EP1137944A2 - Expression differentielle dans le cas du cancer primaire du sein - Google Patents

Expression differentielle dans le cas du cancer primaire du sein

Info

Publication number
EP1137944A2
EP1137944A2 EP99959579A EP99959579A EP1137944A2 EP 1137944 A2 EP1137944 A2 EP 1137944A2 EP 99959579 A EP99959579 A EP 99959579A EP 99959579 A EP99959579 A EP 99959579A EP 1137944 A2 EP1137944 A2 EP 1137944A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
seq
sequence
nos
acid molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99959579A
Other languages
German (de)
English (en)
Inventor
Alan Gordon Ludwig Inst. For Cancer Res. MACKAY
Michael John Ludwig Inst. For Cancer Res. O'HARE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Institute for Cancer Research Ltd
Ludwig Institute for Cancer Research New York
Original Assignee
Ludwig Institute for Cancer Research Ltd
Ludwig Institute for Cancer Research New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Institute for Cancer Research Ltd, Ludwig Institute for Cancer Research New York filed Critical Ludwig Institute for Cancer Research Ltd
Publication of EP1137944A2 publication Critical patent/EP1137944A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Definitions

  • This invention relates to nucleic acid molecules that are expressed differentially in primary breast cancer cells, when compared to normal luminal breast cells, and their expression products.
  • the invention relates to methods of identifying such nucleic acid molecules and to methods of treating and diagnosing disease, preferably breast cancer, involving the use of such nucleic acid molecules and their expression products.
  • the invention also relates to methods of treating disease, preferably breast cancer, using agents capable of modulating the expression of such nucleic acid molecules or the activity of their expression products, and to the use of such nucleic acid molecules and expression products in the identification of agents suitable for use in such methods.
  • the invention further relates to pharmaceutical preparations and diagnostic kits for use in the aforementioned methods.
  • tumour cell The phenotypic changes which distinguish a tumour cell from its normal counterpart are often the result of one or more changes in the genome of the cell.
  • Genes which are differentially expressed, that is to say either up or down regulated, in tumour cells, when compared to their normal counterparts, can be markers for the tumour phenotype.
  • the increased expression or up regulation or the loss of expression or down regulation of a gene can also be an essential event in the process of tumourigenesis.
  • tumour cells can provide a means of identifying a cell as a tumour cell.
  • Diagnostic compounds can be based on such genes, or the polypeptide products encoded by them, and used to determine the presence and location of tumour cells.
  • Such compounds can be nucleic acid sequences complimentary to all or parts of differentially expressed gene sequences or can be agents, such as antibodies, which bind preferentially to the polypeptide products of differentially expressed genes.
  • tumour phenotype e.g., unregulated growth or metastasis
  • it can be used to provide therapeutics, such as antisense nucleic acids or other inhibitors, which can reduce or substantially eliminate expression of that gene, or inhibit the activity of that gene's expression product, and thereby reduce or substantially eliminate the phenotype which depends on the expression of the gene.
  • Therapeutics such as antisense nucleic acids or other inhibitors, which can reduce or substantially eliminate expression of that gene, or inhibit the activity of that gene's expression product, and thereby reduce or substantially eliminate the phenotype which depends on the expression of the gene.
  • Polypeptides encoded by such genes often play a role in catalysing tumourigenic activity (e.g., unregulated growth or metastasis) and they, therefore, can be of assistance in the hunt for agents which will inhibit such activity.
  • the latter can include small molecule inhibitors or polypeptide binding agents which can bind to, occupy or occlude a catalytic site either on such a polypeptide, or on a receptor to which the polypeptide binds, to thereby make the catalytic site inaccessible and inhibit the biological activity of the polypeptide.
  • small molecule inhibitors include small peptides, or peptide like molecules.
  • genes which are preferentially down regulated in tumours can also provide a means of identifying a cell as a tumour cell.
  • Diagnostic compounds can be based on the normal gene, or its polypeptide product, and its absence in a cell sample used to determine the presence and location of tumour cells.
  • the normal gene when the normal gene is essential for the manifestation of a normal cell phenotype (e.g., regulated growth), it can be reintroduced by in vivo gene therapy, or the polypeptide which it encodes can be administered in a pharmaceutical preparation, and restoration of the normal cell phenotype may be possible.
  • tumour specific expression of genes suggests that such genes can encode proteins which could be recognised by the immune system as foreign and thus provide a target for tumour rejection.
  • the polypeptide products of tumour specific genes can, for example, comprise peptides which complex with HLA-Class I and thus can be the targets for host immune surveillance and provoke selection and expansion of one or more clones of cytotoxic T lymphocytes specific for the tumour specific gene product. Sequences within polypeptides that bind HLA can be identified using a computer algorithm that searches for HLA binding motifs (see http:Wbimas.dcrt.nih.gov and Parker et al. 1994, J.Immunol.
  • Examples of this phenomenon include proteins and fragments thereof encoded by the MAGE family of genes, the tyrosinase gene, the Melan-A gene, the BAGE gene, the GAGE gene, the RAGE family of genes, the PRAME gene and the brain glycogen phosphorylase gene.
  • the proteins encoded by such genes are known as "tumour rejection antigen precursors", or TRAPs, and they can be used to generate therapeutics for enhancement of the immune system response to tumours expressing such genes and proteins.
  • TRAPs tumor rejection antigen precursors
  • a discussion of TRAPs, the aforementioned TRAP genes, and their properties and uses can be found in O92/20356 (MAGE), WO 96/29409 (RAGE) and WO 97/49817 (Brain glycogen phosphorylase).
  • Fibroblast activation protein is a cell-surface glycoprotein which is rarely found in normal tissues, but which is expressed by reactive stromal fibroblasts of epithelial cancers, such as primary and metastatic colorectal carcinomas, and in the malignant mesenchymal cells of bone and soft tissue sarcomas.
  • FAP expressed by cultured fibroblasts consists of two sub-units, FAP ⁇ and FAP ⁇ .
  • Monoclonal antibodies which recognise FAP and both of its sub-units have been generated and their use to recognise cancer cells and, thus, in the detection and therapy of cancers has been proposed (see Rettig W.
  • the present inventors Rather than selecting those cells identified by monoclonal antibodies which recognise FAP as previously proposed, the present inventors, starting from solid breast tumour samples, selected only those cells which were not recognised by the antibodies and found, surprisingly, that the resulting FAP " cells consisted mainly of primary breast cancer cells and few contaminating stromal and non-malignant breast epithelial cells. In so doing, the present inventors solved the above discussed problem by providing an effective technique for preparing highly purified populations of primary breast cancer cells, from which they were able, in accordance with further aspects of the invention, to identify nucleic acid molecules which are differentially expressed in primary breast cancer cells and, hence, to arrive at the various further aspects of the invention, which will be discussed below.
  • tumour cells preferably primary breast tumour cells
  • an agent specific for fibroblast activation protein FAP
  • the agent can be an antibody and, preferably, is a monoclonal antibody specific for FAP, or a FAP epitope.
  • the antibody can be a monoclonal antibody which is specific for an epitope on the FAP ⁇ sub-unit.
  • the antibody can be any one of the monoclonal antibodies F19, FB23, FB58, FB52 or C48 disclosed by Rettig et al., Welt et al.
  • the present invention relates to a method for identifying a nucleotide sequence which is differentially expressed in a tumour cell, preferably a primary breast tumour cell, comprising carrying out a method of selecting tumour cells in accordance with the first aspect of the invention, deriving expressed nucleic acid sequences from said harvested tumour cells and from a sample of their normal counterparts, and comparing said sequences to identify those which are differentially expressed.
  • Said nucleic acid sequences can be derived by employing differential display PCR (see Liang P. and Pardee A.
  • DNA for amplification by differential display PCR can be obtained from RNA, extracted from both purified primary breast cancer cells obtained in the aforementioned manner and purified normal breast luminal epithelial cells obtained by immunomagnetic sorting of normal breast tissue (see Clarke C.
  • mRNA from said harvested tumour cells and from their normal counterparts is reversed transcribed, and the resulting cDNA is amplified by PCR, the amplification products are compared and those which are differentially displayed are then identified.
  • This last step can be carried out using conventional techniques. For example, the PCR amplification products can be run ( by electrophoresis ) on a standard sequencing gel and the gel can then be dried and autoradiographed.
  • nucleic acid molecule comprising a nucleotide sequence identified by a method in accordance with the second aspect of the invention, a complimentary sequence, a sequence hybridizable under stringent conditions to such a nucleotide sequence, or a fragment unique to such a nucleotide sequence.
  • Methods in accordance with the second aspect of this invention can include further steps carried out with the objective of identifying longer or "full length" nucleic acid molecules (e.g. mRNA or cDNA) that are differentially expressed in tumour cells, which are also in accordance with the third aspect of the invention.
  • Such further steps include the use of sequences found to be differentially expressed by the foregoing techniques as probes to screen cDNA libraries from breast tumours, or as primers for RACE-PCR techniques, as described in Example 6 below.
  • the present invention relates to a nucleic acid molecule which is:-
  • nucleic acid molecules in accordance with this aspect of the invention which are hybridizable to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30, or a complimentary sequence, or to a portion thereof, should comprise a nucleotide sequence that shows a greater degree of homology with any one of SEQ ID NOs: 1-30 than its closest known match, as set out in table 1 below.
  • nucleic acid molecule which is:-
  • the invention also relates to nucleic acid molecules which comprise a nucleotide sequence coding for a polypeptide or protein encoded for by a nucleic acid molecule in accordance with previously discussed aspects of the invention, or a complimentary nucleic acid sequence.
  • the nucleic acid molecules of the invention can be single or double stranded and can be DNA or RNA. Moreover, the recited nucleotide sequence included in any such molecule can be in the form of at least two exons separated by at least one intron.
  • stringent conditions refers to hybridisation at 65°C in hybridisation buffer (3.5 x SSC, 0.02% Ficoll, 0.2% Polyvinyl pyrolidone, 0.02% bovine serum albumin, 25 mM NaH 2 P0 4 (pH 7), 0.5% SDS, 2 mM EDTA).
  • hybridisation buffer 3.5 x SSC, 0.02% Ficoll, 0.2% Polyvinyl pyrolidone, 0.02% bovine serum albumin, 25 mM NaH 2 P0 4 (pH 7), 0.5% SDS, 2 mM EDTA).
  • nucleic acid molecule When a nucleic acid molecule is said to be hybridizable to another of a given sequence under “stringent conditions" it is preferred that it should be at least 75, 80, 85, 90, 95, 97, 98 or 99% homologous to the given sequence. Wherever a nucleotide is described as hybridizable to another, it is understood such hybridisation can be hybridisation with a polynucleotide strand complimentary to that exemplified.
  • Percentage homology figures can be calculated using the BLAST algorithm (BLASTN), available via the world wide web at the NCBI (see also Altschul, S.F. et. al., Basic local alignment search tool, J. Mol. Biol. 215:403-10). However, other algorithms can be employed, where appropriate. Many aspects of the present invention make use of "fragments unique" to one or a combination of the sequences set out in SEQ ID NOs: 1-30. A fragment unique to a particular nucleic acid molecule is one that is a "signature" for the larger nucleic acid molecule. It should be long enough to assure that its precise sequence is not found in molecules other than those to which it is unique.
  • Such unique fragments and other nucleic acid molecules in accordance with the invention are useful as probes in Southern or Northern blot assays to identify the presence, amplification, mutation or expression of nucleic acid molecules comprising the sequences of the present invention or can be used in amplification assays such as those employing PCR.
  • large probes such as those comprising 200 nucleotides or more are preferred for certain uses such as Southern or Northern blots, whilst smaller fragments will be preferred for uses such as PCR.
  • Unique fragments also can be used to produce fusion proteins for generating antibodies or for generating immuno-assay components.
  • Unique fragments further can be used as antisense molecules to inhibit the expression of nucleic acid molecules and, thus, for certain of the therapeutic purposes of the present invention.
  • the size of a unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NOs: 1-30 and compliments thereof will require longer segments to be unique, while others will require only short segments, typically of between 12 and 32 nucleotides in length. Those skilled in the art will be well able to select such sequences, typically on the basis of the ability of unique fragments to selectively distinguish sequences of interest from others. A comparison of the sequences of candidate fragments to those on known databases typically is all that is necessary, although in vitro confirmation by hybridisation and sequence analysis may be required. Wherever "portions" of a defined nucleotide sequence or sequences are referred to, these can be and, preferably, are fragments unique to that sequence, or to one or a combination of those sequences.
  • Nucleic acid molecules in accordance with the present invention can be used in a variety of ways in accordance with the invention. For example, they can be labelled and used as DNA probes to screen cDNA libraries so as to select by hybridisation cDNA sequences that code for proteins which are differentially expressed in breast cancer. Alternatively, they can be used to form "microarrays" of immobilised DNA or oligonucleotides on glass or nylon substrates (for a review of this technique see Ramsay, G. Nature Biotechnology, 1998, 16(l):40-44). Such microarrays can be used for screening a sample to determine the expression of nucleic acid molecules of the current invention.
  • nucleic acid molecules of the invention can be used to screen a microarray (chip) library which displays genes associated with a known condition or function to determine whether the former are involved in said condition or function.
  • the invention relates to a polypeptide encoded by a nucleic acid molecule in accordance with any of the third to fifth aspects of the invention.
  • the invention also provides polypeptide-binding agents which selectively bind or are specific for polypeptides in accordance with the invention.
  • Preferred such polypeptide-binding agents include antibodies, for example monoclonal antibodies, or antibody fragments specific for isolated polypeptides in accordance with the invention.
  • the polypeptide-binding agents can comprise agents capable of occupying or occluding a catalytic site on a polypeptide in accordance with the invention.
  • Polypeptide-binding agents can include humanised (chimeric) and synthetic antibodies, or antibody like molecules, and fragments thereof (e.g., Fab, F(ab) 2 , fd and antibody fragments which include a CDR III region that binds selectively to the polypeptide or proteins of the invention).
  • the antibodies can be radio-labelled or carry a fluorescent marker.
  • Polypeptide-binding agents which selectively bind or are specific for polypeptides in accordance with the invention can be used, as described, for screening assays, for diagnostic assays (see for example Goldenberg, D.M., Am. J. Med. 1993; 94(3) :297- 312) for purification protocols or for targeting drugs, toxins and/or labelling agents (e.g. radioisotopes, fluorescent molecules, etc.) to cells which express a polypeptide or protein in accordance with the invention on the cell surface, or in any method of immunotherapy (for a review of such methods see Bodey et al. Anticancer Research, 1996, 16(2):661-674).
  • binding agents can also be prepared to bind complexes of a polypeptide or protein in accordance with the invention and an HLA molecule by selecting the binding agent using such complexes.
  • Drug molecules that would disable or destroy tumour cells which express such complexes are known to those skilled in the art and are commercially available.
  • the immunotoxin art provides examples of toxins which are effective when delivered to a cell by an antibody or fragment thereof.
  • examples of toxins include ribosome-damaging toxins derived from plant or bacterial such as ricin, abrin, saporin, Pseudomomonas endotoxin, diphtheria toxin, A chain toxins, blocked ricin, etc.
  • Polypeptide-binding agents can also be used to target gene therapy vectors to cells expressing the polypeptides of the current invention.
  • peptides that bind the expressed polypeptides can be selected from peptide-presenting phage libraries as described. These selected peptides can be incorporated into biological or physical gene therapy vectors. Alternatively, the peptide-presenting phage themselves may be candidates for gene therapy vectors, (see Dower et al. Nature Medicine, 1996, Mar;2(3):299-305.)
  • Polypeptides and peptides in accordance with or used in the practice of the present invention can be prepared by using the recombinant DNA technology.
  • a coding DNA sequence can be introduced into an expression vector suitable for directing the expression of the polypeptide coded for by that DNA sequence in a host cell.
  • Suitable vectors include bacterial plasmids, phage DNA, cosmids, yeast plasmids and viral DNA, such as vaccinia and adenovirus DNA.
  • the procedure generally involves inserting a DNA sequence to be expressed into an appropriate restriction endonuclease site so that it is operatively linked to a promoter for directing mRNA synthesis.
  • a coding sequence and regulatory sequence are considered to be "operably” linked when they are covalently linked in such as way as to the place the expression or transcription of the coding sequence under the influence or control of the regulatory sequence.
  • the resulting vector may then be employed to transform or transfect an appropriate host to cause that host to express the required polypeptide or protein.
  • Appropriate host cells can be higher eukaryotic cells, such as mammalian cells or insect cells, or can be lower eukaryotic cells, such as yeast cells, or prokaryotic cells, such as bacterial cells. Examples include E-coli and Bowes melanoma cells.
  • the transformed cells can be grown to an appropriate cell density and then harvested, for example by centrifugation, and disrupted by physical or chemical means. Such means can include freeze-thaw cycling, sonication, or mechanical disruption.
  • the resulting crude extract can be further purified using techniques known in the art, including high performance liquid chromatography (HPLC), which may be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • Example 7 A specific example of a technique for preparing expression products of the nucleic acid molecules disclosed herein is described in Example 7 below and involves the use of the commercially available Tet-On or Tet-Off systems. When such systems are used, the expression products can be isolated by alternative techniques, which do not involve the destruction of the transformed cells, as well as by the disrupting techniques described immediately above.
  • Antibodies both poly- and monoclonal, antibody fragments, chimeric antibodies and antibody like molecules specific for polypeptides in accordance with the invention can be prepared by conventional techniques, using polypeptides in accordance with the present invention, fragments, analogues or derivatives thereof, or cells which express such polypeptides as immunogens. Short peptides having amino acid sequences corresponding to portions of the polypeptide molecules referred to herein can also be used to prepare useful antibodies.
  • Suitable antibodies can be generated by injecting peptides or polypeptides directly into an animal.
  • monoclonal antibodies can be produced by continuous cell line cultures using techniques which are well known to those skilled in the art. Examples of the latter include the hybridoma techniques originally described by Cohler and Milstein, in 1975, Nature 256:495-497, and those described in and referred to in the aforementioned Rettig W.J. et al. and Welt S. et al., publications.
  • Antibodies or antibody-like molecules can also be produced by genetic engineering techniques.
  • a 'phage display library' can be constructed by cloning immunoglobulin V-region genes in filamentous phage so that the latter express, on their surfaces, fusion proteins containing the antigen-binding domains coded for by the cloned genes. Such a library can then be used to identify phage particles which express those antibody-like fusion proteins having a high affinity for a particular antigen. These phage particles can be used like antibody molecules or the V-region genes that they contain can be recovered and engineered into antibody genes and the latter can be used to produce antibody molecules. See Janeway and Travers in Tmmunobiology', 3 rd Edition, Current Biology Ltd., page 2:18-2:19 and Winter et al. in 'Making antibodies by phage display technology', Ann. Rev. Immunol. 1994, 12: 433-455.
  • epitope-specific antibodies may be "humanized” by grafting the antigen-binding loops or CDRs of a mouse monoclonal antibody onto the framework of a human immunoglobulin molecule. See Winter and Harris in 'Humanized antibodies', Immunol. Today, 1993, 14, 243-246 and Janeway and Travers in Tmmunobiology' (see above) page 3:8.
  • nucleic acid molecules or polypeptides referred to herein which retain essentially the same biological function or activity are considered to be functionally equivalent homologues to the recited nucleic acid molecules and polypeptides and are encompassed by the present invention.
  • Analogues of polypeptides include pro-proteins, which can be activated by cleavage of the pro-protein portion to produce an active mature polypeptide.
  • the present invention provides a method of diagnosing a disease, preferably breast cancer, comprising contacting a biological sample isolated from a subject with an agent that is specific for a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ
  • nucleic acid molecule which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue, or with an agent that is specific for an expression product of such a nucleic acid molecule, and assaying for interaction between the agent and any of the nucleic acid molecule or expression product in the sample as a determination of the disease.
  • an agent should be considered as "specific" for a particular nucleic acid molecule or polypeptide if it is capable of interacting with that nucleic acid molecule or polypeptide in a manner which can be distinguished from its interactions with other molecules in the context in which it is used.
  • an agent may be capable of selectively binding to the relevant nucleic acid molecule or polypeptide under the conditions prevalent in a particular assay.
  • the term "contacting" means that the biological sample is placed in sufficient proximity to the agent and under appropriate conditions of, for example, concentration, temperature, time, to allow the specific interaction between the agent and any nucleic acid molecule or polypeptide for which is it specific, to take place. Appropriate conditions for contacting agents and biological samples are well known to those skilled in the art and are selected to facilitate the specific interaction between particular target molecules (nucleic acid or polypeptide) and specific agents.
  • the agent can comprise a polypeptide-binding agent, such as an antibody, preferably a monoclonal antibody, an antibody fragment, or an antibody-like molecule (as described above), specific for a polypeptide encoded by the nucleic acid molecule or any other polypeptide binding agent which selectively binds a polypeptide encoded by the nucleic acid molecule.
  • the antibodies or antibody fragments can carry fluorescent markers, or can be radio-labelled. They can also be chimeric.
  • the agent can also be a nucleic acid molecule complimentary to the nucleic acid molecule and the assay can comprise amplification (for example using PCR) specific for the nucleic acid molecule.
  • the biological sample can be in vruo or in vitro. However, it is preferred that the biological sample is invitro and comprises cell-containing tissue extracted from a patient.
  • the agent can be an immobilised antibody attached to a substrate and the method of diagnosing disease can involve a conventional enzyme-linked immunosorbent assay (ELISA) carried out on a protein containing biological sample derived from a patient.
  • ELISA enzyme-linked immunosorbent assay
  • the method can comprise a Western blot in which the agent is a labelled or unlabelled antibody and the biological sample comprises proteins derived from a patient and separated by electrophoresis on an SDS polyacrylamide gel.
  • the biological sample is isolated from breast tissue and the diagnostic method in accordance with this aspect of the invention is practised using a kit comprising an agent specific for the nucleic acid molecule or an expression product of such a molecule.
  • the agent can comprise a nucleic acid molecule which is:-
  • nucleic acid molecule (d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.
  • the nucleic acid molecule can be labelled with a detectable marker, such as 32 P or 35 S, and employed, in accordance with this aspect of the invention, as a hybridisation probe to probe a cDNA library derived from a tissue sample taken from a patient.
  • cDNA is firstly isolated using known methods, and then digested with one or more restriction enzymes. The resulting cDNA fragments are separated on agarose gels, denatured in situ, and transferred to membrane filters.
  • the radio-labelled nucleic acid probe is hybridised to the immobilised cDNA fragments.
  • the membrane is then washed to remove unbound or weakly bound probe, and is then autoradiographed to identify the DNA fragments that have hybridised with the probe.
  • the nucleic acid molecule can also be labeled with a fluorescent probe and used to probe a high density microarray of DNA elements to search for differential gene expression, (see for example De Risi et al., Nature Genetics, 1996, 14(4):457- 460.)
  • the interaction can also be determined by conventional PCR amplification of nucleic acid molecules present in the biological sample, preferably using a nucleic acid molecule as defined above as a primer.
  • a kit for diagnosing disease preferably breast cancer, or for detecting the presence or expression of a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence;
  • kits comprising a pair of isolated nucleic acid molecules each of which comprises a) a 12-32 nucleotide contiguous segment of any of SEQ ID NOs 1-30 or of a nucleic acid molecule in accordance with the third aspect of the invention, or b) a complement of a), wherein the contiguous segments are non-overlapping.
  • the present invention provides a method of identifying agents for treating a disease, preferably breast cancer, comprising assaying for a capacity to modulate an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence;
  • the method comprises assaying for a capacity to modulate an activity of a polypeptide encoded by the nucleic acid molecule and can comprise screening for a capacity to bind to the polypeptide or a receptor for the polypeptide, or to otherwise disrupt the normal interaction between the polypeptide and its receptor.
  • the method can involve transforming or transfecting a host cell to express the polypeptide (see above), contacting the host cell with a putative agent for modulating the activity or expression of the polypeptide and assaying for an alteration in a phenotype associated with expression of the polypeptide.
  • Agents can be identified by selecting from "libraries" of putative molecules. Such libraries and their applications are described, for example, in Houghten, R.A, Gene, 1993 Dec 27;137(1):7-11; Lam, K.S., Anticancer Drug Des. 1997 Apr;12(3):145-167; Needels et al. Proc. Nat. Acad. Sci.USA, 1993, Nov 115;90(22): 10700-4.
  • the invention provides a pharmaceutical composition for treating disease, preferably breast cancer, comprising an agent having the capacity to modulate an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of
  • SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence (b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof;
  • Antisense molecules capable of binding to them, or to promoter regions associated with them in vivo.
  • Antisense molecules are generally oligonucleotides of from 10 to 40 bases in length, which are complimentary to the region of a target gene involved in transcription and which, by binding thereto, can prevent transcription of that gene.
  • one of the nucleic acid molecules discussed above can be used to design an antisense RNA oligonucleotide of from 10 to 40 bases in length, which is capable of in vivo hybridisation with an mRNA transcription of the gene to which the aforementioned nucleic acid molecule corresponds, to block translation of that mRNA molecule into the polypeptide encoded by that gene.
  • Similar techniques can be employed using antisense DNA.
  • Antisense molecules can be delivered directly to affected cells or, alternatively, by other known procedures in which antisense RNA or DNA is caused to be expressed in vivo and thereby to inhibit in vivo production of such polypeptide products. The techniques involved in preparing and employing antisense molecules are well known to those skilled in the art.
  • Agents which effectively alter the expression of a nucleic acid molecule can be detected after treatment by using a microarray of cDNA derived from a tissue sample and using a fluorescently labelled probe derived from the nucleic acid molecule to detect the presence and amount of expression (see Ramsay G. above).
  • agents which have a capacity to modulate the activity or expression of a polypeptide encoded by a nucleic acid molecule in accordance with the invention can also include small molecule inhibitors which can bind to and occupy a catalytic site either on such a polypeptide, or on a receptor to which the polypeptide binds, thereby making the catalytic site inaccessible and inhibiting the biological activity of the polypeptide.
  • small molecule inhibitors include small peptides, and peptide-like molecules.
  • Candidate such agents can be identified in accordance with the ninth aspect of the invention, by exposing host cells transformed (using the conventional recombinant DNA techniques referred to above) to express polypeptides coded for by nucleic acid molecules in accordance with the invention and identifying those agents which inhibit a tumourigenic phenotype (such as accelerated growth) exhibited by such cells, as being potentially useful in the treatment of disease, especially breast cancer.
  • a candidate agent Once a candidate agent has been identified, structurally similar chemical entities can be tested, either by using conventional techniques or by using the above described techniques, in order to find further efficacious agents.
  • Such candidates can then be subjected to further tests of the type conventionally employed in the pharmaceutical industry. Such further tests can include toxicology and efficacy tests carried out using animals and subsequent human clinical trials.
  • small molecule chemical entities selected on the basis of their known or predicted properties for a potential to bind the relevant polypeptides can be screened for such binding activities.
  • Those compounds which are found to bind with the relevant polypeptides and which, therefore, have the potential to inhibit their activities, can be further tested using conventional techniques (as discussed above), to confirm their ability to ameliorate the symptoms of disease, especially breast cancer, and their suitability for use as pharmaceuticals.
  • Such polypeptide binding compounds can also include genetically engineered fusion proteins composed of physiological ligands of a target protein linked to genetically modified bacterial toxins ( Tagliaferri, P. et al, Anticancer Drugs, 1994, Aug:5(4):379-93).
  • the agent has the capacity to down regulate or inhibit an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of
  • agent employed in this aspect of the invention can be an antisense molecule capable of binding to the nucleic acid molecule, or to an associated promoter region, or it can be a polypeptide binding agent, such as an antibody or antibody fragment, capable of selectively binding to the polypeptide.
  • the agent can comprise an inhibitor or antagonist capable of binding to the polypeptide or a receptor for the polypeptide, to thereby inhibit the biological activity of the polypeptide.
  • the agent will have been identified, or is identifiable, by a method involving carrying out an assay in accordance with the ninth aspect of the invention.
  • compositions in accordance with the invention have a capacity to up regulate or enhance the activity or expression of a polypeptide encoded by a nucleic acid molecule which is:-
  • the agent may have been identified or be identifiable by a method involving an assay in accordance with a previously described aspect of the invention.
  • compositions for treating disease comprising a polypeptide encoded by an isolated nucleic acid molecule which is:-
  • the invention also contemplates gene therapy.
  • a procedure for performing ex vivo gene therapy is outlined in US Patent No. 5,399,346 and in exhibits submitted in the file history of that patent.
  • the procedure involves the introduction in vitro of a functional copy of a gene into a cell of a subject which contained a defective copy of the gene, and returning the genetically engineered cell to the subject.
  • the functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell.
  • Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in WO96/00654.
  • In vivo gene therapy using vectors such as adenovirus, retrovirus, poxvirus and lentivirus is also contemplated in accordance with the present invention.
  • the present invention provides a pharmaceutical composition for treating a disease, preferably breast cancer, comprising a nucleic acid molecule which is:-
  • nucleic acid molecule which forms at least a portion of nucleic acid molecule differentially displayed/ expressed in breast tumour tissue in comparison to normal breast tissue.
  • the nucleic acid molecule is included within an expression vector, and is operably linked to a promoter.
  • an expression vector can be used to transform or transfect a host cell ( see above ) and such transformed or transfected host cells themselves, can be employed in pharmaceutical compositions in accordance with the invention.
  • these expression vectors or host cells are capable of expressing, in vivo, a polypeptide encoded by an isolated nucleic acid molecule which is:-
  • the present invention provides a method of treating disease, preferably breast cancer, comprising administering a pharmaceutical composition in accordance with one of the above discussed aspects of the invention to a patient.
  • the method can be for the treatment of established disease or one of prophylaxis.
  • nucleic acid molecules, polypeptides, polypeptide binding agents, kits and compositions in accordance with the invention can be used in the diagnosis, treatment as prophylaxis of tumours other than breast tumours and, in particular, tumour of the oesophagus and colon.
  • compositions in accordance with the present invention can be formulated with conventional pharmaceutically acceptable carriers and excipients, either for systemic or local administration. Such carriers and recipients can be selected without difficulty by those skilled in the art.
  • Negative cell sorting primarily with the F19 antibody (Rettig W. J., et al, Fibroblast activation protein: purification, epitope mapping and induction by growth factors, Int. J. Cancer, 58, 385-92 (1994) and Welt S. et al, Antibody targeting in metastatic colon cancer: a phase I study of monoclonal antibody F19 against a cell-surface protein of reactive tumour stromal fibroblasts, J. Clin. Oncol, 12(6) 1193-203 (1994)) directed against a protein expressed in activated stromal fibroblasts was used to produce populations of highly purified tumour cells from solid tumours in small amounts .
  • Pathological tumour samples were stored in L-15 medium for transport prior to processing. Upon receipt, samples were trimmed of fat, weighed and cut into 1 mm 3 pieces. With larger pieces (> lg) one part was taken for direct freezing whilst the remainder was disaggregated. Smaller pieces (0.5-lg) were completely disaggregated. Disaggregation of tumours was performed with 0.25% (w/v) type 1 collagenase at 37°C for 4-6 hours with agitation. Fragments were removed by centrifugation and resuspended in fresh L-15. Fragments were passed through a 100 micron filter and examined. The larger retained fragments tended to include "normal" epithelium.
  • the filtrate consisting mainly of smaller tumour fragments and single cells, was stained with the F19 anti-stromal cell antibody. Stained cells were then labelled with anti-mouse IgG coated Dynabeads. These cells were then removed from suspension in a magnetic particle concentrator. F19 positive (stroma) and negative (tumour) fractions were separately collected, recorded by phase photography and stored as cytospin preparations. Fractions were washed in PBS and flash frozen prior to RNA extraction.
  • Example 2 Isolation of sequences differentially expressed by primary breast tumour cells using differential display PCR
  • Preparations of F19 negative tumour cells obtained by the method described in Example 1, were used in a differential display comparison with purified normal breast luminal epithelial cells obtained by immunomagnetic sorting of normal breast tissue from cosmetic reduction mammoplasty surgery (Clarke C, et al, An immunomagnetic separation method using superparamagnetic (MACS) beads for large-scale purification of human mammary luminal and myoepithelial cells; Epithelial Cell Biol, 3(1), 38-46 (1994)).
  • MCS superparamagnetic
  • MessageClean kit Biogene/GenHunter
  • RNA sample 0.2 ⁇ g of cleaned total RNA was reverse transcribed from each of 3 single base anchored oligo-dT primers (T ⁇ G, T n A, T n C) using Superscript II reverse transcriptase (Life Technologies) under standard conditions in a 20 ⁇ l reaction.
  • DDPCR differential display PCR
  • 2 ⁇ l of each mixed reverse transcription was then amplified in a lO ⁇ l PCR reaction containing lOmM Tris pH 8.3, 50 mM KCl, 1.5mM MgCl 2 , 2 ⁇ M dNTPs, 0.2 ⁇ M mixed anchor primer (T n M), 0.2 ⁇ M random internal 10-mer (Operon Technologies), 0.2 ⁇ Ci 35 SdATP (Amersham) and 1 U AmpliTaq polymerase (Perkin Elmer).
  • PCR was performed under the following conditions: 94°C for 1 minute, followed by 40 cycles of 94°C for 30 seconds, 40°C for 2 minutes and 72°C for 30 seconds with a final cycle of 72°C for 5 minutes.
  • RNA sample 100 separate PCR reactions were performed, each containing a different single 10 base primer (Operon Technologies) and a mixture of 3 anchor primers (T ⁇ M).
  • Figure 1 shows examples of one such comparison between 4 normal luminal cell samples (L) and 5 ( Figure (a)) or 4 ( Figure (b)) F19 negative tumour samples (T).
  • the OP nomenclature denotes the random primers used in combination with a mixed 3' anchor primer (T n M) and those bands which were up-regulated and subsequently cloned and sequenced are identified by their SEQ ID NOs.
  • the selected bands were cut from the gels for all four tumour samples, mixed, eluted in 4M Ammonium acetate solution at 37°C for 4 hours and precipitated with 3 volumes of ethanol at -20°C overnight. After centrifugation DNA pellets were resuspended in 20 ⁇ l water and 4 ⁇ l was used as a template for reamplification in a PCR reaction containing lOmM Tris pH 8.3, 50mM KCI, 1.5mM MgCl 2 , 200 ⁇ M dNTPs, 0.2 ⁇ M mixed anchor primer (T n M), 0.2 ⁇ M random internal 10-mer (Operon Technologies), and I U AmpliTaq polymerase (Perkin Elmer).
  • PCR conditions were exactly as described above for the differential display with the same primer combination.
  • Reamplified products were checked and sized on agarose gels and cloned without purification into the P-Gem T Easy vector (Promega) according to the manufacturers instructions.
  • Cloned cDNAs were sequenced with the dRhodamine cycle sequencing kit on an ABI Prism automated sequencer (Perkin Elmer). The sequences of the resulting 29 clones derived from the differentially displayed bands are set out in SEQ ID Nos: 1-29.
  • Table 1 shows a summary of the sequences obtained (giving their corresponding SEQ IDs) and the results of their comparison to the Genbank/EMBLnr and EST databases.
  • Example 3 Secondary screening of candidate tumour markets Semi-quantitative RT-PCR was used as a screen to verify increased expression of candidate genes in tumours.
  • RNA was prepared against which the sequences obtained by the differential display method (DDPCR) described in Example 2 (which could be potential breast tumour markers) were screened: 1) The same RNA as was used in DDPCR, i.e. 4 normal luminal cell preparations and 4 F19 negative tumour samples; 2) A separate series of RNA preparations from 8 normal luminal cell samples and RNA from 22 breast cancer cell lines;
  • DDPCR differential display method
  • RNA prepared from 8 normal breast tissue preparations and 8 solid breast tumours RNA prepared from 8 normal breast tissue samples and 11 human tissues; (liver, colon, spleen, kidney, skin, lymph node, duodenum, muscle, placenta, prostate and testis).
  • PCR was performed under standard conditions in 50 ⁇ l; lOmM Tris pH 8.3, 50mM KCI, 1.5mM MgCl 2 , 200 ⁇ M dNTPs, 0.2 ⁇ M each primer (sense and antisense), and 1 U AmpliTaq polymerase (Perkin Elmer) with PCR cycles of 94°C for 1 minute then 25-40 cycles of 94°C for 30 seconds, 55-60°C for 1 minute and 72°C for 1-2 minutes with a final cycle of 72°C for 5 minutes.
  • Control amplifications were performed with GAPDH (sense- TCCTGCACCACCAACTG (SEQ ID NO: 31) , antisense- GCCTGCTTCACCACCTT (SEQ ID NO:32)) and ⁇ -Actin (sense CGGTGGACGATGGAGGGGCCG (SEQ ID NO: 33), antisense- GCCGAGCGGGAAATCGTGCGTG (SEQ ID NO: 34)) specific primers. lO ⁇ l of each PCR product was resolved in 1.5% agarose gels after different cycle numbers.
  • RNA from normal luminal cells (L) and F19 negative tumour cells (T) was amplified in RT-PCT reactions with conventional PCR primers designed from the sequences for GAPDH, ⁇ -Actin, and from the sequences set out in SEQ ID NOs: 1, 4, 7 and 10 in the manner described in Example 3. lO ⁇ l samples were taken from each 50 ⁇ l reaction throughout the amplification process and analysed by agarose gel electrophoresis.
  • PCR products were Southern blotted onto Hybond-N nylon membranes which were then hybridised to the cloned differential display bands (corresponding to SEQ ID NOs: 1, 4, 7 and 10) and to clones for GAPDH and ⁇ -Actin under standard conditions (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)).
  • Figure 3 shows the results of these Southern hybridisations after the number of PCR cycles indicated using cloned differential display products from the sequences indicated.
  • Example 5 RT-PCR based expression screening of breast cancer cell lines compared to normal breast organoids and normal human tissues RNA extracted from a series of luminal cell preparations (L) and from 22 breast cancer lines (A-X) is used as a secondary screen for expression of candidate sequences (see RNA panel (2) in Example 3).
  • Figure 4 shows the expression of the estrogen receptor (ER) across this panel of RNAs.
  • RNA from each sample was amplified in RT-PCR reactions with primers directed against ER (sense-GGAGACATGAGAGCTGCCAAC (SEQ ID NO: 35), antisense- CCAGCAGCATCTCGAAGATC (SEQ ID NO: 36)) and GAPDH.
  • Standard RT- PCR was performed as described above and lO ⁇ l of a 50 ⁇ l reaction was removed after 25 (GAPDH) and 40 (ER) cycles of PCR and resolved on a 1.5% agarose gel. The gel was Southern blotted and filters hybridised to cDNAs for GAPDH and ER respectively under the conditions described above.
  • Screening of the panel of cell lines for ER demonstrates that this method can quickly identify ER-positive and ER-negative lines (and rank the level of expression) and, hence, that it can be used to screen for genes carrying the sequences identified in SEQ ID NOs: 1-30 and others differentially expressed in primary breast tumour cells, in comparison normal luminal cells that have been identified by techniques described herein. The results also demonstrate that this technique can be used to identify sources which contain a high level of expression of differentially displayed/expressed genes for use in the methods described in Example 6.
  • Example 6 Obtaining full length sequences Full length cDNAs, which contain the differential display sequences whose expression pattern has been confirmed by RT-PCR techniques (such as those set out in Examples 3-5) can be isolated. Breast cancer cell lines and breast tumour RNAs can be screened by RT-PCR (for example, in the manner described in Example 5) to identify an RNA source which contains a high level of expression of the differential display of interest.
  • RNAs The correct size of full length messenger RNAs can be ascertained on Northern blots of l-5 ⁇ g of polyA + RNA from cell lines and/or tumour samples expressing the gene of interest as confirmed by RT-PCR using standard methods (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)).
  • Poly A+RNA can be prepared from total RNA extracted by standard methods using the Dynabeads mRNA purification system
  • RNA expressing the differential display sequence of interest as confirmed by RT-PCR and Northern blotting can then provide the source for cDNA library construction and/or RACE PCR.
  • Amplified phage stocks of each library can be PCR screened to confirm the presence of clones matching the differential display sequence.
  • Positive libraries can be screened by conventional library screening techniques (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)) to identify clones containing the differential display sequence. Sequencing of each clone can then identify those which contain an exact match to the differential display sequence.
  • Comparison of each clone with polyA+ Northerns and results from RACE PCR can allow the assignment of clones as full length cDNAs. Once a full length cDNA sequence has been identified a suggested open reading frame can be assigned to each messenger RNA. This open reading frame can be used for subsequent expression studies.
  • RACE-PCR Rapid Amplification of Cohesive Ends
  • This is a PCR based method for generating full length cDNAs using short pieces of internal sequence information.
  • RACE PCR is performed using a Marathon cDNA synthesis kit (Clontech) essentially as described by the manufacturer. Briefly, l ⁇ g poly A+ RNA from a source expressing the sequence of interest (confirmed by RT- PCR for example, in the manner described in Example 5) is reverse transcribed by Superscript II (Life Technologies) under standard conditions. Second strand cDNA is then synthesised with a mixture of E. coli DNA polymerase 1, E.
  • coli DNAligase E. coli RNAase H and T4 DNA polymerase. Double stranded cDNA is then extracted, precipitated and ligated to synthetic adaptors with Ready-to-go T4 DNA ligase (Pharmacia). The resulting adaptor ligated cDNA is then used as a template for RACE PCR. 5' and 3' RACE products are amplified from primers designed within the differential display sequence used in conjunction with adaptor primers. PCR is performed with tTH polymerase (Perkin Elmer) to minimize PCR mutations. Resulting RACE PCR products can then be cloned into pCR-Script (Stratagene). Sequencing of overlapping 5' and 3' RACE products should then allow reconstruction of the full length cDNA sequence.
  • RNAs i.e. 4 from normal luminal cell samples (luminal) and 4 from F19 negative tumour samples (F19-ve tumour) show a strong band at 900bp overexpressed in the tumours (see Figure 5A).
  • Example 7 Inducible expression studies Stable cell lines can be created which overexpress candidate genes (e.g. SEQ ID NOS. 1-29) constitutively. However, regulated expression removes the problem of adaption/desensitisation found with continuous expression and permits the study of potentially lethal/toxic genes.
  • candidate genes e.g. SEQ ID NOS. 1-29
  • tetR tet r ⁇ ressor
  • Tc transposon-10 tetracycline
  • teiK is fused to the acidic C-terminal domain of the herpes simplex virus protein VP16 (which is essential for the transcription of viral immediate early genes) to produce a tetracycline controlled transactivator (tTA)
  • tTA tetracycline controlled transactivator
  • first stable lines are produced which constitutively express tTA.
  • a second transfection is then performed to introduce a construct containing a novel gene under the control of a minimal CMN promoter which has been fused downstream to heptameric repeats of the tet operon tetO.
  • tTA causes the activation of transcription of the novel gene, while addition of Tc titrates out tTA and transcription is turned off.
  • This system is marketed by Clontech under the name Tet-Off.
  • Tc Activity can be regulated over a range of 5 orders of magnitude in a Tc concentration-dependent manner.
  • the level of Tc required for full inactivation is very low (0.1 mg/ml), while effects on cell growth and morphology are only seen at very high concentrations (10 mg/ml). Partial induction experiments may allow the study of the quantitative aspects of gene activity.
  • cells are cultured routinely in the presence of Tc which is then removed from culture medium to activate the gene of interest. >20% significant induction of gene activity is seen within 12 hours of Tc removal.
  • Tc doxycycline
  • a mutant of tetR (rTetR) has been produced, generated by random mutagenesis, that has reversed D ⁇ A binding properties compared to wildtype tetR / tTA and so requires the Tc derivative doxycycline for specific D ⁇ A binding.
  • rTetR has 4 amino acid changes (one at surface, one connects D ⁇ A reading head to the core of the protein, one involved in a sub unit dimerisation, one adjacent to a contact point with Tc) which result in a major as yet undefined conformational change (M.
  • Tet-On Transcriptional activation by tetracyclines in mammalian cells; Science, 268 (5218), 1766-9 (1995)). This system is marketed by Clontech under the name Tet-On, and would be particularly useful invivo, since a gene can remain silent during embryonic development and then be switched on. Initially, the two plasmid Tet-Off system will be used but the Tet-On system will also be examined.
  • Tc- inducible expression will be established through the transient transfection of reporter constructs carrying the luciferase gene of Photinus pyralis under the control of the tetO.
  • the assay involved is quick and easy (transfected cells grown, supernatant sampled, supernatant incubated with the substrate luciferin, relative light units (rlu) emitted measured, cells, lysed and protein concentration estimated, values given as rlu/mg of protein). Data will be collected from the luciferase assay using a luminescence plate reader.
  • Each gene X cDNA will be expressed in either the sense or antisense orientations. Expression of gene X will be identified initially using PCR primers designed to flank the multiple cloning site of construct. In addition, the FLAG epitope will also be included in the cDNA insert. This will effectively tag the gene X product allowing easy visualisation and purification without the need for costly (both in time and money) specific antibody production. Tc-regulation of expression of the gene X product will be determined by Western blotting and localisation will be identified by immunofluoresence.
  • Stable transfectants showing inducible expression of the gene X product will be fully characterised both biologically and biochemically in the presence and absence of Tc, to determine the exact nature of gene X function and its contribution to tumourigenicity.
  • Functional phototypes can be determined in the appropriate assays and compared to the parent/normal cell lines. Such assays can include the following:
  • Matrix synthesis or degradation e.g. expression of metalloproteinases (Vacca et al, Int J Clin Lab Res, (1998), 28(1), 55-68) or their inhibitors
  • Cells transfected with gene X can also be used in assays for identifying agents, such as small molecule chemical entities, which can modulate the expression or activity of the gene X product and which, thus, could be useful in treating disease associated with the expression product of gene X.
  • agents such as small molecule chemical entities
  • the effect of candidate agents upon the expression of the gene X product by such transfectants can be studied and, where the gene X product contributes to tumourigeneicity and the agent is found to inhibit its expression or activity, then that candidate could be useful in pharmaceutical preparations in accordance with the invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé permettant d'identifier des séquences nucléotidiques qui ont une expression différentielle dans des cellules tumorales, de préférences de cellules tumorales primaires du sein. Ce procédé consiste à prendre un échantillon tissulaire contenant une cellule tumorale et à l'exposer à un agent spécifique de la protéine d'activation du fibroblaste (FAP), à séparer du reste des cellules de l'échantillon les cellules reconnues par cet agent, et à récolter ces cellules restantes. L'invention concerne également, d'une part des molécules d'acides nucléiques découlant de l'utilisation de cette technique, d'autre part des compositions les comprenant, et enfin leurs utilisations.
EP99959579A 1998-12-11 1999-12-10 Expression differentielle dans le cas du cancer primaire du sein Withdrawn EP1137944A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9827430.1A GB9827430D0 (en) 1998-12-11 1998-12-11 Differential expression in primary breast cancer
GB9827430 1998-12-11
PCT/GB1999/004183 WO2000036420A2 (fr) 1998-12-11 1999-12-10 Expression differentielle dans le cas du cancer primaire du sein

Publications (1)

Publication Number Publication Date
EP1137944A2 true EP1137944A2 (fr) 2001-10-04

Family

ID=10844141

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99959579A Withdrawn EP1137944A2 (fr) 1998-12-11 1999-12-10 Expression differentielle dans le cas du cancer primaire du sein

Country Status (3)

Country Link
EP (1) EP1137944A2 (fr)
GB (1) GB9827430D0 (fr)
WO (1) WO2000036420A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988160A (zh) * 2018-01-11 2018-05-04 武汉大学深圳研究院 人乳腺癌细胞及其原代分离培养和传代培养方法与用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EA010352B1 (ru) * 2006-10-09 2008-08-29 Институт Молекулярной Генетики Российской Академии Наук (Имг Ран) Способ дифференциального анализа протеомов
EP3555627B1 (fr) 2016-12-14 2023-11-22 Purdue Research Foundation Imagerie et thérapie ciblées par une protéine d'activation des fibroblastes (fap)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2782292A (en) * 1991-09-18 1993-04-27 Sloan-Kettering Institute For Cancer Research Activated stromal fibroblast-specific antibody, f19 and methods of using the same
DE4228389C2 (de) * 1992-08-26 1994-07-21 Kuebler Gmbh Dr Gewinnung und Kultivierung transformierter Zellen
US5543297A (en) * 1992-12-22 1996-08-06 Merck Frosst Canada, Inc. Human cyclooxygenase-2 cDNA and assays for evaluating cyclooxygenase-2 activity
WO1994025852A1 (fr) * 1993-04-26 1994-11-10 Coulter Corporation Procede d'analyse de la teneur en adn de cellules tumorales par enrichissement en cellules tumorales
AU725192B2 (en) * 1996-02-16 2000-10-05 Brigham And Women's Hospital Compositions and methods for the treatment and diagnosis of cardiovascular disease
EP0944651A2 (fr) * 1996-04-10 1999-09-29 California Pacific Medical Center Genes amplifies dans des cellules cancereuses
CA2280229A1 (fr) * 1997-02-03 1998-08-06 Human Genome Sciences, Inc. Gene 1 specifique du cancer du sein
GB9722320D0 (en) * 1997-10-22 1997-12-17 Janssen Pharmaceutica Nv Human cell cycle checkpoint proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0036420A2 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988160A (zh) * 2018-01-11 2018-05-04 武汉大学深圳研究院 人乳腺癌细胞及其原代分离培养和传代培养方法与用途

Also Published As

Publication number Publication date
GB9827430D0 (en) 1999-02-03
WO2000036420A2 (fr) 2000-06-22
WO2000036420A3 (fr) 2000-10-19

Similar Documents

Publication Publication Date Title
CA2281952C (fr) Composes permettant l'immunotherapie du cancer de la prostate et procedes concernant leur utilisation
JP4942637B2 (ja) Ｄｎａ認識のための結合タンパク質におけるまたはそれに関連する改良
JP3844366B2 (ja) 前立腺ガンの免疫診断のための化合物およびそれらの使用方法
JPH11510393A (ja) 白血病マーカーとしておよび乳癌の予後において有用な単離された核酸分子
WO2001002568A2 (fr) Nouveaux genes humains et produits d'expression genique
JP2004502406A (ja) ヒト遺伝子およびヒト遺伝子発現産物
WO1999064594A9 (fr) Genes et produits d'expression genique regules de façon differentielle lors du cancer de la prostate
US5759803A (en) Recombinant retinoblastoma-associated protein 1 (E2F-1) polypeptides and cDNA
US9090899B2 (en) Methods of diagnosing and treating prostate cancer characterized by NDRG1-ERG fusion
US8722350B2 (en) Methods and compositions for categorizing patients
US7118912B2 (en) Methods and compositions for categorizing patients
US7666603B2 (en) Breast cancer related protein, gene encoding the same, and method of diagnosing breast cancer using the protein and gene
Hollington et al. Expression and localization of homeodomain proteins DLX4, HB9 and HB24 in malignant and benign human colorectal tissues
EP1137944A2 (fr) Expression differentielle dans le cas du cancer primaire du sein
JP4201712B2 (ja) Ｇｉｐ、グッドパスチャー抗原結合タンパク質と相互作用する転写因子活性を備えたポリペプチドのファミリー
PL204844B1 (pl) Izolowany polinukleotyd, polinukleotyd antysensowny, izolowany polipeptyd, przeciwciało monoklonalne lub jego fragment wiążący antygen, wektor ekspresyjny, komórka gospodarza transformowana lub transfekowana wektorem ekspresyjnym, kompozycja farmaceutyczna, zastosowanie izolowanego polipeptydu
JP2001527408A (ja) Ｓｓｘファミリーのメンバーをコードする単離核酸分子、およびそれらの利用方法
WO2003102028A1 (fr) Proteine induite par le gene rb1 (rb1cc1) et gene
WO2002044372A2 (fr) Sequence nucleotidique et proteinique d'helios 3 et procedes d'utilisation
CA2323076A1 (fr) Genes associes au chondrosarcome
WO1997001634A2 (fr) Polypeptide pour la reparation d'informations genetiques, sequence nucleotidique codant pour ce polypeptide, et son procede de preparation (proteine de liaison de guanine-thymine - gtbp)
EP1466988A2 (fr) Gènes et produits d'expression génique régulés de façon différentielle lors du cancer de la prostate
JP2001340081A (ja) ヒト膵癌抗原

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010607

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040701