole plants were carried out as by Bade, JB and Damm, B. (in: Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38 ).

Example 11

Production of transgenic Nicotiana tabacum plants

Ten ml of YEB medium with antibiotic (5 g / 1 bovine extract, 1 g / 1 yeast extract, 5 g / 1 peptone, 5 g / 1 sucrose and 2 mM MgSo ₄ ) were mixed with a colony of Agrobacterium tumefaciens inoculated and cultivated overnight at 28 ° C. The cells were pelleted in a table top centrifuge for 20 min at 4 ° C., 3500 rpm and then resuspended in fresh YEB medium without antibiotics under sterile conditions. The cell suspension was used for the transformation.

The wild-type plants from sterile culture were obtained by vegetative replication. For this purpose, only the tip of the plant was cut off and transferred to fresh 2MS medium in a sterile mason jar. The hair on the top of the leaf and the central ribs of the leaves were removed from the rest of the plant. The leaves were cut into approximately 1 cm ² pieces with a razor blade. The agrobacterial culture was transferred to a small petri dish (2 cm in diameter). The leaf pieces were briefly pulled through the solution and placed with the underside of the leaf on 2MS medium in Petri dishes (diameter 9 cm) so that they touched the medium. After two days in the dark at 25 ° C, the explants were transferred to plates with callus induction medium and heated to 28 ° C in the climatic chamber. The medium had to be changed every 7-10 days. As soon as calli formed, the explants were transferred to sterile mason jars on shoot induction medium with claforan (see above). Organogenesis occurred after about a month and the sprouts formed could be cut off. The shoots were cultivated on 2MS medium with Claforan and a selection marker. As soon as a strong root ball had formed, the plants could be potted in prickly soil.

Example 12

Characterization of the transgenic plants WO 01/04330 _Λ “PCT / EPO0 / O5862

27

To confirm that the expression of the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803 the vitamin E biosynthesis is increased in the transgenic plants, the tocopherol and tocotrienol contents in leaves and seeds of the plants with the constructs pBinARleP-TkTp-9 / sll0418 and pBinAR-TkTp-9 / sll0418 (Arabidopsis thaliana, Brassica napus and Nicotiana tabacum) were analyzed. For this purpose, the transgenic plants were cultivated in the greenhouse and plants which code the gene for the 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis spec. PCC 6803 express analyzed at Northern level. The tocopherol content and the tocotrienol content were determined in the leaves and seeds of these plants. In all cases, the tocopherol or tocotrienol concentration in transgenic plants which additionally express a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 was increased compared to non-transformed plants.

Claims

claims

1. DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 and with this hybridizing or homologous to the overall sequence or partial sequences coding DNA sequence for a 2-methyl-6-phytylhydroquinone methyltransferase from Synechocystis ,

2. Use of DNA sequences coding for a 2-methyl-6-phytylhydroquinone methyl transferase for the production of plants and photosynthetically active organisms with an increased content of tocopherols and tocotrienols.

3. Use of a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence hybridizing therewith coding for a 2-methyl-6-phytylhydroquinone methyltransferase for the production of plants and photosynthetically active organisms with an increased Content of tocopherols and tocotrienols.

4. A process for the production of plants and photosynthetically active organisms with an increased content of tocopherols and tocotrienols, characterized in that a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or one which hybridizes with this or to the entire sequence or to partial sequences homologous DNA sequence is expressed in plants and photosynthetically active organisms.

5. A method for transforming a plant, characterized in that an expression cassette containing a promoter, a signal sequence, a DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 and a terminator or a DNA sequence hybridizing with this introduces a plant cell into callus tissue, an entire plant or protoplasts from plant cells.

Process for the transformation of plants according to claim 5, characterized in that the transformation is carried out using the strain Agrobacterium tumefaciens, the electroporation or the particle bombardment method.

Plant with an increased content of tocopherols and tocotrienols containing an expression cassette according to claim 5.

Sign.

8. Plant according to claim 7, selected from the group of soybeans, canola, barley, oats, wheat, rapeseed, maize, rye, tagetes or sunflower.

9. Use of the DNA sequence SEQ-ID No. 1 or SEQ-ID No. 7 or a hybridizing with this DNA sequence according to claim 1 for the production of a test system for the identification of inhibitors of 2-methyl-6-phytylhydroquinone-methyl transferase.

10. Test system based on the expression of the DNA sequence

SEQ-ID No. 1 or SEQ-ID No. 7 or a DNA sequence hybridizing with it according to claim 1 for the identification of inhibitors of 2-methyl-6-phytylhydroquinone methyltransferase.