EP1190061A1 - Fusions de genes exprimees par la streptavidine et methodes pour les utiliser - Google Patents

Fusions de genes exprimees par la streptavidine et methodes pour les utiliser

Info

Publication number
EP1190061A1
EP1190061A1 EP00941246A EP00941246A EP1190061A1 EP 1190061 A1 EP1190061 A1 EP 1190061A1 EP 00941246 A EP00941246 A EP 00941246A EP 00941246 A EP00941246 A EP 00941246A EP 1190061 A1 EP1190061 A1 EP 1190061A1
Authority
EP
European Patent Office
Prior art keywords
streptavidin
fusion protein
antibody
amino acids
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00941246A
Other languages
German (de)
English (en)
Inventor
Stephen Charles Goshorn
Scott Stoll Graves
Joanne Elaine Schultz
Yukang Lin
James Allen Sanderson
John M. Reno
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Poniard Pharmaceuticals Inc
Original Assignee
Poniard Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Poniard Pharmaceuticals Inc filed Critical Poniard Pharmaceuticals Inc
Publication of EP1190061A1 publication Critical patent/EP1190061A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/66—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
    • A61K47/665—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells the pre-targeting system, clearing therapy or rescue therapy involving biotin-(strept) avidin systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/36—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag

Definitions

  • the present invention relates generally to streptavidin expressed gene fusion constructs, and more particularly, to genomic streptavidin expressed gene fusions and methods of using these constructs in diagnostic and therapeutic applications.
  • Streptavidin is a 159 amino acid protein produced by Streptomyces avidinii, and which specifically binds water-soluble biotin (Chaiet et al, Arch. Biochem. Biophys. 70(5:1-5, 1964). Streptavidin is a nearly neutral 64,000 dalton tetrameric protein. Accordingly, it consists of four identical subunits each having an approximate molecular mass of 16,000 daltons (Sano and Cantor, Proc. Natl. Acad. Sci. USA 57:142-146, 1990).
  • Streptavidin shares some common characteristics with avidin, such as molecular weight, subunit composition, and capacity to bind biotin with high affinity (K D «10 "15 ) (Green, Adv. Prot. Chem. 29:85-133, 1975). Further, while streptavidin and avidin differ in their amino acid compositions, both have an unusually high content of threonine and tryptophan. In addition, streptavidin differs from avidin in that it is much more specific for biotin at physiological pH, likely due to the absence of carbohydrates on streptavidin.
  • streptavidin gene has been cloned and expressed in E. coli (Sano and Cantor, Proc. Natl. Acad. Sci. USA 57(7): 142- 146, 1990; Agarana, et al, Nucleic Acids Res. 14(4):187 -1882, 1986). Fusion constructs of streptavidin, and truncated forms thereof, with various proteins, including single-chain antibodies, have also been expressed in E. coli (Sano and Cantor, Biotechnology (NY) 9(72j:1378-1381, 1991; Sano and Cantor, Biochem. Biophys. Res. Commun. 176(2):57 X-577 , 1991; Sano, et al, Proc. Natl.
  • preparations of streptavidin expressed gene fusions are usually made by expressing a core streptavidin-containing construct in bacteria, wherein inclusion bodies are formed.
  • Such production has several disadvantages, including the rigor and expense of purifying from inclusion bodies, the necessity of using harsh denaturing agents such as guanidine hydrochloride, and the difficulty in scaling up in an economical fashion.
  • harsh denaturing agents such as guanidine hydrochloride
  • periplasmic expression of core streptavidin-containing constructs in soluble form Dubel, et al., supra).
  • a genomic streptavidin expressed gene fusion is expressed as a soluble protein into the periplasmic space of bacteria and undergoes spontaneous folding. Accordingly, such expression offers the advantage that the periplasm is a low biotin environment and one need not purify and refold the protein under harsh denaturing conditions that may prove fatal to the polypeptide encoded by a heterologous nucleic acid molecule fused to the genomic streptavidin nucleic acid molecule.
  • the present invention fulfills this need, while further providing other related advantages.
  • the present invention generally provides expression cassettes and fusion constructs encoded thereby comprising genomic streptavidin.
  • the present invention provides a vector construct for the expression of streptavidin fusion proteins, comprising a first nucleic acid sequence encoding at least 129 amino acids of streptavidin ( Figure 4), or a functional variant thereof, a promoter operatively linked to the first nucleic acid sequence, and a cloning site for, or with, insertion of a second nucleic acid sequence encoding a polypeptide to be fused with streptavidin, interposed between the promoter and the first nucleic acid sequence.
  • the second nucleic acid may encode the streptavidin portion of the construct and the first nucleic acid encodes a polypeptide to be fused with streptavidin.
  • the promoter is inducible or constitutive.
  • the first nucleic acid sequence encodes at least amino acids 14 to 150, 14 to 151, 14 to 152, 14 to 153, 14 to 154, 14 to 155, 14 to 156, 14 to 157, or 14 to 158 of streptavidin, Figure 4.
  • the first nucleic acid sequence encodes at least amino acids 5 to 150-158 of Figure 4 or 1 to 150-158 of Figure 4.
  • Host cells containing genomic streptavidin expression cassettes are also provided as are fusion proteins expressed by the same.
  • fusion proteins comprising single chain antibodies are provided.
  • the single chain antibodies are directed to a cell surface antigen.
  • the single chain antibodies are directed to cell surface antigens, or cell-associated stromal or matrix antigens, including, but not limited to, CD20, CD22, CD45, CD52, CD56, CD57, EGP40 (or EPCAM or KSA), NCAM, CEA, TAG-72, mucins (MUC-1 through MUC-7), ⁇ -HCG, EGF receptor, IL-2 receptor, her2/neu, Lewis Y, GD2, GM2, tenascin, sialylated tenascin, somatostatin, activated tumor stromal antigen, or neoangiogenic antigens.
  • methods for targeting a tumor cell comprising the administration of a fusion protein, said fusion protein comprising at least a first and a second polypeptide joined end to end, wherein said first polypeptide comprises at least 129 amino acids of streptavidin ( Figure 4), or conservatively substituted variants thereof, wherein said second polypeptide is a polypeptide which binds a cell surface protein on a tumor cell, wherein the fusion protein binds the cell surface protein on a tumor cell and wherein the streptavidin portion of the fusion protein is capable of binding biotin.
  • the second polypeptide is an antibody or antigen-binding fragment thereof.
  • pharmaceutical compositions, comprising genomic streptavidin fusion constructs are provided.
  • Figure 1 is a schematic representation of a heterologous protein-genomic streptavidin expressed gene construct.
  • Figure 2 is a schematic representation of a single chain antibody- genomic streptavidin fusion construct.
  • Figure 3 is a schematic representation of the pEX94B expression vector containing a single chain antibody(huNR-LU-10)-genomic streptavidin fusion construct.
  • Figure 4 is the sequence of genomic streptavidin (SEQ ID NO: 1) including the signal sequence and predicted amino acid sequence (SEQ ID NO: 2).
  • Figure 5 is a schematic representation of the construction of the pKKlac/pelB vector.
  • Figure 6 is a schematic representation of the construction of the pEX-1 vector.
  • Figure 7 is a schematic representation of the construction of the pEX-
  • Figure 8 is a schematic representation of the construction of the pEX94B vector.
  • Figure 9 is a schematic representation of the construction of the pEX94B neo vector.
  • Figure 10 represents the determined nucleic acid sequence (SEQ ID NO:
  • streptavidin regulatory region is noted as are the various linkers and light and heavy chains of the single chain antibody.
  • Figures 11A and 11B are the determined nucleic acid (SEQ ID NO: 5) and predicted amino acid sequences (SEQ ID NO: 6) of a B9E9 scFvSA fusion construct, with the pKOD linker between V L and V H . Linkers are boxed and the orientation is V L -linker-V H -linker-Streptavidin.
  • Figure 11C is an expression cassette comprising the nucleic acid sequences (SEQ ID NO: 7) and predicted amino acid sequences (SEQ ID NO: 8) of a B9E9 scFvSA fusion construct encoding V H -linker-V L -linker-Streptavidin.
  • Figure 12 is a scanned image representing SDS-PAGE analysis of huNR-LU-10 scFvSA.
  • Figure 13 is graphic representation of size exclusion HPLC analysis of huNR-LU-lO scFvSA.
  • Figure 14 is a plot illustrating a competitive immunoreactivity assay of huNR-LU-10 scFvSA (97-20.0 and 98-01.0) as compared to huNR-LU-10 mAb.
  • Figure 15 is a plot illustrating the rate of dissociation of DOTA-biotin from huNR-LU-10 scFvSA (97-13.0) as compared to recombinant streptavidin (r-SA).
  • Figure 16 is a graph illustrating biodistribution of pretargeted huNR-LU- I O SCFVSA.
  • Figure 17 is a graph depicting blood clearance and tumor uptake of huNR-LU-10 scFvSA versus a chemically conjugated form (mAb/SA).
  • Figure 18 is a bar graph illustrating biodistribution of pretargeted B9E9 scFvSA.
  • Figure 19 is a scanned image of SDS-PAGE analysis of scFvSA fusion protein expression in the presence and absence of FkpA.
  • Core streptavidin refers to a streptavidin molecule consisting of the central amino acid residues 14-136 of streptavidin of Figure 4 and also of Figure 3 of U.S. Patent No. 4,839,293 and deposited at ATCC number X03591.
  • genomic streptavidin refers to a sequence comprising at least 129 residues of the sequence set forth in Figure 4. Accordingly, genomic streptavidin refers to streptavidin molecules that have N-terminal, C-terminal, or both N- and C-terminal extensions of core streptavidin. The N- and C-terminal extensions may comprise any number of amino acids selected from 1 to 13, 137 to 159, and in some cases -1 to -24 of Figure 4.
  • the genomic streptavidin molecules of the subject invention also include variants (including alleles) of the native protein sequence.
  • variants may result from natural polymorphisms or may be synthesized by recombinant DNA methodology, and differ from wild-type protein by one or more amino acid substitutions, insertions, deletions, or the like.
  • Variants generally have at least 75% nucleotide identity to native sequence, preferably at least 80%-85%, and most preferably at least 90% nucleotide identity.
  • amino acid substitutions will be conservative, i.e., substitution of amino acids within groups of polar, non-polar, aromatic, charged, etc. amino acids.
  • variants should preferably have at least 90% amino acid sequence identity, and within certain embodiments, greater than 92%, 95%, or 97% identity.
  • amino acid sequence identity may be determined by standard methodologies, including use of the National Center for Biotechnology Information BLAST search methodology available at www.ncbi.nlm.nih.gov. using default parameters. The identity methodologies most preferred are those described in U.S. Patent 5,691,179 and AXtsc uX et al, Nucleic Acids Res. 25:3389-3402, 1997.
  • nucleotide sequence and the encoded genomic streptavidin or variant thereof may differ from known native sequence, due to codon degeneracies, nucleotide polymorphisms, or amino acid differences.
  • variants will preferably hybridize to the native nucleotide sequence at conditions of normal stringency, which is approximately 25- 30°C below Tm of the native duplex (e.g., 5X SSPE, 0.5% SDS, 5X Denhardfs solution, 50% formamide, at 42°C or equivalent conditions; see generally, Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, 1989; Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing, 1995).
  • low stringency hybridizations utilize conditions approximately 40°C below Tm
  • high stringency hybridizations utilize conditions approximately 10°C below Tm.
  • polypeptide refers to a series of amino acids of five or more.
  • isolated nucleic acid molecule refers to a polynucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid construct, that has been separated from its source cell (including the chromosome it normally resides in) at least once, and preferably in a substantially pure form.
  • Nucleic acid molecules may be comprised of a wide variety of nucleotides, including DNA, RNA, nucleotide analogues, or combination thereof.
  • heterologous nucleic acid sequence refers to at least one structural gene operably associated with a regulatory sequence such as a promoter.
  • the nucleic acid sequence originates in a foreign species, or, in the same species if substantially modified from its original form.
  • heterologous nucleic acid sequence includes a nucleic acid originating in the same species, where such sequence is operably associated with a promoter that differs from the natural or wild-type promoter.
  • an "antibody,” as used herein, includes both polyclonal and monoclonal antibodies; primatized (e.g., humanized); murine; mouse-human; mouse-primate; and chimeric; and may be an intact molecule, a fragment thereof (such as scFv, Fv, Fd, Fab, Fab' and F(ab)' 2 fragments), or multimers or aggregates of intact molecules and/or fragments; and may occur in nature or be produced, e.g., by immunization, synthesis or genetic engineering; an "antibody fragment,” as used herein, refers to fragments, derived from or related to an antibody, which bind antigen and which in some embodiments may be derivatized to exhibit structural features that facilitate clearance and uptake, e.g., by the incorporation of galactose residues. This includes, e.g., F(ab), F(ab)' 2 , scFv, light chain variable region (V L ), heavy chain variable region (
  • protein includes proteins, polypeptides and peptides; and may be an intact molecule, a fragment thereof, or multimers or aggregates of intact molecules and/or fragments; and may occur in nature or be produced, e.g., by synthesis (including chemical and/or enzymatic) or genetic engineering.
  • streptavidin fusion constructs that include streptavidin nucleic acid molecules of various lengths, which, in certain embodiments, are constructed from full-length genomic streptavidin nucleic acid molecules available in the art and specifically described in U.S. Patent Nos. 4,839,293;
  • Variants of streptavidin nucleic acid molecules may be engineered from natural variants (e.g., polymorphisms, splice variants, mutants), synthesized or constructed. Many methods have been developed for generating mutants (see, generally, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989, and Ausubel, et al Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Interscience, New York, 1995). Briefly, preferred methods for generating nucleotide substitutions utilize an oligonucleotide that spans the base or bases to be mutated and contains the mutated base or bases.
  • the oligonucleotide is hybridized to complementary single stranded nucleic acid and second strand synthesis is primed from the oligonucleotide.
  • the double-stranded nucleic acid is prepared for transformation into host cells, typically E coli, but alternatively, other prokaryotes, yeast or other eukaryotes. Standard methods of screening and isolation and sequencing of DNA were used to identify mutant sequences.
  • deletions and/or insertions of the streptavidin nucleic acid molecule may be constructed by any of a variety of known methods as discussed, supra.
  • the nucleic acid molecule can be digested with restriction enzymes and religated, thereby deleting or religating a sequence with additional sequences (e.g. , linkers), such that an insertion or large substitution is made.
  • additional sequences e.g. , linkers
  • Other means of generating variant sequences may be employed using methods known in the art, for example those described in Sambrook et al, supra; Ausubel et al, supra. Verification of variant sequences is typically accomplished by restriction enzyme mapping, sequence analysis, or probe hybridization.
  • variants of streptavidin nucleic acid molecules whose encoded product is capable of binding biotin are useful in the context of the subject invention.
  • the ability of the variant streptavidin to bind biotin may be increased, decreased or substantially similar to that of native streptavidin.
  • the ability to bind biotin is not required, provided that the variant form retains the ability to self-assemble into a typical tetrameric structure similar to that of native streptavidin.
  • Such tetrameric structures have a variety of uses such as the formation of tetravalent antibodies when fused to sequences encoding an antibody or fragment thereof.
  • a genomic streptavidin fusion construct expression cassette of the present invention may be generated by utilizing the full gene sequence of the streptavidin gene, or variant thereof.
  • the expression cassette contains a nucleic acid sequence encoding at least 129 contiguous amino acids of Figure 4 or functional variants thereof.
  • the nucleic acid sequence encodes at least amino acid residues 14 to 140 of Figure 4.
  • the nucleic acid sequence encodes at least amino acids 14 to 150, 14 to 151, 14 to 152, 14 to 153, 14 to 154, 14 to 155, 14 to 156, 14 to 157, 14 to 158, or 14 to 159 of streptavidin, Figure 4.
  • the nucleic acid sequence encodes at least amino acids 10 to 150-158 of Figure 4, or 5 to 150-158 of Figure 4 or 1 to 150-158 of Figure 4. In yet other embodiments, the nucleic acid sequence encodes at least amino acid residues 1 to 159 of Figure 4. In still yet other embodiments, the expression cassette comprises a nucleic acid sequence that encodes at least 10 amino acids of residues -1 to -24 of Figure 4.
  • the genomic streptavidin encoding nucleic acid molecules of the subject invention may be constructed from available streptavidin sequences by a variety of methods known in the art.
  • a preferred method is amplification (e.g., polymerase chain reaction (PCR)) to selectively amplify the individual regions and place these in cloning vectors such as pCR2.1 (Invitrogen).
  • PCR reactions can be performed in a variety of ways such that the primers used for amplification contain specific restriction endonuclease sites to facilitate insertion into a vector.
  • PCR a variety of other methodologies besides PCR may be used to attain the desired construct.
  • one skilled in the art may employ isothermal methods to amplify the nucleotide sequence of interest, using existing restriction endonuclease sites present in the nucleotide sequence to excise and insert sequences, or by the introduction of distinct restriction endonuclease sites by site-directed mutagenesis followed by excision and insertion. These and other methods are described in Sambrook et al, supra; Ausubel, et al, supra.
  • one methodology is to generate single-stranded streptavidin encoding DNA, followed by annealing a primer, which is complementary except for the desired alteration (e.g., a small insertion, deletion, or mutation such that a unique restriction site is created between the domains).
  • Bacterial cells are transformed and screened for those cells which contain the desired construct. This construct is then digested to liberate the desired sequences, which can then be purified and religated into the appropriate orientation.
  • genomic streptavidin is only a secondary consideration when designing an expression cassette, as compared to utilizing a form which is capable of binding biotin and capable of expressing into the periplasmic space of a bacterial host.
  • Such constructs can be readily tested for their ability to bind biotin and maintain solubility in the periplasmic space by assays known in the art and those described herein. Accordingly, experiments such as, measuring biotin binding capacity and biotin dissociation rate are well known in the art and applicable in this regard.
  • such constructs can be tested for their ability to bind biotin by a variety of means, including labeling the fusion protein with a subsaturating level of radiolabeled biotin, then adding a 100-fold saturating level of biocytin to initiate dissociation.
  • the free radiolabeled biotin is measured at timed intervals.
  • the expression cassette of the present invention need not necessarily contain a promoter, but upon insertion into a vector system the sequence contained within the cassette must be capable of being expressed once associated with a promoter or other regulatory sequences.
  • the expression cassette itself comprises a promoter.
  • the cassette preferably contains a cloning site for the insertion of a heterologous nucleic acid sequence to be fused/linked to the genomic streptavidin encoding sequence.
  • a cassette is set forth in Figure 1. However, it should be noted that the cloning site need not be 5' of the genomic streptavidin sequence, but could be placed 3' of the streptavidin sequence.
  • an encoded fusion protein could contain the genomic streptavidin polypeptide either N- or C- terminal to the encoded polypeptide fused thereto.
  • the sequence encodes an antibody fragment, and in certain embodiments a single chain antibody (scFv).
  • the cassette may include a linker molecule.
  • Linker molecules are typically utilized within the context of fusion proteins and are well known in the art. As exemplified in Figure 2, linkers are typically utilized to separate the genomic streptavidin sequence from the other sequences linked thereto and to separate the V H and the V L of the scFv.
  • the linking sequence can encode a short peptide or can encode a longer polypeptide.
  • Preferable linker sequences encode at least two amino acids, but may encode as many amino acids as desired as long as functional activity is retained. In the various embodiments, the linker sequence encodes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 35 amino acids.
  • an encoded linker may be a standard linker such as (Gly 4 Ser) x where x may be any integer, but is preferably 1 to 10.
  • the length and composition can be empirically determined to give the optimum expression and biochemical characteristics. For example, the composition of the linker can be changed to raise or lower the isoelectric point of the molecule.
  • the length of linker between variable light and heavy chains need be at least long enough to facilitate association between the two domains, while the linker between streptavidin and the antibody fragment may vary from zero amino acids to 100 or more as long as functionality is maintained.
  • the linker between the light and heavy chain is typically greater than five amino acids, and preferably greater than ten, and more preferably greater than fifteen amino acids in length.
  • the expression cassette may be used in a vector to direct expression in a variety of host organisms.
  • the genomic streptavidin expressed gene fusion is produced in bacteria, such as E. coli, or mammalian cells (e.g., CHO and COS-7), for which many expression vectors have been developed and are available.
  • Other suitable host organisms include other bacterial species, and eukaryotes, such as yeast (e.g., Saccharomyces cerevisiae), plants, and insect cells (e.g., Sf9).
  • a DNA sequence encoding a genomic streptavidin fusion protein is introduced into an expression vector appropriate for the host cell.
  • the sequence may contain alternative codons for each amino acid with multiple codons.
  • the alternative codons can be chosen as "optimal" for the host species.
  • Restriction sites are typically incorporated into the primer sequences and are chosen with regard to the cloning site of the vector. If necessary, translational initiation and termination codons can be engineered into the primer sequences.
  • the vector will contain a promoter sequence.
  • a "promoter” refers to a nucleotide sequence that contains elements that direct the transcription of a linked gene.
  • a promoter contains an RNA polymerase binding site. More typically, in eukaryotes, promoter sequences contain binding sites for other transcriptional factors that control the rate and timing of gene expression. Such sites include TATA box, CAAT box, POU box, API binding site, and the like. Promoter regions may also contain enhancer elements. When a promoter is linked to a gene so as to enable transcription of the gene, it is "operatively linked.”
  • the expression vectors used herein include a promoter designed for expression of the proteins in a host cell (e.g., bacterial). Suitable promoters are widely available and are well known in the art. Inducible or constitutive promoters are preferred. Such promoters for expression in bacteria include promoters from the T7 phage and other phages, such as T3, T5, and SP6, and the trp, Ipp, and lac operons. Hybrid promoters (see, U.S. Patent No. 4,551,433), such as tac and trc, may also be used.
  • Promoters for expression in eukaryotic cells include the PI 0 or polyhedron gene promoter of baculovirus/insect cell expression systems (see, e.g., U.S. Patent Nos. 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784), MMTV LTR, CMV IE promoter, RSV LTR, SV40, metallothionein promoter (see, e.g., U.S. Patent No. 4,870,009), ecdysone response element system, tetracycline-reversible silencing system (tet-on, tet-off), and the like.
  • the promoter controlling transcription of the genomic streptavidin fusion construct may itself be controlled by a repressor.
  • the promoter can be derepressed by altering the physiological conditions of the cell, for example, by the addition of a molecule that competitively binds the repressor, or by altering the temperature of the growth media.
  • Preferred repressor proteins include, the E. coli lad repressor responsive to IPTG induction, the temperature sensitive ⁇ cI857 repressor, and the like.
  • Other regulatory sequences may be included. Such sequences include a transcription termination sequence, secretion signal sequence (e.g., nucleotides 480-551 of Figure 2B of U.S. Patent No.
  • the regulatory sequences are operationally associated with one another to allow transcription, translation, or to facilitate secretion.
  • the regulatory sequences of the present invention also include the upstream region of the streptavidin gene as described in U.S. Patent No. 5,272,254 (e.g., nucleic acid residues 174-551 depicted in Figures 2A-2B of U.S. Pat. No. 5,272,254). Accordingly, an upstream sequence of 100 to 300 base pairs may be utilized in expression constructs to facilitate secretion and/or expression. Such an upstream untranslated region is depicted in U.S. Patent No. 5,272,254 Figures 2A and 2B as nucleotides 174-479. In preferred embodiments nucleic acid residues 408-479 of those described above are utilized in the expression construct.
  • the vector also includes a transcription termination sequence.
  • a "transcription terminator region” has either a sequence that provides a signal that terminates transcription by the polymerase that recognizes the selected promoter and/or a signal sequence for polyadenylation.
  • the vector is capable of replication in the host cells.
  • the vector when the host cell is a bacterium, the vector preferably contains a bacterial origin of replication.
  • Bacterial origins of replication include the fl-ori and col ⁇ l origins of replication, especially the ori derived from pUC plasmids. In yeast, ARS or C ⁇ N sequences can be used to assure replication.
  • a well-used system in mammalian cells is
  • the plasmids also preferably include at least one selectable marker that is functional in the host.
  • a selectable marker gene includes any gene that confers a phenotype on the host that allows transformed cells to be identified and selectively grown.
  • Suitable selectable marker genes for bacterial hosts include the ampicillin resistance gene (Amp 1 ), tetracycline resistance gene (Tc 1" ) and the kanamycin resistance gene (Kan 1 ). The ampicillin resistance and kanamycin resistance genes are presently preferred.
  • Suitable markers for eukaryotes usually require a complementary deficiency in the host (e.g., thymidine kinase (tk) in tk- hosts). However, drug markers are also available (e.g., G418 resistance and hygromycin resistance).
  • the nucleotide sequence encoding the genomic streptavidin fusion protein may also include a secretion signal (e.g., a portion of the leader sequence, the leader sequence being the upstream region of a gene including a portion of a secretion signal), whereby the resulting peptide is a precursor protein processed and secreted.
  • the resulting processed protein may be recovered from the periplasmic space or the fermentation medium.
  • Secretion signals suitable for use are widely available and are well known in the art (von Heijne, J. Mol. Biol. 754:99-105, 1985; von Heijne, Eur. J. Biochem. 753:17-21, 1983). Prokaryotic and eukaryotic secretion signals that are functional in E.
  • the presently preferred secretion signals include, but are not limited to, those encoded by the following bacterial genes: streptavidin, pelB (Lei et al, J. Bacteriol 169:4379, 1987), phoA, ompA, ompT, ompF, ompC, beta-lactamase, and alkaline phosphatase.
  • components which increase expression may also be included either within the vector directing expression of the streptavidin fusion or on a separate vector.
  • Such components include, for example, bacterial chaperone proteins such as SicA, Gro ⁇ L, Gro ⁇ , DnaK, CesT, SecB, FkpA, SkpA, etc.
  • Vectors which are suitable for expression in bacterial cells and which are readily obtainable.
  • Vectors such as the p ⁇ T series (Novagen, Madison, Wisconsin), the tac and trc series (Pharmacia, Uppsala, Sweden), pTTQ18 (Amersham International pic, England), pACYC 177, pGEX series, and the like are suitable for expression of a genomic streptavidin fusion protein.
  • the choice of a host for the expression of a genomic streptavidin fusion protein is dictated in part by the vector.
  • Commercially available vectors are paired with suitable hosts.
  • a wide variety of suitable vectors for expression in eukaryotic cells are also available.
  • Such vectors include pCMVLacI, pXTl (Stratagene Cloning Systems, La Jolla, California); pCDNA series, pREP series, pEBVHis, pDisplay (Invitrogen, Carlsbad, California).
  • the genomic streptavidin fusion protein encoding nucleic acid molecule is cloned into a gene targeting vector, such as pMClneo, a pOG series vector (Stratagene Cloning Systems).
  • preferred host cells include, by way of example, bacteria such as Escherichia coli; mammalian cells such as Chinese Hamster Ovary
  • CHO cells COS cells, myeloma cells; yeast cells such as Saccharomyces cerevisiae; insect cells such as Spodoptera frugiperda; plant cells such as maize, among other host cells.
  • Insect cells are capable of high expression of recombinant proteins.
  • baculovirus vectors such as pBlueBac (see, e.g., U.S. Patent Nos. 5,278,050, 5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051 and 5,169,784; available from Invitrogen, San Diego, California) may be used for expression in insect cells, such as Spodoptera frugiperda Sf9 cells (see, U.S. Patent No. 4,745,051).
  • Expression in insect cells or insects is preferably effected using a recombinant baculovirus vector capable of expressing heterologous proteins under the transcriptional control of a baculovirus polyhedrin promoter, (e.g., U.S. Patent No. 4,745,051 relating to baculovirus/insect cell expression system).
  • Polyhedrin is a highly expressed protein, therefore its promoter provides for efficient heterologous protein production.
  • the preferred baculovirus is Autographa californica (ACMNPV). Suitable baculovirus vectors are commercially available from Invitrogen.
  • the fusion construct of the present invention may be expressed in transgenic animals.
  • the genomic streptavidin containing expression cassette may be operatively linked to a promoter that is specifically activated in mammary tissue such as a milk-specific promoter. Such methods are described in U.S.
  • Patent No. 4,873,316 and U.S. Patent No. 5,304,498 The genomic streptavidin gene fusion may also be expressed in plants, e.g., transgenic plants, plant tissues, plant seeds and plant cells. Such methods are described, e.g., in U.S. Patent No. 5,202,422.
  • genomic streptavidin fusion protein is expressed as soluble protein into the periplasmic space of bacteria and undergoes spontaneous folding. Accordingly, such expression offers the advantage that the periplasm is a low biotin, oxidizing environment and produces a soluble, functional molecule. This avoids having to purify and refold the protein under harsh denaturing conditions, which may prove fatal to the polypeptide encoded by the heterologous nucleic acid molecule.
  • the genomic streptavidin expressed gene fusion may be isolated by a variety of methods known to those skilled in the art. However, preferably the purification method takes advantage of the presence of a functional streptavidin molecule, by utilizing its high affinity binding to aid in purification. Accordingly, preferred purification methods are by the use of iminobiotin immobilized on a solid surface.
  • genomic streptavidin expressed gene fusion molecules may be designed by the methods described herein, a particularly useful fusion protein is that of an antibody and genomic streptavidin, in particular an antibody-genomic streptavidin expressed gene fusion (Ab-SA).
  • the expression construct encodes an Fv or scFv portion of an antibody.
  • the construct encodes a Fab fragment or functional derivative thereof, to which streptavidin may be linked via a terminus of either the heavy chain portion or light chain portion of the molecule.
  • DNA encoding the Fv regions of interest may be prepared by any suitable method, including, for example, amplification techniques such as polymerase chain reaction from cDNA of a hybridoma, using degenerate oligonucleotides, ligase chain reaction (LCR) (see Wu and Wallace, Genomics, 4:560, 1989, Landegren et al, Science, 241:1077, 1988 and Barringer et al, Gene, 89:1 X7, 1990), transcription-based amplification (see Kwoh et al, Proc. Natl. Acad. Sci. USA, 86:1 X73, 1989), and self-sustained sequence replication (see Guatelli et al, Proc. Natl.
  • LCR ligase chain reaction
  • DNA encoding regions of interest may also be isolated from phage display libraries.
  • any number of binding pair members may be utilized and thus would not be limited to streptavidin/biotin binding.
  • antibody/epitope pairs or any ligand/anti-ligand pair may be utilized.
  • the present disclosure provides a general method for the preparation of tetravalent antibodies. Since the avidity of an antibody for its cognate antigen is generally a function of its valency, there are many applications in which a tetravalent antibody would be preferable to a divalent antibody. Such applications include, but are not limited to, immunoassays, immunotherapy, immunoaffinity chromatography, etc.
  • Chemical synthesis may also be utilized to produce a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. While it is possible to chemically synthesize an entire single chain Fv region, it is preferable to synthesize a number of shorter sequences (about 100 to 150 bases) that are later ligated together.
  • subsequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
  • variable light (V L ) and heavy chain (V H ) DNA the sequences may be ligated together, either directly or through a DNA sequence encoding a peptide linker, using techniques well known to those of skill in the art.
  • heavy and light chain regions are connected by a flexible polypeptide linker (e.g., (Gly 4 Ser) x , or the pKOD sequence, or others, provided, infra) which starts at the carboxyl end of the light chain Fv domain and ends at the amino terminus of the heavy chain Fv domain, or vice versa, as the order of the Fv domains can be either light-heavy or heavy-light.
  • the entire sequence encodes the Fv domain in the form of a single-chain antigen binding protein.
  • fusion proteins comprising that Fv region may be prepared by methods known to one of skill in the art.
  • the Fv region may be fused to genomic streptavidin directly in the expression cassette of the present invention or, alternatively, may be joined directly to genomic streptavidin through a peptide or polypeptide linker, thereby forming a linked product.
  • the linker may be present simply to provide space between the Fv and the fused genomic streptavidin or to facilitate mobility between these regions to enable them to each attain their optimum conformation.
  • the genomic streptavidin-antibody expression cassette typically, comprises a single vector which provides for the expression of both heavy and light variable sequences fused by an appropriate linker as well as a linker fusing the light and heavy chains with genomic streptavidin, thereby encoding a single chain antibody: genomic streptavidin (scFvSA) conjugate.
  • the linker connecting the variable light and heavy chains is of sufficient length or side group selection to allow for flexibility.
  • the linker is a standard linker such as (Gly 4 Ser) x , described supra, while in another embodiment the linker is the pKOD linker (GlyLeuGluGlySerProGluAlaGlyLeuSerProAspAlaGlySerGlySer) (SEQ ID NO: 9). It should be understood that a variety of linkers may be used, but in some embodiments it may be preferred that the linker separating the light and heavy antibody chains should allow flexibility and the linker attaching the scFv to the genomic streptavidin sequence can be fairly rigid or fairly flexible.
  • linkers in addition to linkers, additional amino acids may be encoded by the addition of restriction sites to facilitate linker insertion and related recombinant DNA manipulation, as such these amino acids while not necessarily intended to be linkers may or may not be included within the constructs described herein, depending on the construction method utilized.
  • linkers are known by those of skill in the art.
  • Fv portions of the heavy and light chain of antibodies held together by a polypeptide linker can have the same binding properties as their full length two chain counterparts (Bird et al, Science, 242:423-26, 1988 and Huston et al, Proc. Natl. Acad. Sci. USA, 55:5879-83, 1988).
  • fusion proteins composed of single chain antibodies linked to toxins may retain the binding capacity of the single chain antibody as well as the activity of the toxin (Chaudary et al, Nature, 339: 394-97, 1989; Batra et al, J. Biol.
  • the DNA sequence comprising the linker may also provide sequences, such as primer sites or restriction sites, to facilitate cloning or may preserve the reading frame between the sequence encoding the scFv and the sequence encoding genomic streptavidin.
  • sequences such as primer sites or restriction sites, to facilitate cloning or may preserve the reading frame between the sequence encoding the scFv and the sequence encoding genomic streptavidin.
  • the design of such linkers is well known to those of skill in the art.
  • this ligand antigen may be a cell surface antigen, cell- associated stromal or matrix antigen, or cell-secreted antigens, including, but not limited to, CD19, CD20, CD22, CD25, CD33, CD45, CD52, CD56, CD57, EGP40 (or EPCAM or KSA), NCAM, CEA, TAG-72, a mucin (MUC-1 through MUC-7), ⁇ -HCG, EGF receptor and variants thereof, IL-2 receptor, her2/neu, Lewis y, GD2, GM2, Lewis x, folate receptor, fibroblast activation protein, tenascin, sialylated tenascin, somatostatin, activated tumor stromal antigen, or a neoangiogenic antigen.
  • methods for evaluating the ability include, but not limited to, CD19, CD20, CD22, CD25, CD33, CD45, CD52, CD56, CD57, EGP40 (or EPCAM or KSA),
  • scFv fragments of antibodies are useful as tools in methods for medical diagnostic and therapeutic purposes.
  • a diagnostic or therapeutic method is described for detecting the presence or absence of, or treating, a target site within a mammalian host.
  • One method for reducing non-target tissue exposure to a diagnostic or therapeutic agent involves "pretargeting" the targeting moiety (e.g., scFvSA) to a target site, and then subsequently administering a rapidly clearing diagnostic or therapeutic agent conjugate that is capable of binding to the "pretargeted" targeting moiety at the target site.
  • an optional intermediate step may involve administration of a clearing agent to aid in the efficient removal of the unbound targeting moiety conjugate from the circulation prior to administration of the active agent conjugate.
  • a clearing agent to aid in the efficient removal of the unbound targeting moiety conjugate from the circulation prior to administration of the active agent conjugate.
  • scFvSA is a conjugate (fusion) of the targeting moiety (scFv) and ligand (streptavidin).
  • the active agent is administered as a conjugate to the member of the ligand/anti-ligand pair that is complementary to that of the targeting conjugate (e.g., biotin would be the complementary member in the exemplified embodiment).
  • the agent-ligand or agent-anti-ligand has a short serum half life and is excreted via the renal pathway. In this manner, the therapeutic agent either accretes to the target site where exertion of its therapeutic or diagnostic capability is desired, or it is rapidly removed from the recipient.
  • the targeting moiety will comprise an antibody fusion of the present invention specific for a particular antigen associated with the target cells of interest.
  • the antigen marker may be associated with a cancer, including, but not limited to, the following: lymphoma (e.g., CD20); leukemia (e.g., CD45); prostate (e.g., TAG-72); ovarian (e.g., TAG-72); breast (e.g., MUC-1); colon (e.g., CEA); and pancreatic (e.g., TAG-72).
  • lymphoma e.g., CD20
  • leukemia e.g., CD45
  • prostate e.g., TAG-72
  • ovarian e.g., TAG-72
  • breast e.g., MUC-1
  • colon e.g., CEA
  • pancreatic e.g., TAG-72
  • the CD20 antigen may be targeted for the treatment of lymphoma wherein the ligand/anti-ligand binding pair may be biotin avidin (e.g., streptavidin-gene fusion (scFvSA)), and the active agent will be a radionuclide in pretargeting methods.
  • biotin avidin e.g., streptavidin-gene fusion (scFvSA)
  • the active agent will be a radionuclide in pretargeting methods.
  • a variety of antigens may be targeted, such as CD45 antigen targeting for pretargeted radioimmunotherapy (PRIT) to treat patients having any one of a broad range of hematologic malignancies by employing antibody-mediated targeting to the CD45 antigen.
  • PTT pretargeted radioimmunotherapy
  • CD45 is the most broadly expressed of the known hematopoietic antigens, found on essentially all white blood cells and their precursors, including neutrophils, monocytes and macrophages, all lymphocytes, myeloid and lymphoid precursors, and about 90%) of acute myelogenous leukemia (AML) cells. Accordingly, as the antigens available for targeting for diagnostic or therapeutic purposes are numerous, the present invention may be used to facilitate targeting to any of these antigens.
  • An optional step in pretarget methods comprises the initial administration of a non-conjugated targeting moiety (i. e., not conjugated to a ligand or anti-ligand) or, alternatively, administering this non- conjugated targeting moiety concurrently with the conjugated form in the first step, thus blocking those targets contacted initially.
  • a non-conjugated targeting moiety i. e., not conjugated to a ligand or anti-ligand
  • administering this non- conjugated targeting moiety concurrently with the conjugated form in the first step, thus blocking those targets contacted initially.
  • Such blocking may be especially useful, for example, in the treatment of non-Hodgkin's lymphoma, where the first set of targeted tissues may be the spleen, while most tumors are found in the deep lymph nodes.
  • Such pre-blocking allows for substantial protection of the spleen cells from later treatment with the active agent. While the non-conjugated targeting agent need not necessarily bind the same epitope, to be effective it
  • U.S. Patent No. 4,867,962 issued to Abrams describes such an improved method for delivering active agent to target sites, which method employs active agent-targeting moiety conjugates.
  • the Abrams method contemplates administration to a recipient two or more active agent-targeting moiety conjugates, wherein each conjugate includes a different antibody species as the targeting moiety.
  • Each of the utilized antibody species is reactive with a different target site epitope (associated with the same, or a different, target site antigen), while the patterns of cross-reactivity of the antibody species with non-target tissues are non- overlapping.
  • the different antibodies accumulate additively at the desired target site, while fewer than the total species accumulate at any type of non-target tissue.
  • a higher percentage of the administered agent therefore, becomes localized in vivo at target sites than at non-target tissues.
  • the present invention encompasses approaches similar to this, as well as in pretargeting formats.
  • two or more species of targeting conjugates (fusion) with antibodies directed to different epitopes and having non-overlapping cross-reactivity, each prepared according to the present invention are administered according to the pretarget method so as to improve the diagnostic or therapeutic utility.
  • a further embodiment utilizes the property that streptavidin monomers naturally associate to form tetramers.
  • two or more antibodies each conjugated (fusion) to the monomeric form of streptavidin are selectively combined and, upon formation of tetrameric streptavidin, yield single species with specificity for multiple epitopes at the target site.
  • the methods described may be modified and still achieve the desired effect.
  • two antibodies specific for the same antigen or cell type regardless of their respective cross-reactivity, may be used. All that is necessary for these methods is that the targeting moiety-ligand anti-ligand conjugate preferentially binds the target cells and that the active agent-conjugate substantially localizes to the pretargeted cells and is otherwise substantially cleared from circulation.
  • antibody-based or non-antibody-based targeting moieties may be employed to deliver a ligand/anti-ligand to a target site bearing an unregulated antigen.
  • a natural binding agent for such an unregulated antigen is used for this purpose.
  • Pretarget methods as described herein optionally include the administration of a clearing agent.
  • the dosage of the clearing agent is an amount which is sufficient to substantially clear the previously administered targeting moiety- ligand/anti-ligand conjugate from the circulation.
  • the determination of when to administer the clearing agent depends on the target uptake and endogenous clearance of the targeting moiety conjugate.
  • Particularly preferred clearing agents are those which provide for Ashwell receptor-mediated clearance, such as galactosylated proteins, e.g., galactosylated biotinylated human serum albumin, and small molecule clearing agents containing N-acetylgalactosamine and biotin.
  • Types of active agents (diagnostic or therapeutic) useful herein include radionuclides, toxins, anti-tumor agents, drugs, genes, and cytokines.
  • conjugates of such agents to biotin may be useful in the pretargeting approach.
  • a therapeutic antibody e.g., an antibody that induces apoptosis or inhibits angiogenesis
  • pretargeting e.g., an antibody that induces apoptosis or inhibits angiogenesis
  • diagnostic agent fusions in contrast to therapeutic agent fusions, enhanced target cell internalization is disadvantageous if one administers diagnostic agent-targeting moiety conjugates. Internalization of diagnostic conjugates results in cellular catabolism and degradation of the conjugate. Upon degradation, small adducts of the diagnostic agent or the diagnostic agent per se may be released from the cell, thus eliminating the ability to detect the conjugate in a target-specific manner.
  • Radionuclides useful herein include radionuclides, drugs, anti-tumor agents, toxins, genes, and cytokines.
  • Radionuclides useful within the present invention include gamma-emitters, positron-emitters, Auger electron-emitters, X-ray emitters and fluorescence-emitters, with beta- or alpha-emitters preferred for therapeutic use.
  • Radionuclides are well-known in the art and include 123 I, I25 I, 130 I, 131 I, ,33 I, ,35 I, 47 Sc, 72 As, 72 Se, 90 Y, 88 Y, 97 Ru, 100 Pd, 101m Rh, 119 Sb, 128 Ba, 197 Hg, 2U At, 212 Bi, 153 Sm, 169 Eu, 212 Pb, ,09 Pd, In, 67 Ga, 68 Ga, ⁇ Cu, 67 Cu, 75 Br, 76 Br, 77 Br, 99m Tc, ⁇ C, ,3 N, 15 O, 166 Ho and 18 F.
  • Preferred therapeutic radionuclides include ,88 Re, 186 Re, 203 Pb, 212 Bi, 213 Bi, ,09 Pd, 64 Cu, 67 Cu, 90 Y, 125 I, ,31 1, 77 Br, 2U At, 97 Ru, 105 Rh, ,98 Au and 199 Ag, 166 Ho or 177 Lu.
  • streptavidin gene fusions may be utilized in combination therapies, such as when "pretargeting" is combined with the use of radiation-sensitizing agents.
  • radiation sensitizing agents include, but are not limited to, gemcitabine, 5-fluorouracil, paclitaxel, and the like.
  • potent toxins useful within the present invention consist of an A and a B chain.
  • the A chain is the cytotoxic portion and the B chain is the receptor-binding portion of the intact toxin molecule (holotoxin).
  • toxin B chain may mediate non-target cell binding, it is often advantageous to conjugate only the toxin A chain to a targeting moiety (e.g., molecule).
  • a targeting moiety e.g., molecule
  • elimination of the toxin B chain decreases non-specific cytotoxicity, it also generally leads to decreased potency of the conjugated toxin A chain, as compared to the conjugate of the corresponding holotoxin.
  • Preferred toxins in this regard include holotoxins, such as abrin, ricin, modeccin, Pseudomonas exotoxin A, Diphtheria toxin, pertussis toxin, Shiga toxin, and bryototoxin; and A chain or "A chain-like" molecules, such as ricin A chain, abrin A chain, modeccin A chain, the enzymatic portion of Pseudomonas exotoxin A, Diphtheria toxin A chain, the enzymatic portion of pertussis toxin, the enzymatic portion of Shiga toxin, gelonin, pokeweed antiviral protein, saporin, tritin, barley toxin and snake venom peptides.
  • holotoxins such as abrin, ricin, modeccin, Pseudomonas exotoxin A, Diphtheria toxin, pertussis toxin, Shig
  • Ribosomal inactivating proteins are also suitable for use herein.
  • Highly toxic toxins such as palytoxin and the like, are also contemplated for use in the practice of the present invention.
  • therapeutic drugs may themselves facilitate internalization of the complex.
  • Therapeutic drugs administered as targeted conjugates, are also encompassed herein. Again, the goal is administration of the highest possible concentration of drug (to maximize exposure of target tissue), while remaining below the threshold of unacceptable normal organ toxicity (due to non-target tissue exposure). Unlike radioisotopes, however, therapeutic drugs need to be taken into a target cell to exert a cytotoxic effect. In the case of targeting moiety-therapeutic drug conjugates, it would be advantageous to combine the relative target specificity of a targeting moiety with a means for enhanced target cell internalization of the targeting moiety-drug conjugate.
  • Therapeutic drugs suitable for use herein include conventional chemo- therapeutics, such as vinblastine, doxorubicin, bleomycin, methotrexate, 5-fluorouracil, 6-thioguanine, cytarabine, cyclophosphamide and cis-platinum, as well as other conventional chemotherapeutics including those described in Cancer: Principles and Practice of Oncology, 2d ed., V.T. DeVita, Jr., S. Hellman, S.A. Rosenberg, J.B. Lippincott Co., Philadelphia, Pennsylvania, 1985, Chapter 14, and analogues of such drugs where the analogue has greater potency that the parent molecule.
  • Another drug within the present invention is a trichothecene.
  • Other preferred drugs suitable for use herein as a diagnostic or therapeutic active agent in the practice of the present invention include experimental drugs including those as described in NC7 Investigational Drugs, Pharmaceutical Data 1987, ⁇ IH Publication No. 88-2141, Revised November
  • anti-tumor agents e.g., agents active against proliferating cells
  • exemplary anti-tumor agents include pro-apoptotic antibodies, anti-angiogenic antibodies, cytokines, such as IL-2, tumor necrosis factor or the like, lectin inflammatory response promoters (selectins), such as L-selectin, E-selectin, P-selectin or the like, and similar molecules.
  • a therapeutic effective dosage is one that treats a patient by extending the survival time of the patient.
  • the therapy further treats the patient by arresting the tumor growth and, most preferably, the therapy further eradicates the tumor.
  • a single chain Fv/streptavidin (scFvSA) fusion protein is expressed from the genetic fusion of the single chain antibody of the variable regions (scFv) to the genomic streptavidin of Streptomyces avidinii.
  • the scFv gene consists of the variable regions of the light (V L ) and heavy (V H ) chains separated by a DNA linker sequence (e.g., Figure 2).
  • the streptavidin coding sequence is joined to the 3' terminus of the scFv gene, and the two genes are separated in-frame by a second DNA linker sequence.
  • the signal sequence from the streptavidin gene is fused at the 5' terminus of the scFvSA gene to direct expression to the E. coli periplasmic space.
  • the scFvSA gene is under control of the lac promoter, and the expressed fusion protein is extracted and purified from E. coli and forms a soluble tetramer of about 172,000 molecular
  • Plasmid pKK233-2 (Amersham Pharmacia Biotech, Piscataway, NJ) was digested with BamHI and Ncol to remove the trc promoter.
  • the lac promoter was amplified from pBR322 by polymerase chain reaction (PCR) and cloned into the BamHIINcoI site of pKK233-2. In the process an EcoRI site was introduced immediately 5' to the Ncol site.
  • the plasmid was digested with Ncol and Pstl and ligated with oligonucleotides encoding the pelB leader sequence. The accepting Ncol site on the plasmid was not regenerated and a new Ncol site was introduced in the 3' area of the pelB encoding sequence.
  • pKK- lac/pelB The resulting plasmid was referred to as pKK- lac/pelB ( Figure 5).
  • pKK-lac/pelB and pUC18 were digested with Pvul and PvuII
  • the 2.9 kb fragment of pKK-lac/pelB containing the lac promoter and multi-cloning site was ligated to the 1.4 kb fragment of pUC18 containing the origin of replication to form plasmid pEX-1 ( Figure 6).
  • streptavidin and huNR-LU-10 scFv genes (a monoclonal antibody that binds the antigen EGP40 or EPCAM, epithelial glycoprotein, 40 kD) were cloned onto separate plasmids prior to construction of the huNR-LU-10 scFvSA gene.
  • the streptavidin gene, signal sequence and approximately 300 bp of upstream sequence were PCR-amplified from Streptomyces avidinii (ATCC 27419) genomic DNA and cloned into pEX-1 as an EcoRIIHindlll fragment to form pEX318 ( Figure 7).
  • the huNR-LU-10 scFv was derived from the humanized antibody plasmid pNRX451 (Graves et al, Clin. Cancer Res., 5:899-908, 1999).
  • the heavy and light chain variable regions were PCR-amplified separately from pNRX451 and then combined in a subsequent PCR.
  • Ohgonucleotides used in this process were designed to introduce a (Gly 4 Ser) 3 linker between the leading V L and the trailing V H .
  • the resulting PCR product was cloned into pEX-1 as a NcoIIHindlll fragment forming the plasmid pEX- scFv3.2.1 ( Figure 7).
  • the scFv and streptavidin genes were PCR-amplified from pEX- scFv3.2.1 and pEX318, respectively, and combined into a fusion, as illustrated in Figure 8.
  • the ohgonucleotides used in these reactions created an overlap between the 3' end of the leading scFv and the 5' end of the trailing streptavidin, which encoded a five amino acid linker (GSGSA).
  • the fragments were joined by PCR using the outside primers.
  • the resulting 1.25 kb fragment was cloned into the NJe7 and BamHI sites of vector pET3a (Novagen), generating pET3a-41B.
  • This plasmid was digested with Xhol and Hindlll, and the 1.3 kb fragment containing the V H -SA coding region and transcription terminator was ligated to a 4.6 kb XhoIIHindlll fragment of pEX- scFv3.2.1 containing the V L coding region, lac promoter, and ampicillin resistance gene (pYL256).
  • the streptavidin regulatory region and signal sequence were PCR-amplified from pEX318 and cloned into the EcoRII col sites of pYL256 to form pEX94B ( Figure 8).
  • the Tn5 kanamycin resistance gene (neo) was inserted into the huNR- LU-10 scFvSA expression plasmid pEX94B as follows ( Figure 9): plasmid pNEO (Amersham Pharmacia) was digested with BamHI, blunt-ended with nucleotides using Pfu polymerase (Stratagene, La Jolla, CA), then further digested with Hindlll. The 1494 bp fragment containing the kanamycin resistance gene was ligated to Hindlll/ Seal-digested pEX94B plasmid, generating plasmid pEX94Bneo. The DNA sequence of the 1.6 kb EcoRI to BamHI fragment of plasmids pEX94B and pEX94Bneo is shown in Figure 10.
  • scFvS A version of the anti-CD20 mAb, B9E9 was constructed in the V L V H orientation with either a (Gly 4 Ser) 3 (SEQ ID NO: 10)linker or a linker termed pKOD (amino acids GLEGSPEAGLSPDAGSGS) (SEQ ID NO: 9).
  • B9E9-1D3 hybridoma cells (1 X 10 7 )(from Bioprobe BV, Amstelveen, The Netherlands) were harvested, and total RNA was prepared.
  • the cDNAs for kappa chain and heavy chain of B9E9 were obtained by a reverse transcriptase reaction using primers RX207 and RX215, respectively.
  • PCR fragments of variable regions of kappa chain and heavy chain were obtained using above cDNAs and pairs of oligos (RX207 and NX54 for kappa chain; RX215 and NX50 for heavy chain).
  • the PCR fragments were digested with EcoRI and Not/ and subsequently cloned into a pPIC ⁇ A vector (Invitrogen, Sorrento Valley, CA), previously restricted with EcoRI and Not!
  • the resultant plasmids C58-1 and C58-16 carried B9E9 kappa chain and heavy chain, respectively.
  • the two chains were further cloned out from C58- 1 and C58-16 by PCR using pairs of oligos (RX468 and RX469 for kappa chain; RX470 and RX471 for heavy chain).
  • the kappa chain fragment was digested with Ncol and Bglll and the heavy chain was digested with Xhol-Sacl, respectively.
  • the kappa chain was cloned into pEX94B (Ncol-Bglll) as vector and heavy chain was cloned at Xhol-Sacl sites in pEX94B.
  • the resultant plasmids (C74-2 for kappa chain and C76-10 for heavy chain) were digested with Xhol and Hindlll. The small fragment from C76-10 was ligated into C74-2 vector restricted with the same enzymes.
  • a resultant plasmid (C87-14) carried B9E9 scFvSA fusion protein with a (G 4 S) 3 (SEQ ID NO: 10) linker between kappa chain and heavy chain.
  • the C87-14 was further digested with Bglll and Xhol and ligated with a pKOD linker prepared with two oligos (plnew5' and plnew3') to generate C 136-1.
  • Figures 11A and 11B illustrate the determined nucleic acid sequence and predicted amino acid sequence of B9E9pKOD scFvSA.
  • B9E9 scFvSA was constructed in the V H V L orientation with an extended 25mer (Gly 4 Ser) 5 (SEQ ID NO: 11) linker.
  • the Ncol-Sacl fragment of C87-14 containing scFv was further subcloned by PCR using a pair of primers (RX633 and RX471) to add a serine residue in the V L region.
  • the PCR fragment was digested with Ncol and Sad and cloned into the pEX94B vector restricted with Ncol and Sacl
  • the resultant plasmid D59-3 was subject to subcloning to generate the V H or V L fragments by PCR using RX781 and RX782 or RX729 and RX780, respectively.
  • the V H PCR fragment was digested with Ncol and Bglll and cloned into the pEX94B vector at the same sites to form D 142-6.
  • the V L PCR fragment was digested with Xhol and Sacl and cloned into the pEX94B vector at the same sites to form D 142-1.
  • a Xhol- Hindlll fragment from D 142-1 was isolated and replaced a Xhol-Hindlll fragment of D 142-6 to generate D 148-1 (V H -V L scFvSA).
  • the D 148-1 was also digested with Bglll and Xhol to remove the linker fragment and ligated with a 25mer linker (annealed with RX838 and RX839) to form E5-2-6.
  • oligonucleotide primers as listed below, were synthesized by Operon Technologies, Inc. (Alameda, CA).
  • NX50 (SEQ ID NO: 12) TGCCGTGAATTCGTSMARCTGCAGSARTCWGG
  • RX215 (SEQ ID NO: 15) TAGCTGGCGGCCGCTTTCTTGTCCACCTTGGTGC
  • RX468 (SEQ ID NO: 16) TTACGGCCATGGCTGACATCGTGCTGCAGTCTCCAGCAATCCTGTCT
  • RX469 (SEQ IDNO: 17) CACCAGAGATCTTCAGCTCCAGCTTGGTCCCA
  • RX470 (SEQ ID NO: 18)
  • RX471 (SEQ ID NO: 19) GAGCCAGAGCTCACGGTGACCGTGGTCCCTGCGCCCCA plnew5' (SEQ ID NO: 20) GATCTCTGGTCTGGAAGGCAGCCCGGAAGCAGGTCTGTCTCCGGACGCAGG TTCCGGC pInew3' (SEQ ID NO: 21)
  • RX633 (SEQ ID NO:22) TTACGGCCATGGCTGACATCGTGCTGTCGCAGTCTCCAGCAATCCTGTCT RX779 (SEQ IDNO: 23)
  • RX780 (SEQ ID NO: 24) GAGCCAGAGCTCTTCAGCTCCAGCTTGGTCCC
  • RX781 (SEQIDNO:25) TTACGGCCATGGCTCAGGTTCAGCTGGTCCAGTCA RX782 (SEQ ID NO: 26) AGACCAGAGATCTTGCTCACGGTGACCGTGGTCCC RX838 (SEQ ID NO: 27)
  • RX839 (SEQ ID NO: 28) TCGAGCCGCCGCCGCCCGACCCACCACC ACCCGAGCCGCCGCC ACCCGACC CACCACCGCCCGAGCCACCGCCACCAGA
  • Periplasmic extracts were prepared for qualitative analysis of the scFvSA expression level.
  • Cells were resuspended in an ice-cold solution of 20% sucrose, 2 mM EDTA, 30 mM Tris, (pH 8.0), and lysozyme (2.9 mg/ml) and were incubated on ice for 30 min.
  • Supernatants were analyzed on 4-20% Tris-glycine SDS-PAGE gels (Novex) under non-reducing, non-boiled conditions, and gels were stained with Coomassie Blue.
  • Expression in shake flasks was optimized by testing different environmental parameters, such as IPTG concentration and timing, temperature, media, or carbon source, or testing genetic factors, such as different promoters or signal sequences.
  • Clones were further grown in an 8L fermentor and analyzed for expression level.
  • the primary inoculum 50 ml was grown overnight at 30°C in shake flasks containing Terrific broth plus 50 ⁇ g/ml kanamycin (plasmids pEX94Bneo or E31-2-20) or carbenicillin (plasmids pEX94B or E5-2-6), depending on the selectable marker of the plasmid.
  • the culture was then diluted 100-fold into the same medium and grown at 30°C for an additional 4-5 h.
  • This secondary inoculum 0.5 liter was transferred to a 14 liter BioFlo 3000 fermentor (New Brunswick Scientific) containing
  • E. coli medium 8 liters of complete E. coli medium [per liter: 6 g Na j HPO,,, 3 g KH 2 PO 4 , 0.5 g NaCl, 3 g (NH 4 ) 2 SO 4 , 48 g yeast extract (Difco), 0.25 ml Mazu DF204 antifoam (PPG Industries).
  • the medium contained an initial 5 g/liter galactose as carbon source plus 50 ⁇ g/ml of kanamycin or carbenicillin for plasmid retention.
  • the culture was grown at 30°C and induced with IPTG (0.2 mM) at 6 h post-inoculation.
  • the pH was maintained at 7.0 by the automatic addition of either phosphoric acid or NaOH.
  • Dissolved oxygen concentration was maintained at or above 30% throughout the run using agitation speeds of 400-800 rpm and oxygen supplementation as necessary.
  • a galactose solution (50%) was fed over a 9 h period after exhaustion of the initial galactose present in the medium to a total of 20-25 g per liter.
  • Cells were harvested at 24-26 h post-inoculation (for B9 ⁇ 9 scFvSA) or 48-56 h post-inoculation (for huNR-LU-10 scFvSA) in a continuous flow centrifuge (Pilot Powerfuge, Carr Separations, Franklin, MA), washed with PBS (10 mM sodium phosphate, 150 mM NaCl, pH 7.2), and pelleted by centrifugation.
  • a typical fermentation produced 80-90 g of cells (wet wt) per liter culture medium.
  • Detection was using peroxidase- labeled goat anti-streptavidin polyclonal antibody (Zymed, So. San Francisco, CA) and ABTS (Sigma) substrate buffer. Plates were read at 415/490 nm with a dual wavelength automated plate reader. A first order, log x/log y regression analysis was performed for quantitation of the fusion protein.
  • a rhodamine-biotin HPLC assay was devised that provided faster results.
  • the fusion protein in centrifuged lysates was complexed with excess rhodamine-derivatized biotin, which was prepared as follows: 5-(and-6-)- carboxytetramethylrhodamine, succinimidyl ester (Molecular Probes, Eugene OR) was coupled to biocytin (Pierce, Rockford IL) through the formation of a stable amide bond.
  • reaction mixture was purified by HPLC using a Dynamax semi -preparative C-18 column (Rainin Instrument Co., Woburn, MA). The effluent was monitored at 547 nm and peak fractions collected and analyzed by mass spectrometry. Fractions corresponding in molecular weight to biocytin-rhodamine conjugate were pooled and concentrated by roto-evaporation (Buchii, Switzerland).
  • the molar extinction coefficient for the fusion protein standard was calculated using a previously described method summing the relative contributions of amino acids absorbing at 280 nm (Gill and von Hippel, Analyt. Chem. 182:3X9-326, 1989).
  • a number of genetic variants were constructed that contained linkers of different lengths and composition and the variable regions in different order (Table 1). These constructs were initially grown and induced in shake flask cultures and qualitatively assessed for expression by visualizing periplasmic proteins on Coomassie- stained, non-reducing, SDS gels. High-expressing constructs were further tested in an 8L fermentor using a galactose fed-batch protocol, and their expression levels were quantitatively determined by size exclusion HPLC using rhodamine-derivatized biotin. The construct that best fulfilled these criteria contained a 25-mer Gly 4 Ser linker with the scFv in the V H V L orientation.
  • Linker sequences 15 mer G4S: GGGGSGGGGSGGGGS (SEQ ID NO: 10)
  • G4S GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 11)
  • the E. coli fkpA gene is a member of the family of FK506-binding proteins (FKBPs) and is one of the periplasmic components involved in protein folding. It is expressed in the E. coli periplasm and has peptidyl-prolyl isomerase (PPIase) activity.
  • PPIase peptidyl-prolyl isomerase
  • the PPIase-independent chaperone activity of the FkpA gene product has also been demonstrated both in vivo and in vitro.
  • the FkpA chaperone protein is involved in a protein-folding process by stabilizing the folding intermediates in the periplasm. It was tested whether co-expression of the single chaperone gene (fkpA) was able to stimulate the expression of scFvS A fusion proteins, especially among those that had not previously expressed well in E. coli.
  • chromosomal DNA was extracted from E. coli XL 1 -Blue cells (Stratagene) and digested with Xhol. Thirty-five cycles of PCR were performed using a pair of ohgonucleotides (RX1229: ACGACGGTTGCTGCGGCGGTC (SEQ ID NO: 32); RX1231 : AGGCTCATTAAT GATGCGGGT (SEQ ID NO: 33); both obtained from Operon Technologies, Inc.) and 300 ng of the digested genomic DNA as a template.
  • the PCR mixture was subject to a second round of PCR (30 cycles) using a pair of nested ohgonucleotides (RX1230: GGATCCAAGCTTACGATCACGGTCATGAACACG (SEQ ID NO: 34); RX1232: CTCGAGAAGCTTTAACTAAATTAATACAGCGGA) (SEQ ID NO: 35).
  • the PCR fragments were resolved on a 1% agarose gel, and the 1.6-kb fragment was isolated.
  • the extracted DNA was cloned into the TA vector (Invitrogen), and the sequence was confirmed by DNA sequencing.
  • the clone was digested with Hindlll ⁇ using a site that was incorporated into ohgonucleotides RX1230 and RX 1232 and was ligated with H ⁇ II-digested vector E84-2-8 (NeoRx Corp.), harboring the anti-CEA T84.66 scFvSA fusion gene (T84.66 cDNA from City of Hope, Duarte, CA).
  • the resultant plasmid (FI 15-1-1) was used to transform XLl-Blue E. coli for shake-flask expression.
  • the periplasmic components were extracted and analyzed on 4-20% SDS-PAGE.
  • the iminobiotin affinity matrix was prepared by reacting epoxide- activated Macro-prep matrix (BioRad, Hercules CA) with 112 ⁇ m N-(3-amino-propyl)- 1,3 propane diamine (Sigma) per g of matrix in 0.2 M carbonate buffer. The reaction was stopped after 8 h by filtering the slurry through a scintered glass funnel and rinsing the matrix with distilled water. Residual epoxides were inactivated by reacting the matrix with 0.1 M sulfuric acid for 4 h at 80°C, and the matrix was again rinsed.
  • the amine-derivitized matrix was suspended in PBS, and the pH increased to 8.5 by the addition of 10%> volume of 0.5 M sodium borate, pH 8.5.
  • NHS-iminobiotin (Pierce) was dissolved in DMSO and added to the suspended matrix at a ratio of 2.6 mg/g of matrix.
  • the matrix was rinsed with distilled water followed by several alternating washes with pH 11 sodium carbonate buffer and pH 4 sodium acetate buffer and a final rinse with distilled water.
  • the matrix was stored as a slurry in 20% ethanol.
  • Cells (650-750 g, wet wt) were washed twice in PBS, resuspended to 10-
  • Capacity using recombinant streptavidin was 2 mg per ml of bed volume under a flow of 2 ml/cm 2 /min.
  • the 0.2 ⁇ m filtered cell homogenized supernatant was pumped at room temperature at 2 ml/cm 2 per min using 80 ml of bed volume per 100 g of cells.
  • the scFvSA fusion protein was eluted with 0.2 M sodium acetate, 0.1 M NaCl, pH 4.0, neutralized with
  • purified protein was concentrated using an Amicon YM30 membrane apparatus and filter-sterilized for aseptic storage at 4°C. At concentrations of 2-3 mg/ml, purified preparations typically contained ca. 5-8% aggregate.
  • Typical recoveries from iminobiotin chromatography were 50-60%> with less than 5%> appearing in the flow-through and wash. The residual remained as aggregate/entrapped material on the column. Addition of DMSO to the eluting buffer yielded ⁇ 5% additional purified protein. Use of a variety of ionic and nonionic detergents did not improve recoveries.
  • HPLC size exclusion analysis of the eluted fusion protein showed that up to 40% of the protein was in an aggregated form. Light scattering HPLC indicated aggregate sizes between 400,000 and 4 million. Treatment with 10%) DMSO for several hours resulted in the slow de-aggregation of the fusion protein, yielding >92% tetrameric species that remained so when stored refrigerated in
  • Size exclusion HPLC and Laser Light Scattering Analysis Purified protein preparations were analyzed by size exclusion HPLC performed on a Zorbax GF-250 column with a 20 mM sodium phosphate/0.5 M NaCl mobile phase. The molecular weight of the fusion construct was measured using this Zorbax system connected in series with a Varian Star 9040 refractive index detector and a MiniDawn light scattering instrument (Wyatt Technologies, Santa Barbara, CA). A dn/dc value of 0.185 for a protein in an aqueous buffer solution was used in the molecular weight calculations.
  • the mass spectrum of the B9E9 monomer showed a deconvoluted molecular weight of 43,401, which is in agreement with the calculated most abundant mass of 43 ,400.
  • HuNR-LU-10 Competitive Immunoreactivity ELISA Serial dilutions of the humanized NR-LU-10 whole antibody or the huNR-LU-10 fusion protein were allowed to compete with peroxidase-labeled murine NR-LU-10 whole antibody for binding to an 0.1 % NP40 membrane extract from the human carcinoma cell line, LS- 174 (ATCC #CL188). Following a log-logit transformation of the data in which curves were fit to the same slope, the concentration of competitor antibody that gave 50%> inhibition (k) was calculated. Percent immunoreactivity was determined according the formula: k (fusion protein standard)/k (whole antibody standard) x 100. The huNR- LU-10 fusion protein was found to possess immunoreactivity superior ( ⁇ 225%>) to the intact divalent humanized antibody ( Figure 14).
  • B9E9 Competitive Immunoreactivity FACS Assay. Immunoreactivity was assessed in a competitive binding assay using flow cytometry that measured the binding of fluorescein-labeled B9E9 to the CD20-positive Ramos cell line (Burkitt's lymphoma; ATCC CRL-1596) in the presence of various concentrations of unlabeled antibody. B9E9 mAb was labeled using fluorescein N-hydroxysuccinimidate, and an optimized amount of this conjugate was mixed with serial dilutions (3-200 ng/ml) of
  • B9E9 mAb standard or molar equivalents of B9E9 scFvSA incubated with 1 x 10 6 cells at 4°C for 30 minutes. Samples were washed and then analyzed on a single laser
  • FACSCalibur (Becton Dickinson). After gating on single cells, the geometric mean fluorescence intensity was determined from a histogram plot of fluorescence. The concentration of competitor antibody required for 50%> inhibition (IC 50 ) of fluorescein-
  • the scFvSA was about twice as immunoreactive (-—185%) as the divalent B9E9 antibody on a molar basis, and nearly equivalent ( ⁇ 93%>) to B9E9 mAb when adjusted for tetravalency (graph not shown).
  • B9E9 scFvSA Avidity was determined using saturation binding experiments that measure specific binding of radiolabeled mAb or fusion protein (0.025-50 ng/ml) at equilibrium in the presence of excess antigen (10 7 cells). Nonspecific binding was determined in the presence of excess cold mAb or fusion protein (50 ⁇ g/ml). Mixtures were incubated and centrifuged as described above. The equilibrium dissociation constant (Kd) was calculated from nonlinear regression analysis of nM bound vs. nM radioligand using immunoreactivity-adjusted antibody concentrations. The B9E9 fusion protein retained the same relative nanomolar avidity as the B9E9 mAb, as determined by radiolabeled binding to Ramos cells (Table 3).
  • HuNR-LU-10 scFvSA and B9E9 scFvSA were capable of binding an average of 3.0 and 3.6 biotins, respectively, as compared to 4 biotin binding sites for recombinant streptavidin.
  • the rate of DOTA-biotin dissociation was assessed at 37°C in 0.25 M phosphate, 0.15 M sodium chloride, pH 7.0 containing either 10 ⁇ M fusion protein or recombinant streptavidin and a subsaturating level of [ 90 Y]DOTA-biotin.
  • a 100-fold saturating level of biocytin (Sigma) was added to initiate the dissociation measurement. At timed intervals, aliquots of incubate were diluted in PBS containing 0.5% bovine serum albumin.
  • biotin dissociation was measured as described above, except [ 3 H]biotin was used instead of [ 90 Y]DOTA-biotin.
  • the calculated t 1/2 for biotin dissociation was 379 min for B9E9 scFvSA vs. 364 min for recombinant streptavidin (graph not shown).
  • HUNR-LU-I O SCFVSA The expressed huNR-LU-10 scFvSA gene fusion was tested in a full pretarget protocol in female nude mice bearing SW-1222 human colon cancer xenografts (100-200 mg), subcutaneously implanted on the right flank.
  • 575 ⁇ g of 125 I-labeled fusion protein was injected intravenous (iv) and allowed to circulate for 18 hours prior to iv injection of 100 ⁇ g of synthetic clearing agent (sCA) (See e.g., PCT Publication Nos. WO 97/46098 and WO 95/15978).
  • sCA synthetic clearing agent
  • the concentration of 125 I-huNR-LU-10 scFvSA radioactivity in blood and most well-perfused soft tissues was very low, due to the low blood pool concentration induced by the sCA complexation and subsequent hepatic clearance.
  • the exceptions were liver and tumor. Liver uptake and retention of fusion protein was due to the mechanism of clearing agent action, and the somewhat retarded degradation of the streptavidin-containing fusion protein, which was consistent with similar results observed in studies of both streptavidin and the chemical conjugate of huNR-LU-10 and streptavidin (huNR-LU-10/SA) (data not shown).
  • the 125 I-huNR-LU-10 scFvSA exhibited evidence of in vivo immunoreactivity by the retention of relatively high radiolabel concentration at the tumor (both stoichiometrically and relative to blood pool concentration) at all time points.
  • the ratio of tumor concentration to blood concentration continuously increased from 23 to 143 hours.
  • the lower blood pool values induced by clearing agent have led to a dramatic increase in the ratio, achieving average values over twice those observed in the absence of clearing agent (data not shown).
  • the pretargeted 1 H In-DOTA-biotin biodistribution is shown in Figure 16. Consistent with pretargeting results employing the chemical conjugate huNR-LU-10/SA, the concentration of ⁇ In-DOTA-biotin radioactivity in blood and all non-xenograft soft tissues was very low. Despite the high concentrations of fusion protein in the liver noted above, l u In-DOTA-biotin uptake and retention in this organ was not evident, indicating that the fusion protein had been efficiently internalized and was unavailable to bind the subsequently administered radiobiotin. The highest concentration of In-DOTA-biotin was at the tumor at all time points.
  • the tissues in order in Figure 16 are blood, tail, lung, liver, spleen, stomach, kidney, intestine, and tumor.
  • the rapid uptake, achieving peak concentrations at the earliest time point sampled, is a hallmark of pretargeting. Efficient, consistent delivery and retention of 1 H In-DOTA-biotin at the tumor was also observed. Peak concentrations of n 'In- DOTA-biotin at the tumor were within the range consistently achieved by use of the chemical NR-LU-10/SA conjugate (20-25 % injected dose/g) (data not shown).
  • mice Groups of three mice per time point were bled and sacrificed at 2, 24, and 48 hours after injection of l u In-DOTA-biotin. Whole organs and tissue were isolated, weighed, and counted for radioactivity using a gamma counter.
  • the In-DOTA-biotin radioactivity in blood and all non-xenograft soft tissues was below 2%> of the injected dose/g. Further, ⁇ ⁇ In- DOTA-biotin uptake and retention in liver is not seen, indicating that the fusion protein has been efficiently internalized by the liver, via the added clearing agent, and is unavailable to bind the subsequently administered radiobiotin. Stable delivery and retention of l u In-DOTA-biotin at the tumor were observed. The highest concentration of radiobiotin at all time points was at the tumor (both stoichiometrically and relative to blood pool concentration).
  • Peak concentrations of u l In-DOTA-biotin at the tumor were 17-24 % of injected dose/g (mean 21.66, s.d. 3.17). Tumor to blood ratios increased from about 90, 2 hours after DOTA-biotin injection, to greater than 700 by 24 hours. In these experiments no effort was made to optimize the dose of the fusion protein, clearing agent, or DOTA-biotin, nor was any effort made to optimize the schedule of administration of these components. (In Figure 18, the tissues in order are blood, tail, lung, liver, spleen, stomach, kidney, intestine, and tumor.)

Abstract

La présente invention concerne des vecteurs servant à exprimer des cassettes de fusion issues de la streptavidine génomique. Divers modes de réalisation de l'invention décrivent des protéines de fusion obtenues à partir de ces vecteurs. Des modes de réalisation particuliers décrivent des protéines de fusion comprenant un anticorps à chaîne unique et la streptavidine génomique, ainsi que des vecteurs codant lesdites protéines. L'invention concerne en outre des méthodes d'utilisation des protéines de fusion de l'invention et, notamment, l'utilisation de protéines de fusion scFvSA comme marqueurs de diagnostic ou comme agents de ciblage spécifiques à une cellule.
EP00941246A 1999-06-07 2000-06-05 Fusions de genes exprimees par la streptavidine et methodes pour les utiliser Withdrawn EP1190061A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US13790099P 1999-06-07 1999-06-07
US137900P 1999-06-07
US16897699P 1999-12-03 1999-12-03
US168976P 1999-12-03
PCT/US2000/015595 WO2000075333A1 (fr) 1999-06-07 2000-06-05 Fusions de genes exprimees par la streptavidine et methodes pour les utiliser

Publications (1)

Publication Number Publication Date
EP1190061A1 true EP1190061A1 (fr) 2002-03-27

Family

ID=26835691

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00941246A Withdrawn EP1190061A1 (fr) 1999-06-07 2000-06-05 Fusions de genes exprimees par la streptavidine et methodes pour les utiliser

Country Status (5)

Country Link
EP (1) EP1190061A1 (fr)
JP (1) JP2003501096A (fr)
AU (1) AU5597500A (fr)
CA (1) CA2376192A1 (fr)
WO (1) WO2000075333A1 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003047620A2 (fr) * 2001-12-07 2003-06-12 Virexx Research, Inc. Compositions et procedes de production d'occlusion vasculaire
KR101033196B1 (ko) * 2002-02-14 2011-05-09 이뮤노메딕스, 인코오포레이티드 항-ｃｄ20 항체 및 그 융합 단백질 및 이들의 이용방법
US20100069815A1 (en) * 2006-06-27 2010-03-18 Asahi Kasei Kabushiki Kaisha Substrate for biological fluid treatment
US8933202B2 (en) * 2007-11-12 2015-01-13 U3 Pharma Gmbh AXL antibodies
NO2399993T3 (fr) * 2009-02-20 2018-02-17
TWI526223B (zh) 2009-05-11 2016-03-21 Ｕ３製藥有限責任公司 人化ａｘｌ抗體類
DE102009047243A1 (de) 2009-11-27 2011-06-01 Orgentec Diagnostika Gmbh Monospezifische Polypeptidreagenzien
WO2022087154A1 (fr) * 2020-10-20 2022-04-28 Repertoire Immune Medicines, Inc. Multimères peptidiques de classe ii du cmh et leurs utilisations

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2624470B2 (ja) * 1984-10-02 1997-06-25 バイオジェン インコーポレイテッド ストレプトアビジン様ポリペプチドの製造
US4839293A (en) * 1986-02-24 1989-06-13 The Trustees Of Columbia University In The City Of New York DNA encoding streptavidin, streptavidin produced therefrom, fused polypeptides which include amino acid sequences present in streptavidin and uses thereof
CA2136178A1 (fr) * 1992-05-29 1993-12-09 Vasantha Nagarajan Production de straptavidine a partir bacillus subtilis
EP0646019B9 (fr) * 1992-06-09 2002-12-18 Neorx Corporation Biotine-DOTA conjugués et leur utilisation dans des procédés de préciblage
WO1995015770A1 (fr) * 1993-12-09 1995-06-15 Neorx Corporation Procedes et composes de preciblage
CA2237296C (fr) * 1995-11-16 2008-10-07 Boehringer Mannheim Gmbh Procede de preparation de peptides par l'intermediaire de proteines de fusion issues de la streptavidine
US6497881B1 (en) * 1995-11-30 2002-12-24 New York University High efficiency tissue specific compound delivery system using streptavidin-protein a fusion protein
US6451995B1 (en) * 1996-03-20 2002-09-17 Sloan-Kettering Institute For Cancer Research Single chain FV polynucleotide or peptide constructs of anti-ganglioside GD2 antibodies, cells expressing same and related methods

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0075333A1 *

Also Published As

Publication number Publication date
CA2376192A1 (fr) 2000-12-14
WO2000075333A9 (fr) 2002-06-20
AU5597500A (en) 2000-12-28
WO2000075333A1 (fr) 2000-12-14
JP2003501096A (ja) 2003-01-14

Similar Documents

Publication Publication Date Title
US7144991B2 (en) Streptavidin expressed gene fusions and methods of use thereof
EP1499630A2 (fr) Fusions de genes exprimees par la streptavidine et leurs procedes d'utilisation
US6083477A (en) Non-antigenic toxin-conjugate and fusion protein of internalizing receptor system
Schultz et al. A tetravalent single-chain antibody-streptavidin fusion protein for pretargeted lymphoma therapy
EP3231812B1 (fr) Exotoxine de pseudomonas ayant moins d'épitopes immunogènes de lymphocytes t et/ou de lymphocytes b
AU2006275865B2 (en) Mutated Pseudomonas exotoxins with reduced antigenicity
US10111927B2 (en) Pseudomonas exotoxin A with less immunogenic B cell epitopes
US5889157A (en) Humanized B3 antibody fragments, fusion proteins, and uses thereof
EP2178559B1 (fr) Exotoxines recombinantes de vibrio cholerae
TW413636B (en) A conjugate between a modified superantigen and a target-seeking compound and the use of the conjugate
Erlandsson et al. Identification of the antigenic epitopes in staphylococcal enterotoxins A and E and design of a superantigen for human cancer therapy
EP1071717A1 (fr) Molecules chimeres mutagenisees a base d'il-13
CN106432502B (zh) 用于治疗cea阳性表达肿瘤的双特异纳米抗体
JP2013136593A (ja) コンビナトリアルターゲティングを通じたプロトキシンの選択的活性化のための方法、組成物、およびキット
JP2003524587A (ja) 多発性骨髄腫を処置するための、ｃｄ３８に対する、遺伝子操作した抗体の使用
JP2010534486A (ja) 新規な組成物、方法および使用
Albrecht et al. Monospecific bivalent scFv-SH: effects of linker length and location of an engineered cysteine on production, antigen binding activity and free SH accessibility
CA2973538C (fr) Conjugues anticorps-urease pour des fins therapeutiques
Matthey et al. A new series of pET-derived vectors for high efficiency expression of Pseudomonas exotoxin-based fusion proteins
WO2000075333A1 (fr) Fusions de genes exprimees par la streptavidine et methodes pour les utiliser
Brinkmann et al. Recombinant immunotoxins containing the VH or VL domain of monoclonal antibody B3 fused to Pseudomonas exotoxin.
Goshorn et al. Preclinical evaluation of a humanized NR-LU-10 antibody-streptavidin fusion protein for pretargeted cancer therapy
Khoshnood et al. Bacteria-derived chimeric toxins as potential anticancer agents
US20030103948A1 (en) Streptavidin expressed gene fusions and methods of use thereof
Zhu et al. A new recombinant immunotoxin hscFv-ETA’demonstrates specific cytotoxicity against chronic myeloid leukemia cells in vitro

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020107

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RIC1 Information provided on ipc code assigned before grant

Free format text: 7C 12N 15/31 A, 7C 12N 15/13 B, 7C 12N 15/62 B, 7C 12N 15/72 B, 7C 12N 1/21 B, 7C 07K 14/36 B, 7C 07K 16/28 B, 7A 61K 39/395 B, 7A 61K 47/48 B

17Q First examination report despatched

Effective date: 20040130

D17P Request for examination filed (deleted)
GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070101