EP1194544A1 - Facteurs de transcription oca-b chimeriques - Google Patents
Facteurs de transcription oca-b chimeriquesInfo
- Publication number
- EP1194544A1 EP1194544A1 EP00941478A EP00941478A EP1194544A1 EP 1194544 A1 EP1194544 A1 EP 1194544A1 EP 00941478 A EP00941478 A EP 00941478A EP 00941478 A EP00941478 A EP 00941478A EP 1194544 A1 EP1194544 A1 EP 1194544A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- domain
- nucleic acid
- target gene
- transcription
- ligand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
- C07K2319/715—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16 containing a domain for ligand dependent transcriptional activation, e.g. containing a steroid receptor domain
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
- C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
Definitions
- this invention takes a novel approach to the challenge of optimizing heterologous gene expression through new uses of, and new designs for, transcription factor proteins which are expressed within the engineered cells containing the target gene.
- the invention provides improved methods and materials for achieving high-level expression of a target gene in genetically engineered cells, including genetically engineered cells within whole organisms.
- This invention involves improvements in transcription activation domains and their use in fusion proteins referred to as "chimeric transcription factors".
- the invention further involves DNA sequences encoding those chimeric transcription factors, transcription control sequences responsive to the chimeric transcription factors, target gene constructs containing a target gene operably linked to such a transcription control sequence, genetically engineered cells which contain a target gene construct and a construct for expressing a chimeric transcription factor of the invention, organisms containing such cells, methods for producing such cells and organisms, and methods for using the foregoing in gene therapy, production of biological materials and biological research.
- nucleic acids typically DNA, although embodiments involving RNA are within the scope of the invention
- a chimeric transcription factor which (a) contains at least two mutually heterologous domains comprising all or a part of a transcription activation domain from the B cell-specific transcriptional coactivator OCA-B (also known as OBF-1) and a ligand binding domain, and (b) is capable of activating the transcription of an appropriate target gene construct, discussed below, in a ligand-dependent manner.
- OCA-B domain comprises part or all of the peptide sequence spanning positions 201-257 of human OCA-B, or a peptide sequence derived therefrom, capable of activating transcription of a target gene.
- the OCA-B domain may include OCA-B peptide sequence extending beyond position 201 (i.e., to lower numbers).
- An "OCA-B domain" as that term is used herein denotes a peptide sequence from usually at least 30 amino acids up to about one hundred amino acids in length, as discussed in further detail and illustrated below.
- the chimeric transcription factors may further contain one or more additional, optional domains, including for instance, one or more transcription potentiating domains and/or a nuclear localization sequence.
- Preferred chimeric transcription factors stimulate transcription of a target gene in a ligand-dependant manner as disclosed in greater detail below.
- the difference in level of transcription observed in the presence and absence of ligand, respectively is at least two, more preferably three, and even more preferably four or more orders of magnitude.
- the chimeric transcription factor contains one or more copies of one or more OCA-B domains, optionally together with one or more copies of one or more different transcription activation domains, regulatory domains, subdomains or potentiating motifs derived for example from Heat shock factor or other transcription activation domains (collectively, "transcription potentiating domains").
- Transcription activation domains comprising a non-naturally occurring peptide sequence containing either two or more heterologous activation domains, one activation domain and two or more copies of a reiterated peptide sequence or two or more copies of a reiterated peptide sequence constitute "composite transcription activation domains".
- One illustrative class of composite transcription activation domains comprise domains containing (a) two or more OCA-B domains (which may be the same or different) or (b) one or more OCA-B domains together with one or more copies of one or more transcription activation potentiating domains.
- Transcription potentiating domains are peptide sequences which can be shown to potentiate the transcription activation potency of a transcription factor (relative to the corresponding chimeric transcription factor lacking that potentiating domain).
- Illustrative potentiating domains comprise motifs which may be selected or derived from the so-called “proline-rich”, “glutamine-rich” and “acidic” activation motifs such as the VP16 V8 motif (DFDLDMLG), the related N9" motif (DFDLDMLGG), a human activation motif such as the 14 amino acid acidic motif of human heat shock factor (HSF) or an alanine/proline-rich motif selected from p53 or CTF (preferably human) including such motifs which are homologous to alanine/proline rich motifs within residues 361 - 450 of p65.
- motifs which may be selected or derived from the so-called “proline-rich”, “glutamine-rich” and “acidic” activation motifs such
- Ligand binding domains may be used in this invention, although ligand binding domains which bind to a cell permeant ligand are generally preferred. It is also preferred that the ligand have a molecular weight under about 5kD, more preferably below 2.5 kD and optimally below about 1500 D. Non-proteinaceous ligands are also preferred.
- Ligand binding domains include, for example, domains selected or derived from (a) an immunophilin (e.g.
- FKBP 12 cyclophiiin or FRAP domain
- a hormone receptor such as a receptor for progesterone, ecdysone or another steroid
- an antibiotic receptor such as a tetR domain for binding to tetracycline, doxycycline or other analogs or mimics thereof.
- a tetR domain useful in the practice of this invention may comprise a naturally occurring peptide sequence of a tetR of any of the various classes (e.g.
- mutated tetR which comprises at least one amino acid substitution, addition or deletion compared to a wild-type tetR, especially those mutated tetR domains in which the presence of the ligand stimulates target gene transcription in a cell engineered in accordance with this invention.
- mutated tetR domains include mutated Tn10-derived tetR domains having an amino acid substitution at one or more of amino acid positions 71 , 95, 101 and 102.
- one mutated tetR comprises amino acids 1 - 207 of the Tn10 tetR in which glutamic acid 71 is changed to lysine, aspartic acid 95 is changed to asparagine, leucine 101 is changed to serine and glycine 102 is changed to aspartic acid.
- Ligands include tetracycline and a wide variety of analogs and mimics of tetracycline, including for example, anhydrotetracycline and doxycycline.
- Target gene constructs in these embodiments contain a target gene operably linked to a transcription control sequence including one or more copies of a DNA sequence recognized by the tetR of interest, including for example, an upstream activator sequence for the appropriate tet operator. See e.g. US Patent No. 5,654,168, the full contents of which are expressly incorporated by reference.
- DNA binding domains may be used in the practice of this invention, including a domain selected or derived from a GAL4, lexA or composite (e.g. ZFHD1 ) DNA binding domain, or a DNA binding domain, e.g., in combination with ligand binding domains such as a wt or mutated progesterone receptor domain.
- TetR domains are discussed in the context of ligand binding domains. In many applications it is preferable to use a DNA binding domain which is heterologous to the cells to be engineered.
- Heterologous DNA binding domains include those which occur naturally in cell types other than the cells to be engineered as well as composite DNA binding domains containing component portions which are not found in the same continuous polypeptide or gene in nature, at least not in the same order or orientation or with the same spacing present in the composite domain.
- component peptide portions which are endogenous to the cells or organism to be engineered are generally preferred.
- the DNA binding domain is typically provided by the tetR component, and is by its nature heterologous to eukaryotic cells. TetR domains are discussed in further detail in the context of ligand binding domains.
- a composite DNA binding domain which is selected for recognition of one or more sequences upstream of the target gene may be deployed.
- each of the various domains incorporated into the design of the chimeric transcription factor contain a peptide sequence which is or is derived from a peptide sequence which naturally occurs in the cells or organism in which the chimeric transcription factor is to be expressed.
- human sequences or sequences derived therefrom are preferred for chimeric transcription factors for use in humans. In some cases, such as the ecdysone or tetR cases, the inclusion of non-human sequence may be unavoidable.
- the encoded chimeric transcription factor may further contain one or more additional domains such as a transcription potentiating domain.
- chimeric transcription factors include fusion proteins containing at least:
- an OCA-B domain and a ligand binding domain containing a peptide sequence selected from within, or derived from, an FKBP, FRB or cyclophilin domain (these will typically be paired with a second fusion protein comprising a DNA binding domain and at least one ligand binding domain which, in the presence of a divalent ligand, forms a ligand-dependent (cross-linked) complex with the OCA-B fusion protein and activates transcription of a target gene operably linked to a transcription control sequence containing one or more recognition sequences for the DNA binding domain);
- an OCA-B domain (b) an OCA-B domain, a DNA binding domain (e.g. GAL4 or ZFHD1 ) and a ligand binding domain containing peptide sequence selected from within, or derived from, a hormone receptor such as a progesterone receptor domain (see e.g. WO 93/23431 and WO 98/18925) or ecdysone receptor (see e.g., WO 97/38117 and WO 96/37609); and,
- a hormone receptor such as a progesterone receptor domain (see e.g. WO 93/23431 and WO 98/18925) or ecdysone receptor (see e.g., WO 97/38117 and WO 96/37609); and,
- the chimeric transcription factors may further include one or more optional domains, including for example, one or more transcription potentiating domains, and the OCA-B domain may in fact be replaced with a OCA-B-containing composite transcription activation domain as described above.
- the recombinant nucleic acid encoding the chimeric transcription factor may be operably linked to a transcription control sequence permitting expression of the chimeric transcription factor in cells.
- Such recombinant nucleic acid constructs may be contained within any of a variety of DNA vectors for use in transfecting prokaryotic or eukaryotic cells.
- a target gene construct may be included in the same vector or may be provided in an additional vector.
- the recombinant nucleic acid encoding the chimeric transcription factor and optionally a target gene construct may be present within one or more recombinant viruses for delivery (by infection) to cells in vitro or in vivo (i.e., by administration of recombinant virus to the whole organism).
- Conventional techniques may be used to prepare recombinant viruses harboring the recombinant nucleic acids of this invention.
- Adenoviruses, adeno-associated viruses, hybrid adeno-AAV, retroviruses and lentiviruses are of particular interest at present.
- compositions containing a recombinant nucleic acid encoding a chimeric transcription factor together with a target gene construct may be included in a kit or package for delivery to researchers, hospitals, physicians or veterinarians.
- a "universal" target gene construct may be included in which the target gene is replaced with a cloning site for insertion by the practitioner of any desired coding sequence.
- Such compositions or kits which are designed for regulated expression may further include a sample of ligand for activating target gene transcription.
- the various nucleic acids may be present in vectors, recombinant viruses, etc. as described elsewhere.
- a recombinant nucleic acid encoding a chimeric transcription factor of this invention may be used to transduce a cell to render it capable of expressing a target gene in a ligand-dependent manner.
- the chimeric transcription factor is chosen which is capable of stimulating, in a ligand-dependent manner, the transcription of a target gene operably linked to a transcription control sequence recognized by the chimeric transcription factor.
- a target gene construct comprising a desired target gene operably linked to a transcription control sequence which is recognized by the chimeric transcription factor nay be transduced into the cell as well, and may be included in the same or a different vector or recombinant virus for this purpose (as the recombinant nucleic acid encoding the chimeric transcription factor).
- cells are so transduced in vitro.
- cells are transduced while present within an organism, generally a human or non-human mammal.
- Cells containing a recombinant nucleic acid encoding a chimeric transcription factor of this invention are useful in a variety of applications as mentioned above, especially cells which further comprise a target gene operably linked to a transcription control sequence which is responsive to the chimeric transcription factor in the presence of a ligand.
- a target gene operably linked to a transcription control sequence which is responsive to the chimeric transcription factor in the presence of a ligand.
- a ligand which binds to the chimeric transcription factor. This may be conveniently effected by simply adding the ligand to the culture medium, in an effective amount to yield the desired level of transcription.
- Examples of such cells include the following:
- a cell containing (a) a recombinant nucleic acid encoding a chimeric transcription factor which comprises an OCA-B domain, a DNA binding domain and a ligand binding domain comprising or derived from a progesterone receptor domain, and (b) a target gene construct which comprises a target gene operably linked to a transcription control sequence which contains one or more copies of a DNA sequence recognized by the DNA binding domain of the chimeric transcription factor, the cell being capable of expressing its target gene in a ligand-dependent manner, the ligand being progesterone or an analog or mimic thereof.
- a cell containing (a) a recombinant nucleic acid encoding a chimeric transcription factor which comprises an OCA-B domain and a tetR domain which binds to a recognized DNA sequence in the presence of its ligand, and (b) a target gene construct which comprises a target gene operably linked to a transcription control sequence which contains one or more copies of a DNA sequence recognized by the tetR domain of the chimeric transcription factor, the cell being capable of expressing its target gene in a ligand-dependent manner, the ligand being tetracycline, doxycycline or an analog or mimic thereof.
- a cell containing (a) a recombinant nucleic acid encoding a chimeric transcription factor which comprises an OCA-B domain and an ecdysone receptor domain capable of binding to a DNA binding protein comprising or derived from the peptide sequence of an RXR protein, and (b) a target gene construct which comprises a target gene operably linked to a transcription control sequence which contains one or more copies of a DNA sequence recognized by the RXR, the cell being capable of expressing its target gene in a ligand-dependent manner, the ligand being ecdysone or an analog or mimic thereof.
- a cell containing (a) a recombinant nucleic acid encoding a chimeric transcription factor which comprises an OCA-B domain and a ligand binding domain containing a peptide sequence selected from within, or derived from, an FKBP, FRB or cyclophilin domain (these will typically be paired with a second fusion protein comprising a DNA binding domain and at least one ligand binding domain which, in the presence of a divalent ligand, forms a ligand-dependent (cross-linked) complex with the OCA-B fusion protein and activates transcription of a target gene operably linked to a transcription control sequence containing one or more recognition sequences for the DNA binding domain) and (b) a target gene construct which comprises a target gene operably linked to a transcription control sequence which contains one or more copies of a DNA sequence recognized by the DNA binding domain of the second fusion protein, the cell being capable of expressing its target gene in a ligand-dependent manner, the ligand being rapamycin, FK
- Cells so engineered to express a chimeric transcription factor of this invention and a corresponding target gene construct responsive to such factor in a ligand-dependent manner may be introduced into the host organism, thereby rendering the organism capable of regulated expression of a target gene.
- a non-human organism containing one or more such cells can be used in research to study the effect of regulated expression of a target gene of possible interest.
- Such animals may also be used as model systems for the study of various diseases and for the evaluation of drug candidates for treating such diseases.
- the various recombinant nucleic acids may be introduced directly into the organism to transduce cells in vivo and render a host organism capable of regulated expression of a target gene.
- use of one or more recombinant viruses containing the recombinant nucleic acids is currently preferred.
- Particularly important applications of this methodology involve the use of human subjects as the host organism.
- a ligand which binds to the chimeric transcription factor expressed in the cells, in an amount effective to yield the desired level of gene transcription.
- the ligand may be in the form of a pharmaceutically or veterinarily acceptable composition, delivered by any pharmaceutically or veterinarily acceptable route of administration.
- Activate as applied to the expression or transcription of a gene denotes a directly or indirectly observable increase in the production of a gene product, e.g., an RNA or polypeptide encoded by the gene.
- Capable of selectively hybridizing means that two DNA molecules are susceptible to hybridization with one another, despite the presence of other DNA molecules, under hybridization conditions which can be chosen or readily determined empirically by the practitioner of ordinary skill in this art.
- Such treatments include conditions of high stringency such as washing extensively with buffers containing 0.2 to 6 x SSC, and/or containing 0.1 % to 1% SDS, at temperatures ranging from room temperature to 65-75°C. See for example F.M. Ausubel et al., Eds, Short Protocols in Molecular Biology, Units 6.3 and 6.4 (John Wiley and Sons, New York, 3d Edition, 1995).
- Cells refer not only to the particular subject cells but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
- Cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
- Composite”, “fusion”, “chimeric” and “recombinant” denote a material such as a nucleic acid, nucleic acid sequence or polypeptide which contains at least two constituent portions which are mutually heterologous in the sense that they are not otherwise found directly (covalently) linked in nature, e.g. are not found in the same continuous polypeptide or gene in nature, at least not in the same order or orientation or with the same spacing present in the composite, fusion or recombinant product.
- Such materials contain components derived from at least two different proteins or genes or from at least two non-adjacent portions of the same protein or gene.
- composite refers to portions of different proteins or nucleic acids which are joined together to form a single functional unit, while “fusion” generally refers to two or more functional units which are linked together.
- fusion generally refers to two or more functional units which are linked together.
- Recombinant is generally used in the context of nucleic acids or nucleic acid sequences.
- a “coding sequence” or a sequence which "encodes” a particular polypeptide or RNA is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of an appropriate expression control sequence.
- the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
- a coding sequence can include, but is not limited to, cDNA from procaryotic or eukaryotic mRNA, genomic DNA sequences from procaryotic or eukaryotic DNA, and even synthetic DNA sequences.
- a transcription termination sequence will usually be located 3' to the coding sequence.
- a "construct" e.g., a "nucleic acid construct' or “DNA construct” refers to a nucleic acid or nucleic acid sequence.
- “Derived from” indicates a peptide or nucleotide sequence selected from within a given sequence.
- a peptide or nucleotide sequence derived from a named sequence may contain a small number of modifications relative to the parent sequence, in most cases representing deletion, replacement or insertion of less than about 15%, preferably less than about 10%, and in many cases less than about 5%, of amino acid residues or base pairs present in the parent sequence.
- one DNA molecule is also considered to be derived from another if the two are capable of selectively hybridizing to one another.
- a derived peptide sequence will differ from a parent sequence by the replacement of up to 5 amino acids, in many cases up to 3 amino acids, and very often by 0 or 1 amino acids.
- a derived nucleic acid sequence will differ from a parent sequence by the replacement of up to 15 bases, in many cases up to 9 bases, and very often by 0 - 3 bases. In some cases the amino acid(s) or base(s) is/are deleted rather than replaced.
- "Divalent" as that term is applied to ligands in this document, denotes a ligand which is capable of forming a complex with at least two protein molecules which contain ligand binding domains, to form a three (or greater number)-component complex.
- Domain refers to a portion of a protein or polypeptide.
- domain may refer to a discrete 2 ° structure.
- domain is not intended to be limited to a discrete folding domain. Rather, consideration of a polypeptide sequence as a "domain” in, e.g., a fusion protein herein, can be made simply by the observation that the polypeptide has a specific activity, function or source. Most domains described herein can be derived from proteins ranging from naturally occurring proteins to completely artificial sequences.
- DNA recognition sequence means a DNA sequence which is capable of binding to one or more DNA-binding domains, e.g., of a transcription factor or an engineered polypeptide.
- Endogenous refers to molecules which are naturally occurring in a cell, i.e. prior to the genetic engineering or infection of the cell. "Exogenous” refers to molecules which are not naturally present in the cell, and which have been, e.g., introduced by transfection or transduction of the cell (or the parent cell thereof).
- Gene refers to a nucleic acid molecule or sequence comprising an open reading frame and including at least one exon and (optionally) an intron sequence.
- intron refers to a DNA sequence present in a given gene which is not translated into protein and is generally found between exons.
- Genetically engineered cells denotes cells which have been modified by the introduction of recombinant or heterologous nucleic acids (e.g. one or more DNA constructs or their RNA counterparts) and further includes the progeny of such cells which retain part or all of such genetic modification.
- recombinant or heterologous nucleic acids e.g. one or more DNA constructs or their RNA counterparts
- Heterologous as it relates to nucleic acid sequences such as coding sequences and control sequences, denotes sequences that are not normally joined together, and/or are not normally associated with a particular cell.
- a “heterologous" region of a nucleic acid construct is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
- a heterologous region of a construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
- Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene).
- the cell and the construct would be considered mutually heterologous for purposes of this invention. Allelic variation or naturally occurring mutational events do not give rise to heterologous DNA, as used herein.
- Interact as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay or by immunoprecipitation.
- the term interact is also meant to include "binding" interactions between molecules. Interactions may be, for example, protein-protein, protein-nucleic acid, protein-small molecule or small molecule-nucleic acid in nature.
- Ligand refers to any molecule which is capable of interacting with a corresponding protein or protein domain.
- a ligand can be naturally occurring, or the ligand can be partially or wholly synthetic.
- modified ligand refers to a ligand which has been modified such that it does not significantly interact with the naturally occurring receptor of the ligand in its non modified form.
- Ligands may be formulated and administered to cells or human or non-human animals as disclosed in the various patent documents cited herein.
- a “ligand binding domain” is a domain which binds to a ligand or analogs or mimics thereof with measurable preference over binding to other materials.
- DNA is not a ligand
- a DNA binding domain is not a ligand binding domain.
- Minimum promoter refers to the minimal expression control sequence that is necessary for initiating transcription of a selected DNA sequence to which it is operably linked.
- minimal promoter may be used to refer to a DNA sequence which is derived from a regulatory region upstream of a gene, contains a TATA box flanked upstream by usually at least 20-30 base pairs and on its 3' end by -100-300 bp, and which has little or no basal promoter activity, i.e., less than about 1 % of the promoter activity observed with the full length regulatory region as determined by any measure of transcriptional activity.
- promoter and transcription control sequence further encompass "tissue specific” promoters and expression control sequences, i.e., promoters and expression control sequences which effect expression of the selected DNA sequence preferentially in specific cells (e.g., cells of a specific tissue). Gene expression occurs preferentially in a specific cell if expression in this cell type is significantly higher than expression in other cell types.
- promoter and expression control sequence also encompass so-called “leaky” promoters and “ expression control sequences”, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well. These terms also encompass non-tissue specific promoters and expression control sequences which are active in most cell types.
- a promoter or expression control sequence can be constitutive i.e. one which is active basally or inducible, i.e., a promoter or expression control sequence which is active primarily in response to a stimulus.
- a stimulus can be, e.g., a molecule, such as a hormone, a cytokine, a heavy metal, phorbol esters, cyclic AMP (cAMP), or retinoic acid.
- Nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the term should also be understood to include, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
- a "DNA binding domain” refers to a polypeptide which interacts, or binds, with a higher affinity to a nucleic acid having a particular nucleotide sequence relative to a nucleic acid having a different nucleotide sequence.
- Oligomerization and “multimerization”, used interchangeably herein, refer to the association of two or more proteins which can be constitutive or inducible. Inducible oligomerization is mediated, in the practice of this invention, by the binding of each such protein to a common ligand. "Dimerization” refers to the association of two proteins. The formation of a tripartite (or greater) complex comprising proteins containing one or more FKBP domains together with one or more molecules of an FKBP ligand which is at least divalent (e.g. FK1012 or AP1510) is an example of such association or clustering.
- tripartite (or greater) complex comprising proteins containing one or more FKBP domains together with one or more molecules of an FKBP ligand which is at least divalent (e.g. FK1012 or AP1510) is an example of such association or clustering.
- fusion proteins contain multiple FRB and/or FKBP domains.
- Complexes of such proteins may contain more than one molecule of rapamycin or a derivative thereof and more than one copy of one or more of the constituent proteins. Again, such multimeric complexes are still referred to herein as tripartite complexes to indicate the presence of the three types of constituent molecules, even if one or more are represented by multiple copies.
- the formation of complexes containing at least one divalent ligand and at least two molecules of a protein which contains at least one ligand binding domain may be referred to as'Oligomerization" or “multimerization”, or simply as”dimerization", “clustering” or association".
- “Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
- a transcription control sequence operably linked to a coding sequence permits expression of the coding sequence.
- the control sequence need not be contiguous with the coding sequence so long as it functions to direct the expression thereof.
- intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
- Protein Protein
- polypeptide and “peptide” are used interchangeably herein when referring to a gene product, e.g., as may be encoded by a coding sequence.
- a “recombinant virus” is a virus particle in which the packaged nucleic acid contains a heterologous portion.
- a "target gene” is a nucleic acid of interest, the expression of which is modulated according to the methods of the invention.
- the target gene can be endogenous or exogenous and can integrate into a cell's genome, or remain episomal.
- the target gene can encode a protein or be a non coding nucleic acid, e.g, a nucleic acid which is transcribed into an antisense RNA or a ribozyme.
- Transcription factor refers to any protein or modified form thereof that is involved in the initiation of transcription but which is not itself a part of the polymerase. Transcription factors are proteins or modified forms thereof, which interact preferentially with specific nucleic acid sequences, i.e., regulatory elements. Some transcription factors are active when they are in the form of a monomer. Alternatively, other transcription factors are active in the form of oligomers consisting of two or more identical proteins or different proteins (heterodimer). The factors have different actions during the transcription initiation: they may interact with other factors, with the RNA polymerase, with the entire complex, with activators, or with DNA. Transcription factors usually contain one or more transcription regulatory domains.
- Transcription activation motifs as that phrase is used herein means a peptide motif of usually at least 6 amino acid residues which is either a transcription potentiating motif (i.e., it need not have a naturally occurring peptide sequence) or it is associated with a transcription activation domain, including, as non-limiting examples, the well-known "acidic”, “glutamine-rich” and “proline-rich” motifs such as the K13 motif from p65, the OCT2 Q domain and the OCT2 P domain, respectively.
- Transfection means the introduction of a naked nucleic acid molecule into a recipient cell.
- Infection refers to the process wherein a virus enters the cell in a manner whereby the genetic material of the virus can be expressed in the cell.
- a "productive infection” refers to the process wherein a virus enters the cell, is replicated, and then released from the cell (sometimes referred to as a “lytic” infection).
- Transduction encompasses the introduction of nucleic acid into cells by any means.
- Transgene refers to a nucleic acid sequence which has been introduced into a cell.
- Daughter cells deriving from a cell in which a transgene has been introduced are also said to contain the transgene (unless it has been deleted).
- a transgene can encode, e.g., a polypeptide, partly or entirely heterologous to the animal or cell into which it is introduced, or comprises or is derived from an endogenous gene of the animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the recipient's genome in such a way as to alter that genome, (e.g., it is inserted at a location which differs from that of the natural gene).
- a transgene can also be present in an episome.
- a transgene can include one or more expression control sequences and any other nucleic acid, (e.g. intron), that may be necessary or desirable for optimal expression of a selected coding sequence.
- Transient transfection refers to cases where exogenous DNA does not integrate into the genome of a transfected cell, e.g., where episomal DNA is transcribed into mRNA and translated into protein.
- a cell has been "stably transfected” with a nucleic acid construct when the nucleic acid construct has been integrated into the genome of that cell.
- Wild-type means naturally occurring in a normal cell.
- the system comprises: (1 ) a recombinant nucleic acid construct encoding and capable of directing the expression of a chimeric transcription factor protein as described above; and, (2) a target gene construct containing a target gene and a transcription control sequence permitting transcription of the target gene under the direction of the chimeric transcription factor and in a ligand-dependent manner.
- the transcription control sequence comprises a DNA promoter sequence and one or more copies of a DNA recognition sequence to which the transcription factor is capable of binding ("recognizing").
- a second recombinant nucleic acid which encodes an accessory chimeric protein comprising at least one DNA binding domain and a ligand binding domain permitting ligand-dependent crosslinking with the chimeric transcription factor protein to form a two-hybrid-type chimeric transcription factor complex, capable of recognizing the target gene's transcription control sequence and stimulating transcription of the target gene in a ligand-dependent manner.
- Chimeric transcription factors of this invention contain one or more copies of one or more OCA-B domains, one or more ligand binding domains, and optionally one or more copies of one or more regulatory domains, transcription activation domains or potentiating domains.
- additional activation domains may be selected from peptide sequences of naturally occurring transcription factors such as the widely used transcription activation domain of Herpes Simplex Virus VP16, may be derived from such sequences or may comprise a composite transcription activation region.
- a composite transcription activation region consists of a continuous polypeptide region containing two or more reiterated or mutually heterologous component polypeptide portions.
- the component polypeptide portions comprise polypeptide sequences derived from at least two different proteins, polypeptide sequences from at least two non-adjacent portions of the same protein, polypeptide sequences which are not found so linked in nature (including reiterated copies of a polypeptide sequence) or non-naturally occurring peptide sequence.
- the activation domain or component peptide sequences thereof are selected or derived from peptide sequences endogenous to the cells or organism to be engineered.
- NF-kB p65 turned out to be an important source of transcription activation domains and motifs.
- p65(450-550) is a known transcription activation domain and methods and materials for using it are disclosed in Natesan and Gilman, USSN 09/ 096,732, the full contents of which are incorporated herein by reference.
- the Heat Shock transcription factor is a potent transcriptional activator that belongs to the class of activation domains known as the acidic, hydrophobic transcription factors. Chimeric proteins containing HSF activation domains are disclosed in USSN 09/262,600, the full contents of which are incorporated herein by reference.
- OCA-B (also known as OBF-1 ) was originally identified as a B-cell specific co- activator. It has no intrinsic DNA binding activity, but by association with either Oct-1 or Oct-2, OCA-B can activate transcription in an octamer-site dependent manner.
- the OCA-B mRNA is expressed in a highly cell-specific manner and stimulates immunoglobulin promoter activity in B cells (Strubin et al., Cell 80:497-506, 1995).
- Recent studies indicate that, like the HSV VP16 activation domain, the OCA-B transcription activation domain stabilizes Oct-1 on the Oct-1 responsive octamer sequence (Babb et al., Mol Cell Biol 17:2430, 1997).
- OCA-B-based chimeric transcription factors contains more than one copy of a OCA-B-derived domain.
- Such proteins will typically contain two to six copies of a peptide sequence comprising all or a portion of OCA-B(201 -257), or peptide sequence derived therefrom.
- Such transcription factors may contain one or more ligand- binding domains to provide for regulation as described elsewhere herein, and in some cases additional other domains.
- Chimeric transcription factors of this invention may contain, in addition to one or more copies of a OCA-B activation domain such as described above, one or more copies of one or more heterologous peptide sequences which potentiate the transcription activation potency of the transcription factor, as measured by any means. Inclusion of such motifs, including the so-called “glutamine-rich”, “proline-rich” and “acidic" transcription activation motifs, in combination with a primary activation domain can result in extremely high levels of transcription.
- transcription activation domains and motifs can be used in the practice of the present invention in conjunction with OCA-B-based domains.
- Polypeptides which can function to activate transcription in eukaryotic cells are well known in the art.
- transcription activation domains have been described for many transcription factors and have been shown to retain their activation function when the transcription activation domain, or a suitable fragment thereof, is present within a fusion protein.
- Activation domains can comprise naturally occurring or non-naturally occurring peptide sequences, so long as, either alone or in combination with other activation domains, they are capable of activating transcription. Any particular activation domain is preferably at least 6 amino acids in length.
- Naturally occurring activation domain subunits or motifs include portions of transcription factors.
- a domain that can be used in combination with the OCA-B activation domain is the LZ4 (leucine zipper 4) region of HSF1 , comprising amino acids 371 -430.
- Other motifs from heat shock factor proteins may also be used, such as the acidic motif DLDSSLASIQELLS, spanning amino acids 431- 444 of human HSF1 , or the motif comprising amino acids 409-444 of HSF1.
- Domains from other transcription factors may also be used, such as a thirty amino acid fragment of the C-terminus of VP16 (amino acids 461 -490), referred to herein as "Vc".
- Other activation domain subunits are derivatives of naturally occurring peptides. For example, the replacement of one amino acid of a naturally occurring activation unit by another may further increase activation.
- An example of such an activation unit is a derivative of an eight amino acid peptide of VP16, the derivative having the amino acid sequence DFDLDMLG.
- activation units are entirely synthetic. It is known, for example, that certain random alignments of acidic amino acids are capable of activating transcription.
- tissue specific activation domains By using tissue specific activation domains, it is possible to design a transcription factor having a certain tissue specificity.
- VP16 herpes simplex virus virion protein 16
- an activation domain corresponding to about 127 of the C-terminal amino acids of VP16 is used.
- a polypeptide having amino acid residues 208-335 can be used as an auxilliary activation domain.
- at least one copy of about 11 amino acids from the C-terminal region of VP16 which retain transcription activation ability is used as an additional activation domain.
- an oligomer of this region i.e., about 22 amino acids
- Suitable C-terminal peptide portions of VP16 are described in Seipel, K. et al. (EMBO J. (1992) 13:4961 -4968). VP16-derived transcription activation domains have been used successfully in many of the different regulated expression systems referred to herein.
- an acidic activation domain is provided in residues 753-881 of GAL4.
- Other illustrative activation domains and motifs of human origin include the activation domain of human CTF, the 18 amino acid (NFLQLPQQTQGALLTSQP) glutamine rich region of Oct-2, the N-terminal 72 amino acids of p53, the SYGQQS repeat in Ewing sarcoma gene and an 11 amino acid (535-545) acidic rich region of Rel A protein.
- Various additional activation domains, motifs and chimeric transcription factors are provided in the examples which follow. See also USSN 08/920,610, the contents of which are incorporated herein by reference, especially for additional information concerning sources of activation domains and motifs that may be used in combination with OCA-B domains in the chimeric transcription domains of this invention.
- the chimeric transcription factors contain at least one OCA-B domain and one ligand binding domain, but function, in the various embodiments, through different molecular mechanisms.
- the ligand binding domain permits ligand-mediated cross- linking of the chimeric transcription factor with a second fusion protein (which contains at least one ligand binding domain and DNA binding domain).
- the ligand is at least divalent and functions as a dimerizing agent by binding to the two fusion proteins and forming a cross-linked heterodimeric complex which activates target target gene expression. See e.g. WO 94/18317, WO 96/20951 , WO 96/06097, WO 97/31898, WO 96/41865, and PCT US98/17723, the contents of which are incorporated herein by reference.
- the ligand binding event is thought to result in an allosteric change in the chimeric transcription factor leading to binding of the fusion protein to a target DNA sequence [see e.g. US 5,654,168 and 5,650,298 (tet systems), and WO 93/23431 and WO 98/18925 (RU486-based systems)] or to another protein [see e.g. WO 96/37609 and WO 97/381 17 (ecdysone/RXR-based systems)], in either case, modulating target gene expression.
- the fusion proteins can contain one or more ligand binding domains (in some cases containing two, three or four such domains) and can further contain one or more additional domains, heterologous thereto, including e.g. a DNA binding domain, transcription activation domain, etc.
- ligand binding domains may be derived from an immunophilin such as an FKBP, cyclophilin, FRB domain, hormone receptor protein, antibody, etc., so long as a ligand is known or can be identified for the ligand binding domain.
- an immunophilin such as an FKBP, cyclophilin, FRB domain, hormone receptor protein, antibody, etc.
- the receptor domains will be at least about 50 amino acids, and fewer than about 350 amino acids, usually fewer than 200 amino acids, either as the natural domain or truncated active portion thereof.
- the binding domain will be small ( ⁇ 25 kDa, to allow efficient transfection in viral vectors), monomeric, nonimmunogenic, and should have synthetically accessible, cell permeant, nontoxic ligands as described above.
- the ligand binding domain is for (i.e., binds to) a ligand which is not itself a gene product (i.e., is not a protein), has a molecular weight of less than about 5 kD and preferably less than about 3 kD, and is cell permeant. In many cases it will be preferred that the ligand does not have an intrinsic pharmacologic activity or toxicity which interferes with its use as a transcription regulator.
- the DNA sequence encoding the ligand binding domain can be subjected to mutagenesis for a variety of reasons.
- the mutagenized ligand binding domain can provide for higher binding affinity, allow for discrimination by a ligand between the mutant and naturally occurring forms of the ligand binding domain, provide opportunities to design ligand-ligand binding domain pairs, or the like.
- the change in the ligand binding domain can involve directed changes in amino acids known to be involved in ligand binding or with ligand-dependent conformational changes. Alternatively, one may employ random mutagenesis using combinatorial techniques. In either event, the mutant ligand binding domain can be expressed in an appropriate prokaryotic or eukaryotic host and then screened for desired ligand binding or conformational properties.
- FKBP12's Phe36 to Ala and/or Asp37 to Gly or Ala to accommodate a substituent at positions 9 or 10 of FK506 or FK520.
- mutant FKBP12 moieties which contain Vai, Ala, Gly, Met or other small amino acids in place of one or more of Tyr26, Phe36, Asp37, Tyr82 and Phe99 are of particular interest as receptor domains for FK506-type and FK-520-type ligands containing modifications at C9 and/or C10.
- Illustrative mutations of current interest in FKBP domains also include the following:
- Table 1 Entries identify the native amino acid by single letter code and sequence position, followed by the replacement amino acid in the mutant.
- F36V designates a human FKBP12 sequence in which phenylalanine at position 36 is replaced by valine.
- F36V/F99A indicates a double mutation in which phenylalanine at positions 36 and 99 are replacedby valine and alanine, respectively.
- rapamycin-binding domains are those which include an approximately 89-amino acid rapamycin-binding domain from FRAP, e.g., containing residues 2025-2113 of human FRAP. Another preferred portion of FRAP is a 93 amino acid fragment consisting of amino acids 2021 -2113. Similar considerations apply to the generation of mutant FRAP-derived domains which bind preferentially to rapamycin analogs (rapalogs) containing modifications (i.e., are 'bumped') relative to rapamycin in the FRAP-binding effector domain.
- Exemplary mutations include Y2038H, Y2038L, Y2038V, Y2038A, F2039H, F2039L, F2039A, F2039V, D2102A, T2098A, T2098N, T2098L, and T2098S.
- Exemplary mutations include E2032A and E2032S. Proteins comprising an FRB containing one or more amino acid replacements at the foregoing positions, libraries of proteins or peptides randomized at those positions (i.e., containing various substituted amino acids at those residues), libraries randomizing the entire protein domain, or combinations of these sets of mutants are made using the procedures described above to identify mutant FRAPs that bind preferentially to bumped rapalogs. See, for example, USSN 09/012,097, the contents of which are incorporated herein by reference.
- the ability to employ in vitro mutagenesis or combinatorial modifications of sequences encoding proteins allows for the production of libraries of proteins which can be screened for binding affinity for different ligands. For example, one can totally randomize a sequence of 1 to 5, 10 or more codons, at one or more sites in a DNA sequence encoding a binding protein, make an expression construct and introduce the expression construct into a unicellular microorganism, and develop a library. One can then screen the library for binding affinity to one or desirably a plurality of ligands. The best affinity sequences which are compatible with the cells into which they would be introduced can then be used as the ligand binding domain.
- the ligand would be screened with the host cells to be used to determine the level of binding of the ligand to endogenous proteins.
- a binding profile could be defined weighting the ratio of binding affinity to the mutagenized binding domain with the binding affinity to endogenous proteins. Those ligands which have the best binding profile could then be used as the ligand.
- Phage display techniques as a non-limiting example, can be used in carrying out the foregoing.
- antibody subunits e.g. heavy or light chain, particularly fragments, more particularly all or part of the variable region, or fusions of heavy and light chain to create single chain antibodies
- Antibodies can be prepared against haptenic molecules which are physiologically acceptable and the individual antibody subunits screened for binding affinity.
- the cDNA encoding the subunits can be isolated and modified by deletion of the constant region, portions of the variable region, mutagenesis of the variable region, or the like, to obtain a binding protein domain that has the appropriate affinity for the ligand. In this way, almost any physiologically acceptable haptenic compound can be employed as the ligand or to provide an epitope for the ligand.
- the DNA binding unit is linked to more than one ligand binding domain.
- a DNA binding domain can be linked to at least 2, 3, 4, or 5 ligand binding domains.
- a DNA binding domain can also be linked to at least 5 ligand binding domains or any number of ligand binding domains.
- the ligand binding domains can be, by illustration, linked to each other in a linear array, by linking the NH2-terminus of one ligand binding domain to the COOH-terminus of another ligand binding domain.
- more than one molecule of a chimeric transcription factor can be cross-linked to a single DNA binding domain in the presence of a divalent ligand.
- ligand-dependent transcription regulation switches based on allosteric changes in a chimeric transcription factor are also useful in practicing the subject invention.
- One such switch employs a deletion mutant of the human progesterone receptor which no longer binds progesterone or any known endogenous steroid but can be activated by the orally active progesterone antagonist RU486, described, e.g, in Wang et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91 :8180.
- the transcription factor in this system generally consists of a ligand binding domain for binding RU486, a DNA binding domain such as GAL4 and an activation domain, typically VP16.
- the invention provides an ecdysone inducible system, in which a truncated mutant EcR is fused to at least one subunit of a transcription activator of the invention.
- the transcription factor further comprises USP, thereby providing high level induction of transcription of a target gene having the EcR target sequence, dependent on the presence of ecdysone.
- the inducible system comprises the E. coli tet repressor (TetR), which binds to tet operator (tetO) sequences upstream of target genes.
- TetR E. coli tet repressor
- tetO tet operator sequences upstream of target genes.
- target gene expression can be regulated over concentrations up to several orders of magnitude.
- the system not only allows differential control of the activity of an individual gene in eukaryotic cells but also is suitable for creation of "on/off" situations for such genes in a reversible way.
- This system provides target gene expression in the absence of tetracycline or an analog.
- the invention described herein provides a method for obtaining even stronger transcription induction of a target gene, which is regulatable by the tetracycline system or other inducible DNA binding domain.
- a "reverse" Tet system is used, again based on a DNA binding domain that is a mutant of the E. coli TetR, but which binds to TetO in the presence of Tet. Additional information on mutated tetR-based systems is provided above and in patent documents cited previously.
- the invention described herein provides a method for obtaining even stronger transcription induction of a target gene in the presence of tetracycline or an analog thereof from a very low background in the absence of tetracycline. 3.
- a ligand binding domain for the ligand is endogenous to the cells to be engineered, it is desirable to use a ligand which preferentially binds to a modified ligand binding domain relative to a naturally occurring peptide sequence, e.g., from this the modified domain was derived. This approach can avoid untoward intrinsic activities of the ligand. Significant guidance and illustrative examples toward that end are provided in the various references cited herein.
- Cross-linking/dimerization systems Any ligand for which a binding protein or ligand binding domain is known or can be identiified may be used in combination with such ligand binding domain in carrying out this invention.
- Regulated expression systems relevant to this invention involve the use of a protein containing a DNA binding domain to selectively target a desired gene for expression.
- the DNA binding domain can be provided in a fusion protein with one or more ligand binding domains.
- the transcription activation domain is provided as part of a fusion protein which further comprises a DNA-binding domain.
- Various DNA binding domains may be incorporated into the design of the chimeric transcription factor (or companion fusion protein) so long as a corresponding DNA "recognition" sequence is known or can be identified to which the domain is capable of binding.
- One or more copies of the recognition sequence are incorporated into the transcription control sequence of the target gene construct.
- Peptide sequence of human origin is often preferred, where available, for uses in human gene therapy.
- Composite DNA binding domains provide one means for achieving novel sequence specificity for the protein-DNA binding interaction.
- An illustrative composite DNA binding domain containing component peptide sequences of human origin is ZFHD-1 which is described in detail below.
- Individual DNA-binding domains may be further modified by mutagenesis to decrease, increase, or change the recognition specificity of DNA binding. These modifications could be achieved by rational design of substitutions in positions known to contribute to DNA recognition (often based on homology to related proteins for which explicit structural data are available).
- substitutions can be made in amino acids in the N-terminal arm, first loop, second helix, and third helix known to contact DNA.
- substitutions can be made at selected positions in the DNA recognition helix.
- random methods such as selection from a phage display library could be used to identify altered domains with increased affinity or altered specificity.
- Individual DNA-binding domains may be further modified by mutagenesis to decrease, increase, or change the recognition specificity of DNA binding. These modifications could be achieved by rational design of substitutions in positions known to contribute to DNA recognition (often based on homology to related proteins for which explicit structural data are available).
- substitutions can be made in amino acids in the N-terminal arm, first loop, second helix, and third helix known to contact DNA.
- substitutions can be made at selected positions in the DNA recognition helix.
- random methods such as selection from a phage display library can be used to identify altered domains with increased affinity or altered specificity.
- DNA binding domain of interest is a DNA binding domain which binds to a characteristic DNA sequence in a ligand-dependent manner.
- This sort of DNA binding domain is exemplified by the Tet repressor (tetR) and mutated versions thereof which are discussed in detail elsewhere herein and in various cited references.
- Domains which regulate the transcriptional activity of OCA-B-containing chimeric transcription factors may be included in the chimeric transcription factors of this invention.
- Such domains may be, for example, multimerization domains, as described in Natesan USSN 09/140,149.
- One example of such a multimerization domain is the trimerization domain which spans amino acids 126-217 of human HSF1. This domain is required for DNA binding to the wild-type heat shock transcription factor (Morimoto 1998, Genes and Development 12:3788-3796) and may be used e.g., as previously disclosed, to recruit additional activation domains to the promoter.
- the regulatory domain of HSF1 comprising amino acids 201-371 , may be used in the chimeric transcription factors of this invention.
- a smaller fragment comprising amino acids 221-310 may be used.
- a minimal regulatory domain comprising amino acids 300-310 which contains the serine phosphorylation sites at positions 303 and 307 may be used. If desired, one or more of the serines at positions 303 and 307 in the context of the full length or minimal regulatory domain may be replaced by different amino acids. As described in Green et al., supra, the regulatory domain negatively regulates the transcriptional activity of the HSF activation domain in the wild type transcription factor as well as in fusion proteins containing the GAL4 DNA binding domain. If lower levels of transcriptional activation are required or desired, this domain may be fused to the OCA-B domain alone or in combination with other potentiating or regulatory domains.
- Another regulatory domain which may be used in combination with an OCA-B domain in the practice of this invention comprises the peptide sequence spanning amino acids 280-360 of human NF-kb p65.
- the regulatory region stabilizes the activation domain (361 -550) and allows higher levels of transcription factor to be expressed in the cell.
- the chimeric proteins may contain a nuclear localization sequence which provides for translocation of the protein to the nucleus.
- a nuclear localization sequence has a plurality of basic amino acids, referred to as a bipartite basic repeat (reviewed in Garcia-Bustos et al, Biochimica et Biophysica Acta (1991 ) 1071 , 83-101). This sequence can appear in any portion of the molecule internal or proximal to the N- or C-terminus and results in the chimeric protein being localized inside the nucleus.
- the chimeric proteins may include domains that facilitate their purification, e.g. "histidine tags” or a glutathione-S-transferase domain. They may include "epitope tags” encoding peptides recognized by known monoclonal antibodies for the detection of proteins within cells or the capture of proteins by antibodies in vitro. Transcription factors can be tested for activity in vivo using a simple assay (F.M. Ausubel et al., Eds., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (John Wiley & Sons, New York, 1994); de Wet et al., Mol. Cell Biol. 7:725 (1987)).
- the in vivo assay requires a plasmid containing and capable of directing the expression of a recombinant DNA sequence encoding the transcription factor.
- the assay also requires a plasmid containing a reporter gene , e.g., the luciferase gene, the chloramphenicol acetyl transferase (CAT) gene, secreted alkaline phosphatase or the human growth hormone (hGH) gene, linked to a binding site for the transcription factor.
- CAT chloramphenicol acetyl transferase
- hGH human growth hormone
- a second group of cells which also lack both the gene encoding the transcription factor and the reporter gene, serves as the control group and receives a plasmid containing the gene encoding the transcription factor and a plasmid containing the test gene without the binding site for the transcription factor.
- the production of mRNA or protein encoded by the reporter gene is measured.
- An increase in reporter gene expression not seen in the controls indicates that the transcription factor is a positive regulator of transcription. If reporter gene expression is less than that of the control, the transcription factor is a negative regulator of transcription.
- the assay may include a transfection efficiency control plasmid.
- This plasmid expresses a gene product independent of the test gene, and the amount of this gene product indicates roughly how many cells are taking up the plasmids and how efficiently the DNA is being introduced into the cells. Additional guidance on evaluating chimeric proteins of this invention is provided below.
- Transcription factor constructs generally contain (1 ) a promoter region consisting minimally of a TATA box and initiator sequence but optionally including other transcription factor binding sites; (2) DNA sequence encoding the desired transcription factor, including sequences that promote the initiation and termination of translation, if appropriate; (3) an optional sequence consisting of a splice donor, splice acceptor, and intervening intron DNA; and (4) a sequence directing cleavage and polyadenylation of the resulting RNA transcript.
- the practitioner may select a conventional promoter such as the widely used hCMV promoter region
- the transcription factors be expressed in a cell-specific or tissue-specific manner.
- specificity of expression may be achieved by operably linking one or more of the DNA sequences encoding the chimeric protein(s) to a cell-type specific transcriptional regulatory sequence (e.g. promoter/enhancer).
- a cell-type specific transcriptional regulatory sequence e.g. promoter/enhancer
- Numerous cell-type specific transcriptional regulatory sequences are known. Others may be obtained from genes which are expressed in a cell-specific manner.
- constructs for expressing the chimeric proteins may contain regulatory sequences derived from genes known to exhibit expression in selected tissues. See e.g. PCT/US95/10591 , especially pp. 36-37.
- a DNA construct that enables transcription of a target gene to be regulated by a transcription factor in accordance with this invention comprises a DNA molecule which includes a synthetic transcription unit typically consisting of: (1 ) one copy or multiple copies of a DNA sequence recognized with high-affinity by the transcription factor or one or more of its component DNA binding domains; (2) a promoter sequence consisting minimally of a TATA box and initiator sequence but optionally including other transcription factor binding sites; (3) sequence encoding the desired product, including sequences that promote the initiation and termination of translation, if appropriate; (4) an optional sequence consisting of a splice donor, splice acceptor, and intervening intron DNA; and (5) a sequence directing cleavage and polyadenylation of the resulting RNA transcript.
- the gene construct contains a copy of the target gene to be expressed, operably linked to a transcription control sequence comprising a minimal promoter and one or more copies of a DNA recognition sequence responsive to the transcription factor.
- Target genes A wide variety of genes can be employed as the target gene, including genes that encode a therapeutic protein, antisense sequence or ribozyme of interest.
- the target gene can be any sequence of interest which provides a desired phenotype. It can encode a surface membrane protein, a secreted protein, a cytoplasmic protein, or there can be a plurality of target genes encoding different products.
- the target gene may be an antisense sequence which can modulate a particular pathway by inhibiting a transcriptional regulation protein or turn on a particular pathway by inhibiting the translation of an inhibitor of the pathway.
- the target gene can encode a ribozyme which may modulate a particular pathway by interfering, at the RNA level, with the expression of a relevant transcriptional regulator or with the expression of an inhibitor of a particular pathway.
- the proteins which are expressed, singly or in combination, can involve homing, cytotoxicity, proliferation, immune response, inflammatory response, clotting or dissolving of clots, hormonal regulation, etc.
- the proteins expressed may be naturally- occurring proteins, mutants of naturally-occurring proteins, unique sequences, or combinations thereof.
- hormones such as insulin, human growth hormone, glucagon, pituitary releasing factor, ACTH, melanotropin, relaxin, etc.
- growth factors such as EGF, IGF-1 , TGF-alpha, -beta, PDGF, G-CSF, M-CSF, GM-CSF, FGF, erythropoietin, thrombopoietin, megakaryocytic stimulating and growth factors, etc.
- interleukins such as IL-1 to -13; TNF-alpha and -beta, etc.
- enzymes and other factors such as tissue plasminogen activator, members of the complement cascade, perforins, superoxide dismutase, coagulation factors, antithrombin-lll, Factor Vlllc, vWF, Factor IX, alpha-anti-trypsin, protein C, protein S, endorphins, dynorphin, bone
- the gene can encode a naturally-occurring surface membrane protein or a protein made so by introduction of an appropriate signal peptide and transmembrane sequence.
- Various such proteins include homing receptors, e.g. L-selectin (Mel-14), blood-related proteins, particularly having a kringle structure, e.g. Factor Vlllc, Factor VlllvW, hematopoietic cell markers, e.g.
- CD3, CD4, CD8, B cell receptor TCR subunits alpha, beta, gamma or delta, CD10, CD19, CD28, CD33, CD38, CD41 , etc., receptors, such as the interleukin receptors IL-2R, IL-4R, etc., channel proteins, for influx or efflux of ions, e.g. H+, Ca+2, K+, Na+, CI", etc., and the like; CFTR, tyrosine activation motif, zap-70, etc.
- Proteins may be modified for transport to a vesicle for exocytosis.
- the modified protein By adding the sequence from a protein which is directed to vesicles, where the sequence is modified proximal to one or the other terminus, or situated in an analogous position to the protein source, the modified protein will be directed to the Golgi apparatus for packaging in a vesicle. This process in conjunction with the presence of the chimeric proteins for exocytosis allows for rapid transfer of the proteins to the extracellular medium and a relatively high localized concentration.
- intracellular proteins can be of interest, such as proteins in metabolic pathways, regulatory proteins, steroid receptors, transcription factors, etc., depending upon the nature of the host cell. Some of the proteins indicated above can also serve as intracellular proteins.
- T-cells one may wish to introduce genes encoding one or both chains of a T-cell receptor.
- B-cells one could provide the heavy and light chains for an immunoglobulin for secretion.
- cutaneous cells e.g. keratinocytes, particularly stem cells keratinocytes, one could provide for protection against infection, by secreting alpha, beta or gamma interferon, antichemotactic factors, proteases specific for bacterial cell wall proteins, etc.
- the site can include anatomical sites, such as lymph nodes, mucosal tissue, skin, synovium, lung or other internal organs or functional sites, such as clots, injured sites, sites of surgical manipulation, inflammation, infection, etc.
- anatomical sites such as lymph nodes, mucosal tissue, skin, synovium, lung or other internal organs or functional sites, such as clots, injured sites, sites of surgical manipulation, inflammation, infection, etc.
- surface membrane proteins which will direct the host cell to the particular site by providing for binding at the host target site to a naturally-occurring epitope, localized concentrations of a secreted product can be achieved.
- Proteins of interest include homing receptors, e.g. L- selectin, GMP140, CLAM-1 , etc., or addressins, e.g.
- ELAM-1 ELAM-1 , PNAd, LNAd, etc.
- clot binding proteins or cell surface proteins that respond to localized gradients of chemotactic factors.
- Minimal Promoters may be selected from a wide variety of known sequences, including promoter regions from fos, hCMV, SV40 and IL-2, among many others. Illustrative examples are provided which use a minimal CMV promoter or a minimal IL2 gene promoter (-72 to +45 with respect to the start site; Siebenlist et al., MCB 3:120- 3049, 1986). Genbank accession numbers for several promoters are given in the table below:
- DNA recognition sequences for other DNA binding domains may be determined experimentally.
- DNA recognition sequences can be determined experimentally, as described below, or the proteins can be manipulated to direct their specificity toward a desired sequence.
- a desirable nucleic acid recognition sequence for a composite DNA binding domain consists of a nucleotide sequence spanning at least ten, preferably eleven, and more preferably twelve or more bases.
- the component binding portions (putative or demonstrated) within the nucleotide sequence need not be fully contiguous; they may be interspersed with "spacer" base pairs that need not be directly contacted by the chimeric protein but rather impose proper spacing between the nucleic acid subsites recognized by each module. These sequences should not impart expression to linked genes when introduced into cells in the absence of the engineered DNA-binding protein.
- nucleotide sequence that is recognized by a chimeric protein containing a DNA-binding region preferably recognized with high affinity (dissociation constant 10- 1 1 M or lower are especially preferred).
- high affinity binding sites for individual subdomains of a composite DNA-binding region are already known, then these sequences can be joined with various spacing and orientation and the optimum configuration determined experimentally (see below for methods for determining affinities).
- high-affinity binding sites for the protein or protein complex can be selected from a large pool of random DNA sequences by adaptation of published methods (Pollock, R. and Treisman, R., 1990, A sensitive method for the determination of protein-DNA binding specificities. Nucl. Acids Res.
- Bound sequences are cloned into a plasmid and their precise sequence and affinity for the proteins are determined. From this collection of sequences, individual sequences with desirable characteristics (i.e., maximal affinity for composite protein, minimal affinity for individual subdomains) are selected for use. Alternatively, the collection of sequences is used to derive a consensus sequence that carries the favored base pairs at each position. Such a consensus sequence is synthesized and tested to confirm that it has an appropriate level of affinity and specificity.
- the target gene constructs may contain multiple copies of a DNA recognition sequence. For instance, the constructs may contain 5, 8, 10 or 12 recognition sequences for GAL4 or for ZFHD1.
- a number of well-characterized assays are available for determining the binding affinity, usually expressed as dissociation constant, for DNA-binding proteins and the cognate DNA sequences to which they bind. These assays usually require the preparation of purified protein and binding site (usually a synthetic oligonucleotide) of known concentration and specific activity. Examples include electrophoretic mobility-shift assays, DNasel protection or "footprinting", and filter-binding. These assays can also be used to get rough estimates of association and dissociation rate constants. These values may be determined with greater precision using a BIAcore instrument.
- the synthetic oligonucleotide is bound to the assay "chip," and purified DNA-binding protein is passed through the flow-cell. Binding of the protein to the DNA immobilized on the chip is measured as an increase in refractive index. Once protein is bound at equilibrium, buffer without protein is passed over the chip, and the dissociation of the protein results in a return of the refractive index to baseline value. The rates of association and dissociation are calculated from these curves, and the affinity or dissociation constant is calculated from these rates. Binding rates and affinities for the high affinity composite site may be compared with the values obtained for subsites recognized by each subdomain of the protein. As noted above, the difference in these dissociation constants should be at least two orders of magnitude and preferably three or greater.
- the above-mentioned plasmids are introduced together into tissue culture cells by any conventional transfection procedure, including for example calcium phosphate coprecipitation, electroporation, and lipofection. After an appropriate time period, usually 24-48 hr, the cells are harvested and assayed for production of the reporter protein. In embodiments requiring dimerization of chimeric proteins for activation of transcription, the assay is conducted in the presence of the dimerizing agent. In an appropriately designed system, the reporter gene should exhibit little activity above background in the absence of any co-transfected plasmid for the composite transcription factor (or in the absence of dimerizing agent in embodiments under dimerizer control).
- reporter gene expression should be elevated in a dose-dependent fashion by the inclusion of the plasmid encoding the composite transcription factor (or plasmids encoding the multimerizable chimeras, following addition of multimerizing agent). This result indicates that there are few natural transcription factors in the recipient cell with the potential to recognize the tested binding site and activate transcription and that the engineered DNA-binding domain is capable of binding to this site inside living cells.
- the transient transfection assay is not an extremely stringent test in most cases, because the high concentrations of plasmid DNA in the transfected cells lead to unusually high concentrations of the DNA-binding protein and its recognition site, allowing functional recognition even with relative low affinity interactions.
- a more stringent test of the system is a transfection that results in the integration of the introduced DNAs at near single-copy. Thus, both the protein concentration and the ratio of specific to non-specific DNA sites would be very low; only very high affinity interactions would be expected to be productive. This scenario is most readily achieved by stable transfection in which the plasmids are transfected together with another DNA encoding an unrelated selectable marker (e.g., G418-resistance).
- an unrelated selectable marker e.g., G418-resistance
- Transfected cell clones selected for drug resistance typically contain copy numbers of the nonselected plasmids ranging from zero to a few dozen. A set of clones covering that range of copy numbers can be used to obtain a reasonably clear estimate of the efficiency of the system.
- a viral vector typically a retrovirus, that incorporates both the reporter gene and the gene encoding the composite transcription factor or multimerizable components thereof.
- Virus stocks derived from such a construction will generally lead to single-copy transduction of the genes. If the ultimate application is gene therapy, it may be preferred to construct transgenic animals carrying similar DNAs to determine whether the protein is functional in an animal.
- Constructs may be designed in accordance with the principles, illustrative examples and materials and methods disclosed in the patent documents and scientific literature cited herein, each of which is incorporated herein by reference, with modifications and further exemplification as described herein.
- Components of the constructs can be prepared in conventional ways, where the coding sequences and regulatory regions may be isolated, as appropriate, ligated, cloned in an appropriate cloning host, analyzed by restriction or sequencing, or other convenient means. Particularly, using PCR, individual fragments including all or portions of a functional unit may be isolated, where one or more mutations may be introduced using "primer repair", ligation, in vitro mutagenesis, etc. as appropriate.
- DNA sequences encoding individual domains and sub-domains are joined such that they constitute a single open reading frame encoding a fusion protein capable of being translated in cells or cell lysates into a single polypeptide harboring all component domains.
- the DNA construct encoding the fusion protein may then be placed into a vector that directs the expression of the protein in the appropriate cell type(s).
- plasmids that direct the expression of the protein in bacteria or in reticulocyte-lysate systems.
- the protein-encoding sequence is introduced into an expression vector that directs expression in these cells. Expression vectors suitable for such uses are well known in the art. Various sorts of such vectors are commercially available.
- the animal cells may be insect, worm or mammalian or other animal cells. While various mammalian cells may be used, including, by way of example, equine, bovine, ovine, canine, feline, murine, and non-human primate cells, human cells are of particular interest.
- various types of cells may be used, such as hematopoietic, neural, glial, mesenchymal, cutaneous, mucosal, stromal, muscle (including smooth muscle cells), spleen, reticuloendotheliai, epithelial, endothelial, hepatic, kidney, gastrointestinal, pulmonary, fibroblast, and other cell types.
- hematopoietic cells which may include any of the nucleated cells which may be involved with the erythroid, lymphoid or myelomonocytic lineages, as well as myoblasts and fibroblasts.
- stem and progenitor cells such as hematopoietic, neural, stromal, muscle, hepatic, pulmonary, gastrointestinal and mesenchymal stem cells
- the cells may be autologous cells, syngeneic cells, allogeneic cells and even in some cases, xenogeneic cells with respect to an intended host organism.
- the cells may be modified by changing the major histocompatibility complex ("MHC") profile, by inactivating beta2-microglobulin to prevent the formation of functional Class I MHC molecules, inactivation of Class II molecules, providing for expression of one or more MHC molecules, enhancing or inactivating cytotoxic capabilities by enhancing or inhibiting the expression of genes associated with the cytotoxic activity, or the like.
- MHC major histocompatibility complex
- specific clones or oligoclonal cells may be of interest, where the cells have a particular specificity, such as T cells and B cells having a specific antigen specificity or homing target site specificity.
- Constructs encoding the chimeric transcription factors or other fusion proteins and constructs comprising target genes can be introduced into the cells as one or more DNA molecules or constructs, in many cases in association with one or more markers to allow for selection of host cells which contain the construct(s).
- the construct(s) once completed and demonstrated to have the appropriate sequences may then be introduced into a host cell by any convenient means.
- the constructs may be incorporated into vectors capable of episomal replication (e.g. BPV or EBV vectors) or into vectors designed for integration into the host cells' chromosomes.
- the constructs may be integrated and packaged into non-replicating, defective viral genomes like Adenovirus, Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or others, including retroviral vectors, for infection into cells. Viral delivery systems are discussed in greater detail below.
- the construct may be introduced by protoplast fusion, electroporation, biolistics, calcium phosphate transfection, lipofection, microinjection of DNA or the like.
- the host cells will in some cases be grown and expanded in culture before introduction of the construct(s), followed by the appropriate treatment for introduction of the construct(s) and integration of the construct(s). The cells will then be expanded and screened by virtue of a marker present in the constructs.
- markers which may be used successfully include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc., and various cell- surface markers such as Tac, CD8, CD3, Thy1 and the NGF receptor.
- a target site for homologous recombination where it is desired that a construct be integrated at a particular locus. For example, one can delete and/or replace an endogenous gene (at the same locus or elsewhere) with a recombinant target construct of this invention.
- homologous recombination one may generally use either ⁇ or O-vectors.
- the constructs may be introduced as a single DNA molecule encoding all of the genes, or different DNA molecules having one or more genes.
- the constructs may be introduced simultaneously or consecutively, each with the same or different markers.
- Vectors containing useful elements such as bacterial or yeast origins of replication, selectable and/or amplifiable markers, promoter/enhancer elements for expression in prokaryotes or eukaryotes, and mammalian expression control elements, etc. which may be used to prepare stocks of construct DNAs and for carrying out transfections are well known in the art, and many are commercially available.
- Cells which have been modified ex vivo with the DNA constructs may be grown in culture under selective conditions and cells which are selected as having the desired construct(s) may then be expanded and further analyzed, using, for example, the polymerase chain reaction for determining the presence of the construct in the host cells and/or assays for the production of the desired gene product(s).
- modified host cells Once modified host cells have been identified, they may then be used as planned, e.g. grown in culture or introduced into a host organism.
- the cells may be introduced into a host organism, e.g. a mammal, in a wide variety of ways.
- Hematopoietic cells may be administered by injection into the vascular system, there being usually at least about 10 4 cells and generally not more than about 1010 cells.
- the number of cells which are employed will depend upon a number of circumstances, the purpose for the introduction, the lifetime of the cells, the protocol to be used, for example, the number of administrations, the ability of the cells to multiply, the stability of the therapeutic agent, the physiologic need for the therapeutic agent, and the like.
- the number of cells will be at least about 10 4 and not more than about 10 9 and may be applied as a dispersion, generally being injected at or near the site of interest.
- the cells will usually be in a physiologically-acceptable medium.
- Cells engineered in accordance with this invention may also be encapsulated, e.g. using conventional biocompatible materials and methods, prior to implantation into the host organism or patient for the production of a therapeutic protein. See e.g. Hguyen et al, Tissue Implant Systems and Methods for Sustaining viable High Cell Densities within a Host, US Patent No. 5,314,471 (Baxter International, Inc.); Uludag and Sefton, 1993, J Biomed. Mater. Res.
- the cells may then be introduced in encapsulated form into an animal host, preferably a mammal and more preferably a human subject in need thereof.
- the encapsulating material is semipermeable, permitting release into the host of secreted proteins produced by the encapsulated cells.
- the semipermeable encapsulation renders the encapsulated cells immunologically isolated from the host organism in which the encapsulated cells are introduced.
- the cells to be encapsulated may express one or more chimeric proteins containing component domains derived from proteins of the host species and/or from viral proteins or proteins from species other than the host species.
- the chimeras may contain elements derived from GAL4 and VP16.
- the cells may be derived from one or more individuals other than the recipient and may be derived from a species other than that of the recipient organism or patient.
- adenovirus adeno-associated virus
- retroviruses which allow for transduction and, in some cases, integration of the virus into the host. See, for example, Dubensky et al. (1984) Proc. Natl. Acad. Sci. USA 81 , 7529-7533; Kaneda et al., (1989) Science 243,375-378; Hiebert et al. (1989) Proc. Natl. Acad. Sci.
- the vector may be administered by injection, e.g. intravascularly or intramuscularly, inhalation, or other parenteral mode.
- Non- viral delivery methods such as administration of the DNA via complexes with liposomes or by injection, catheter or biolistics may also be used. See e.g.
- the manner of the modification will depend on the nature of the tissue, the efficiency of cellular modification required, the number of opportunities to modify the particular cells, the accessibility of the tissue to the DNA composition to be introduced, and the like.
- an attenuated or modified retrovirus carrying a target transcriptional initiation region if desired, one can activate the virus using one of the subject transcription factor constructs, so that the virus may be produced and transfect adjacent cells.
- the DNA introduction need not result in integration in every case. In some situations, transient maintenance of the DNA introduced may be sufficient. In this way, one could have a short term effect, where cells could be introduced into the host and then turned on after a predetermined time, for example, after the cells have been able to home to a particular site.
- This invention is applicable to any situation that calls for expression of an endogenous or exogenously-introduced gene, e.g. one embedded within a large genome.
- the desired expression level could be preset very high or very low.
- the system may be further engineered to achieve regulated or titratable expression. See e.g. PCT/US93/01617 and other previously cited references. In most cases, the inadvertent activation of unrelated cellular genes is undesirable.
- one application of this invention to gene therapy is the delivery of a two-transcription-unit cassette (which may reside on one or two plasmid molecules, depending on the delivery vector) consisting of (1 ) a transcription unit encoding a chimeric transcription factor of this invention, in some cases along with a DNA binding domain, and (2) a transcription unit consisting of the target gene linked to and under the control of a minimal promoter carrying one, and preferably several, binding sites for the DNA-binding domain of the transcription factor.
- Cointroduction of the two transcription units into a cell results in the production of the hybrid transcription factor which in turn activates the therapeutic gene to high level.
- This strategy essentially incorporates an amplification step, because the promoter that would be used to produce the therapeutic gene product in conventional gene therapy is used instead to produce the activating transcription factor.
- Each transcription factor has the potential to direct the production of multiple copies of the therapeutic protein.
- This method may be employed to increase the efficacy of many gene therapy strategies by substantially elevating the expression of a therapeutic target gene, allowing expression to reach therapeutically effective levels.
- therapeutic genes that would benefit from this strategy are genes that encode secreted therapeutic proteins, such as cytokines (e.g., IL-2, IL-4, IL-12), CFTR (see e.g. Grubb et al, 1994, Nature 371 :802-6), growth factors (e.g., VEGF), antibodies, and soluble receptors.
- the system is subject to many variables, such as the efficiency of expression and, as appropriate, the level of secretion, the activity of the expression product, the particular need of the patient, which may vary with time and circumstances, the rate of loss of the cellular activity as a result of loss of cells or expression activity of individual cells, and the like. Therefore, it is expected that for each individual patient, even if there were universal cells which could be administered to the population at large, each patient would be monitored for the proper dosage for the individual.
- kits useful for practicing the described methods contain a first DNA sequence encoding a transcription factor comprising an OCA-B domain and, in some cases, a second DNA sequence encoding the DNA binding domain of the transcription factor.
- a third DNA sequence contains a target gene linked to a DNA element to which the transcription factor is capable of binding.
- the third DNA sequence may contain a cloning site for insertion of a desired target gene by the practitioner.
- the kits optionally also contain a ligand useful for regulated expression of the target gene.
- DNA-binding and transcription activating components are modular, may be incorporated into fusion proteins with various other domains and tested in cell culture and in animals:
- Additional DNA vectors for directing the expression of fusion proteins relevant to this invention were derived from the mammalian expression vector pCGNN (Attar, R.M. and Gilman, M.Z. 1992. MCB 12: 2432-2443). Inserts cloned as Xbal-BamHI fragments into pCGNN are transcribed under the control of the human CMV promoter and enhancer sequences (nucleotides -522 to +72 relative to the cap site), and are expressed with an optional epitope tag (a 16 amino acid portion of the H.
- influenzae hemaglutinin gene that is recognized by the monoclonal antibody 12CA5) and, in the case of transcription factor domains, with an N-terminal nuclear localization sequence (NLS; from SV40 T antigen).
- NLS nuclear localization sequence
- all fragments cloned into pCGNN were inserted as Xbal-BamHI fragments that included a Spel site just upstream of the BamHI site.
- Xbal and Spel produce compatible ends, this allowed further Xbal-BamHI fragments to be inserted downstream of the initial insert and facilitated stepwise assembly of proteins comprising multiple components.
- a stop codon was interposed between the Spel and BamHI sites.
- the vector pCGNN-GAL4 was additionally used, in which codons 1- 94 of the GAL4 DNA binding domain gene were cloned into the Xbal site of pCGNN such that a Xbal site is regenerated only at the 3' end of the fragment.
- Xbal-BamHI fragments could be cloned into this vector to generate GAL4 fusions, and subsequently recovered.
- OCA-B The full length coding sequence of OCA-B can be found in Genbank, accession number Z47550.
- the 50 amino acid OCA-B transcription activation sequence is encoded by the following linear sequence: CCTGGGCCCCAGTTTGTCCAGCTCCCCATCTCTATCCCAGAGCCAGTCCTTC AGGACATGGAAGACCCCAGAAGAGCCGCCAGCTCGTTGACCATCGACAAGCT GCTTTTGGAGGAAGAGGATAGCGACGCCTATGCGCTTAACCACACTCTCTCTG TGGAAGGCTTT
- pCGNN/OCA-B An oligonucleotide encoding the C-terminal 50 amino acids of OCA-B was synthesized. The resulting fragment, which has 5' Xbal and 3' Spel sites, was inserted into Xbal-Spel-opened pCGNN (Rivera et al). The resulting plasmid will has two in-frame stop codons and a BamHI site downstream of the Spel site.
- the internal ribosome entry sequence (IRES) from the encephalomyocarditis virus was amplified by PCR from pWZL-Bleo.
- the resulting fragment which was cloned into pBS- SK+ (Stratagene), contains an Xbal site and a stop codon upstream of the IRES sequence and downstream of it, an Ncol site encompassing the ATG followed by Spel and BamHI sites.
- the sequence around the initiating ATG of pCGNN-ZFHD1 -3FKBP was mutated to an Ncol site and the Xbal site was mutated to a Nhel site using the oligonucleotides
- ZFHD1 and OCA-B fusions Human fibrosarcoma cells can be transiently transfected with a SEAP target gene and plasmids encoding representative ZFHD-FKBP- and FRB-OCA-B-containing fusion proteins to measure rapamycin-dependent and dose-responsive secretion of SEAP into the cell culture medium.
- HT1080 cells (ATCC CCL-121 ), derived from a human fibrosarcoma, are grown in MEM supplemented with non-essential amino acids and 10% Fetal Bovine Serum.
- Cells plated in 24-well dishes (Falcon, 6 x 104 ceils/well) are transfected using Lipofectamine under conditions recommended by the manufacturer (GIBCO/BRL).
- GEBCO/BRL Lipofectamine under conditions recommended by the manufacturer
- a total of 300 ng of the following DNA can be transfected into each well: 100 ng ZFHDxl 2-CMV-SEAP reporter gene, 2.5ng pCGNN-ZFHD1-3FKBP or other DNA binding domain fusion, 5 ng pCGNN-1 FRB-OCA-B or other activation domain fusion and 192.5 ng pUC118.
- transiently transfected HT1080 cells for injection into mice (See below), cells in 100 mm dishes (2 x 106 cells/dish) are transfected by calcium phosphate precipitation for 16 hours (Gatz, C, Kaiser, A. & Wendenburg, R. , 1991 , Mo/. Gen. Genet. 227, 229- 237) with the following DNAs: 10 mg of ZHWTx12-CMV-hGH, 1 mg pCGNN-ZFHD1- 3FKBP, 2 mg pCGNN-1 FRB-OCA-B and 7 mg pUC118. Transfected cells are rinsed 2 times with phosphate buffered saline (PBS) and given fresh medium for 5 hours.
- PBS phosphate buffered saline
- cells are removed from the dish in Hepes Buffered Saline Solution containing 10 mM EDTA, washed with PBS/0.1 % BSA/0.1 % glucose and resuspended in the same at a concentration of 2 x 10 7 cells/ml.
- pZHWTxl 2-CM V-SEAP This reporter gene, containing 12 tandem copies of a ZFHD1 binding site (Pomerantz et al., 1995) and a basal promoter from the immediate early gene of human cytomegalovirus (Boshart et. al., 1985) driving expression of a gene encoding secreted alkaline phosphatase (SEAP), was prepared by replacing the Nhel-Hindlll fragment of pSEAP Promoter (Clontech) with the following Nhel-Xbal fragment containing 12 ZFHD binding sites:
- pZHWTx12-CMV-hGH Activation of this reporter gene leads to the production of hGH. It was constructed by replacing the Hindlll-BamHI (blunted) fragment of pZHWTx12-CMV-SEAP (containing the SEAP coding sequence) with a Hindlll (blunted) -EcoRI fragment from pOGH (containing an hGH genomic clone; Selden et al., MCB 6:3171-3179, 1986; the BamHI and EcoRI sites were blunted together).
- pZHWTx12-IL2-SEAP containing the SEAP coding sequence
- This reporter gene is identical to pZHWTxl 2-CMV-SEAP except the Xbal-Hindlll fragment containing the minimal CMV promoter was replaced with the following Xbal- Hindlll fragment containing a minimal IL2 gene promoter (-72 to +45 with respect to the start site; Siebenlist et al., MCB 3:149, 1986):
- pLH L R-hph
- pBabe Hygro Morganstem and Land, NAR 18:3587-96, 1990
- BamHI-Clal cut pBabe Bleo resulting in the loss of the bleo gene; the BamHI and Hindlll sites were blunted together.
- the Mlul-Clal fragment from pZHWTx12-IL2-SEAP was cloned into the Clal site of pLH. It was oriented such that the directions of transcription from the viral LTR and the internal ZFHD-IL2 promoters were the same.
- a Clal-BstBI fragment consisting of the following was inserted into the Clal site of pLH such that the directions of transcription from the viral LTR and the internal Gal4-IL2 promoters were the same:
- GAGQQG ⁇ CT ⁇ CIGICCTCCGAGCGC ⁇ and a Hindlll-BstBI fragment containing the SEAP gene coding sequence (Berger et al., Gene 66:1-10, 1988) mutagenized to add the following sequence (containing a BstB1 site) immediately after the stop codon: 5'-CCCGTGGTCCCGCGTTGCTTCGAT
- Stable cell lines can be generated by sequential transfection of a SEAP target gene and expression vectors for ZFHD1 -3FKBP and 1 FRB- OCA-B, respectively. Stable clones that exhibit rapamycin-dependent SEAP production will be pooled and from this pool, several individual clones will be characterized.Those clones that exhibit SEAP production that is significantly higher than the pool and significantly higher than transiently transfected cells will be selected.
- a second set of assays can be performed in which the length of the SEAP assay is increased by a factor of approximately 50 to detect any SEAP activity in untreated cells.
- a bicistronic expression vector that directs the production of both ZFHD1-3FKBP and 1 FRB-OCA-B through the use of an internal ribosome entry sequence (IRES).
- IRS internal ribosome entry sequence
- This expression plasmid is cotransfected, together with a zeocin-resistance marker plasmid, into a cell line carrying a retrovirally- transduced SEAP reporter gene. Following transfection, a pool of expressing clones is selected, expanded and assayed for rapamycin dependent SEAP production.
- mice Animals, husbandry, and general procedures. Male nu/nu mice are obtained from Charles River Laboratories (Wilmington, MA) and allowed to acclimate for five days prior to experimentation. They are housed under sterile conditions, allowed free access to sterile food and sterile water throughout the entire experiment, and are handled with sterile techniques throughout. To transplant transiently transfected cells into mice, 2 x 106 transfected
- HT1080 cells are suspended in 100 ml PBS/0.1 % BSA/0.1% glucose buffer and administered into four intramuscular sites (approximately 25 ml per site) on the haunches and flanks of the animals. Control mice receive equivalent volume injections of buffer alone. Rapamycin is formulated for in vivo administration by dissolution in equal parts of N,N- dimethylacetamide and a 9:1 (v:v) mixture of polyethylene glycol (average molecular weight of 400) and polyoxyethylene sorbitan monooleate. Concentrations of rapamycin in the completed formulation are sufficient to allow for in vivo administration of the appropriate dose in a 2.0 ml/kg injection volume.
- mice bearing no transfected HT1080 cells, receive 10.0 mg/kg rapamycin.
- Other control mice bearing transfected cells receive only the rapamycin vehicle.
- Blood is collected by either anesthetizing or sacrificing mice via CO2 inhalation. Anesthetized mice are used to collect 100 ml of blood by cardiac puncture. The mice are revived and allowed to recover for subsequent blood collections. Sacrificed mice are immediately exsanguinated. Blood samples are allowed to clot for 24 hours, at 4 ° C, and sera are collected following centrifugation at 1000 x g for 15 minutes.
- Serum hGH is measured by the Boehringer Mannheim non-isotopic sandwich ELISA (Cat No. 1 585 878).
- the assay has a lower detection limit of 0.0125 ng/ml and a dynamic range that extends to 0.4 ng/ml.
- Absorbance is read at 405 nm with a 490 nm reference wavelength on a Molecular Devices microtiter plate reader, as per the standard instructions.
- the antibody reagents in the ELISA demonstrate no cross reactivity with endogenous, murine hGH in diluent sera or native samples.
- rapamycin is administered to mice approximately one hour following injection of HT1080 cells. Rapamycin doses are either 0.01 , 0.03, 0.1 , 0.3, 1.0, 3.0, or 10.0 mg/kg. Seventeen hours following rapamycin administration, the mice are sacrificed for blood collection.
- mice receive 10.0 mg/kg of rapamycin one hour following injection of the cells. Mice are sacrificed at 4, 8, 1 , 24, and 42 hours following rapamycin administration.
- mice are administered transfected HT1080 cells as described above. Approximately one hour following injection of the cells, mice receive the first of five intravenous 10.0 mg/kg doses of rapamycin. The four remaining doses are given under anesthesia, immediately subsequent to blood collection, at 16, 32, 48, and 64 hours. Additional blood collections are also performed at 72, 80, 88, and 96 hours following the first rapamycin dose. Control mice are administered cells, but receive only vehicle at the various times of administration of rapamycin. Experimental animals and their control counterparts are each assigned to one of two groups. Each of the two experimental groups and two control groups receive identical drug or vehicle treatments, respectively. The groups differ in that blood collection times alternate between the two groups to reduce the frequency of blood collection for each animal.
- An additional RU 486 dependent transcription factor can be prepared using the composite DNA binding domain ZFHD1 (Rivera et al., supra, and US 08/366,083.) Primers 5'-PR- LBD and 3'-PR-LBD to amplify amino acids 640-891 of hPRB891 from plasmid pT7bhPRB-891 (Vegeto et al, Cell 69:703-713, 1992) . The resulting fragment, which will have 5' Xbal and 3' Spel sites, can be inserted into the Spel site of pCGNN-ZFHD1- OCA-B. This will place the PR-LBD in-frame and at the carboxy terminus of OCA-B.
- 5'-PR-LBD 5'-tctagaAAAAAGTTCAATAAAGTCAG
- An expression vector for directing the expression of an RU486 dependent transcription factor consisting of a progesterone receptor ligand binding domain, a GAL4 DNA binding domain and an OCA-B transcription activation domain can be prepared as follows: Use primers 5'-OCA-Bglll and 3'-OCA-BamHI to amplify amino acids 601 to 768 of OCA-B from plasmid pcGNN-OCA-B.
- 3'-OCA-BamHI ggatccXAAAGCCTTCCACAGAGAG where X is 0, 1 or 2 nucleotides that may be required to create in-frame fusions rtTA/OCA-B
- a tetracycline inducible transcription factor containing the OCA-B activation domain can be constructed using pUHD17-1 (described in US 5,654,168) as follows. Digest pUHD17-1 with Aflll. Remove the protruding 5' end with mung bean nuclease and ligate the synthetic oligonucleotide 5'-CactagtTAACTAAGTAA. The resulting plasmid, rTetR- Spel contains a Spel cleavage site at the very end of the rTetR gene. Insert an Xbal-Spel fragment from pCGNN-OCA-B into Spel-digested rTetR-Spel to clone the OCA-B activation domain at the carboxy terminus of the rTetR.
Abstract
L'invention concerne de nouveaux matériels et de nouvelles méthodes faisant intervenir l'expression hétérologue de facteurs de transcription qui sont utiles pour la transcription de gènes cibles dans des cellules et organismes génétiquement modifiés qui les contiennent. L'invention concerne également des gènes chimères cibles ainsi que d'autres matériels servant à mettre en oeuvre l'invention.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14028999P | 1999-06-18 | 1999-06-18 | |
US140289P | 1999-06-18 | ||
PCT/US2000/016620 WO2000078951A1 (fr) | 1999-06-18 | 2000-06-16 | Facteurs de transcription oca-b chimeriques |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1194544A1 true EP1194544A1 (fr) | 2002-04-10 |
Family
ID=22490589
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP00941478A Withdrawn EP1194544A1 (fr) | 1999-06-18 | 2000-06-16 | Facteurs de transcription oca-b chimeriques |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1194544A1 (fr) |
AU (1) | AU5618200A (fr) |
CA (1) | CA2375490A1 (fr) |
IL (1) | IL147004A0 (fr) |
WO (1) | WO2000078951A1 (fr) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
IL152871A0 (en) * | 2000-06-16 | 2003-06-24 | Ariad Gene Therapeutics Inc | Chimeric hsf transcription factors |
CN103038343A (zh) * | 2010-03-23 | 2013-04-10 | 英特瑞克斯顿股份有限公司 | 条件表达治疗蛋白的载体,包含所述载体的宿主细胞,及其应用 |
EP3568474A1 (fr) * | 2017-01-10 | 2019-11-20 | Intrexon Corporation | Modulation de l'expression de polypeptides par l'intermédiaire de nouveaux systèmes d'expression de commutateurs géniques |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995032284A1 (fr) * | 1994-05-24 | 1995-11-30 | Ciba-Geigy Ag | Facteur agissant en interaction avec des proteines nucleaires |
JP2001514007A (ja) * | 1997-08-27 | 2001-09-11 | アリアド ジーン セラピューティクス インコーポレイテッド | キメラ転写アクチベーター、ならびにそれに関連する組成物および使用 |
-
2000
- 2000-06-16 AU AU56182/00A patent/AU5618200A/en not_active Abandoned
- 2000-06-16 EP EP00941478A patent/EP1194544A1/fr not_active Withdrawn
- 2000-06-16 WO PCT/US2000/016620 patent/WO2000078951A1/fr not_active Application Discontinuation
- 2000-06-16 CA CA002375490A patent/CA2375490A1/fr not_active Abandoned
- 2000-06-16 IL IL14700400A patent/IL147004A0/xx unknown
Non-Patent Citations (1)
Title |
---|
See references of WO0078951A1 * |
Also Published As
Publication number | Publication date |
---|---|
WO2000078951A1 (fr) | 2000-12-28 |
CA2375490A1 (fr) | 2000-12-28 |
AU5618200A (en) | 2001-01-09 |
IL147004A0 (en) | 2002-08-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6117680A (en) | Compositions and methods for regulation of transcription | |
US6479653B1 (en) | Compositions and method for regulation of transcription | |
AU752129B2 (en) | Chimeric transcriptional activators and compositions and uses related thereto | |
US6015709A (en) | Transcriptional activators, and compositions and uses related thereto | |
JP3817739B2 (ja) | キメラdna結合性タンパク質 | |
US6506379B1 (en) | Intramuscular delivery of recombinant AAV | |
US20010049144A1 (en) | Methods for high level expression of genes in primates | |
US6306649B1 (en) | Heterologous transcription factors | |
JP2002508971A (ja) | 多量体キメラ蛋白質を使用する生物学的イベントの調節 | |
WO1996041865A1 (fr) | Regulation d'evenements biologiques fondee sur la rapamycine | |
JP2002507895A (ja) | 段階的なトランス活性化能を有する転写活性化因子 | |
WO1996006110A1 (fr) | Proteines composites se fixant a de l'adn et substances et procedes concernant ces proteines | |
US7109317B1 (en) | FK506-based regulation of biological events | |
US20030235889A1 (en) | Materials and methods involving conditional retention domains | |
EP1194544A1 (fr) | Facteurs de transcription oca-b chimeriques | |
US20020048792A1 (en) | Methods and materials for regulated production of proteins | |
EP1290196A1 (fr) | Facteurs de transcription hsf chimeres | |
CA2413468A1 (fr) | Methodes et moyens de regulation de l'expression genique | |
CA2346962A1 (fr) | Regulation fondee sur fk506 d'evenements biologiques | |
AU714904C (en) | Rapamcycin-based regulation of biological events | |
US20030206891A1 (en) | Rapamycin-based biological regulation | |
US20040265288A1 (en) | New applications of gene therapy technology | |
JP2002535958A (ja) | 条件集合ドメインに関する材料および方法 | |
WO1998039418A1 (fr) | Nouvelles applications de la technique de la therapie genique |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20020118 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
17Q | First examination report despatched |
Effective date: 20030606 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20031217 |