EP1144655A2 - Materiaux et methodes impliquant des domaines de retention conditionnelle - Google Patents

Materiaux et methodes impliquant des domaines de retention conditionnelle

Info

Publication number
EP1144655A2
EP1144655A2 EP99955001A EP99955001A EP1144655A2 EP 1144655 A2 EP1144655 A2 EP 1144655A2 EP 99955001 A EP99955001 A EP 99955001A EP 99955001 A EP99955001 A EP 99955001A EP 1144655 A2 EP1144655 A2 EP 1144655A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
cells
protein
recombinant nucleic
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99955001A
Other languages
German (de)
English (en)
Inventor
Victor Rivera
Timothy Clackson
James Rothman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ariad Gene Therapeutics Inc
Original Assignee
Ariad Gene Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ariad Gene Therapeutics Inc filed Critical Ariad Gene Therapeutics Inc
Publication of EP1144655A2 publication Critical patent/EP1144655A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C07K2319/715—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16 containing a domain for ligand dependent transcriptional activation, e.g. containing a steroid receptor domain
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus

Definitions

  • a number of important applications including for example, gene therapy- production of biological materials and materials and methods for biological research- depend on the ability to induce cells to produce proteins of therapeutic- commercial, or experimental value.
  • a variety of regulatable expression systems have been developed, including systems involving allostery-based switches triggered by tetracycline, RU486 or ecdysone, as well as dimerization-based switches triggered by dimerizing agents such as rapamycin, coumermycin, dimers of FK506, synthetic FKBP-binders and /or CsA, or analogs thereof. See e.g. Clackson, "Controlling mammalian gene expression with small molecules" Current Opinion in Chemical Biology, 1:210-218, 1997.
  • protein production is regulated at the transcriptional level.
  • An inherent limitation of all such systems is the inability to achieve fine temporal control over secretion of the target protein. For example, secretion of maximal, therapeutic levels of the protein is delayed by many hours or even days until the transcribed mRNA accumulates to levels high enough to produce significant amounts of secreted protein. Likewise, secretion cannot return to low baseline levels following removal of the inducing drug until the mRNA is completely degraded, which may also take many hours or days. For man ⁇ - applications this level of control is not sufficient; in these instances, it would be desirable to induce protein production on a much more rapid time scale than that achievable using transcription-based methods.
  • This invention takes a unique approach to the regulated production of a target protein, based not on regulated transcription, but on regulated release or secretion of the target protein.
  • Compositions and methods of this invention are useful in biological research and in gene therapy applications.
  • CRDs conditional retention domains
  • fusion proteins containing them ligands which bind to the CRDs and permit release or secretion of the fusion proteins
  • recombinant nucleic acids encoding such fusion proteins vectors containing such recombinant nucleic acids, cells transduced with these vectors and other materials and important methods involving such.
  • Key fusion proteins of the invention contain at least two mutually heterologous domains, one of which being a CRD. More specifically, the fusion proteins of this invention are designed to contain at least one conditional retention domain (CRD) and at least one additional domain that is heterologous thereto, usually with a secretory signal sequence.
  • Proteins containing a secretory signal sequence are translated in the endoplasmic reticulum (ER) and then pass through other secretory compartments such as the cis, medial and trans Golgi on their way to being secreted.
  • proteins containing one or more CRDs are, as a rule, retained in the secretory machinery except in the presence of a ligand which binds to the protein.
  • Illustrative examples of CRDs include retinol binding proteins and human FKBP 12 mutants such as F36M hFKBP12, as are discussed in detail below. Concatenation of multiple CRDs may allow the user to modulate the degree of aggregation or retention.
  • the fusion protein also contains a secretory signal sequence to target the fusion protein to a secretory compartment such as the ER or any part of the Golgi apparatus.
  • secretory signal sequences are known. Human growth hormone, for example, is the source of a secretory signal sequence suitable for use in this invention.
  • the fusion protein further contain an enzymatic cleavage site such that a portion of the fusion protein containing the CRD can be cleaved from a portion of the fusion protein containing a peptide sequence heterologous to the CRD.
  • the enzymatic cleavage site comprises a peptide sequence recognized by a trans-Golgi specific endoprotease such as furin.
  • a cleavage site for furin is provided by the peptide sequence SARNRQKR.
  • the portion of the fusion protein which is heterologous to the CRD may comprise any protein or protein domain of interest to the practitioner.
  • the heterologous portion may comprise a target protein such as insulin, parathyroid hormone or beta- endorphin.
  • one typical fusion protein of the invention comprises a signal sequence, a conditional retention domain, a furin cleavage site, and a polypeptide sequence comprising a selected target protein sequence.
  • An example of such a fusion protein comprises, in N-terminal to C-terrninal order, a signal sequence from human growth hormone, three F36M hFKBP 12 domains, a human stromelysin-3 furin cleavage site, and a selected target protein sequence.
  • Fusion proteins may also contain several target proteins each separated by an enzymatic cleavage site.
  • a fusion protein might contain a signal sequence from human growth hormone, one or more copies of a CRD such as F36M hFKBP 12, a furin cleavage site, a target protein, another furin cleavage site and another target protein. This type of construct allows for simultaneous release of more than one target protein.
  • the fusion proteins of this invention may optionally comprise a lysosomal targeting signal or other polypeptide sequence targeting it for degradation.
  • a lysosomal targeting signal or other polypeptide sequence targeting it for degradation By locating such a peptide sequence together with the CRD(s) on one side of the cleavage site and the selected target polypeptide on the other side of the cleavage site, one can help assure cellular removal of the CRD-containing portion of the fusion protein.
  • One object of the invention is thus the fusion proteins described herein.
  • Another object of the invention is the recombinant nucleic acids encoding such fusion proteins.
  • Those recombinant nucleic acids may be operably linked to an expression control sequence permitting their expression in host cells into which they have been transduced, or which otherwise contain them.
  • Any promoter may be used to drive expression of these fusion proteins, including strong promoters like the CMV enhancer, other viral promoters such as the RSV promoter or tissue specific promoters like the MCK enhancer.
  • Another object is a vector containing a recombinant nucleic acid of the invention, generally operably linked to an expression control sequence.
  • Such vectors include "viral" vectors which contain part or all of a viral genome in addition to the recombinant nucleic acid encoding the fusion protein of this invention.
  • Viral vectors can be designed and used for the production of recombinant viruses harboring a recombinant nucleic acid of this invention.
  • a wide variety of such viral systems are known in the art and may be adapted to the practice of this invention, including e.g. adenovirus, AAV, retrovirus, hybrid adeno-AAV, lentivirus and others.
  • Recombinant nucleic acids of this invention may be transduced into host cells by any available means e.g. in order to render those cells capable of regulated secretion of a target protein.
  • the cells are preferably eukaryotic cells, generally are animal cells, and in many embodiments are mammalian, whether human or non-human.
  • the cells may be transduced in situ within their host organism, or they may be transduced while being maintained in vitro.
  • the cells may be primary cells or may be from a cell line.
  • the invention thus provides methods for rendering a cell capable of regulated secretion of a target protein which involves introducing into the cell a recombinant nucleic acid of this invention to yield engineered cells which can express the encoded fusion protein.
  • the recombinant nucleic acid may be introduced in viral or other form into cells maintained in vitro or into cells present within an organism.
  • the resultant engineered cells and their progeny containing one or more of these recombinant nucleic acids may be used in a variety of important applications discussed elsewhere, including human gene therapy, analogous veterinary applications, the creation of cellular or animal models (including transgenic applications), assay applications, and the production of a desired protein in vitro, e.g. for recovery and use.
  • Such cells are useful, for example, in methods involving the addition of a ligand, preferably a cell permeant ligand, to the cells (or administration of the ligand to an organism containing the cells) to regulate secretion of a target protein.
  • animal models include rodent (especially mouse and rat) and non-human primate models.
  • the cells will generally be human and the peptide sequence of each of the various domains present in the fusion proteins will preferably be, or be derived from, a peptide sequence of human origin, to the extent possible.
  • CRDs may be identified by two hybrid type methods, in which a genetically engineered host cell is provided which comprises (a) a reporter gene linked to a regulatable expression control element, and (b) a recombinant nucleic acid comprising a polylinker linked to two recombinant nucleic acid sequences, the first recombinant nucleic acid sequence encoding a DNA binding domain and the second recombinant nucleic acid sequence encoding a transcription activation domain, wherein association of the DNA binding domain with the transcription activation domain activates expression of the reporter gene.
  • the construct contains a single polylinker linked to two independent translational cassettes.
  • genetically engineered host cells comprise (a) a reporter gene linked to a regulatable expression control element, (b) a first recombinant nucleic acid encoding a fusion protein comprising a transcription activation domain linked to a candidate conditional retention domain, (c) a second recombinant nucleic acid encoding a fusion protein containing a DNA binding domain linked to the candidate conditional retention domain wherein association of the fusion proteins activates expression of the reporter gene.
  • the invention further provides methods for identifying a ligand capable of binding to a conditional retention domain. See, "Methods for identifying CRDs", part 3, page 46 et seq, below.
  • One such method uses cells genetically engineered to express a reporter gene when CRD-containing aggregates are disaggregated by an appropriate ligand. The method involves the following steps: (a) contact the genetically engineered cells with candidate ligands under suitable conditions permitting gene expression, (b) observe the presence and/or amount of expression of the reporter gene, and (c) correlate the presence and/or amount of reporter gene expression with contact of cells with one or more candidate ligands.
  • the invention also provides methods for screening directly for CRDs which enable ligand-dependent secretion of a target protein or ligand-dependent localization of a membrane protein.
  • fusion proteins are expressed which encode members of a library of candidate CRDs linked to a signal sequence and an enzymatic cleavage site. These domains are further linked to either a secreted target protein or the extracellular and membrane domain of a membrane protein.
  • the fusion proteins are expressed under conditions permitting secretion of the target protein or localization of the membrane protein.
  • Cells containing the fusion proteins are treated with a ligand that binds the CRD, and then the ligand-dependent presence of the secreted protein or membrane protein is assessed. Secretion of the target protein and/or localization of the membrane protein is then correlated with one or more individual members of the CRD library.
  • Figure 1 General design of fusion proteins for use in this invention, containing, from amino- to carboxy- terminus, a secretion signal sequence, a "conditional retention domain", a protease cleavage site, and the secreted target protein of interest.
  • Figure 2 Constructs used to make CRD-containing fusion proteins.
  • Figure 2A F36M-EGFP fusion proteins
  • Figure 2B F36M- hGH fusion proteins
  • Figure 2C EGFP-F36M-hGH fusion proteins
  • Figure 2D F36M-insulin fusion proteins
  • Figure 2E LNGFR-F36M fusion proteins.
  • Figure 3 Ligand dependent secretion of hGH. Levels of hGH secreted into the culture medium of transiently transfected (Figure 3A) or stably transfected ( Figure 3B) HT1080 cells in the absence and presence of ligand.
  • Figure 4 Immunoblots of cell lysates and supernatants prepared from the HT88 cells incubated in the presence or absence of ligand for 2 hours. The samples were immunoblotted with anti-hGH and anti-FKBP antibodies.
  • Figure 5 Dose-dependence of hGH secretion from HT88 cells in response to ligand (Figure 5A). Time course of accumulation of secreted hGH in the culture medium ( Figure 5B).
  • Figure 6 Kinetics of secretion in response to ligand.
  • Group A the constitutive rate of secretion from the cells.
  • Group B secretion from cells not previously exposed to ligand.
  • Group C cells exposed to ligand following a large bolus release of hGH.
  • Figure 6B shows the amount of hGH released by incubation with maximal concentration of ligand.
  • Figure 6c shows the amount of hGH secreted following addition of sub-maximal concentrations of ligand.
  • FIG. 7 Effect of varying the number of CRDs on hGH secretion. hGH secretion was measured following addition of ligand in cell lines expressing fusion proteins containing varying numbers of CRDs.
  • Figure 8 Regulated secretion of insulin. Levels of insulin secretion were measured in transiently transfected HT1080 cells treated with varying concentrations of AP21998.
  • Figure 9 Regulated expression of a membrane tethered protein. 3, 4, or 6 copies of F(36M) were fused to the extracellular and transmembrane portions of the low-affinity nerve growth factor receptor (LNGFR; Figure 3E). Surface expression was assessed by FACS analysis using anti-LNGFR antibodies.
  • LNGFR low-affinity nerve growth factor receptor
  • Figure 10 Constructs useful for screening for novel CRDs.
  • A. Candidate DNA sequences may be cloned into the polylinker for identifying CRDs that induce ligand-dependent secretion of hGH.
  • B. Candidate DNA sequences may be cloned into the polylinker for identifying CRDs that induced ligand-dependent localization of p75.
  • C. Construct used for "two hybrid" style assay, in which fusion proteins containing CRDs cause association of the DNA binding domain and transcription activation domain to induce transcription.
  • FIG. 11 Ligand-mediated regulation of insulin and glucose levels in vivo.
  • A Insulin and glucose levels were measured in mice implanted with FKBP(F36M)-insulin-containing constructs before and after adrninistration of AP22542.
  • B Levels of serum glucose were measured in mice implanted with FKBP(F36M)-insulin-containing constructs at various time points following administration of AP22542.
  • Capable of selectively hybridizing means that two DNA molecules are susceptible to detectable hybridization with one another, despite the presence of other DNA molecules, under hybridization conditions which can be chosen or readily determined empirically by the practitioner of ordinary skill in this art.
  • Such treatments include conditions of high stringency such as washing extensively with buffers containing 0.2 to 6 x SSC, and/or containing 0.1% to 1% SDS, at temperatures ranging from room temperature to 65-75°C. See for example F.M. Ausubel et al., Eds, Short Protocols in Molecular Biology, Units 6.3 and 6.4 (John Wiley and Sons, New York, 3d Edition, 1995).
  • Cells refer not only to the particular cells under discussion, but also to their progeny. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • Cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from a given cell line may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
  • Composite”, “fusion”, and “recombinant” denote a material such as a nucleic acid, nucleic acid sequence or polypeptide which contains at least two constituent portions which are mutually heterologous in the sense that they are not otherwise found directly (covalently) linked in nature, i.e., are not found in the same continuous polypeptide or gene in nature, at least not in the same order or orientation or with the same spacing present in the composite, fusion or recombinant product.
  • such materials contain components derived from at least two different proteins or genes or from at least two non-adjacent portions of the same protein or gene.
  • composite refers to portions of different proteins or nucleic acids which are joined together to form a single functional unit, while “fusion” generally refers to two or more functional units which are linked together.
  • “Recombinant” is generally used in the context of nucleic acids or nucleic acid sequences.
  • a "coding sequence” or a sequence which "encodes” a particular polypeptide or RNA is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of an appropriate expression control sequence.
  • a coding sequence can include, but is not limited to, cDNA from procaryotic or eukaryotic mRNA, genomic DNA sequences from procaryotic or eukaryotic DNA, and synthetic DNA sequences.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • a “construct”, e.g., a “nucleic acid construct” or “DNA construct”, refers to a nucleic acid or nucleic acid sequence.
  • “Derived from” denotes a peptide or nucleotide sequence selected from within a given sequence.
  • a peptide or nucleotide sequence derived from a named sequence may further contain a small number of modifications relative to the parent sequence, in most cases representing deletion, replacement or insertion of less than about 15%, preferably less than about 10%, and in many cases less than about 5%, of amino acid residues or bases present in the parent sequence.
  • one DNA molecule is also considered to be derived from another if the two are capable of selectively hybridizing to one another.
  • Polypeptides or polypeptide sequences are also considered to be derived from a reference polypeptide or polypeptide sequence if any DNAs encoding the two polypeptides or sequences are capable of selectively hybridizing to one another.
  • a derived peptide sequence will differ from a parent sequence by the replacement of up to 5 amino acids, in many cases up to 3 amino acids, and very often by 0 or 1 amino acids.
  • a derived nucleic acid sequence will differ from a parent sequence by the replacement of up to 15 bases, in many cases up to 9 bases, and very often by 0 - 3 bases. In some cases the amino acid(s) or base(s) is /are added or deleted rather than replaced.
  • Domain refers to a portion of a protein or polypeptide.
  • domain may refer to a portion of a protein having a discrete secondary structure.
  • domain does not necessarily connote a given secondary structure. Rather, a peptide sequence is referred to herein as a “domain” simply to denote a polypeptide sequence from a defined source, or having or conferring an intended or observed activity. Domains can be derived from naturally occurring proteins or may comprise non-naturally-occurring sequence.
  • “Expression control element”, or simply “control element” refers to DNA sequences, such as initiation signals, enhancers, promoters and silencers, which induce or control transcription of DNA sequences with which they are operably linked. Control elements of a gene may be located in introns, exons, coding regions, and 3' flanking sequences. Some control elements are "tissue specific”, i.e., affect expression of the selected DNA sequence preferentially in specific cells (e.g., cells of a specific tissue), while others are active in many or most cell types. Gene expression occurs preferentially in a specific cell if expression in this cell type is observably higher than expression in other cell types.
  • Control elements include so-called “leaky” promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well. Furthermore, a control element can act constitutively or inducibly. An inducible promoter, for example, is demonstrably more active in response to a stimulus than in the absence of that stimulus.
  • a stimulus can comprise a hormone, cytokine, heavy metal, phorbol ester, cyclic AMP (cAMP), retinoic acid or derivative thereof, etc.
  • a nucleotide sequence containing one or more expression control elements may be referred to as an "expression control sequence".
  • Gene refers to a nucleic acid molecule or sequence comprising an open reading frame and including at least one exon and (optionally) one or more intron sequences.
  • Genetically engineered cells denotes cells which have been modified by the introduction of recombinant or heterologous nucleic acids (e.g. one or more DNA constructs or their RNA counterparts) and further includes the progeny of such cells which retain part or all of such genetic modification.
  • heterologous as it relates to nucleic acid or peptide sequences, denotes sequences that are not normally joined together, and /or are not normallv associated with a particular cell.
  • a heterologous region of a nucleic acid construct is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
  • a heterologous region of a construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene).
  • the cell and the construct would be considered mutually heterologous for purposes of this invention.
  • Interact refers to directly or indirectly detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay or by immunoprecipitation.
  • the term “interact” encompasses "binding" interactions between molecules. Interactions may be, for example, protein-protein, protein-nucleic acid, protein- small molecule or small molecule-nucleic acid in nature.
  • Nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
  • a “polylinker”, also sometimes referred to as a “multiple cloning site” is a region within a vector which contains multiple sites for restriction enzyme cleavage, thus rendering the vector suitable for cloning of exogenous genes.
  • a “recombinant virus” is a virus particle in which the packaged nucleic acid contains a heterologous portion.
  • the "secretory machinery” (also called secretory apparatus) of the cell refers to the cellular compartments to which secreted and membrane proteins are targeted and processed. These compartments include the endoplasmic reticulum (ER) and the cis, medial and trans Golgi. In this document, the term ER is often used generically to mean “secretory compartment.”
  • a “target protein” is a protein of interest, the secretion of which is modulated according to the methods of the invention. The target protein can be, for example, a hormone, an endorphin, etc.
  • Trans ection means the introduction of a naked nucleic acid molecule into a recipient cell.
  • Infection refers to the process wherein a nucleic acid is introduced into a cell by a virus containing that nucleic acid.
  • a "productive infection” refers to the process wherein a virus enters the cell, is replicated, and is then released from the cell (sometimes referred to as a “lytic” infection).
  • Transduction encompasses the introduction of nucleic acid into cells by any means.
  • Transgene refers to a nucleic acid sequence which has been introduced into a cell.
  • Daughter cells deriving from a cell in which a transgene has been introduced are also said to contain the transgene (unless it has been deleted).
  • the polypeptide or RNA encoded by a transgene may be partly or entirely heterologous, i.e., foreign, with respect to the animal or cell into which it is introduced.
  • the transgene can be homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene).
  • a transgene can also be present in an episome.
  • a transgene can include one or more expression control elements and any other nucleic acid, (e.g. intron), that may be necessary or desirable for optimal expression of a selected coding sequence.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • One type of vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
  • vectors are used which are capable of autonomous replication and /or expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of an included gene operatively linked to an expression control sequence can be referred to as "expression vectors”.
  • Expression vectors are typically in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and “vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • vector is intended to include such other forms of vectors which serve equivalent functions and which are or become known in the art.
  • Viral vectors are nucleic acid molecules containing viral sequences which can be packaged into viral particles.
  • a conditional retention domain is any domain which is retained in the ER or other secretory compartment in the absence of ligand and is released from the secretory machinery when ligand is bound, i.e. in the presence of ligand.
  • CRDs is considered to take advantage of the phenomenon of ER "quality control", whereby proteins that are incorrectly folded or aggregated are retained in the ER rather than traveling to the Golgi. Eventually, most misfolded proteins are degraded, but others have been observed to accumulate in substantial steady-state amounts (eg. the VSV-G protein: A. M. de Silva et al. (1990) J. Cell Biol. Ill, 857-866. See also, Kopito, R. R. (1997) Cell 88, 427-430).
  • the CRD can be a natural example of a protein that is retained in the secretory machinery in the absence of a particular small molecule.
  • An example of this type of conditional retention domain is or is derived from retinol binding protein (RBP).
  • Retinol binding protein is a serum protein of approximately 20 kD that is a specific carrier for retinol (Vitamin A) (Melhus, H. et al. (1992) J Biol. Chem. 267, 12036-12041). It is retained in the ER in complex with another protein, transerythrin.
  • the complex Upon binding of retinol to RBP, the complex is released from its molecular chaperone and is free to enter the Golgi apparatus.
  • the retinol binding protein acts as a CRD which is retained in the ER in the absence of ligand and secreted in its presence.
  • retinol binding protein is expressed primarily in hepatocytes, it is generally useful as a CRD, since several groups have shown that retinol-mediated secretion of RBP is cell-type independent and requires no hepatocyte specific cofactors (see, e.g. Melhus et al, J. Biol. Chem. 267:12036-12041, 1992.)
  • IgM Another example of a protein that is retained in the ER in the absence of a small molecule ligand is IgM. Retention of soluble ⁇ chains in the ER is dependent on a single unpaired cysteine residue. Although secretion of IgM normally requires binding of light chains to the ⁇ heavy chain, secretion of IgM intermediates can be induced by addition of 2- mercaptoethanol or other reducing agents (Alberini et al., Nature 347:485-487, 1990). Thus, soluble ⁇ chains can function as CRDs which are secreted in the presence of a thiol-reactive small molecule.
  • the CRD can be an engineered mutant of a natural protein, chosen because it has the property of being selectively retained in the absence of a given small molecule. It is known that mutations that destabilize proteins can lead to ER retention. Without wishing to be bound to any one theory, including that theory, we have observed that some mutations at human FKBP Phe36 lead to proteins that are poorly expressed (eg. F36A), probably due to instability. Such proteins are thought to be retained to some extent in the secretory apparatus. Using a high affinity ligand that binds to the protein to permit ER exit.
  • the CRD can be a protein that self-aggregates in a small molecule-reversible manner. It is known that large protein aggregates are retained in the ER. In such cases, ER retention occurs because of formation of aggregates rather than due to misfolding of proteins. A naturally occurring example of aggregation-dependent ER retention is found in the Z mutation of ⁇ j -antitrypsin. In the secreted M form of this plasma protease, a glutamic acid residue is located at position 342 in the reactive center loop of the molecule.
  • this glutamic acid is substituted by lysine; this substitution allows the reactive loop to insert itself into the A-sheet of an adjacent (X j -antitrypsin molecule, forming linear, transport-incompetent aggregates.
  • the aggregates accumulate in the ER, but can be released by addition of a peptide which inserts into the A-sheet and prevents polymerization (Hammond and Helenius, Current Opinion in Cell Biology 7:523-529, 1995; Lomas et al., Nature 357:605-607, June 18, 1992).
  • the mutant form of ⁇ -galactosidase A that is found in Fabry lymphoblasts provides an additional example of small-molecule dependent release of aggregates from the ER .
  • the mutant protein aggregates in the endoplasmic reticulum, contributing, at least in part, to enzyme deficiency in Fabry patients.
  • the CRD is derived from human FKBP12.
  • the FKBP mutant F36M functions as a conditional retention domain when fused to a signal sequence and heterologous target sequence in mammalian cells.
  • fusion proteins containing FKBP F36M and a signal sequence self-aggregate and accumulate in the endoplasmic reticulum.
  • the fusion protein disaggregates and transits through the ER, resulting in secretion of the fusion protein or cleavage products thereof.
  • Another FKBP mutant which functions as a CRD is FKBP W59V.
  • a wide variety of ligands can be used in this invention to effect disaggregation and /or secretion of the fusion protein molecules from the secretory machinery. Criteria for selecting a ligand are: (A) physiologic acceptability of the ligand (i.e., the ligand lacks undue toxicity towards the cell or animal for which it is to be used), (B) reasonable therapeutic dosage range, (C) suitability for oral administration (i.e., suitable stability in the gastrointestinal system and absorption into the vascular system), for applications in whole animals, including gene therapy applications, (D) ability to cross cellular and other membranes, as necessary, (E) reasonable binding affinity for the CRD (for the desired application), and (F) efficacy in stimulating transit of the fusion protein.
  • the compound is relatively physiologically inert, but for its affinity for the CRD.
  • the ligand will be other than a peptide or nucleic acid, and will preferably have a molecular weight of less than about 5000 Daltons, more preferably less than about 1200 Daltons.
  • a ligand binding domain for a candidate ligand is endogenous to the cells to be engineered
  • Such a ligand should bind preferentially to the engineered ligand binding domain relative to a naturally occurring peptide sequence, e.g., from which the modified domain was derived. This approach can avoid untoward intrinsic activities of the ligand.
  • Significant guidance and illustrative examples toward that end are provided in the various references cited herein.
  • a ligand for a ligand binding domain is permitted, so long as the modified compound still functions as a ligand for the ligand binding domain of interest, i.e., so long as the compound possesses sufficient binding affinity and specificity to function as disclosed herein.
  • Some of the compounds will be macrocyclics, e.g. macrolides, although linear and branched compounds may be preferred in specific embodiments.
  • Suitable binding affinities will be reflected in Kd values well below 10" 4 , preferably below 10 ⁇ 6 , more preferably below about 10" 7 , although binding affinities below 10" 9 or 10 ⁇ 10 are possible, and in some cases will be most desirable.
  • Illustrative examples of ligand binding domain/ligand pairs include retinol binding protein or variants thereof and retinol or derivatives thereof; cyclophilin or variants thereof and cyclosporin or analogs thereof; FKBP or variants thereof and FK506, FK520, rapamycin, analogs thereof or synthetic FKBP ligands.
  • a ligand binding domain comprising or derived from an i__m_unophilin or cyclophilin
  • the complex of the ligand with the ligand binding domain will desirably not bind specifically to calcineurin or FRAP.
  • FK506 derivatives and synthetic FKBP ligands are known which do not have observable immunosuppressive activity.
  • rapamycin analogs which bind to FKBP but are not immunosuppressive. See e.g. WO 98/02441 for non-inununosuppressive rapalogs.
  • Those and other ligands can be used as well, depending on the choice of CRD. Numerous assays are known in the art for identifying ligands which bind to CRDs that are identified through screening, as described below.
  • Ligand binding domain/ligand pairs are illustrated by FKBP domains, e.g. F36M FKBP, and FKBP ligands. In general, it is preferred that the ligand bind preferentially to a mutated (i.e., having a peptide sequence not naturally occurring in the cells to be engineered) FKBP relative to wild-type FKBP.
  • Ligands for FKBP proteins, including F36M FKBP can comprise or be derived from a naturally occurring FKBP ligand such as rapamycin, FK506 or FK520, or a synthetic FKBP ligand, e.g. as disclosed in PCT/US95/ 10559; Holt, et al, J. Atner. Chem.
  • Illustrative types of ligands for FKBP-derived ligand binding domains include the following Genus I:
  • n 1 or 2;
  • X O, S, NH or CH 2 ;
  • B 1 and B 2 are independently H or aliphatic, heteroaliphatic, aryl or heteroaryl as those terms are defined below, usually containing one to about 12 carbon atoms (not counting carbon atoms of optional substituents);
  • R 1 , R 2 , and R 3 are aliphatic, heteroaliphatic, aryl or heteroaryl, usually containing one to about 36 carbon atoms (not counting carbon atoms of optional substituents); two or more of B 1 , B 2 and R 2 may be covalently linked to form a C3-C7 cyclic or heterocyclic moiety; and,
  • aliphatic as used herein includes both saturated and unsaturated straight chain, branched, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more substituents.
  • Aliphatic, heteraliphatic, aryl and heterocyclic substituents may themselves be substituted or unsubstituted (e.g. mono-, di- and tri-alkoxyphenyl; methylenedioxyphenyl or ethylenedioxyphenyl; halophenyl; or -phenyl-C(Me) 2 -CH 2 -O-CO-[C3-C6] alkyl or alkylamino). Additional examples of substituents are illustrated by the specific embodiments shown in the Examples which follow. (Unless otherwise specified, the alkyl, other aliphatic, alkoxy and acyl groups preferably contain 1-8, and in many cases 1-6, contiguous aliphatic carbon atoms).
  • aliphatic is thus intended to include alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties.
  • alkyl includes both straight and branched alkyl groups.
  • An analogous convention applies to other generic terms such as “alkenyl”, “alkynyl” and the like.
  • alkyl alkenyl, “alkynyl” and the like encompasses both substituted and unsubstituted groups.
  • alkyl refers to groups usually having one to eight, preferably one to six carbon atoms.
  • alkyl may refer to methyl, ethyl, n-propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl tert-pentyl, hexyl, isohexyl, and the like.
  • Suitable substituted alkyls include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 3-fluoropropyl, hydroxymethyl, 2-hydroxyethyl, 3- hydroxypropyl, and the like.
  • alkenyl refers to groups usually having two to eight, preferably two to six carbon atoms.
  • alkenyl may refer to prop-2-enyl, but-2-enyl, but-3-enyl, 2- methylprop-2-enyl, hex-2-enyl, hex-5-enyl, 2,3-dimethylbut-2-enyl, and the like.
  • alkynyl which also refers to groups having two to eight, preferably two to six carbons, includes, but is not limited to, prop-2-ynyl, but-2-ynyl, but-3-ynyl, pent-2-ynyl, 3- methylpent-4-ynyl, hex-2-ynyl, hex-5-ynyl, and the Uke.
  • cycloalkyl refers to groups having three to seven, preferably three to six carbon atoms. Suitable cycloalkyls include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like.
  • heteroaliphatic refers to aliphatic moieties which contain one or more oxygen, sulfur, or nitrogen atoms, e.g., in place of carbon atoms.
  • heterocycle refers to cyclic aliphatic groups having one or more heteroatoms, and preferably three to seven ring atoms total, includes, but is not limited to oxetane, tetrahydrofuranyl, tetrahydropyranyl, aziridine, azetidine, pyrrolidine, piperidine, morpholine, piperazine and the like.
  • aryl and “heteroaryl” as used herein refer to stable mono- or polycyclic, heterocyclic, polycyclic, and polyheterocyclic unsaturated moieties having 3 - 14 carbon atom which may be substituted or unsubstituted.
  • useful aryl ring groups include phenyl, halophenyl, alkoxyphenyl, dialkoxyphenyl, trialkoxyphenyl, alkylenedioxyphenyl, naphthyl, phenanthryl, anthryl, phenanthro and the like.
  • heteroaryl rings include 5-membered monocyclic ring groups such as thienyl, pyrrolyl, imidazolyl, pyrazolyl, furyl, isothiazolyl, furazanyl, isoxazolyl, thiazolyl and the like; 6- membered monocyclic groups such as pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl and the like; and polycyclic heterocyclic ring groups such as benzo[b]thienyl, naphtho[2,3- bjthienyl, thianthrenyl, isobenzofuranyl, chromenyl, xanthenyl, phenoxathienyl, indolizinyl, isoindolyl, indolyl, indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyrid
  • aryl or heteroaryl moieties may be substituted with one to five members selected from the group consisting of hydroxy, C1-C8 alkoxy, C1-C8 branched or straight-chain alkyl, acyloxy, carbamoyl, amino, N-acylamino, nitro, halo, trihalomethyl, cyano, and carboxyl.
  • a "halo" substituent according to the present invention may be a fluoro, chloro, bromo or iodo substituent.
  • R 1 may be aliphatic, heteroaliphatic, aryl or heteroaryl and usually comprises one to about 36 carbon atoms, exclusive of optional substituents.
  • R 1 is optionally be joined, i.e., covalently linked, to R 2 , B 1 or B 2 , forming a macrocyclic structure.
  • -XR 1 is a moiety of the formula
  • R 4 is a H, aliphatic, heteroaliphatic, aryl or heteroaryl.
  • the ahphatic moieties may be branched, unbranched, cyclic, saturated or unsaturated, substituted or unsubstituted and include, e.g, methyl, ethyl, isopropyl, t-butyl, cyclopentyl, cyclohexyl, etc.
  • Heteroaliphatic moieties may be branched, unbranched or cyclic and include heterocycles such as morpholino, pyrrolidinyl, etc.
  • Illustrative ortho-, meta- or para-, substitutents for a phenyl group at this position include one or more of the following: halo, e.g. chloro or flouro; hydroxyl, amino, -SO 2 NH 2 , -SO 2 NH(aliphatic), -SO 2 N(aliphatic) 2 , -O-aliphatic-COOH,-
  • O-aliphatic-NH 2 (which may contain one or two N-aliphatic or N-acyl substituents), C1-C6 alkyl, acyl, acyloxy, C1-C6 alkoxy, e.g. methoxy, ethoxy, methylenedioxy, ethylenedioxy, etc.
  • Heteroaryl groups are as discussed previously, including indolyl, pyridyl, pyrrolyl, etc.
  • Particular R 4 moieties include the following:
  • R 5 is a branched, unbranched or cyclic aliphatic moiety of 1 to 8 carbon atoms, which may be optionally substituted, including for example, -CH-, -CHCH2-, -CH 2 CH-,- CHCH 2 CH 2 _-, -CH 2 CHCH 2 -,-CH(CH 3 )-CH 2 -CH, -CH(CH 2 CH 3 )-CH 2 -CH, -CH 2 CH 2 CH-,-
  • R 6 is an ahphatic, heteroaliphatic, heterocylic, aryl or heteroaryl moiety, which may be substituted or unsubstituted.
  • Typical substituents for R 6 include branched, unbranched or cyclic, C1-C8, aliphatic or heteroaliphatic groups, including unsaturated groups such as substitute or unsubstituted alkenes, heterocycles, phenyl, etc.
  • R 6 is aryl
  • R 7 may be present in the o, m, or p position
  • z is an integer from 0 through 4.
  • B 1 , B 2 and R 2 may be aliphatic, heteroaliphatic, aryl or heteroaryl.
  • Typical groups include a branched, unbranched or cyclic, saturated or unsaturated, aliphatic moiety, preferably of 1 to about 12 carbon atoms (including for example methyl, ethyl, n-propyl, isopropyl, cyclopropyl, -CH 2 -cyclopropyl, allyl, n-butyl, sec-butyl, isobutyl, tert-butyl, cyclobutyl, -CH 2 -cyclobutyl, n-pentyl, sec-pentyl, isopentyl, tert-pentyl, cyclopentyl, -CH 2 -cyclopentyl, n-hexyl, sec-hexyl, cyclohexyl, -CH 2 -cyclohexyl and
  • B 2 is preferably not cyclopentyl.
  • Particular XR 1 , G, B 1 , B 2 and YR 2 groups for the various foregoing structures further include those illustrated in compounds described in the examples, tables of monomers and dimers and other disclosure in WO 96/06097, WO 97/31899 and WO 97/31898.
  • One preferred class of compounds are those compounds of Genus I in which n is 2.
  • B 1 is H
  • B 2 is branched, unbranched or cyclic, saturated or unsaturated, aliphatic moiety, preferably of 1 to 8, more preferably 1 to 6, carbon atoms (including for example methyl, ethyl, n-propyl, isopropyl, cyclopropyl, -CH 2 -cyclopropyl, allyl, n-butyl, sec-butyl, isobutyl, tert-butyl, cyclobutyl, -CH 2 -cyclobutyl, n-pentyl, sec-pentyl, isopentyl, tert-pentyl, cyclopentyl, -CH 2 -cyclopentyl, n-hexyl, sec-hexyl, cyclohexyl, -CH 2 -cyclohexyl and the like), which ahphatic moiety may
  • YR 2 is aryl, heteroaryl and may be optionally substituted (YR 2
  • moieties such as o-, m-, or p-alkoxyphenyl; 3,5-, 2,3-, 2,4-, 2,5-, 3,4- or 3,5-dia ⁇ koxyphenyl, or 3,4,5-trialkoxyphenyl, e.g. where the alkoxy groups are independently selected from methoxy and ethoxy (one or more of which may bear a hydroxy or amino moiety).
  • Another preferred class of compounds are those compounds of Genus I in which B 1 ,
  • B 2 and YR 2 are the same or different lower aliphatic moieties.
  • Another preferred class of compounds are those compounds of Genus I which contain a moiety -NB ⁇ 2 in which B 1 is H and R 2 is lower aliphatic.
  • Another preferred class of compound are those compounds of Genus I in which G is an alicyclic or heterocychc group bearing optional substituents.
  • R 1 comprises R 4 R 5 R 6 R 7 where R 4 is ahphatic, alicyclic, aryl, heteroaryl, or heterocyclic, optionally substituted; R 5 is a branched or unbranched lower ahphatic group; R 6 is aliphatic, alicyclic, heteroaliphatic, heterocyclic, aryl or heteroaryl, optionally substituted.
  • Rl comprises R 4 R 5 R 6 R 7 as described in the immediately preceding paragraph and YR 2 comprises a substituted or unsubstituted aryl or heteroaryl, including phenyl; o-, m- or p- substituted phenyl where the substituent is halo such as chloro, lower alkyl, or alkoxy, such as methoxy or ethoxy; disubstituted phenyl, e.g.
  • dialkoxyphenyl such as 2,4-, 3,4- or 3.5-dimethoxy or diethoxy phenyl or such as methylenedioxyphenyl, or 3-methoxy-5-ethoxyphenyl; or trisubstituted phenyl, such as trialkoxy (e.g., 3,4,5-trimethoxy or ethoxyphenyl), 3,5- dimethoxy-4-chloro-phenyl, etc.).
  • such compounds may comprise a substituted proline and pipecolic acid derivative, numerous examples of which have been described in the literature.
  • substituted prolines and pipecolates can be utilized to prepare hgands with substituents at positions C-2 to C-6 (with reference to the FK506 numbering of most of the references cited below), as exemplified in the patent applications cited herein.
  • substituted prolines and pipecolic acids see: Chung, et al, J. Org. Chem., 1990, 55, 270; Shuman, et al, J. Org. Chem., 1990, 55, 738; Hanson, et al, Tetrahedron Lett, 1989, 30, 5751; Bailey, et al, Tetrahedron Lett., 1989, 30, 6781.
  • fusion proteins of this invention it is often preferable in the design of fusion proteins of this invention to have an enzymatic cleavage site located between the CRD and the target protein.
  • the enzymatic cleavage site allows the target protein to be released from the CRD and secreted.
  • the cleavage site should be specific to an enzyme which resides in a cellular compartment between the ER and the plasma membrane, e.g. the Golgi apparatus.
  • An exemplary cleavage enzyme is furin, also known as PACE.
  • Furin is a member of the KEX2/subtilisin family of pro-protein convertases, which convert pro-proteins and pro-hormones to their active forms (Kazuhisa Nakayama, Biochem J. (1997) 327:625-635). It is a protein which resides in the trans-golgi, although like many golgi proteins such as TGN38, it constitutively cycles between the cell surface and the TGN (trans-golgi network). Furin has a ubiquitous tissue distribution and its substrates are numerous and varied. However, nearly all share the consensus cleavage sequence RX(K/R)R.
  • Proteins which are substrates for furin include: human pro- neurotrophin-3 (MSMRVRR), human pro-insulin like growth factor I (KPAKSAR), human pro-parathyroid hormone (KSVKKR), human stromelysin-3 (AJRNRQKR).
  • Furin is also capable of cleaving membrane bound substrates, such as human insulin pro-receptor (RPSRKRR) and human hepatocyte growth factor pro-receptor (TEKRKKR).
  • a cleavage site from any furin substrate can be used in the fusion proteins of the invention. In some cases, the site will be be a non-naturally occurring peptide sequence containing the consensus furin cleavage sequence.
  • furin as the cleavage enzyme is that its recognition sequence is located exclusively N-terminal to the cleavage site. This allows the portion of the protein that encodes the target protein to be released from the cell unaltered by the presence of additional amino acids.
  • the furin family contains other members which may also be useful in the practice of this invention. Many of these proteins have a unique tissue distribution. For example,
  • PC1/PC3 and PC2 are only found in neuroendocrine tissues like pancreatic islets, pituitary and brain and PC4 is expressed primarily within testicular-germ cells.
  • PACE4 as well as PC5/PC6 and LPC/PC7/PC8/SPC7 are expressed ubiquitously (Nakayama, 1997). Cleavage sites for these enzymes may also be used in the practice of this invention, provided the fusion proteins are expressed in the appropriate cell type.
  • any mammalian protease with a specific cleavage sequence such as subtilisin
  • subtilisin could be targeted to the TGN by fusing it to a localization sequence from a resident golgi protein such as TGN38.
  • the motifs which are known to target furin to the TGN including YKGL and the Ser-containing cluster SDSEEDE, may suffice to target a cytoplasmic protease to the Golgi.
  • Cells may also be engineered to express an enzyme tailored to cut a sequence found only in the CRD containing fusion protein. For example, Ballinger et al.
  • an amino acid sequence of 16-30 residues directs the ribosome to the ER membrane. This sequence then initiates a signal which transports the nascent chain into the ER, across the ER membrane.
  • signal sequences are found at the N-terminus of a protein and contain one or more positively charged amino acids followed by a stretch of 6-12 hydrophobic residues.
  • Numerous signal sequences are known, and any signal sequence which normally directs the translocation of a secretory or transmembrane protein to the ER may be used in the fusion proteins of this invention.
  • Exemplar ⁇ 7 signal sequences are those from preproalbumin, prelysozyme, human growth hormone, proinsulin, acetylcholine receptor or IgG light chain.
  • a signal sequence is encoded at the N- terminus of the protein to be regulatably secreted. This signal sequence then directs the ribosome to the ER, where the translated protein containing the CRD aggregates until hgand is added to the cell.
  • Fusion proteins of this invention may contain any target protein which one may want to secrete or translocate rapidly and efficiently.
  • the target protein will be a therapeutic protein.
  • the target protein can provide a desired phenotype. It can be a membrane-bound or membrane-spairning protein, a secreted protein, or a cytoplasmic protein.
  • the proteins which are expressed, singly or in combination, can involve homing, cytotoxicity, proliferation, differentiation, immune response, inflammatory response, clotting, thrombolysis, hormonal regulation, angiogenesis, etc.
  • the polypeptide may be of naturally occurring or non-naturally occurring peptide sequence.
  • hormones such as insulin, human growth hormone, glucagon, pituitary releasing factor, ACTH, melanotropin, relaxin, leptin,efc
  • growth factors such as EGF, IGF-1, TGF-alpha, -beta, PDGF, G-CSF, M-CSF, GM-CSF, members of the FGF family, erythropoietin, thrombopoietin, megakaryocytic growth factors, nerve growth factors, etc.
  • proteins which stimulate or inhibit angiogenesis such as angiostatin, endostatin and VEGF and variants thereof
  • interleukins such as IL-1 to -15
  • TNF-alpha and -beta interferons -alpha, -beta and -gamma
  • enzymes and other factors such as tissue plasminogen activator, members of the complement cascade, performs, superoxide dismutase; coagulation-related
  • the protein may be a naturally-occurring surface membrane protein or a protein made so by introduction of an appropriate signal peptide and transmembrane sequence.
  • Various such proteins include homing receptors, e.g. L-selectin (Mel-14), hematopoietic cell markers, e.g.
  • CD3, CD4, CD8, B cell receptor TCR subunits alpha, beta, gamma or delta, CD10, CD19, CD28, CD33, CD38, CD41, etc., receptors, such as the interleukin receptors IL-2R, IL-4R, etc.; receptors for other hgands including the various hormones, growth factors, etc.; receptor antagonists for such receptors and soluble forms of such receptors; channel proteins, for influx or efflux of ions, e.g. H+, Ca+2 7 ⁇ +, Na+, Cl", etc., and the like; CFTR, tyrosine activation motif, zap- 70, etc.
  • the target protein can be an intracellular protein such as a protein involved in a metabolic pathway, or a regulatory' protein, steroid receptor, transcription factor, etc.
  • T-cells one may wish to introduce genes encoding one or both chains of a T-cell receptor.
  • B-cells one could provide the heavy and light chains for an inamunoglobulin for secretion.
  • cutaneous cells e.g. keratinocytes, particularly keratinocyte stem cells
  • the site can include anatomical sites, such as lymph nodes, mucosal tissue, skin, synovium, lung or other internal organs or functional sites, such as clots, injured sites, sites of surgical manipulation, inflammation, infection, etc.
  • Regulated expression of a membrane protein which recognizes or binds to the particular site of interest provides a method for directing the engineered cells to that site.
  • Proteins of interest include homing receptors, e.g.
  • L-selectin, GMP140, CLAM- 1, etc. or addressins, e.g. ELAM-1, PNAd, LNAd, etc., clot binding proteins, or cell surface proteins that respond to localized gradients of chemotactic factors.
  • binding of a hgand to a CRD regulates transcription of a target gene.
  • the target gene may encode any protein, including those described above.
  • lysosomal proteins are sorted from the trans-golgi network, where they are directed to the endosomal pathway, and subsequently, to lysosomes.
  • Resident soluble lysosomal enzymes such as cathepsin D are marked for targeting to the lysosomal pathway by attachment of a phosphate group on carbon 6 of one or more mannose residues on a particular N-linked oligosaccharide, which are then recognized by the mannose-6- phosphate receptor in the lysozyme.
  • the phosphotransferase recognition sequence of cathepsin D consists of two discontinuous sequences: amino acids 188-230, including a critical lysine residue at position 203, and amino acids 265-292 (Baranski et al., Cell 1990, 63:281-291.) Baranski et al.
  • chimeric proteins consisting of soluble CD4, procathepsin D and the C-teiminal tails of three lysosomal membrane proteins were able to direct the HIV glycoprotein gpl60 to the lysosome for degradation (Lin et al., FASEB J., 7:1070-1080, August 1993.) Lysosomal membrane proteins such as lamp-1 and LAP are directed to the lysosome via a tyrosine- based targeting motif in their C-terminal tails (Williams et al., J. Cell Biol., 111:955-966, 1990; Klionsky et al., J. Biol. Chem., 265:5349-5352, 1990.) Fusion of these tails onto the extracellular and transmembrane domains of resident plasma membrane proteins is sufficient to target those proteins to the lysosome.
  • Either of the aforementioned lysosomal targeting signals may be used to target CRDs of this invention for disposal.
  • the preferred method is to fuse a resident lysosomal protein containing a mannose-6-phosphate signal to the CRD.
  • examples of such proteins are the cysteine proteases of the cathepsin family: cathepsins B, D, H, L, S, C and K.
  • Other lysosomal enzymes which may be used include the carboxypeptidases prolylcarboxypeptidase and deamidase (cathepsin A).
  • the preferred targeting sequence would be one found in lysosomal membrane proteins, e.g.
  • tyrosine-based internahzation motif a tyrosine-based internahzation motif. These motifs are short, linear stretches of amino acids within the cytoplasmic region of the protein to be targeted. Tyrosine-based motifs center on a critical tyrosine residue within the sequence NPXY or YXX0, where X is any amino acid and 0 is an amino acid with a bulky hydrophobic group. In many proteins, a glycine preceding the tyrosine in a YXX0-type signal enhances targeting of these proteins to the lysosome.
  • Sequences for use in some applications of this invention may be derived from proteins such as Lamp-1, LAP (lysosomal acid phosphatase), CD63, Lamp-2 or CD3- gamma, all of which are normally targeted to the lysosome.
  • proteins such as Lamp-1, LAP (lysosomal acid phosphatase), CD63, Lamp-2 or CD3- gamma, all of which are normally targeted to the lysosome.
  • Constructs may be designed in accordance with the principles, illustrative examples and materials and methods disclosed in the patent documents and scientific literature cited herein, with modifications and further exemplification as described.
  • Components of the constructs can be prepared in conventional ways, where the coding sequences and regulatory regions may be isolated, as appropriate, ligated, cloned in an appropriate cloning host, analyzed by restriction or sequencing, or other convenient means. Particularly, using PCR, individual fragments including all or portions of a functional unit may be isolated, where one or more mutations may be introduced using "primer repair", ligation, in vitro mutagenesis, etc. as appropriate.
  • DNA sequences encoding individual domains and sub-domains are joined such that they constitute a single open reading frame encoding a fusion protein capable of being translated in cells or cell lysates into a single polypeptide harboring all component domains.
  • the DNA construct encoding the fusion protein may then be placed into a vector for transducing host cells and permitting the expression of the protein.
  • the protein-encoding sequence is introduced into an expression vector that directs expression in these cells. Expression vectors suitable for such uses are well known in the art. Various sorts of such vectors are commercially available.
  • the fusion proteins described herein may be used in combination with any promoter that will direct their expression in mammalian cells.
  • the promoter may be a strong promoter, such as the human CMV promoter , or a weaker promoter, such as a promoter for an endogenous human gene.
  • Other promoters which may be used include, but are not limited to, the Rous Sarcoma Virus (RSV) promoter, the retroviral LTR from Murine Moloney Leukemia Virus (MMLV), the muscle creatine kinase (MCK) enhancer, the SV40 promoter, and the CMV enhancer from the major immediate early gene.
  • RSV Rous Sarcoma Virus
  • MMLV Murine Moloney Leukemia Virus
  • MK muscle creatine kinase
  • SV40 promoter the SV40 promoter
  • CMV enhancer from the major immediate early gene.
  • promoter will depend upon the configuration of the fusion protein used in a particular application. Thus, if the practitioner desired the CRD- containing fusion protein to be expressed at high levels, a stronger promoter, such as CMV, would be used. Alternatively, for tissue specific expression, a tissue specific promoter like the MCK enhancer (for expression in muscle) would be selected.
  • the animal cells may be, among others, insect, worm or mammalian cells. While various mammalian cells may be used, including, by way of example, equine, bovine, ovine, canine, feline, murine, and non- human primate cells, human and mouse cells are of particular interest.
  • various types of cells may be used, such as hematopoietic, neural, glial, mesenchymal, cutaneous, mucosal, stromal, muscle (including smooth muscle cells), spleen, reticuloendothelial, epithelial, endothelial, hepatic, kidney, gastrointestinal, pulmonary, fibroblast, and other cell types.
  • muscle cells including skeletal, cardiac and other muscle cells
  • hematopoietic cells which may include any of the nucleated cells which may be involved with the erythroid, lymphoid or myelomonocytic lineages, as well as myoblasts and fibroblasts.
  • stem and progenitor cells such as hematopoietic, neural, stromal, muscle, hepatic, pulmonary, gastrointestinal and mesenchymal stem cells
  • the cells may be autologous cells, syngeneic cells, allogeneic cells and even in some cases, xenogeneic cells with respect to an intended host organism.
  • the cells may be modified by changing the major histocompatibility complex ("MHC") profile, by inactivating ⁇ 2-microglobulin to prevent the formation of functional Class I MHC molecules, inactivation of Class II molecules, providing for expression of one or more MHC molecules, enhancing or inactivating cytotoxic capabilities by enhancing or inhibiting the expression of genes associated with the cytotoxic activity, and the like.
  • MHC major histocompatibility complex
  • specific clones or oligoclonal cells mav be of interest, where the cells have a particular specificity, such as T cells and B cells having a specific antigen specificity or horning target site specificity.
  • Constructs encoding the fusion proteins and comprising target genes of this invention can be introduced into the cells as one or more nucleic acid molecules or constructs, in many cases in association with one or more markers to allow for selection of host cells which contain the construct(s).
  • the constructs can be prepared in conventional ways, where the coding sequences and regulatory regions may be isolated, as appropriate, hgated, cloned in an appropriate cloning host, analyzed by restriction or sequencing, or other convenient means. Particularly, using PCR, individual fragments including all or portions of a functional domain may be isolated, where one or more mutations may be introduced using "primer repair", ligation, in vitro mutagenesis, etc. as appropriate.
  • the construct(s) once completed and demonstrated to have the appropriate sequences may then be introduced into a host cell by any convenient means.
  • the constructs may be incorporated into vectors capable of episomal replication (e.g. BPV or EBV vectors) or into vectors designed for integration into the host cells' chromosomes.
  • the constructs may be integrated and packaged into non-replicating, defective viral genomes like Adenovirus, Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or others, including retroviral vectors, for infection or transduction into cells.
  • the construct may be introduced by protoplast fusion, electroporation, biolistics, calcium phosphate transfection, lipofection, microinjection of DNA or the like.
  • the host cells will in some cases be grown and expanded in culture before introduction of the construct(s), followed by the appropriate treatment for introduction of the construct(s) and integration of the construct(s).
  • the cells may then be expanded and /or screened by virtue of a marker present in the constructs.
  • markers which may be used successfully include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc., and various cell-surface markers such as Tac, CD8, CD3, Thyl and the NGF receptor.
  • a target site for homologous recombination where it is desired that a construct be integrated at a particular locus. For example, one can delete and/or replace an endogenous gene (at the same locus or elsewhere) with a recombinant target construct of this invention.
  • homologous recombination one may generally use either ⁇ or O-vectors. See, for example, Thomas and Capecchi, Cell (1987) 51, 503-512; Mansour, et al, Nature (1988) 336, 348-352; and Joyner, et al, Nature (1989) 338, 153-156.
  • the constructs may be introduced as a single DNA molecule encoding all of the genes, or different DNA
  • Vectors containing useful elements such as bacterial or yeast origins of replication, selectable and /or amplifiable markers, promoter/enhancer elements for expression in prokaryotes or eukaryotes, and mammalian expression control elements, etc. which may be used to prepare stocks of construct DNAs and for carrying out transfections are well known in the art, and many are commercially available.
  • Cells which have been transduced ex vivo or in vitro with the DNA constructs may be grown in culture under selective conditions and cells which are selected as having the desired construct(s) may then be expanded and further analyzed, using, for example, the polymerase chain reaction for determining the presence of the construct in the host cells and/or assays for the production of the desired gene product(s).
  • the modified host cells After being transduced with the heterologous genetic constructs, the modified host cells may be identified, selected, grown, characterized, etc. as desired, and then may be used as planned, e.g. grown in culture or introduced into a host organism.
  • the cells may be introduced into a host organism, e.g. a mammal, in a wide variety of ways, generally by injection or implantation into the desired tissue or compartment, or a tissue or compartment permitting migration of the cells to their intended destination.
  • a host organism e.g. a mammal
  • Illustrative sites for injection or implantation include the vascular system, bone marrow, muscle, liver, cranium or spinal cord, peritoneum, and skin.
  • Hematopoietic cells for example, may be administered by injection into the vascular system, there being usually at least about 104 cells and generally not more than about 10l0 cells.
  • the number of cells which are employed will depend upon the circumstances, the purpose for the introduction, the lifetime of the cells, the protocol to be used, for example, the number of administrations, the ability of the cells to multiply, the stability of the therapeutic agent, the physiologic need for the therapeutic agent, and the like.
  • the number of cells will be at least about 104 and not more than about 109 and may be applied as a dispersion, generally being injected at or near the site of interest.
  • the cells wiU usually be in a physiologically-acceptable medium.
  • Cells engineered in accordance with this invention may also be encapsulated, e.g. using conventional biocompatible materials and methods, prior to implantation into the host organism or patient for the production of a therapeutic protein. See e.g. Hguyen et al, Tissue Implant Systems and Methods for Sustaining viable High Cell Densities within a Host, US Patent No. 5,314,471 (Baxter International, Inc.); Uludag and Sefton, 1993, J Biomed. Mater. Res.
  • the cells may then be introduced in encapsulated form into an animal host, preferably a mammal and more preferably a human subject in need thereof.
  • the encapsulating material is semipermeable, permitting release into the host of secreted proteins produced by the encapsulated cells.
  • the semipermeable encapsulation renders the encapsulated cells immunologically isolated from the host organism in which the encapsulated cells are introduced.
  • the cells to be encapsulated may express one or more fusion proteins containing component domains derived from proteins of the host species and/or from viral proteins or proteins from species other than the host species.
  • the cells may be derived from one or more individuals other than the recipient and may be derived from a species other than that of the recipient organism or patient.
  • the DNA constructs are delivered to cells by transfection, i.e., by delivery to cells of "naked DNA", lipid-complexed or liposome-formulated DNA, or otherwise formulated DNA.
  • a plasmid containing a transgene bearing the desired DNA constructs may first be experimentally optimized for expression (e.g., inclusion of an intron in the 5' untranslated region and elimination of unnecessary sequences (Feigner, et al., Ann NY Acad Sci 126-139, 1995).
  • Formulation of DNA e.g.
  • lipid or liposome materials may then be effected using known methods and materials and delivered to the recipient mammal. See, e.g., Canonico et al, Am J Respir Cell Mol Biol 10:24-29, 1994 (in vivo transfer of an aerosolized recombinant human alphal-antirrypsin gene complexed to cationic liposomes to the lungs of rabbits); Tsan et al, Am J Physiol 268 (Lung Cell Mol Physiol 12): L1052-L1056, 1995 (transfer of genes to rat lungs via tracheal insufflation of plasmid DNA alone or complexed with cationic liposomes); Alton et al., Nat Genet.
  • Viral systems include those based on viruses such as adenovirus, adeno-associated virus, hybrid adeno-AAV, lentivirus and retroviruses, which allow for transduction by infection, and in some cases, integration of the virus or transgene into the host genome.
  • viruses such as adenovirus, adeno-associated virus, hybrid adeno-AAV, lentivirus and retroviruses, which allow for transduction by infection, and in some cases, integration of the virus or transgene into the host genome.
  • the virus may be administered by injection (e.g. intravascularly or intramuscularly), inhalation, or other parenteral mode.
  • injection e.g. intravascularly or intramuscularly
  • Non-viral dehvery methods such as administration of the DNA via complexes with liposomes or by injection, catheter or biolistics may also be used. See e.g. WO 96/41865, PCT/US97/22454 and USSN 60/084819, for example, for additional guidance on formulation and delivery of recombinant nucleic acids to cells and to organisms.
  • an attenuated or modified retrovirus carrying a target transcriptional initiation region if desired, one can activate the virus using one of the subject transcription factor constructs, so that the virus may be produced and transduce adjacent cells.
  • the use of recombinant viruses to deliver the nucleic acid constructs are of particular interest.
  • the transgene(s) may be incorporated into any of a variety of viruses useful in gene therapy.
  • the gene dehvery systems i.e., the recombinant nucleic acids in vectors, virus, lipid formulation or other form
  • a pharmaceutical preparation of the gene dehvery system can be introduced systemically, e.g. by intravenous injection, inhalation, etc.
  • the means of delivery provides for specific or selective transduction of the construct into desired target cells. This can be achieved by regional or local administration (see U.S. Patent 5,328,470) or by stereotactic injection, e.g. Chen et al., (1994) PNAS USA 91: 3054-3057 or by determinants of the delivery means.
  • the subject expression constructs are derived by incorporation of the genetic construct(s) of interest into viral dehvery systems including a recombinant retiovirus, adenovirus, adeno-associated virus (AAV), hybrid adenovirus/ AAV, herpes virus or lentivirus (although other applications may be carried out using recombinant bacterial or eukaryotic plasmids).
  • viral dehvery systems including a recombinant retiovirus, adenovirus, adeno-associated virus (AAV), hybrid adenovirus/ AAV, herpes virus or lentivirus (although other applications may be carried out using recombinant bacterial or eukaryotic plasmids).
  • AAV- and adenovirus-based approaches are of particular interest for the transfer of exogenous genes in vivo, particularly into humans and other mammals.
  • the following additional guidance on the choice and use of viral vectors may be helpful to the practitioner, especially with respect to applications involving whole animals (including both human gene therapy and the development and use of animal model systems), whether ex vivo or in vivo.
  • a viral gene dehvery system useful in the present invention utilizes adenovirus- derived vectors.
  • Knowledge of the genetic organization of adenovirus, a 36 kb, linear and double-stranded DNA virus, allows substitution of a large piece of adenoviral DNA with foreign sequences up to 8 kb.
  • retrovirus the infection of adenoviral DNA into host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
  • adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithehal cells regardless of their cell cycle stage.
  • Adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in the human.
  • Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target-cell range, and high infectivity.
  • Both ends of the viral genome contain 100-200 base pair (bp) inverted terminal repeats (LTR), which are cis elements necessary for viral DNA replication and packaging.
  • LTR inverted terminal repeats
  • the early (E) and late (L) regions of the genome contain different transcription domains that are divided by the onset of viral DNA replication.
  • the El region (EIA and EIB) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
  • E2A and E2B results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression, and host cell shut off (Renan (1990) Radiotherap. Oncol. 19:197).
  • the products of the late genes, including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP).
  • MLP located at 16.8 m.u.
  • TL tripartite leader
  • adenovirus The genome of an adenovirus can be manipulated such that it encodes a gene product of interest, but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle (see, for example, Berkner et al., (1988) BioTechniques 6:616; Rosenfeld et al., (1991) Science 252:431-434; and Rosenfeld et al., (1992) Cell 68:143-155).
  • Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus are well known to those skilled in the art.
  • Recombinant adenoviruses can be advantageous in certain circumstances in that they are not capable of infecting nondividing cells and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al., (1992) cited supra), endothelial cells (Lemarchand et al., (1992) PNAS USA 89:6482-6486), hepatocytes (Herz and Gerard, (1993) PNAS USA 90:2812-2816) and muscle cells (Quantin et al., (1992) PNAS USA 89:2581-2584).
  • Adenovirus vectors have also been used in vaccine development (Grunhaus and Horwitz (1992) Seminar in Virology 3:237; Graham and Prevec (1992) Biotechnology 20:363). Experiments in administering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al. (1991) ; Rosenfeld et al. (1992) Cell 68:143), muscle injection (Ragot et al. (1993) Nature 361:647), peripheral intravenous injection (Herz and Gerard (1993) Proc. Natl. Acad. Sci. U.S.A. 90:2812), and stereotactic inoculation into the brain (Le Gal La Salle et al. (1993) Science 254:988).
  • virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity.
  • adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 109 - l ⁇ H plaque-forming unit (PFU)/ml, and they are highly infective.
  • PFU plaque-forming unit
  • the life cycle of adenovirus does not require integration into the host cell genome.
  • the foreign genes delivered by adenovirus vectors are episomal, and therefore, have low genotoxicity to host cells.
  • adenoviral vectors currently in use and therefore favored by the present invention are deleted for all or parts of the viral El and E3 genes but retain as much as 80% of the adenoviral genetic material (see, e.g., Jones et al., (1979) Cell 16:683; Berkner et al., supra; and Graham et al., in Methods in Molecular Biology, E.J. Murray, Ed. (Humana, Clifton, NJ, 1991) vol. 7. pp. 109- 127).
  • Expression of the inserted gene can be under control of, for example, the EIA promoter, the major late promoter (MLP) and associated leader sequences, the viral E3 promoter, or exogenously added promoter sequences.
  • MLP major late promoter
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
  • Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the method of the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
  • the typical vector according to the present invention is replication defective and will not have an adenovirus El region.
  • the position of insertion of the nucleic acid of interest in a region within the adenovirus sequences is not critical to the present invention.
  • the nucleic acid of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described previously by Karlsson et. al. (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.
  • helper cell line is 293 (ATCC Accession No. CRL1573).
  • This helper cell line also termed a "packaging cell line” was developed by Frank Graham (Graham et al. (1987) J. Gen. Virol. 36:59-72 and Graham (1977) J.General Virology 68:937-940) and provides EIA and EIB in trans.
  • helper cell lines may also be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
  • the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
  • adenovirus vectors have been shown to be of use in the transfer of genes to mammals, including humans.
  • Replication-deficient adenovirus vectors have been used to express marker proteins and CFTR in the pulmonary epithehum. Because of their ability to efficiently infect dividing cells, their tropism for the lung, and the relative ease of generation of high titer stocks, adenoviral vectors have been the subject of much research in the last few years, and various vectors have been used to dehver genes to the lungs of human subjects (Zabner et al., Cell 75:207-216, 1993; Crystal, et al., Nat Genet.
  • the first generation Ela deleted adenovirus vectors have been improved upon with a second generation that includes a temperature-sensitive E2a viral protein, designed to express less viral protein and thereby make the virally infected cell less of a target for the immune system (Goldman et al., Human Gene Therapy 6:839-851,1995). More recently, a viral vector deleted of all viral open reading frames has been reported (Fisher et al., Virology 217:11-22, 1996).
  • Adenoviruses can also be cell type specific, i.e., infect only restricted types of cells and /or express a transgene only in restricted types of cells.
  • the viruses comprise a gene under the transcriptional control of a transcription initiation region specifically regulated by target host cells, as described e.g., in U.S. Patent No. 5,698,443, by Henderson and Schuur, issued December 16, 1997.
  • rephcation competent adenoviruses can be restricted to certain cells by, e.g., inserting a cell specific response element to regulate a synthesis of a protein necessary for rephcation, e.g., EIA or EIB.
  • DNA sequences of a number of adenovirus types are available from Genbank.
  • human adenovirus type 5 has GenBank Accession No.M73260.
  • the adenovirus DNA sequences may be obtained from any of the 42 human adenovirus types currently identified.
  • Various adenovirus strains are available from the American Type Culture
  • a transgene as described herein may be incorporated into any adenoviral vector and delivery protocol, by the same methods (restriction digest, linker ligation or filling in of ends, and ligation) used to insert the CFTR or other genes into the vectors.
  • Adenovirus producer cell lines can include one or more of the adenoviral genes El,
  • E2a, and E4 DNA sequence for packaging adenovirus vectors in which one or more of these genes have been mutated or deleted are described, e.g., in PCT/US95/15947 (WO 96/18418) by Kadan et al.; PCT/US95/07341 (WO 95/346671) by Kovesdi et al.; PCT/FR94/00624 (WO94/28152) by Imler et al.;PCT/FR94/00851 (WO 95/02697) by Perrocaudet et al., PCT/US95/14793 (WO96/14061) by Wang et al.
  • Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient rephcation and a productive life cycle.
  • AAV has not been associated with the cause of any disease.
  • AAV is not a fransforming or oncogenic virus.
  • AAV integration into chromosomes of human cell lines does not cause any significant alteration in the growth properties or morphological characteristics of the ceUs. These properties of AAV also recommend it as a potentially useful human gene therapy vector.
  • AAV is also one of the few viruses that may integrate its DNA into non-dividing cells, e.g., pulmonary epithelial cells or muscle cells, and exhibits a high frequency of stable integration (see for example Flotte et al., (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356; Samulski et al, (1989) J. Virol. 63:3822-3828; and McLaughlin et al, (1989) J. Virol. 62:1963-1973).
  • Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb.
  • An AAV vector such as that described in Tratschin et al., (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce DNA into cells.
  • a variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., (1984) PNAS USA 81:6466- 6470; Tratschin et al., (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al., (1988) Mol. Endocrinol. 2:32-39; Tratschin et al., (1984) J. Virol. 51:611-619; and Flotte et al., (1993) J. Biol. Chem. 268:3781-3790).
  • the AAV-based expression vector to be used typically includes the 145 nucleotide AAV inverted terminal repeats (ITRs) flanking a restriction site that can be used for subcloning of the transgene, either directly using the restriction site available, or by excision of the transgene with restriction enzymes followed by blunting of the ends, ligation of appropriate DNA linkers, restriction digestion, and ligation into the site between the ITRs.
  • ITRs inverted terminal repeats
  • the capacity of AAV vectors is about 4.4 kb.
  • a transgene incorporating the various DNA constructs of this invention can similarly be included in an AAV-based vector.
  • a constitutive promoter such as CMV
  • an AAV promoter can be used (ITR itself or AAV p5 (Flotte, et al. J. Biol.Chem. 268:3781-3790, 1993)).
  • Such a vector can be packaged into AAV virions by reported methods.
  • a human cell line such as 293 can be co-transfected with the AAV-based expression vector and another plasmid containing open reading frames encoding AAV rep and cap (which are obligatory for replication and packaging of the recombinant viral construct) under the control of endogenous AAV promoters or a heterologous promoter.
  • the rep proteins Rep68 and Rep 78 prevent accumulation of the replicative form, but upon superinfection with adenovirus or herpes virus, these proteins permit rephcation from the ITRs (present only in the construct containing the transgene) and expression of the viral capsid proteins.
  • AAV virion Such strategies include, but are not limited to: stable expression of the ITR- flanked transgene in a cell line followed by transfection with a second plasmid to direct viral packaging; use of a ceU line that expresses AAV proteins inducibly, such as temperature- sensitive inducible expression or pharmacologically inducible expression.
  • a cell can be transformed with a first AAV vector including a 5' ITR, a 3' ITR flanking a heterologous gene, and a second AAV vector which includes an inducible origin of rephcation, e.g., SV40 origin of rephcation, which is capable of being induced by an agent, such as the SV40 T antigen and which includes DNA sequences encoding the AAV rep and cap proteins.
  • an agent such as the SV40 T antigen and which includes DNA sequences encoding the AAV rep and cap proteins.
  • the second AAV vector may replicate to a high copy number, and thereby increased numbers of infectious AAV particles may be generated (see, e.g, U.S. Patent No. 5,693,531 by Chiorini et al., issued December 2, 1997.
  • a plasmid which incorporate the Epstein Barr Nuclear Antigen (EBNA) gene , the latent origin of replication of Epstein Barr virus (oriP) and an AAV genome.
  • EBNA Epstein Barr Nuclear Antigen
  • oriP Epstein Barr virus
  • an AAV packaging plasmid that allows expression of the rep gene, wherein the p5 promoter, which normally controls rep expression, is replaced with a heterologous promoter (U.S. Patent 5,658,776, by Flotte et al., issued Aug. 19, 1997). Additionally, one may increase the efficiency of AAV transduction by treating the cells with an agent that facilitates the conversion of the single stranded form to the double stranded form, as described in Wilson et al., WO96/39530.
  • AAV stocks can be produced as described in Hermonat and Muzyczka (1984) PNAS 81:6466, modified by using the pAAV/Ad described by Samulski et al. (1989) J. Virol. 63:3822. Concentration and purification of the virus can be achieved by reported methods such as banding in cesium chloride gradients, as was used for the initial report of AAV vector expression in vivo (Flotte, et al. J.Biol. Chem. 268:3781-3790, 1993) or chromatographic purification, as described in O'Riordan et al., WO97/08298.
  • AAV technology which may be useful in the practice of the subject invention, including methods and materials for the incorporation of a transgene, the propagation and purification of the recombinant AAV vector containing the transgene, and its use in transfecting cells and mammals, see e.g. Carter et al, US Patent No. 4,797,368 (10 Jan 1989); Muzyczka et al, US Patent No. 5,139,941 (18 Aug 1992); Lebkowski et al, US Patent No. 5,173,414 (22 Dec 1992); Srivastava, US Patent No. 5,252,479 (12 Oct 1993); Lebkowski et al, US Patent No. 5,354,678 (11 Oct 1994); Shenk et al, US Patent No.
  • Hybrid Adenovirus- AAV vectors represented by an adenovirus capsid containing a nucleic acid comprising a portion of an adenovirus, and 5' and 3' ITR sequences from an AAV which flank a selected transgene under the control of a promoter. See e.g. Wilson et al, International Patent Application Publication No. WO 96/13598.
  • This hybrid vector is characterized by high titer transgene delivery to a host cell and the ability to stably integrate the transgene into the host cell chromosome in the presence of the rep gene.
  • This virus is capable of infecting virtually all cell types (conferred by its adenovirus sequences) and stable long term transgene integration into the host cell genome (conferred by its AAV sequences).
  • adenovirus nucleic acid sequences employed in the this vector can range from a minimum sequence amount, which requires the use of a helper virus to produce the hybrid virus particle, to only selected deletions of adenovirus genes, which deleted gene products can be supplied in the hybrid viral process by a packaging ceU.
  • a hybrid virus can comprise the 5' and 3' inverted terminal repeat (ITR) sequences of an adenovirus (which function as origins of rephcation).
  • the left terminal sequence (5') sequence of the Ad5 genome that can be used spans bp 1 to about 360 of the conventional adenovirus genome (also referred to as map units 0-1) and includes the 5' ITR and the packaging/enhancer domain.
  • the 3' adenovirus sequences of the hybrid virus include the right terminal 3' ITR sequence which is about 580 nucleotides (about bp 35,353- end of the adenovirus, referred to as about map units 98.4-100.
  • the AAV sequences useful in the hybrid vector are viral sequences from which the rep and cap polypeptide encoding sequences are deleted and are usually the cis acting 5' and 3' ITR sequences.
  • the AAV ITR sequences are flanked by the selected adenovirus sequences and the AAV ITR sequences themselves flank a selected transgene.
  • the preparation of the hybrid vector is further described in detail in published PCT application entitled “Hybrid Adenovirus- AAV Virus and Method of Use Thereof", WO 96/13598 by Wilson et al.
  • adenovirus and hybrid adenovirus- AAV technology which may be useful in the practice of the subject invention, including methods and materials for the incorporation of a transgene, the propagation and purification of recombinant virus containing the transgene, and its use in transfecting cells and mammals, see also Wilson et al, WO 94/28938, WO 96/13597 and WO 96/26285, and references cited therein.
  • Retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin (1990) Retroviridae and their Replication" In Fields, Knipe ed. Virology. New York: Raven Press).
  • the resulting DNA then stably integrates into cellular chromosomes as a pro virus and directs synthesis of viral proteins.
  • the integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
  • the retroviral genome contains three genes, gag, pol, and env that code for capsidal proteins, polymerase enzyme, and envelope components, respectively.
  • LTR long terminal repeat
  • a nucleic acid of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is rephcation-defective.
  • a packaging cell line containing the gag, pol, and env genes but without the LTR and psi components is constructed (Mann et al. (1983) Cell 33:153).
  • a recombinant plasmid containing a human cDNA, together with the retroviral LTR and psi sequences is introduced into this cell line (by calcium phosphate precipitation for example), the psi sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein (1988) "Retroviral Vectors", In: Rodriguez and Denhardt ed. Vectors: A Survey of Molecular Cloning Vectors and their Uses.
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al. (1975) Virology 67:242).
  • retroviruses A major prerequisite for the use of retroviruses is to ensure the safety of their use, particularly with regard to the possibility of the spread of wild-type virus in the cell population.
  • the development of specialized ceU lines (termed "packaging cells") which produce only rephcation-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are weU characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A.D. (1990) Blood 76:271).
  • recombinant retrovirus can be constructed in which part of the retroviral coding sequence (gag, pol, env) has been replaced by nucleic acid encoding a fusion protein of the present invention, rendering the retrovirus rephcation defective.
  • the rephcation defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F.M. et al., (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art.
  • a preferred retroviral vector is a pSR MSVtkNeo (Muller et al. (1991) Mol.
  • pSR MSV(Xbal) (Sawyers et al. (1995) J. Exp. Med. 181:307) and derivatives thereof.
  • the unique BamHI sites in both of these vectors can be removed by digesting the vectors with BamHI, filling in with Klenow and religating to produce pSMTN2 and pSMTX2, respectively, as described in PCT/US96/09948 by Clackson et al.
  • suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include Crip, Cre, 2 and Am.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including neural cells, epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis et al., (1985) Science 230:1395-1398; Danos and Mulligan, (1988) PNAS USA 85:6460-6464; Wilson et al., (1988) PNAS USA 85:3014-3018; Armentano et al., (1990) PNAS USA 87:6141-6145; Huber et al., (1991) PNAS USA 88:8039-8043; Ferry et al., (1991) PNAS USA 88:8377-
  • retroviral-based vectors it has been shown that it is possible to limit the infection spectrum of retroviruses and consequently of retroviral-based vectors, by modifying the viral packaging proteins on the surface of the viral particle (see, for example PCT publications WO93/25234, WO94/06920, and WO94/11524).
  • strategies for the modification of the infection spectrum of retroviral vectors include: coupling antibodies specific for cell surface antigens to the viral env protein (Roux et al., (1989) PNAS USA 86:9079-9083; Julan et al, (1992) J.
  • Coupling can be in the form of the chemical cross- linking with a protein or other variety (e.g. lactose to convert the env protein to an asialoglycoprotein), as well as by generating fusion proteins (e.g. single-chain antibody/env fusion proteins).
  • This technique while useful to limit or otherwise direct the infection to certain tissue types, and can also be used to convert an ecotropic vector in to an amphotropic vector.
  • Herpes Simplex Virus U.S. Patent No. 5,631,236 by Woo et al., issued May 20, 1997)
  • vaccinia virus Ridgeway (1988) Ridgeway, "Mammalian expression vectors," In: Rodriguez R L, Denhardt D T, ed.
  • Vectors A survey of molecular cloning vectors and their uses. Stoneham: Butterworth,; Baichwal and Sugden (1986) "Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes," In: Kucherlapati R, ed. Gene transfer.
  • viruses include an alphavirus, a poxvirus, an arena virus, a vaccinia virus, a polio virus, and the like.
  • herpes virus vectors may provide a unique strategy for persistence of the recombinant gene in cells of the central nervous system and ocular tissue (Pepose et al.,
  • Chang et al. recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place of the polymerase, surface, and pre-surface coding sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high liters of the recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al. (1991) Hepatology, 14:124A).
  • CAT chloramphenicol acetyltransferase
  • the viral particles are transferred to a biologically compatible solution or pharmaceutically acceptable delivery vehicle, such as sterile saline, or other aqueous or non- aqueous isotonic sterile injection solutions or suspensions, numerous examples of which are well known in the art, including Ringer's, phosphate buffered saline, or other similar vehicles.
  • a biologically compatible solution or pharmaceutically acceptable delivery vehicle such as sterile saline, or other aqueous or non- aqueous isotonic sterile injection solutions or suspensions, numerous examples of which are well known in the art, including Ringer's, phosphate buffered saline, or other similar vehicles.
  • Dehvery of the recombinant viral vector can be carried out via any of several routes of administration, including intramuscular injection, intravenous administration, subcutaneous injection, intrahepatic administration, catheterization (including cardiac catheterization), intracranial injection, nebulization/inhalation or by instillation via bronchoscopy.
  • the DNA or recombinant virus is administered in sufficient amounts to transfect cells within the recipient's target ceUs, including without limitation, muscle cells, liver cells, various airway epithelial cells and smooth muscle cells, neurons, cardiac muscle cells, etc. and provide sufficient levels of transgene expression to provide for observable ligand-responsive secretion of a target protein, preferably at a level providing therapeutic benefit without undue adverse effects.
  • Optimal dosages of DNA or virus depends on a variety of factors, as discussed previously, and may thus vary somewhat from patient to patient. Again, therapeutically effective doses of viruses are considered to be in the range of about 20 to about 50 ml of saline solution containing concentrations of from about 1 X 10? to about 1 X 10l0 pfu of virus/ml, e.g. from 1 X l ⁇ 8 to 1 X 109 pfu of virus/ml.
  • cells engineered in accordance with the invention are used to produce a target protein in vitro.
  • the cells are cultured or otherwise maintained until production of the target protein is desired.
  • the appropriate ligand is added to the culture medium, in an amount sufficient to cause the desired level of target protein production.
  • the protein so produced may be recovered from the medium or from the cells, and may be purified from other components of the cells or medium as desired.
  • Proteins for commercial and investigational purposes are often produced using mammalian ceU lines engineered to express the protein.
  • mammalian cells rather than bacteria, insect or yeast cells, is indicated where the proper function of the protein requires post-translational modifications not generally performed by non-mammalian cells.
  • proteins produced commercially this way include, among others, erythropoietin, BMP-2, tissue plasminogen activator, Factor VIII:c, Factor IX, and antibodies.
  • cells within an animal host or human subject are engineered in accordance with the invention, or cells so engineered are introduced into the animal or human subject, in either case, to prepare the recipient for ligand-mediated regulation of secretion of a therapeutic protein.
  • this can be done as part of veterinary treatment of the animal or to create an animal model for a variety of research purposes.
  • this can be done as part of a therapeutic or prophylactic treatment program.
  • the target protein e.g. a therapeutic protein
  • the target protein can be an endogenous protein or a heterologous protein, and its secretion may be activated by addition of ligand.
  • the target protein is a factor necessary for the proliferation and/or differentiation of one or more cell types of interest.
  • secretion of erythropoietin stimulates the production of red blood cells
  • secretion of G-CSF stimulates the production of granulocytes
  • secretion of GM-CSF stimulates the production of various white blood ceUs, etc.
  • the specific cells can be replenished by stimulating secretion of one or more factors stimulating proliferation of these cells.
  • the method of the invention can also be used to increase the number of lymphocytes in a subject having AIDS, such as by stimulating secretion of lymphokines, e.g., IL-4, which stimulates proliferation of certain T helper (Th) cells.
  • lymphokines e.g., IL-4
  • the target protein is a hormone or endorphin which must be dehvered rapidly and efficiently to its site of action.
  • IDDM insulin-dependent diabetes meUitus
  • Current regulated expression systems rely on transcriptional mechanisms, in which protein levels increase about 12-16 hours after addition of hgand.
  • the present invention would aUow dehvery of insulin to the appropriate site within 20-30 minutes after hgand binding.
  • the invention described herein could be used to treat any condition which would benefit from rapid delivery of a therapeutic protein.
  • this invention would be useful for dehvery of any protein whose biology requires pulsatile or diurnal dehvery.
  • proteins include, among others, parathyroid hormone or growth hormone.
  • Other uses include delivery of proteins for inflammatory, flaring-type diseases, such as rheumatoid arthritis, inflamrnatory bowel disease, etc.
  • therapeutics would be antibodies to TNF, soluble TNFR, and IL-1RA.
  • More generaUy, patients would benefit from regulated secretion of any "on-demand" or self-medicating scenario, like insulin (see above) or other agents for managing blood glucose; anti-pain peptides; inflammation (see above); leptin; contraception e.g., antibodies to LHRH.
  • CRDs comprising natural examples of proteins retained in secretory compartments in a small-molecule reversible manner
  • Candidate CRDs of this class include any naturally secreted protein or subdomain thereof. Such proteins can typicaUy be identified by the presence of a secretion signal sequence at the start of their coding sequence. The characteristics of such signal sequences are well known and computational algorithms are avaUable to assist in their identification. Using these methods, secreted proteins can be identified from searches of sequence databases. A preferred subset of secreted proteins are those that are known to bind smaU molecules, or are predicted to do so by their homology to other small molecule-binding proteins. The small molecule may be a ligand or substrate that is transiently bound to the protein during its normal function, or it may be a cofactor that normaUy remains permanently bound.
  • these small molecules provides a starting point for identifying Ugands for the candidate CRD.
  • smaU molecule-mediated release of the protein from secretory compartments may already be documented in the scientific literature.
  • DNA encoding the candidate polypeptide is amplified by PCR or RT-PCR using standard methods from an appropriate source, such as genomic DNA or total or poly A+ RNA isolated from an appropriate ceUular source, or a cDNA or genomic DNA Ubrary.
  • PCR primers are engineered to include restriction sites allowing insertion into a vector for expression in mammahan cells, or other eukaryotic cells of interest.
  • sequence of interest can be isolated as a restriction fragment.
  • the PCR or restriction fragment is then cloned in frame into the polylinker of an expression vector.
  • a preferred vector is of the form shown in Figure 10A, where hCMV indicates the human CMV immediate early promoter and enhancer, SS indicates a signal sequence, poly is a polylinker region, FCS is a furin cleavage site, and hGH is a cDNA for human growth hormone.
  • Components of this vector can be substituted as appropriate: for example, FCS can be replaced with alternative TGN protease cleavage sites, and hGH can be replaced with other secreted proteins that can be easily detected and are therefore useful as reporter proteins, such as secreted alkaline phosphatase (SEAP) or erythropoietin (EPO).
  • SEAP secreted alkaline phosphatase
  • EPO erythropoietin
  • an epitope tag aUowing immunochemical detection of the protein can be included in the vector sequence or incorporated via either PCR primer.
  • the expression vector is introduced into cells in culture using standard techniques, for example Upofection. After 24 hours, an aliquot of culture medium is removed and assayed for presence of hGH using standard techniques (Rivera et al., 1996). Then, new medium containing various concentrations of candidate CRD hgand are added. After a further period of 2-24 hours, medium is again sampled for presence of hGH.
  • Suitable candidate CRD Ugands to investigate include compounds that are known ligands of the protein under study (for example retinol for RBP), and chemicaUy related molecules that may have usefully different properties, such as cell permeability or effects on ER retention of the protein (for example diverse retinoids for RBP). Suitable concentrations of these ligands to investigate are in the range 1 pM to 1 mM.
  • Additional controls that can be performed to verify the activity of a CRD discovered through the above methods include immunochemical detection of the CRD and hGH domains inside cells treated or not treated with the CRD ligand, to confirm that the proteins are retained inside the secretory apparatus. These experiments use standard cell fixing procedures followed by immunofluorescence. Also, the secreted hGH can be checked for correct processing from the fusion protein by size analysis using SDS-PAGE foUowed by immunoblot with anti-hGH antibodies. For a more exact check, the hGH can be purified (eg. on an hGH binding protein affinity column), and then analyzed for molecular weight by mass spectrometry and for correct processing by immob zation on PVDF foUowed by N-terminal sequence analysis.
  • any polypeptide can be tested using the methods described above.
  • a protein that is not naturally secreted, but that has a known small molecule binding activity can be cloned into the FCS-hGH expression vector and tested for CRD behavior that can be reversed by that smaU molecule (or related molecules).
  • any polypeptide including one that is apparently not normaUy secreted, and that has no known smaU molecule binding activity — can be tested.
  • the candidate CRD-FCS-hGH expression construct can be first tested for retention of hGH.
  • ceUs containing the construct can be chaUenged in separate experiments with a diverse set of candidate small molecules in order to identify a molecule that can promote secretion of the retained fusion proteins.
  • Suitable sets of molecules include coUections of natural products, and the members of synthetic or semi-synthetic combinatorial hbraries. Screening may be expedited by arraying cells in 96- or 384-weU plates to enable robotic high- throughput set-up and analysis of experiments.
  • CRDs that are mutants of a natural protein, chosen for the property of being selectively retained in the absence of a given small molecule
  • Mutations can be chosen to optimize the likelihood of inducing a change in the properties of the protein that results in conditional retention.
  • Mutations of particular interest are those anticipated to disrupt the efficient folding of the protein: such proteins might be subject to retention via the ER quality control system.
  • Example mutations include gain-of-size mutations of side chains that constitute the hydrophobic core of the protein; and alterations of other residues of critical importance in secondary or tertiary structural features, such as glycine residues at beta-turn motifs.
  • Other amino acids of interest are those that form, or are close to, the smaU molecule binding site.
  • Mutants with reduced folding efficiency are preferred because such changes are most Ukely to be stabilized by binding of a smaU molecule, providing a mechanism for selective smaU molecule-mediated release of retained proteins.
  • knowledge of the three-dimensional structure of a candidate CRD can be of great use in focusing mutagenesis to key positions.
  • Both singly and multiply mutated proteins can be engineered and tested. Often, the best variant protein will be altered at several positions. Identifying the best combination of changes at multiple residues by iterative screening of mutants can be tedious and time-consuming.
  • An alternative is the use of selection procedures, in which a large set of mutants is created and then subjected en masse to a selection step to identify the best mutants directly. See Clackson and WeUs (Trends Biotech 1994 12: 173).
  • the expression vector described above is altered by exchanging the hGH coding sequence for DNA encoding a cell surface marker, such as CD2 or the p75 low affinity nerve growth factor receptor.
  • the extracellular and transmembrane domains of ceU surface marker are included, but most of the intraceUular domain is preferably deleted to remove the potential for signaling through the receptor.
  • a suitable expression vector using p75 is shown in Figure 10B, where ECD and TM are respectively the extracellular and transmembrane domains of p75.
  • genes encoding the candidates are ligated into the polylinker to create a library.
  • the library is introduced into mammalian cells by estabUshed methods.
  • Methods should ideally be chosen that (i) lead to a low number of variants being introduced into each ceU, so that the properties of variants can be tested individually, and (u) provide stable introduction of the vector so that cells can be propogated and selected through multiple rounds.
  • a preferred approach is therefore to construct the library in a retroviral vector followed by retroviral infection of cells, since this results single- or low-copy stable integration of the vector.
  • CRDs can be performed directly or indirectly. Direct screening is performed using a fluorescence-activated ceU sorter, in two stages. In the first stage, cells harboring the library of CRD candidates are grown in culture and then incubated with a fluorescently-labeled antibody to the p75 ECD. Cells containing a clone for an active CRD wiU not bind, as p75 wiU be retained in the secretory apparatus. However ceUs harboring ineffective CRDs wUl bind as the protein wUl not be retained. The labeled cells are sorted by FACS and ceUs that are not stained are gated and retrieved, and aUowed to grow again in culture.
  • the sort can optionaUy be repeated several times with a progressively higher gate, in order to isolate the cells expressing lowest levels of p75.
  • a candidate CRD ligand (chosen as described above) is added and then the labeling process repeated. Now the cells with effective CRDs wiU be labeled, since the retained p75 will be released by the CRD hgand.
  • the cells are sorted by FACS and the labeled ceUs are isolated. Again, the selection step can be repeated if desired. Once a suitable population of ceUs has been isolated, the variants that are conferring the CRD activity can be identified by isolating the genomic DNA of the ceUs followed by PCR amplification with primers located each side of the vector polylinker .
  • the PCR products can then be cloned and sequenced.
  • the ability of the identified variants to act as CRDs can be confirmed by cloning them individually into the hGH expression vector followed by testing as described earUer. Indirect screening may be accomplished by determining whether the CRD directs surface localization of a membrane protein which can then activate a signaling pathway.
  • the mutants introduced can be targeted to the residues of interest indicated earher, or can randomly incorporated.
  • alanine-scanning mutagenesis Cunningham and WeUs (1989) Science 244 1081-1085
  • degenerate primer-mediated 'Kunkel' mutagenesis See eg.
  • CRDs that are proteins that self-aggregate in a small molecule-reversible manner. Methods to identify proteins that interact with one another are well known.
  • a commonly used technique is the two-hybrid system, in which one partner is fused to a DNA binding domain and the other to an transcriptional activation domain. Interaction of the partners reconstitutes thae transcription factor, activating transcription of a reporter gene that can be identified by screening (eg. production of beta-galactosidase or SEAP) and/or that leads to cell survival and therefore provides a means for selecting for interacting partners (eg. his gene transcription in a his- strain of yeast).
  • Two-hybrid assays can be performed in yeast or mammalian cells and methods are well known in the art.
  • a preferred embodiment is based on the vectors and ceUs described by Rivera et al. (Nature Med 1996 2, 1028-1032).
  • Two expression vectors are constructed for chimeric transcription factors in which the candidate CRD is fused to the hybrid DNA domain ZFHD1 (in one case) and to an activiation domain of NF-kB p65 subunit, such as amino acids 361-550 (in the other).
  • These vectors are transiently or stably transfected into mammalian ceUs, for example HT1080 cells, together with a SEAP reporter gene under the control of ZFHD1 binding sites. Aggregation of the candidate CRDs results in reconstitution of an active transcription factor and therefore prodiction of SEAP.
  • Presence of more than one aggregating domain may increase the apparent affinity of the aggregative interaction by virtue of the avidity effect.
  • Either natural or mutated proteins can be tested for CRD activity. Mutants of natural proteins are likely to provide good sources of CRDs as examples are known on the literature of aggregative activity induced by point mutations: for example sickle-cell hemoglobin, or alpha-1 antitrypsin as described earlier. Thus, large sets of mutants of a candidate protein can be cloned into two-hybrid vectors as described above, and tested for aggregative activity that can be reduced by addition of a small molecule. The criteria that dictate choice of positions to mutate will largely be the same as those described above for screening for CRDs directly in a secretion system (2 above); in addition, mutants that aggregate might be provided by converting polar surface residues to less polar amino ones. Single or multiple mutants can be engineered, using methods as described above.
  • CRD cand is the candidate CRD: a hbrary of candidates (eg mutant proteins) is inserted here.
  • DBD and AD are the DNA binding and activation domains of a transcription factor.
  • a and D indicate donor and acceptor splice sites, stop indicates a translational stop codon.
  • the CRD exon wUl be spliced to both DBD and AD exons.
  • Repressor protein comprises an amino terminal DNA binding domain (amino acids 1-92) joined by a 40 amino acid flexible linker to a C-terminal dimerization domain.
  • the isolated N-terminal domain binds very weakly to DNA sue to inefficient dimer formation. High affinity DNA binding can be restored by fusing the domain to a heterlogous dimerization domain, such as the GCN4 leucine zipper.
  • a selection system is therefore possible in which phage immunity is used as a selection for interacting proteins.
  • the candidates are cloned in frame with the repressor N-terminus and the hbrary transformed into E.coli.
  • Genes for proteins that aggregate are isolated from colonies that survive on plates containing high titers of lambda phage. These colonies can then be restreaked on to plates containing both lambda phage and candidate CRD hgand. If the ligand dissociates the aggregates, the E.coli wiU now no lolnger grow on these plates.
  • Lambda repressor selection has several advantages for identifying CRDs, including the fact that the system is suitable for screening homodimers, and the large hbrary sizes that can be obtained through the use of E.coli.
  • Another way to directly test whether a protein can act as a CRD in living cells is to fuse its coding sequence to green fluorescent protein (GFP) or variants thereof. Cells expressing such a fusion protein can then be examined directly by fluorescent microscopy to examine whether the CRD candidate appears to cause aggregates of the GFP. Candidate CRD hgands can then be added to determine whether the aggregates then dissociate. Once a CRD candidate has been identified by any of these methods, it can be tested for activity as a CRD by use of the methods outlined in section 1.
  • GFP green fluorescent protein
  • the Ugand may be administered to a human or non-human subject using pharmaceuticaUy acceptable materials and methods of administration.
  • pharmaceuticaUy acceptable materials and methods of administration Various formulations, routes of administration, dose and dosing schedule may be used for the administration of Ugand, depending upon factors such as the condition and circumstances of the recipient, the response desired, the biological hah-Ufe and bioavailability of the ligand, the biological half-hfe and specific activity of the target protein product, the number and location of engineered ceUs present, etc.
  • the drug may be administered parenterally, or more preferably orally.
  • the most preferable route of administration are those in which a rapid onset of response occurs; such methods include, for example, sublingual, buccal, skin patch and inhalation.
  • Dosage and frequency of administration will depend upon factors such as described above.
  • the drug may be taken orally as a pUl, powder, or dispersion; buccally; sublingually; injected intravascularly, intraperitoneally, subcutaneously; or the like.
  • the drug may be formulated using conventional methods and materials well known in the art for the various routes of administration. The precise dose and particular method of administration wiU depend upon the above factors and be determined by the attending physician or healthcare provider.
  • the particular dosage of the drug for any application may be determined in accordance with conventional approaches and procedures for therapeutic dosage monitoring.
  • a dose of the drug within a predetermined range is given and the patient's response is monitored so that the level of therapeutic response and the relationship of protein secretion over time may be determined.
  • the drug is to be administered chronically, once a maintenance dosage of the drug has been determined, one may conduct periodic follow-up monitoring to assure that the overaU therapeutic response continues to be achieved.
  • an antagonist of the drug may be adr inistered.
  • An antagonist is a compound which binds to the drug or drug-binding domain to inhibit interaction of the drug with the fusion protein(s) and thus inhibit the downstream biological event.
  • an antagonist can be administered in any convenient way, particularly intravascularly or by inhalation/nebulization, if a rapid reversal is desired.
  • Drugs for use in this invention can exist in free form or, where appropriate, in salt form.
  • the preparation of a wide variety of pharmaceutically acceptable salts is well-known to those of skiU in the art.
  • Pharmaceutically acceptable salts of various compounds include the conventional non-toxic salts or the quaternary ammonium salts of such compounds which are formed, for example, from inorganic or organic acids of bases.
  • the drugs may form hydrates or solvates. It is known to those of skill in the art that charged compounds form hydrated species when lyophilized with water, or form solvated species when concentrated in a solution with an appropriate organic solvent.
  • the drugs can also be administered as pharmaceutical compositions comprising a therapeuticaUy (or prophylacticaUy) effective amount of the drug, and a pharmaceutically acceptable carrier or excipient.
  • Carriers include e.g. saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof, and are discussed in greater detaU below.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • the composition can be a liquid solution, suspension, emulsion, tablet, pUl, capsule, sustained release formulation, or powder.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, ceUulose, magnesium carbonate, etc. Formulation may involve mixing, granulating and compressing or dissolving the ingredients as appropriate to the desired preparation.
  • the pharmaceutical carrier employed may be, for example, either a sohd or liquid.
  • Illustrative sohd carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, stearic acid and the like.
  • a solid carrier can include one or more substances which may also act as flavoring agents, lubricants, solubilizers, suspending agents, fUlers, gUdants, compression aids, binders or tablet-disintegrating agents; it can also be an encapsulating material.
  • the carrier is a finely divided solid which is in admixture with the finely divided active ingredient.
  • the active ingredient is mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired.
  • the powders and tablets preferably contain up to 99% of the active ingredient.
  • suitable solid carriers include, for example, calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, ceUulose, methyl ceUulose, sodium carboxymethyl ceUulose, polyvinylpyrroUdine, low melting waxes and ion exchange resins.
  • IUustrative liquid carriers include syrup, peanut oil, olive oil, water, etc. Liquid carriers are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions.
  • the active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water, an organic solvent, a mixture of both or pharmaceuticaUy acceptable oUs or fats.
  • the liquid carrier can contain other suitable pharmaceutical additives such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colors, viscosity regulators, stabilizers or osmo-regulators.
  • liquid carriers for oral and parenteral administration include water (partially containing additives as above, e.g. ceUulose derivatives, preferably sodium carboxymethyl ceUulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil).
  • the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate.
  • Sterile liquid carders are useful in sterile Uquid form compositions for parenteral administration.
  • the Uquid carrier for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propeUant.
  • Liquid pharmaceutical compositions which are sterile solutions or suspensions can be utilized by, for example, intramuscular, intraperitoneal or subcutaneous injection. Sterile solutions can also be administered intravenously. The drugs can also be administered oraUy either in hquid or solid composition form.
  • the carrier or excipient may include time delay material well known to the art, such as glyceryl monostearate or glyceryl distearate along or with a wax, ethylcellulose, hydroxypropylmethylcellulose, methylmethacrylate and the like.
  • time delay material well known to the art, such as glyceryl monostearate or glyceryl distearate along or with a wax, ethylcellulose, hydroxypropylmethylcellulose, methylmethacrylate and the like.
  • 1,2-propylene glycol A. Nattermann & Cie. GmbH
  • 1,2-propylene glycol A. Nattermann & Cie. GmbH
  • the preparation can be tableted, placed in a hard gelatin capsule in powder or pellet form or in the form of a troche or lozenge.
  • the amount of solid carrier wiU vary widely but preferably wUl be from about 25 mg to about 1 g. If a liquid carrier is used, the preparation wiU be in the form of a syrup, emulsion, soft gelatin capsule, sterile injectable solution or suspension in an ampule or vial or nonaqueous hquid suspension.
  • a pharmaceuticaUy acceptable salt of the drug may be dissolved in an aqueous solution of an organic or inorganic acid, such as a 0.3M solution of succinic acid or citric acid.
  • acidic derivatives can be dissolved in suitable basic solutions. If a soluble salt form is not available, the compound is dissolved in a suitable cosolvent or combinations thereof. Examples of such suitable dissolved in a suitable cosolvent or combinations thereof.
  • suitable cosolvents include, but are not limited to, alcohol, propylene glycol, polyethylene glycol 300, polysorbate 80, glycerin, polyoxyethylated fatty acids, fatty alcohols or glycerin hydroxy fatty acids esters and the like in concentrations ranging from 0-60% of the total volume.
  • Suitable routes of administration to a patient are oral, sublingual, transdermal (patch), intranasal, pulmonary or bucal.
  • Methods of introduction also could include but are not limited to dermal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, epidural, ocular and (as is usually preferred) oral routes.
  • the drug may be administered by any convenient or otherwise appropriate route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologicaUy active agents. Administration can be systemic or local. For ex vivo apphcations, the drug will be delivered as a hquid solution to the ceUular composition.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic to ease pain at the side of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • composition is administered by injection
  • an ampoule of sterUe water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the compound may be disposed within devices placed upon, in, or under the skin. Such devices include patches, implants, and injections which release the compound into the skin, by either passive or active release mechanisms.
  • the compound may be administered to patients in need of such treatment in a dafly dose range of about 1 to about 2000 mg per patient.
  • the dose administered it is preferred that the dose administered be below that associated with undue immunosuppressive effects.
  • the amount of a given drug which wiU be effective in the treatment or prevention of a particular disorder or condition wiU depend in part on the severity of the disorder or condition, and can be determined by standard clinical techniques.
  • in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges.
  • Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the precise dosage level should be determined by the attending physician or other health care provider and wiU depend upon well known factors, including route of administration, and the age, body weight, sex and general health of the individual; the nature, severity and clinical stage of the disease; the use (or not) of concomitant therapies; and the nature and extent of genetic engineering of cells in the patient.
  • the drugs can also be provided in a pharmaceutical pack or kit comprising one or more containers fiUed with one or more of the ingredients of the pharmaceutical compositions.
  • OptionaUy associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceutical or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • Example 1 Generation of domains and vectors used for expression of F.36M) fusion proteins.
  • Vectors for driving expression of fusion proteins were derived from the mammalian expression vector pCGNN (Attar and Gilman, MCB 12:2432-2443, 1992). Inserts cloned as Xbal-BamHI fragments into pCGNN are transcribed under the control of the human CMV promoter and enhancer sequences (nucleotides -522 to +72 relative to the cap site), and are expressed with an N-terminal nuclear localization sequence (NLS; from SV40 T antigen) and epitope tag (a 16 amino acid portion of the H. influenzae hemaglutinin gene).
  • NLS nuclear localization sequence
  • epitope tag a 16 amino acid portion of the H. influenzae hemaglutinin gene
  • pCGNN was modified by site directed mutagenesis with ohgonucleotides VR65, VR119, and VR120 to create pC4EN.
  • the resulting plasmid has unique restriction sites upstream of the CMV enhancer /promoter region (Mlul) and between the promoter and protein coding region (EcoRI).
  • VR65 TCCCGCACCTCTTCGGCCAGCGaaTTccAGAAGCGCGTAT VR119: GACTCACTATAGGaCGcgTTCGAGCTCGCCCC VR120: CATCATTTTGGCAAAGgATTCACTCCTCAGG
  • fusion proteins Individual components of fusion proteins were generaUy produced as fragments containing an Xbal site immediately upstream of the first codon and a Spel site, an in-frame stop codon, and a BamHI site immediately downstream of the last codon.
  • Chimeric proteins comprising multiple components were assembled by stepwise insertion of Xbal-BamHI fragments into Spel-BamHI-opened vectors or by insertion of Xbal-Spel fragments into Xbal or Spel-opened vectors.
  • F(36M) in which the phenylalanine at amino acid 36 was changed to methionine, was created by mutagenizing a single FKBP domain, cloned into pCGNN with upstream Xbal and downstream Spel and BamHI sites (Rivera et al., Nat. Med 2:1028-1032, 1996) with oligo VR1 to create pCGNN-F(36M). Two, 3, 4 and 6 tandem copies of F(36M) were created by the stepwise insertion of Xbal-BamHI fragments into Spel-BamHI-opened vectors.
  • EGFP coding sequence was amplified from pEGFP-1 (Clontech) with oligos VR2 and VR3. The resulting fragment, with upstream Xbal and downstream Spel sites was inserted into pCGN, a derivative of pCGNN that lacks the SV40 nuclear localization sequence, to create pCGN-EGFP.
  • VR2 tctagaGTGAGCAAGGGCGAGGAG
  • VR3 ggatccttaTTAACTAGTCTTGTACAGCTCGTCCATG
  • F(36M)-EGFP fusions were created by inserting Xbal-Spel fragments containing 3, 4 or 6 copies of F(36M) into the Xbal site of pCGN-EGFP to create pCGN-F(36M)3-EGFP, pCGN-F(36M)4-EGFP, and pCGN-F(36M)6-EGFP .
  • hGH cDNA (506-81) was obtained by RT-PCR amplification of RNA expressed from a ceU line containing a genomic hGH gene (Rivera et al., Nat. Med 2:1028-1032, 1996) using ohgos VR109 and VRllO to amplify the region from 40 bp upstream of the ATG to 60 bp after the stop codon.
  • the resulting Hindlll to EcoRI fragment was cloned into Z12TPL-2, a derivative of ZHWTxl2-IL2-SEAP (Rivera et al., Nat. Med 2:1028-1032, 1996) in which the SEAP gene and SV40 early intron and polyadenylation signal were replaced by a polylinker and the SV40 late polyadenylation signal.
  • VR109 aagcttACCACTCAGGGTCCTGTGG VRllO: gaattcGTGGCAACTTCCA
  • Z12I-hGH-2 was mutagenized with ohgos VR185, VR186, and VR187 to create i) an EcoRI site 32 bp upstream of the ATG, ii) an Xbal site immediately after the last amino acid of the signal sequence and iii) a Spe I site immediately after the last amino acid of hGH.
  • VR185 cacaggaccctG A ATTCtaagcttgtggc
  • VR186 ATAAGGGAATGGTtctagaGGCACTGCCCT
  • VR187 atgccacccgggactagtGAAGCCACAGCTG
  • a Spel-BamHI fragment encoding an FCS-hGH fusion protein was generated by amplification of the hGH cDNA with oligos VR4 and VR5.
  • VR4 actagtGCTAGAAACCGTCAGAAGAGATTCCCAACCATTCCCTTAAGC
  • VR5 ggatcccgggCTAGAAGCCACAGCTGCCCTC
  • a human insulin cDNA was obtained by RT-PCR amplification of human pancreas polyA+ RNA (Clontech) using ohgos VR220 and VR221 to amphfy the region from 9 bp upstream of ATG (EcoRI) to 13 bp after stop codon (BamHI). The resulting EcoRI-BamHI fragment was cloned into pC4EN to generate pC4-hIn.
  • VR220 cGAATTCttctgccATGGCCCTGTGGATGCGC
  • VR221 cGGATCCgcaggctgcgtCTAGTTGCAGTAG
  • a Spel-BamHI fragment encoding an furin cleavage sequence-insulin fusion protein was generated by RT-PCR amplification with oligos VR222 and VR221.
  • VR222 cACTAGTGCTAGAAACCGTCAGAAGAGATTTGTGAACCAACACCTGTGCGGC
  • VR221 cGGATCCgcaggctgcgtCTAGTTGCAGTAG
  • Zif268 sequences were amplified from a cDNA clone by PCR using primers 5'Xba/Zif and 3'Zif +G.
  • Octl homeodomain sequences were amplified from a cDNA clone by PCR using primers 5'Not Oct HD and Spe/Bam 3'Oct.
  • the Zif268 PCR fragment was cut with Xbal and Notl.
  • the Octl PCR fragment was cut with Notl and BamHI.
  • pCGNNZFHDl pCGNNZFHDl in which the cDNA insert is under the transcriptional control of human CMV promoter and enhancer sequences and is linked to the nuclear localization sequence from SV40 T antigen.
  • the plasmid pCGNN also contains a gene for ampicillin resistance which can serve as a selectable marker.
  • An expression vector for directing the expression in mammahan ceUs of a chimeric transcription factor containing the composite DNA-binding domain, ZFHD1, and a transcription activation domain from p65 (human) was prepared as follows.
  • the sequence encoding the C-terminal region of p65 containing the activation domain (amino acid residues 450-550) was amplified from pCGN-p65 using primers p65 5' Xba and p65 3' Spe/Bam.
  • the PCR fragment was digested with Xbal and BamHI and hgated between the the Spel and BamHI sites of pCGNN ZFHD1 to form pCGNN ZFHD-p65AD.
  • the P65 transcription activation sequence contains the following linear sequence:
  • Example 2 Identification and synthesis of a ligand for the conditional retention domain F36M FKBP.
  • AP21998 and AP22542 are ligands of FKBP that have particular utility for CAD applications, because they bind with high affinity to F36M-FKBP but poorly to the wild- type protein, and are thus anticipated to lead to minimal interactions with the endogenous proteins during in vivo apphcations.
  • the design and assay of such "bumped" hgands that target a hole created by truncating FKBP residue Phe36 have been described (Clackson et al., Proc. Natl. Acad. Sci. USA 95:10437-10442, 1998).
  • AP 21998 was prepared via DCC/DMAP-mediated coupling of the previously described acid AP 1867 (compound 5S in Clackson et al., Proc. Natl. Acad. Sci. USA
  • AP 21998 A solution of AP 1867 (5.0 g, 7.21 mmol) in CH2C12 (5.0 mL) at 0 ° C was treated with DCC (178 mg, 0.79 mmol) followed 30 min later by N,N-dimethyl-l,3-propanediamine (880 mg, 8.65 mmol) and DMAP (5 mg). The reaction mixture was allowed to warm to room temperature and stir for 5 h, after which time the reaction mixture was diluted with EtOAc (50 L), filtered, and the filtrate extracted with a 5% aqueous citric acid solution (3 x 20 ml). The acid extract was then made basic by the addition of solid NaHCO3 and extracted with EtOAc (3 x 50 mL).
  • the reaction mixture was allowed to stir for 3.5 h, after which time the solution was dUuted with EtOAc (100 mL), washed with water (15 mL), a 5% aqueous citric acid solution (25 mL), a saturated Na2CO3 solution (10 mL), water (15 mL), and finally brine (15 mL).
  • the organic phase was dried over MgSO4 and concentrated to a yellow oil which was then dissolved in MeOH (14 mL).
  • the methanohc solution was treated with water (1 mL) followed by lithium hydroxide monohydrate (0.620 g, 14.78 mmol).
  • Example 3 The conditional retention domain F(36M) FKBP; studies with hGH
  • F(36M) could function as a conditional retention domain to enable regulated secretion of a fused heterologous protein
  • This fusion protein contains a signal sequence from the human growth hormone (hGH) gene, 4 copies of the F(36M) domain, a furin cleavage sequence from human stromelysin 3 and coding sequence from the mature hGH protein.
  • the resulting fusion protein in essence, simply contains F(36M) domains and a furin cleavage signal inserted at the cleavage site between the signal sequence and the mature hGH peptide sequence. Since the furin recognition sequence is N-terminal to the cleavage site it can be situated so that appropriate cleavage will generate the same hGH amino acid sequence as that generated by natural cleavage of its own signal sequence.
  • cell lines were generated by stably transfecting the F(36M)-hGH expression vector into HT1080 cells.
  • the native hGH gene driven by the same CMV enhancer was also stably transfected into cells.
  • the selectable marker was expressed from the same transcript as the wt hGH or F(36M)-hGH fusion proteins through the use of an internal ribosome entry signal. Equivalent numbers of clones were obtained, suggesting the there was no toxic effect of the fusion protein.
  • the constitutive rate of secretion from the HT88 ceU line was very similar to the rate of secretion from the HT89 cell line which had been stably transfected with the wild type hGH protein (lane 4).
  • the F(36M) domains have no detectable "retention" activity.
  • EGFP coding sequence was incorporated in the fusion protein as shown in Figure 2C.
  • the fusion protein was visible as large green spots concentrated at multiple points in the perinuclear space.
  • Co-localization experiments demonstrated that the fusion protein is aggregated and retained within the ER, as predicted (J. Rothman, data not shown).
  • the aggregates disperse over the next 15 to 60 minutes. This disaggregation coincides with the appearance of hGH protein in the supernatant of the cells.
  • ligand induces a several hundred fold increase in hGH (data not shown).
  • cell lvsates and supernatants were prepared from the HT88 cells that had been incubated in the presence or absence of ligand for 2 hours. These samples were then immunoblotted with anti-hGH and anti-FKBP antibodies. As shown in Figure 4, in the absence of ligand an approximately 75 kDa-sized band, which corresponds to the expected size of the F(36M)-hGH fusion protein, is detected in the lysate (lane 1) but not the supernatant (lane 3) of unstimulated cells with both the anti-hGH and anti-FKBP antibodies.
  • the anti-hGH blot shows the presence of a 22 kDa sized protein (lane 6) that co-migrates with purified recombinant hGH (lane 7).
  • the anti-FKBP blot shows the presence of a 53 kDa protein that is around the expected size of the remainder of the fusion protein (F(36M)-FCS).
  • hGH secreted from HT88 cells in response to ligand is dose-dependent (Fig 5A). Peak level of secretion occurs at approximately 2-3 uM AP21998 with half-maximal secretion occurring at 600 nM.
  • Group C shows that if the ceUs are exposed to ligand following the large bolus release, within 2 hours the rate of secretion matches that of the constitutively producing cells (group A). Since the constitutive rate of hGH production is only about 75 ng/million cells/hr while 1250 ng/million cells is released in the first hour after the stores are emptied, it should take some time for the stores to be refilled. As shown in Figure 6B, when the stored hGH is released by incubation with maximal concentration of ligand, it takes between 8-24 hours for the stores to be refilled so that the magnitude second bolus release matches that of the first (or exceeds it since the ceU number has increased in the time).
  • the degree of aggregation increases as the number of F(36M) domains increases.
  • constructs containing 2, 3 or 6 F(36M) domains were fused to hGH, stable cell lines generated and hGH secreted in the presence and absence of ligand assayed.
  • the basal secretion in the absence of ligand increases as the number of F(36M) domains decreases. This likely reflects a reduction in the size of aggregates which permits monomeric fusion proteins to escape retention.
  • An increase in the "leakiness" of fusion protein secretion is also reflected as a decrease in the amount of stored fusion protein and, hence, the amount of protein released in bolus upon addition of Ugand. It may be possible to exploit this to provide transient high level induced secretion against a back drop of relatively high constitutive basal secretion. Such a situation may be particularly desirable in the case of insulin production for the treatment of type 1 diabetes.
  • F(36M) conditional retention domain
  • a fusion protein of the design shown in Figure 3D was constructed.
  • This fusion protein is analogous to the F(36M)4-hGH fusion protein described in example X, except the mature hGH coding sequence has been replaced by coding sequence from the mature human insulin gene.
  • proinsuUn is processed into the mature, active, A and B chain complex by endopeptidases that are expressed exclusively in neuroendocrine cells.
  • F(36M)4-hIn-m3 A vector driving expression of this F(36M)-insulin fusion protein (F(36M)4-hIn-m3) was transiently transfected into HT1080 cells.
  • vectors driving the expression of insulin protein alone, with (hln-m3) or without (hln-wt) the three mutations were also transfected.
  • the medium was washed away and fresh medium added, without or with increasing concentrations of the monomeric ligand, AP21998.
  • the amount of insulin secreted into the medium was determined by ELISA using an assay that recognizes an epitope within the C-peptide (ALPCO).
  • ALPCO assay that recognizes an epitope within the C-peptide
  • Example 7 Regulated expression of a membrane tethered protein
  • F(36M) could also be used to regulate surface expression of a membrane-tethered protein
  • 3, 4, or 6 copies of F(36M) were fused to the extracellular and transmembrane portions of the low-affinity nerve growth factor receptor (LNGFR; Figure 3E).
  • LNGFR low-affinity nerve growth factor receptor
  • the F(36M) domains should be localized to the cytoplasm and tethered to the plasma membrane, in contrast to the hGH and insulin fusions described in examples 3 and 6, in which the F(36M) domains were expressed as part of a soluble protein that localized initially to the lumen of the ER.
  • Surface expression was assessed by FACS analysis using anti-LNGFR antibodies (Chromaprobe, Mountain View, CA).
  • F(36M) domains can also be used to conditionally induce surface epxression of a membrane-tethered protein.
  • Example 8 Construction and testing of a construct for conditional secretion of hGH using rat retinol binding protein as a CRD
  • Rat retinol binding protein (rRBP) is conditionally retained in the ER of a variety of cell types unless retinol is added (Melhus et al., J Biol Chem 1992 vol 26712036-12041), and so is a suitable candidate for use as a CRD.
  • rRBP Rat retinol binding protein
  • the construct comprises the rRBP cDNA, including the authentic signal sequence (SS), foUowed by sequence encoding the furin cleavage site (FCS) derived from stromelysin E (the amino acid sequence SARNRQKR), and then the mature 191 amino acid cDNA coding sequence of hGH (lacking the signal sequence) followed by an in-frame stop codon.
  • SS authentic signal sequence
  • FCS furin cleavage site
  • hGH lacking the signal sequence
  • the stromelysin E cleavage site was chosen because it is of human origin (and therefore expected to be minimally immunogenic in future human therapeutic applications), and because it is known to be recognised by furin in the context of fusion to proteins where the PI' residue — the residue following the cleavage site — is Phe, as in hGH (for a review see Denault and Leduc, FEBS Lett 1996 vol 379, 113-116).
  • AU junctions between the various sequence motifs and domains are direct and include no additional sequence, with the exception of an additional threonine codon between rRBP and FCS to accommodate the Spel site.
  • the expression cassette was cloned into the expression vector pC4EN, placing expression under the control of the strong hCMV immediate early promoter and enhancer.
  • a DNA fragment encompassing the rRBP cDNA was obtained by RT-PCR from rat liver poly A+ RNA (obtained from Clontech, catalog # 6710-1) using the Clontech first strand kit with random primers, followed by PCR under conventional amplification conditions using primers RBP-5' (263) and RBP-3' (264). The PCR product was purified and digested with EcoRI and Spel. A second DNA fragment encoding the FCS and mature hGH coding sequence was obtained by PCR amplification from the hGH cDNA expression vector Z12IHB .
  • FCS-hGH-5' (265) and hGH-3' (266); primer FCS-hGH-5' (265) includes additional sequence that encodes the FCS.
  • the PCR product was purified and digested with Spel and BamHI. The two DNA fragments were then cloned into EcoRI-BamHI-opened pC4EN in a three-way ligation to produce the final expression vector pC4EN-rRBP-hGH. Positive clones were completely sequenced to check that no errors were incorporated during cloning.
  • the construct contains restriction sites that can be used to add additional modules to the expressed fusion protein.
  • the stromelysin E FCS can be replaced with alternative cleavage sites by excising the existing Spel-AfUI fragment and cloning in an appropriate Spel-Aflll compatible oligonucleotide pair.
  • An epitope tag can be appended to the rRBP, upstream of the FCS, to allow irrununochemical tracking of the rRBP module inside ceUs.
  • Alternative target proteins can be cloned as Spel-Xmal fragments (the use of the 3' BamHI site is precluded by the existence of another BamHI site in the rRBP coding sequence).
  • Alternative CRDs can be cloned in place of rRBP as EcoRI-Spel fragments.
  • Particularly important additional constructs are those that incorporate multiple reiterated copies of rRBP. These are obtained by reamplifying pC4EN-rRBP-hGH using primers 5'-RBP-Xba and 3'-RBP-Spe, generating a fragment containing the mature rRBP sequence (no signal sequence) flanked by Spel-compatible 5' Xbal and 3' Spel sites. The PCR product is purified, digested with Xbal and Spel, and cloned into Spel-opened pC4EN-rRBP-hGH to generate pC4EN-(rRBPx2)-hGH. An analogous procedure can be used to prepare constructs encoding higher order concatenates of rRBP.
  • RBP-5' (263) 5'CGTACgaattcCAGAAGCGCGTATGGAGTGGGTGTGGGCGCTCGTGCTG
  • RBP-3' 5'GCATGactagtCAAACTGTTTCTTGAGGGTCTGCTTTGACAG
  • the sequence of the expression cassette is as foUows (key restriction sites underlined):
  • sequence of the encoded protein is as follows:
  • the nucleotide sequence of the expression cassette is as foUows:
  • CTTCTGAC AACTGGGAAGTGTGTGCAGACATGGTGGGCACTTTCACAC ⁇ TACAGAAGATCCTGCCAAG
  • TTCCCTTAAGCAGC CTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAG TTTGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTC
  • pC4EN-rRBP-hGH, pC4EN-(rRBPx2)-hGH and their derivatives are transiently transfected into the human fibrosarcoma cell line HT1080 using standard methods (eg see Rivera et al., Nature Med 2: 1028-1032 1996; Amara et al., PNAS 94:10618-10623 1997). After overnight incubation, medium is removed and new medium added, containing either no drug or retinol at various concentrations.
  • the amount of hGH secreted into the medium is determined by radioimmunoassay (Rivera et al., Nature Med 2: 1028-1032 1996).
  • Example 9 Physiological effects of regulated insulin secretion in vivo
  • HTlOl-lOp cells were implanted intramuscularly into male nu/nu mice.
  • HTlOl-lOp ceUs were generated by stably transfecting HT1080 cells with a vector that drives expression of the F(36M)4- hln-m.3 fusion protein.
  • Mice were made hyperglycemic by treatment 2 days earlier with 300 mg/kg streptozotocin (STZ). As shown in Figure 11a, STZ treatment elevates serum glucose levels to -350 mg/dl from -100 mg/dl seen in non-STZ treated mice.
  • AP22542 an analog of AP2 1998.
  • serum samples were coUected and assayed for insulin (Ultrasensitive human insulin-specific RIA, Linco) and glucose (Sigma) concentrations.
  • insulin Ultrasensitive human insulin-specific RIA, Linco
  • glucose Sigma
  • mice implanted with 2 x 10e7 HTlOl-lOp cells were administered a single dose of 30 mg/kg AP22542 intravenously.
  • Serum glucose levels were measured at various times between 5 minutes and 10 hours later.
  • serum glucose levels are indistinguishable from animals treated with vehicle.
  • serum glucose levels have declined to 50 mg/dl from initial levels of nearly 500 mg/dl. This effect is transient as serum glucose levels rise to 350 mg/dl within 5 hours and return to baseline between 6 and 10 hours later.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Diabetes (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des matériaux et des méthodes impliquant des domaines de rétention conditionnelle (CRD). L'invention concerne également des protéines de fusion contenant des CRD et des cellules exprimant lesdites protéines de fusion. Elle concerne, en outre, de nouvelles méthodes de production de protéines cible in vivo, à l'aide de protéines de fusion contenant des CRD, et des méthodes d'identification des nouveaux CRD.
EP99955001A 1998-10-19 1999-10-19 Materiaux et methodes impliquant des domaines de retention conditionnelle Withdrawn EP1144655A2 (fr)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US17479998A 1998-10-19 1998-10-19
US10474698P 1998-10-19 1998-10-19
US104746P 1998-10-19
US13778799P 1999-06-02 1999-06-02
US137787P 1999-06-02
PCT/US1999/024327 WO2000023602A2 (fr) 1998-10-19 1999-10-19 Materiaux et methodes impliquant des domaines de retention conditionnelle
US174799 2002-06-19

Publications (1)

Publication Number Publication Date
EP1144655A2 true EP1144655A2 (fr) 2001-10-17

Family

ID=27379809

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99955001A Withdrawn EP1144655A2 (fr) 1998-10-19 1999-10-19 Materiaux et methodes impliquant des domaines de retention conditionnelle

Country Status (5)

Country Link
EP (1) EP1144655A2 (fr)
JP (1) JP2002535959A (fr)
AU (1) AU1121000A (fr)
IL (2) IL142137A0 (fr)
WO (1) WO2000023602A2 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7374930B2 (en) * 2002-05-21 2008-05-20 Expression Genetics, Inc. GLP-1 gene delivery for the treatment of type 2 diabetes
FR2968013A1 (fr) * 2010-11-29 2012-06-01 Cis Bio Int Methode de retention conditionnelle d'une proteine d'interet dans le reticulum endoplasmique
WO2015134365A2 (fr) * 2014-03-03 2015-09-11 Acharjee Sujata Protéine chimérique de dystrophine vsv-g pour traiter les dystrophinopathies
KR20220133318A (ko) * 2016-04-15 2022-10-04 노파르티스 아게 선택적 단백질 발현을 위한 조성물 및 방법
CN111629749A (zh) * 2017-10-18 2020-09-04 诺华股份有限公司 用于选择性蛋白质降解的组合物和方法
GB201805918D0 (en) * 2018-04-10 2018-05-23 Autolus Ltd Cell

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2000501171A (ja) * 1995-09-15 2000-02-02 メルク エンド カンパニー インコーポレーテッド 融合タンパク質を用いるハイスループットアッセイ

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0023602A3 *

Also Published As

Publication number Publication date
WO2000023602A2 (fr) 2000-04-27
AU1121000A (en) 2000-05-08
JP2002535959A (ja) 2002-10-29
WO2000023602A3 (fr) 2001-08-02
IL142137A (en) 2007-07-04
IL142137A0 (en) 2002-03-10

Similar Documents

Publication Publication Date Title
US6117680A (en) Compositions and methods for regulation of transcription
US6479653B1 (en) Compositions and method for regulation of transcription
US7067526B1 (en) 28-epirapalogs
US7196192B2 (en) 28-epirapalogs
AU766513B2 (en) Novel dimerizing agents, their production and use
US6187757B1 (en) Regulation of biological events using novel compounds
US6984635B1 (en) Dimerizing agents, their production and use
US20010049144A1 (en) Methods for high level expression of genes in primates
US7109317B1 (en) FK506-based regulation of biological events
JP2002508971A (ja) 多量体キメラ蛋白質を使用する生物学的イベントの調節
US6566073B1 (en) Materials and methods involving conditional retention domains
WO2000023602A2 (fr) Materiaux et methodes impliquant des domaines de retention conditionnelle
EP1123405A1 (fr) Materiaux et methodes impliquant des domaines d'agregation conditionnelle
AU1603900A (en) Fk506-based regulation of biological events

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010521

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

XX Miscellaneous (additional remarks)

Free format text: DERZEIT SIND DIE WIPO-PUBLIKATIONSDATEN A3 NICHT VERFUEGBAR.

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050225

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090219