EP1137944A2

EP1137944A2 - Differential expression in primary breast cancer

Info

Publication number: EP1137944A2
Application number: EP99959579A
Authority: EP
Inventors: Alan Gordon Ludwig Inst. For Cancer Res. MACKAY; Michael John Ludwig Inst. For Cancer Res. O'HARE
Original assignee: Ludwig Institute for Cancer Research Ltd; Ludwig Institute for Cancer Research New York
Current assignee: Ludwig Institute for Cancer Research Ltd; Ludwig Institute for Cancer Research New York
Priority date: 1998-12-11
Filing date: 1999-12-10
Publication date: 2001-10-04
Also published as: WO2000036420A3; GB9827430D0; WO2000036420A2

Abstract

A method for identifying nucleotide sequences that are differentially expressed in tumour cells, preferably primary breast tumour cells, comprising exposing a tumour cell containing tissue sample to an agent specific for fibroblast activation protein (FAP), separating cells recognised by said agent from the remaining cells in the sample and harvesting said remaining cells. Nucleic acid molecules derived from the use of this technique are also described, together with compositions comprising the same and their uses.

Description

Differential expression in primary breast cancer

Description

This invention relates to nucleic acid molecules that are expressed differentially in primary breast cancer cells, when compared to normal luminal breast cells, and their expression products. The invention relates to methods of identifying such nucleic acid molecules and to methods of treating and diagnosing disease, preferably breast cancer, involving the use of such nucleic acid molecules and their expression products. The invention also relates to methods of treating disease, preferably breast cancer, using agents capable of modulating the expression of such nucleic acid molecules or the activity of their expression products, and to the use of such nucleic acid molecules and expression products in the identification of agents suitable for use in such methods. The invention further relates to pharmaceutical preparations and diagnostic kits for use in the aforementioned methods.

The phenotypic changes which distinguish a tumour cell from its normal counterpart are often the result of one or more changes in the genome of the cell. Genes which are differentially expressed, that is to say either up or down regulated, in tumour cells, when compared to their normal counterparts, can be markers for the tumour phenotype. The increased expression or up regulation or the loss of expression or down regulation of a gene can also be an essential event in the process of tumourigenesis.

Thus, the discovery of genes which are up regulated in tumour cells can provide a means of identifying a cell as a tumour cell. Diagnostic compounds can be based on such genes, or the polypeptide products encoded by them, and used to determine the presence and location of tumour cells. Such compounds can be nucleic acid sequences complimentary to all or parts of differentially expressed gene sequences or can be agents, such as antibodies, which bind preferentially to the polypeptide products of differentially expressed genes. Further, when a gene which is up regulated in tumour cells is found to play a role in the manifestation of a tumour phenotype (e.g., unregulated growth or metastasis), it can be used to provide therapeutics, such as antisense nucleic acids or other inhibitors, which can reduce or substantially eliminate expression of that gene, or inhibit the activity of that gene's expression product, and thereby reduce or substantially eliminate the phenotype which depends on the expression of the gene. Polypeptides encoded by such genes often play a role in catalysing tumourigenic activity (e.g., unregulated growth or metastasis) and they, therefore, can be of assistance in the hunt for agents which will inhibit such activity. The latter can include small molecule inhibitors or polypeptide binding agents which can bind to, occupy or occlude a catalytic site either on such a polypeptide, or on a receptor to which the polypeptide binds, to thereby make the catalytic site inaccessible and inhibit the biological activity of the polypeptide. Examples of such small molecule inhibitors include small peptides, or peptide like molecules.

The discovery of genes which are preferentially down regulated in tumours can also provide a means of identifying a cell as a tumour cell. Diagnostic compounds can be based on the normal gene, or its polypeptide product, and its absence in a cell sample used to determine the presence and location of tumour cells. Further, when the normal gene is essential for the manifestation of a normal cell phenotype (e.g., regulated growth), it can be reintroduced by in vivo gene therapy, or the polypeptide which it encodes can be administered in a pharmaceutical preparation, and restoration of the normal cell phenotype may be possible.

Tumour specific expression of genes suggests that such genes can encode proteins which could be recognised by the immune system as foreign and thus provide a target for tumour rejection. The polypeptide products of tumour specific genes can, for example, comprise peptides which complex with HLA-Class I and thus can be the targets for host immune surveillance and provoke selection and expansion of one or more clones of cytotoxic T lymphocytes specific for the tumour specific gene product. Sequences within polypeptides that bind HLA can be identified using a computer algorithm that searches for HLA binding motifs (see http:Wbimas.dcrt.nih.gov and Parker et al. 1994, J.Immunol. 152:163) Examples of this phenomenon include proteins and fragments thereof encoded by the MAGE family of genes, the tyrosinase gene, the Melan-A gene, the BAGE gene, the GAGE gene, the RAGE family of genes, the PRAME gene and the brain glycogen phosphorylase gene. The proteins encoded by such genes are known as "tumour rejection antigen precursors", or TRAPs, and they can be used to generate therapeutics for enhancement of the immune system response to tumours expressing such genes and proteins. A discussion of TRAPs, the aforementioned TRAP genes, and their properties and uses can be found in O92/20356 (MAGE), WO 96/29409 (RAGE) and WO 97/49817 (Brain glycogen phosphorylase).

Attempts to identify genes which are differentially expressed in primary breast cancer cells, when compared to normal luminal breast cells, using solid breast tumour tissue as a source of primary tumour cells, have so far proven unsuccessful due to the presence of many different contaminating cell types in the tissue samples employed. Not only can such samples be contaminated with stromal tumour cells, such as fibroblasts and lymphocytes, but they are also usually contaminated with normal non-malignant breast epithelial cells.

Fibroblast activation protein (FAP) is a cell-surface glycoprotein which is rarely found in normal tissues, but which is expressed by reactive stromal fibroblasts of epithelial cancers, such as primary and metastatic colorectal carcinomas, and in the malignant mesenchymal cells of bone and soft tissue sarcomas. FAP expressed by cultured fibroblasts consists of two sub-units, FAP α and FAP β. Monoclonal antibodies which recognise FAP and both of its sub-units have been generated and their use to recognise cancer cells and, thus, in the detection and therapy of cancers has been proposed (see Rettig W. J., et al., Fibroblast activation protein: purification, epitope mapping and induction by growth factors, Int. J. Cancer 58(3), 385-392 (1994); Welt S., et al., Antibody targeting in metastatic colon cancer: a phase I study of monoclonal antibody F19 against a cell-surface protein of reactive tumour stromal fibroblasts, J. Clin. Oncol, 12(6) 1193-1203 (1994) and W095/29233). Rather than selecting those cells identified by monoclonal antibodies which recognise FAP as previously proposed, the present inventors, starting from solid breast tumour samples, selected only those cells which were not recognised by the antibodies and found, surprisingly, that the resulting FAP^" cells consisted mainly of primary breast cancer cells and few contaminating stromal and non-malignant breast epithelial cells. In so doing, the present inventors solved the above discussed problem by providing an effective technique for preparing highly purified populations of primary breast cancer cells, from which they were able, in accordance with further aspects of the invention, to identify nucleic acid molecules which are differentially expressed in primary breast cancer cells and, hence, to arrive at the various further aspects of the invention, which will be discussed below.

Therefore, in accordance with a first aspect of the present invention, there is provided a method of selecting tumour cells, preferably primary breast tumour cells, comprising exposing a tumour cell containing tissue sample to an agent specific for fibroblast activation protein (FAP), separating cells recognised by said agent from the remaining cells in the sample and harvesting said remaining cells. The agent can be an antibody and, preferably, is a monoclonal antibody specific for FAP, or a FAP epitope. The antibody can be a monoclonal antibody which is specific for an epitope on the FAP α sub-unit. The antibody can be any one of the monoclonal antibodies F19, FB23, FB58, FB52 or C48 disclosed by Rettig et al., Welt et al. (see above), W095/29233, US 5059523, or Rettig et al., Cane. Res. 46:6406-6412 (1986). Further suitable antibodies can be prepared by employing the techniques for so doing disclosed in and referred to by Rettig et al., Welt et al. (see above) or W095/29233. The monoclonal antibodies can be labelled, preferably with iodine 131, and in the manner disclosed in the aforementioned references.

In a second aspect, the present invention relates to a method for identifying a nucleotide sequence which is differentially expressed in a tumour cell, preferably a primary breast tumour cell, comprising carrying out a method of selecting tumour cells in accordance with the first aspect of the invention, deriving expressed nucleic acid sequences from said harvested tumour cells and from a sample of their normal counterparts, and comparing said sequences to identify those which are differentially expressed. Said nucleic acid sequences can be derived by employing differential display PCR (see Liang P. and Pardee A. B., Differential display of eukaryotic messenger RNA by means of polymerase chain reaction, Science, 257:967-971 (1992); Liang P., et al, Analysis of altered gene expression by differential display, Methods Enzymol., 254, 304-21, (1995); and Liang P. & Pardee A. B., Recent advances in differential display, Current Opinion in Immunology, 7: 274-280, (1995)). DNA for amplification by differential display PCR can be obtained from RNA, extracted from both purified primary breast cancer cells obtained in the aforementioned manner and purified normal breast luminal epithelial cells obtained by immunomagnetic sorting of normal breast tissue (see Clarke C. et al., An immunomagnetic separation method using superparamagnetic (MACS) beads for large-scale purification of human mammary luminal and myoepithelial cells, Epithelial Cell Biol., 3(1), 38-46 (1995)), by reverse transcription (see Chomczynski P. & Sacchi N., Single-step method of RNA isolation by guanadinium thiocyanate-phenol-chloroform extraction, Anal. Biochem, 162,156- 159 (1987), and the aforementioned Liang P. et al. and Liang P. and Pardee A. B. references).

Thus, in a preferred embodiment of the method in accordance with the second aspect of the invention, mRNA from said harvested tumour cells and from their normal counterparts is reversed transcribed, and the resulting cDNA is amplified by PCR, the amplification products are compared and those which are differentially displayed are then identified. This last step can be carried out using conventional techniques. For example, the PCR amplification products can be run ( by electrophoresis ) on a standard sequencing gel and the gel can then be dried and autoradiographed.

Nucleotide sequences shown to be differentially displayed by gel electrophoresis can be cut from the gels, optionally amplified by PCR, and cloned using conventional techniques. The cloned cDNAs can then be sequenced, again using conventional techniques. Thus, in a third aspect of the present invention, there is provided a nucleic acid molecule comprising a nucleotide sequence identified by a method in accordance with the second aspect of the invention, a complimentary sequence, a sequence hybridizable under stringent conditions to such a nucleotide sequence, or a fragment unique to such a nucleotide sequence. Methods in accordance with the second aspect of this invention can include further steps carried out with the objective of identifying longer or "full length" nucleic acid molecules (e.g. mRNA or cDNA) that are differentially expressed in tumour cells, which are also in accordance with the third aspect of the invention. Such further steps include the use of sequences found to be differentially expressed by the foregoing techniques as probes to screen cDNA libraries from breast tumours, or as primers for RACE-PCR techniques, as described in Example 6 below.

Using such methods, cDNA clones having the sequences set out in SEQ ID NOs: 1-29 have been identified. All of these sequences (see table 1 below) have been compared with sequences held on searchable databases and have been found either to be entirely unique or to only partially match with known sequences. No known sequences matched with any part of the sequences set out in SEQ ID NOs 14 and 26. Thus, in a fourth aspect, the present invention relates to a nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence;

(b) hybridizable, optionally under stringent conditions, to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof, and comprises a nucleotide sequence that is at least 66, 70, 75, 80, 85, 90, 95, 97, 98 or 99% homologous to any one of SEQ ID NOs: 1-30 or a complimentary sequence; or

(c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue. Nucleic acid molecules in accordance with this aspect of the invention which are hybridizable to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30, or a complimentary sequence, or to a portion thereof, should comprise a nucleotide sequence that shows a greater degree of homology with any one of SEQ ID NOs: 1-30 than its closest known match, as set out in table 1 below. Of the sequences set out in SEQ ID NOs: 1-30, those set out in SEQ ID NOs: 13, 14, 16, 22, 26, 27 and 29 did not match with any known sequences. Thus, in accordance with a fifth aspect of the present invention, there is provided a nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29 or a complimentary sequence, or a portion of such a sequence;

(b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29 or a complimentary sequence, or to a portion thereof; or

(c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

Alternative methods for detecting genes which are differentially expressed are well known to those skilled in the art. One such method is described in Welford et al. Nucleic Acids Res. 1998, 26(12):3059-65. This method used representational difference analysis in combination with "microarray hybridisation", in which differentially expressed genes were identified by arraying cDNAs from a subtracted library at high density on glass slides and hybridising these arrays with differentially fluorescently labelled DNA from the two tissues to be compared. Fluorescent signals at each DNA spot were measured allowing differentially expressed genes to be detected.

The invention also relates to nucleic acid molecules which comprise a nucleotide sequence coding for a polypeptide or protein encoded for by a nucleic acid molecule in accordance with previously discussed aspects of the invention, or a complimentary nucleic acid sequence.

The nucleic acid molecules of the invention can be single or double stranded and can be DNA or RNA. Moreover, the recited nucleotide sequence included in any such molecule can be in the form of at least two exons separated by at least one intron.

Reference is made herein to hybridisation under "stringent conditions". This term refers to parameters well known to those skilled in the art. More specifically,

"stringent conditions" as used herein refers to hybridisation at 65°C in hybridisation buffer (3.5 x SSC, 0.02% Ficoll, 0.2% Polyvinyl pyrolidone, 0.02% bovine serum albumin, 25 mM NaH₂ P0₄ (pH 7), 0.5% SDS, 2 mM EDTA). After hybridisation, the membrane upon which the nucleic acid is transferred is washed at 2 x SSC at room temperature and then 0.1 x SSC/0.1 x SSD at 65°C. SSC is 0.15 M sodium chloride/0.15 M sodium citrate, at pH7; SSD is sodium dodecyl sulphate and EDTA is ethylene diamine tetraacetic acid. There are other conditions, reagents, and so forth which can be used, which result in the same degree of stringency (see Sambrook et al., Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbour, NY (1989) and Current Protocols in Molecular Biology F.M.

Ausubel et al., eds., John Wyllie & Sons, Inc., New York). Those skilled in the art will be familiar with such conditions and will be able to manipulate them in a manner which will permit the clear identification of the nucleic acid molecules of the invention.

When a nucleic acid molecule is said to be hybridizable to another of a given sequence under "stringent conditions" it is preferred that it should be at least 75, 80, 85, 90, 95, 97, 98 or 99% homologous to the given sequence. Wherever a nucleotide is described as hybridizable to another, it is understood such hybridisation can be hybridisation with a polynucleotide strand complimentary to that exemplified.

Percentage homology figures can be calculated using the BLAST algorithm (BLASTN), available via the world wide web at the NCBI (see also Altschul, S.F. et. al., Basic local alignment search tool, J. Mol. Biol. 215:403-10). However, other algorithms can be employed, where appropriate. Many aspects of the present invention make use of "fragments unique" to one or a combination of the sequences set out in SEQ ID NOs: 1-30. A fragment unique to a particular nucleic acid molecule is one that is a "signature" for the larger nucleic acid molecule. It should be long enough to assure that its precise sequence is not found in molecules other than those to which it is unique. Such unique fragments and other nucleic acid molecules in accordance with the invention are useful as probes in Southern or Northern blot assays to identify the presence, amplification, mutation or expression of nucleic acid molecules comprising the sequences of the present invention or can be used in amplification assays such as those employing PCR. As those skilled in the art will be aware, large probes such as those comprising 200 nucleotides or more are preferred for certain uses such as Southern or Northern blots, whilst smaller fragments will be preferred for uses such as PCR. Unique fragments also can be used to produce fusion proteins for generating antibodies or for generating immuno-assay components. Unique fragments further can be used as antisense molecules to inhibit the expression of nucleic acid molecules and, thus, for certain of the therapeutic purposes of the present invention. As those skilled in the art will be aware, the size of a unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NOs: 1-30 and compliments thereof will require longer segments to be unique, while others will require only short segments, typically of between 12 and 32 nucleotides in length. Those skilled in the art will be well able to select such sequences, typically on the basis of the ability of unique fragments to selectively distinguish sequences of interest from others. A comparison of the sequences of candidate fragments to those on known databases typically is all that is necessary, although in vitro confirmation by hybridisation and sequence analysis may be required. Wherever "portions" of a defined nucleotide sequence or sequences are referred to, these can be and, preferably, are fragments unique to that sequence, or to one or a combination of those sequences.

Nucleic acid molecules in accordance with the present invention can be used in a variety of ways in accordance with the invention. For example, they can be labelled and used as DNA probes to screen cDNA libraries so as to select by hybridisation cDNA sequences that code for proteins which are differentially expressed in breast cancer. Alternatively, they can be used to form "microarrays" of immobilised DNA or oligonucleotides on glass or nylon substrates (for a review of this technique see Ramsay, G. Nature Biotechnology, 1998, 16(l):40-44). Such microarrays can be used for screening a sample to determine the expression of nucleic acid molecules of the current invention. They can also be employed to generate primers to amplify cDNA in RT-PCR techniques used for the same purpose. Such techniques can be useful in the search for genetic mutations associated with breast cancer and in the diagnosis of disease and are discussed below. Other uses of the nucleic acid molecules of the invention include their employment in the preparation of polypeptides and peptides in accordance with the invention using the recombinant DNA techniques discussed below. Nucleic acid molecules in accordance with the invention can be used to screen a microarray (chip) library which displays genes associated with a known condition or function to determine whether the former are involved in said condition or function.

In a sixth aspect, the invention relates to a polypeptide encoded by a nucleic acid molecule in accordance with any of the third to fifth aspects of the invention. The invention also provides polypeptide-binding agents which selectively bind or are specific for polypeptides in accordance with the invention. Preferred such polypeptide-binding agents include antibodies, for example monoclonal antibodies, or antibody fragments specific for isolated polypeptides in accordance with the invention. The polypeptide-binding agents can comprise agents capable of occupying or occluding a catalytic site on a polypeptide in accordance with the invention. Polypeptide-binding agents can include humanised (chimeric) and synthetic antibodies, or antibody like molecules, and fragments thereof (e.g., Fab, F(ab)₂, fd and antibody fragments which include a CDR III region that binds selectively to the polypeptide or proteins of the invention). The antibodies can be radio-labelled or carry a fluorescent marker.

Polypeptide-binding agents which selectively bind or are specific for polypeptides in accordance with the invention can be used, as described, for screening assays, for diagnostic assays (see for example Goldenberg, D.M., Am. J. Med. 1993; 94(3) :297- 312) for purification protocols or for targeting drugs, toxins and/or labelling agents (e.g. radioisotopes, fluorescent molecules, etc.) to cells which express a polypeptide or protein in accordance with the invention on the cell surface, or in any method of immunotherapy (for a review of such methods see Bodey et al. Anticancer Research, 1996, 16(2):661-674). Such binding agents can also be prepared to bind complexes of a polypeptide or protein in accordance with the invention and an HLA molecule by selecting the binding agent using such complexes. Drug molecules that would disable or destroy tumour cells which express such complexes are known to those skilled in the art and are commercially available. For example, the immunotoxin art provides examples of toxins which are effective when delivered to a cell by an antibody or fragment thereof. Examples of toxins include ribosome-damaging toxins derived from plant or bacterial such as ricin, abrin, saporin, Pseudomomonas endotoxin, diphtheria toxin, A chain toxins, blocked ricin, etc.

Polypeptide-binding agents can also be used to target gene therapy vectors to cells expressing the polypeptides of the current invention. For example, peptides that bind the expressed polypeptides can be selected from peptide-presenting phage libraries as described. These selected peptides can be incorporated into biological or physical gene therapy vectors. Alternatively, the peptide-presenting phage themselves may be candidates for gene therapy vectors, (see Dower et al. Nature Medicine, 1996, Mar;2(3):299-305.)

Polypeptides and peptides in accordance with or used in the practice of the present invention can be prepared by using the recombinant DNA technology. Thus, a coding DNA sequence can be introduced into an expression vector suitable for directing the expression of the polypeptide coded for by that DNA sequence in a host cell. Suitable vectors include bacterial plasmids, phage DNA, cosmids, yeast plasmids and viral DNA, such as vaccinia and adenovirus DNA. The procedure generally involves inserting a DNA sequence to be expressed into an appropriate restriction endonuclease site so that it is operatively linked to a promoter for directing mRNA synthesis. A coding sequence and regulatory sequence, such as a promoter sequence, are considered to be "operably" linked when they are covalently linked in such as way as to the place the expression or transcription of the coding sequence under the influence or control of the regulatory sequence. The resulting vector may then be employed to transform or transfect an appropriate host to cause that host to express the required polypeptide or protein. Appropriate host cells can be higher eukaryotic cells, such as mammalian cells or insect cells, or can be lower eukaryotic cells, such as yeast cells, or prokaryotic cells, such as bacterial cells. Examples include E-coli and Bowes melanoma cells. The selection of an appropriate host and the manner in which the vector is introduced into the host cell are matters within the knowledge of those skilled in the art. However appropriate techniques, cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecular Cloning, A Laboratory Manual, Second Edition, Coldspring Harbour, NY 1989. The invention, therefore, also extends to expression vectors comprising nucleic acid molecules in accordance with the invention operably linked to suitable promoters, and to host cells transformed or transfected with such expression vectors.

Once a suitable host strain has been selected and transformed with a vector including a DNA sequence encoding a desired protein, the transformed cells can be grown to an appropriate cell density and then harvested, for example by centrifugation, and disrupted by physical or chemical means. Such means can include freeze-thaw cycling, sonication, or mechanical disruption. The resulting crude extract can be further purified using techniques known in the art, including high performance liquid chromatography (HPLC), which may be employed for final purification steps.

A specific example of a technique for preparing expression products of the nucleic acid molecules disclosed herein is described in Example 7 below and involves the use of the commercially available Tet-On or Tet-Off systems. When such systems are used, the expression products can be isolated by alternative techniques, which do not involve the destruction of the transformed cells, as well as by the disrupting techniques described immediately above.

Any of these techniques can be used alone or in conjunction with PCR amplification methods ( see Arnheim N. and Levenson, CH. (1990) Polymerase Chain Reaction, Chem. Eng. News 68(Oct 1) 36-47). Antibodies, both poly- and monoclonal, antibody fragments, chimeric antibodies and antibody like molecules specific for polypeptides in accordance with the invention can be prepared by conventional techniques, using polypeptides in accordance with the present invention, fragments, analogues or derivatives thereof, or cells which express such polypeptides as immunogens. Short peptides having amino acid sequences corresponding to portions of the polypeptide molecules referred to herein can also be used to prepare useful antibodies.

Suitable antibodies can be generated by injecting peptides or polypeptides directly into an animal. Alternatively, monoclonal antibodies can be produced by continuous cell line cultures using techniques which are well known to those skilled in the art. Examples of the latter include the hybridoma techniques originally described by Cohler and Milstein, in 1975, Nature 256:495-497, and those described in and referred to in the aforementioned Rettig W.J. et al. and Welt S. et al., publications. Antibodies or antibody-like molecules can also be produced by genetic engineering techniques. For example, a 'phage display library' can be constructed by cloning immunoglobulin V-region genes in filamentous phage so that the latter express, on their surfaces, fusion proteins containing the antigen-binding domains coded for by the cloned genes. Such a library can then be used to identify phage particles which express those antibody-like fusion proteins having a high affinity for a particular antigen. These phage particles can be used like antibody molecules or the V-region genes that they contain can be recovered and engineered into antibody genes and the latter can be used to produce antibody molecules. See Janeway and Travers in Tmmunobiology', 3^rd Edition, Current Biology Ltd., page 2:18-2:19 and Winter et al. in 'Making antibodies by phage display technology', Ann. Rev. Immunol. 1994, 12: 433-455.

Genetic engineering techniques can also be used to generate chimeric antibodies. For example, epitope-specific antibodies may be "humanized" by grafting the antigen-binding loops or CDRs of a mouse monoclonal antibody onto the framework of a human immunoglobulin molecule. See Winter and Harris in 'Humanized antibodies', Immunol. Today, 1993, 14, 243-246 and Janeway and Travers in Tmmunobiology' (see above) page 3:8.

Derivatives, analogues, portions or fragments of the nucleic acid molecules or polypeptides referred to herein, which retain essentially the same biological function or activity are considered to be functionally equivalent homologues to the recited nucleic acid molecules and polypeptides and are encompassed by the present invention. Analogues of polypeptides, for example, include pro-proteins, which can be activated by cleavage of the pro-protein portion to produce an active mature polypeptide.

In a seventh aspect, the present invention provides a method of diagnosing a disease, preferably breast cancer, comprising contacting a biological sample isolated from a subject with an agent that is specific for a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ

ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; (b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; (c) a nucleic acid molecule in accordance with the third aspect of the invention; or (d) a fragment unique to one or a combination of the sequences set out in SEQ ID

NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue, or with an agent that is specific for an expression product of such a nucleic acid molecule, and assaying for interaction between the agent and any of the nucleic acid molecule or expression product in the sample as a determination of the disease.

An agent should be considered as "specific" for a particular nucleic acid molecule or polypeptide if it is capable of interacting with that nucleic acid molecule or polypeptide in a manner which can be distinguished from its interactions with other molecules in the context in which it is used. For example, such an agent may be capable of selectively binding to the relevant nucleic acid molecule or polypeptide under the conditions prevalent in a particular assay. The term "contacting" means that the biological sample is placed in sufficient proximity to the agent and under appropriate conditions of, for example, concentration, temperature, time, to allow the specific interaction between the agent and any nucleic acid molecule or polypeptide for which is it specific, to take place. Appropriate conditions for contacting agents and biological samples are well known to those skilled in the art and are selected to facilitate the specific interaction between particular target molecules (nucleic acid or polypeptide) and specific agents.

The agent can comprise a polypeptide-binding agent, such as an antibody, preferably a monoclonal antibody, an antibody fragment, or an antibody-like molecule (as described above), specific for a polypeptide encoded by the nucleic acid molecule or any other polypeptide binding agent which selectively binds a polypeptide encoded by the nucleic acid molecule. In embodiments, the antibodies or antibody fragments can carry fluorescent markers, or can be radio-labelled. They can also be chimeric. The agent can also be a nucleic acid molecule complimentary to the nucleic acid molecule and the assay can comprise amplification (for example using PCR) specific for the nucleic acid molecule. The biological sample can be in vruo or in vitro. However, it is preferred that the biological sample is invitro and comprises cell-containing tissue extracted from a patient.

The agent can be an immobilised antibody attached to a substrate and the method of diagnosing disease can involve a conventional enzyme-linked immunosorbent assay (ELISA) carried out on a protein containing biological sample derived from a patient. Alternatively, the method can comprise a Western blot in which the agent is a labelled or unlabelled antibody and the biological sample comprises proteins derived from a patient and separated by electrophoresis on an SDS polyacrylamide gel.

Preferably, the biological sample is isolated from breast tissue and the diagnostic method in accordance with this aspect of the invention is practised using a kit comprising an agent specific for the nucleic acid molecule or an expression product of such a molecule. The agent can comprise a nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in any of SEQ ID

NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; (b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof;

(c) a nucleic acid molecule in accordance with the third aspect of the invention; or

(d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue. The nucleic acid molecule can be labelled with a detectable marker, such as ³²P or ³⁵S, and employed, in accordance with this aspect of the invention, as a hybridisation probe to probe a cDNA library derived from a tissue sample taken from a patient. In such a method, cDNA is firstly isolated using known methods, and then digested with one or more restriction enzymes. The resulting cDNA fragments are separated on agarose gels, denatured in situ, and transferred to membrane filters. After pre-hybridisation to reduce non specific hybridisation, the radio-labelled nucleic acid probe is hybridised to the immobilised cDNA fragments. The membrane is then washed to remove unbound or weakly bound probe, and is then autoradiographed to identify the DNA fragments that have hybridised with the probe. The nucleic acid molecule can also be labeled with a fluorescent probe and used to probe a high density microarray of DNA elements to search for differential gene expression, (see for example De Risi et al., Nature Genetics, 1996, 14(4):457- 460.)

The interaction can also be determined by conventional PCR amplification of nucleic acid molecules present in the biological sample, preferably using a nucleic acid molecule as defined above as a primer. Thus, in a eighth aspect, the invention provides a kit for diagnosing disease, preferably breast cancer, or for detecting the presence or expression of a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence;

(b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof;

(d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue; said kit comprising a pair of isolated nucleic acid molecules each of which comprises a) a 12-32 nucleotide contiguous segment of any of SEQ ID NOs 1-30 or of a nucleic acid molecule in accordance with the third aspect of the invention, or b) a complement of a), wherein the contiguous segments are non-overlapping.

In a ninth aspect, the present invention provides a method of identifying agents for treating a disease, preferably breast cancer, comprising assaying for a capacity to modulate an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence;

(d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs:l-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

Preferably, the method comprises assaying for a capacity to modulate an activity of a polypeptide encoded by the nucleic acid molecule and can comprise screening for a capacity to bind to the polypeptide or a receptor for the polypeptide, or to otherwise disrupt the normal interaction between the polypeptide and its receptor. The method can involve transforming or transfecting a host cell to express the polypeptide (see above), contacting the host cell with a putative agent for modulating the activity or expression of the polypeptide and assaying for an alteration in a phenotype associated with expression of the polypeptide.

Agents can be identified by selecting from "libraries" of putative molecules. Such libraries and their applications are described, for example, in Houghten, R.A, Gene, 1993 Dec 27;137(1):7-11; Lam, K.S., Anticancer Drug Des. 1997 Apr;12(3):145-167; Needels et al. Proc. Nat. Acad. Sci.USA, 1993, Nov 115;90(22): 10700-4.

In another aspect, the invention provides a pharmaceutical composition for treating disease, preferably breast cancer, comprising an agent having the capacity to modulate an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of

SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; (b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof;

Agents specific for particular nucleic acid molecules, or having a capacity to modulate, inhibit or down regulate the expression of such nucleic acid molecules include antisense molecules capable of binding to them, or to promoter regions associated with them in vivo. Antisense molecules are generally oligonucleotides of from 10 to 40 bases in length, which are complimentary to the region of a target gene involved in transcription and which, by binding thereto, can prevent transcription of that gene. For example, one of the nucleic acid molecules discussed above can be used to design an antisense RNA oligonucleotide of from 10 to 40 bases in length, which is capable of in vivo hybridisation with an mRNA transcription of the gene to which the aforementioned nucleic acid molecule corresponds, to block translation of that mRNA molecule into the polypeptide encoded by that gene. Similar techniques can be employed using antisense DNA. Antisense molecules can be delivered directly to affected cells or, alternatively, by other known procedures in which antisense RNA or DNA is caused to be expressed in vivo and thereby to inhibit in vivo production of such polypeptide products. The techniques involved in preparing and employing antisense molecules are well known to those skilled in the art. However, further information may be found in:- Antisense; Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as antisense inhibitors of gene expression, CRC Press, Boca Raton, FLA. (1998); Lee et al, Nucl. Acids. Res. 6:3073 (1979); Cooney et al, Science, 241: 456 (1998); Dervan et al, Science, 251:1360 (1991); and Zhang W.W. . Mol. Med. 1996, 74(4):191-204.

Agents which effectively alter the expression of a nucleic acid molecule can be detected after treatment by using a microarray of cDNA derived from a tissue sample and using a fluorescently labelled probe derived from the nucleic acid molecule to detect the presence and amount of expression (see Ramsay G. above).

In addition to the antibodies, antibody fragments and agents that include antibody fragments discussed above, agents which have a capacity to modulate the activity or expression of a polypeptide encoded by a nucleic acid molecule in accordance with the invention can also include small molecule inhibitors which can bind to and occupy a catalytic site either on such a polypeptide, or on a receptor to which the polypeptide binds, thereby making the catalytic site inaccessible and inhibiting the biological activity of the polypeptide. Examples of such small molecule inhibitors include small peptides, and peptide-like molecules. Candidate such agents can be identified in accordance with the ninth aspect of the invention, by exposing host cells transformed (using the conventional recombinant DNA techniques referred to above) to express polypeptides coded for by nucleic acid molecules in accordance with the invention and identifying those agents which inhibit a tumourigenic phenotype (such as accelerated growth) exhibited by such cells, as being potentially useful in the treatment of disease, especially breast cancer. Once a candidate agent has been identified, structurally similar chemical entities can be tested, either by using conventional techniques or by using the above described techniques, in order to find further efficacious agents. Such candidates can then be subjected to further tests of the type conventionally employed in the pharmaceutical industry. Such further tests can include toxicology and efficacy tests carried out using animals and subsequent human clinical trials. Alternatively, small molecule chemical entities, selected on the basis of their known or predicted properties for a potential to bind the relevant polypeptides can be screened for such binding activities. Those compounds which are found to bind with the relevant polypeptides and which, therefore, have the potential to inhibit their activities, can be further tested using conventional techniques (as discussed above), to confirm their ability to ameliorate the symptoms of disease, especially breast cancer, and their suitability for use as pharmaceuticals.

Such polypeptide binding compounds can also include genetically engineered fusion proteins composed of physiological ligands of a target protein linked to genetically modified bacterial toxins ( Tagliaferri, P. et al, Anticancer Drugs, 1994, Aug:5(4):379-93).

Preferably, the agent has the capacity to down regulate or inhibit an activity or expression of a polypeptide encoded by a nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of

SEQ ID NOs:l,2,4,5 or 7-30 or a complimentary sequence, or a portion of such a sequence;

(b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1,2,4,5 or 7-30 or a complimentary sequence, or to a portion thereof; or

(c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1, 2, 4, 5 or 7-30. The agent employed in this aspect of the invention can be an antisense molecule capable of binding to the nucleic acid molecule, or to an associated promoter region, or it can be a polypeptide binding agent, such as an antibody or antibody fragment, capable of selectively binding to the polypeptide. In embodiments, the agent can comprise an inhibitor or antagonist capable of binding to the polypeptide or a receptor for the polypeptide, to thereby inhibit the biological activity of the polypeptide. Preferably, the agent will have been identified, or is identifiable, by a method involving carrying out an assay in accordance with the ninth aspect of the invention.

In alternative embodiments, pharmaceutical compositions in accordance with the invention have a capacity to up regulate or enhance the activity or expression of a polypeptide encoded by a nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or a portion of such a sequence;

(b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or to a portion thereof; or

(c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 3 and 6.

Again, the agent may have been identified or be identifiable by a method involving an assay in accordance with a previously described aspect of the invention.

In a yet further aspect of the present invention, there is provided a pharmaceutical composition for treating disease, preferably breast cancer, comprising a polypeptide encoded by an isolated nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or a portion of such a sequence; (b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or to a portion thereof; or (c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 3 and 6.

The invention also contemplates gene therapy. A procedure for performing ex vivo gene therapy is outlined in US Patent No. 5,399,346 and in exhibits submitted in the file history of that patent. In general, the procedure involves the introduction in vitro of a functional copy of a gene into a cell of a subject which contained a defective copy of the gene, and returning the genetically engineered cell to the subject. The functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell. Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in WO96/00654. In vivo gene therapy using vectors such as adenovirus, retrovirus, poxvirus and lentivirus is also contemplated in accordance with the present invention.

Thus, in another aspect, the present invention provides a pharmaceutical composition for treating a disease, preferably breast cancer, comprising a nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, a portion of such a sequence;

(c) a nucleic acid molecule in accordance with the third aspect of the invention; or (d) a fragment unique to one or a combination of the sequences set out in SEQ ID

NOs: 1-30; and which forms at least a portion of nucleic acid molecule differentially displayed/ expressed in breast tumour tissue in comparison to normal breast tissue.

Preferably, the nucleic acid molecule is included within an expression vector, and is operably linked to a promoter. Such an expression vector can be used to transform or transfect a host cell ( see above ) and such transformed or transfected host cells themselves, can be employed in pharmaceutical compositions in accordance with the invention. Preferably, these expression vectors or host cells are capable of expressing, in vivo, a polypeptide encoded by an isolated nucleic acid molecule which is:-

(a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, of a portion of such a sequence;

(c) a fragment unique to a combination of the sequences set out in SEQ ID NOs: 3 and 6.

In a yet further aspect, the present invention provides a method of treating disease, preferably breast cancer, comprising administering a pharmaceutical composition in accordance with one of the above discussed aspects of the invention to a patient. The method can be for the treatment of established disease or one of prophylaxis.

In further aspects of the invention nucleic acid molecules, polypeptides, polypeptide binding agents, kits and compositions in accordance with the invention can be used in the diagnosis, treatment as prophylaxis of tumours other than breast tumours and, in particular, tumour of the oesophagus and colon.

Pharmaceutical compositions in accordance with the present invention can be formulated with conventional pharmaceutically acceptable carriers and excipients, either for systemic or local administration. Such carriers and recipients can be selected without difficulty by those skilled in the art.

Figures 1-5 show stained gels and depict the results of experiments described in examples 2-6 below. EXAMPLES

Example 1: Purification of tumour cells

Negative cell sorting primarily with the F19 antibody (Rettig W. J., et al, Fibroblast activation protein: purification, epitope mapping and induction by growth factors, Int. J. Cancer, 58, 385-92 (1994) and Welt S. et al, Antibody targeting in metastatic colon cancer: a phase I study of monoclonal antibody F19 against a cell-surface protein of reactive tumour stromal fibroblasts, J. Clin. Oncol, 12(6) 1193-203 (1994)) directed against a protein expressed in activated stromal fibroblasts was used to produce populations of highly purified tumour cells from solid tumours in small amounts .

Pathological tumour samples were stored in L-15 medium for transport prior to processing. Upon receipt, samples were trimmed of fat, weighed and cut into 1 mm³ pieces. With larger pieces (> lg) one part was taken for direct freezing whilst the remainder was disaggregated. Smaller pieces (0.5-lg) were completely disaggregated. Disaggregation of tumours was performed with 0.25% (w/v) type 1 collagenase at 37°C for 4-6 hours with agitation. Fragments were removed by centrifugation and resuspended in fresh L-15. Fragments were passed through a 100 micron filter and examined. The larger retained fragments tended to include "normal" epithelium. The filtrate, consisting mainly of smaller tumour fragments and single cells, was stained with the F19 anti-stromal cell antibody. Stained cells were then labelled with anti-mouse IgG coated Dynabeads. These cells were then removed from suspension in a magnetic particle concentrator. F19 positive (stroma) and negative (tumour) fractions were separately collected, recorded by phase photography and stored as cytospin preparations. Fractions were washed in PBS and flash frozen prior to RNA extraction.

Example 2: Isolation of sequences differentially expressed by primary breast tumour cells using differential display PCR

Preparations of F19 negative tumour cells, obtained by the method described in Example 1, were used in a differential display comparison with purified normal breast luminal epithelial cells obtained by immunomagnetic sorting of normal breast tissue from cosmetic reduction mammoplasty surgery (Clarke C, et al, An immunomagnetic separation method using superparamagnetic (MACS) beads for large-scale purification of human mammary luminal and myoepithelial cells; Epithelial Cell Biol, 3(1), 38-46 (1994)).

RNA was extracted from 6 samples each of normal breast luminal cells and F19 negative breast tumour cells by standard methods (Chomczynski P. & Sacchi N., Single-step method of RNA isolation by guanadinium thiocyanate-phenol- chloroform extraction, Anal. Biochem., 162, 156-159 (1987)). Yields of approximately 50-200μg of total RNA were obtained from each sample of approximately 10⁶ to 10⁷ cells. 50-100μg of total RNA was DNase-treated to remove contaminating DNA using a MessageClean kit (Biogene/GenHunter) according to the manufacturers instructions. For each RNA sample, 0.2 μg of cleaned total RNA was reverse transcribed from each of 3 single base anchored oligo-dT primers (T_πG, T_nA, T_nC) using Superscript II reverse transcriptase (Life Technologies) under standard conditions in a 20μl reaction.

The use of single base-anchored primers in reverse transcription and subsequent differential display PCR has recently been described (see Liang P., et al, Analysis of altered gene expression by differential display. Methods Enzymol, 254, 304- 21(1995)).

Following reverse transcription, samples were subjected to differential display PCR (DDPCR) essentially as described by the originators of this technique (see, Liang P. & Pardee A. B., Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction; Science 257(5072), 967-71 (1992)) with the following modifications. The three reactions with each of the anchor primers were mixed and diluted 5-fold. 2μl of each mixed reverse transcription was then amplified in a lOμl PCR reaction containing lOmM Tris pH 8.3, 50 mM KCl, 1.5mM MgCl₂ , 2μM dNTPs, 0.2μM mixed anchor primer (T_nM), 0.2μM random internal 10-mer (Operon Technologies), 0.2μ Ci ³⁵SdATP (Amersham) and 1 U AmpliTaq polymerase (Perkin Elmer). PCR was performed under the following conditions: 94°C for 1 minute, followed by 40 cycles of 94°C for 30 seconds, 40°C for 2 minutes and 72°C for 30 seconds with a final cycle of 72°C for 5 minutes. Following amplification 3μl of each reaction was run on a standard sequencing gel (Sequagel 6, National Diagnostics) at 1700V for 3.5-4 hours. Gels were not fixed, but dried and autoradiographed for 1-5 days by exposure to X-Omat LS x-ray film (Kodak).

Comparisons of four normal luminal cell preparations with four F19 negative tumour cell preparations were made. For each RNA sample, 100 separate PCR reactions were performed, each containing a different single 10 base primer (Operon Technologies) and a mixture of 3 anchor primers (T_πM).

Figure 1 shows examples of one such comparison between 4 normal luminal cell samples (L) and 5 (Figure (a)) or 4 (Figure (b)) F19 negative tumour samples (T). The OP nomenclature denotes the random primers used in combination with a mixed 3' anchor primer (T_nM) and those bands which were up-regulated and subsequently cloned and sequenced are identified by their SEQ ID NOs.

Thirty bands which appeared to be up regulated in at least three of the four or five tumour cell samples and reduced or absent in normal luminal cells, plus two bands which were down regulated, were selected for cloning and sequencing.

The selected bands were cut from the gels for all four tumour samples, mixed, eluted in 4M Ammonium acetate solution at 37°C for 4 hours and precipitated with 3 volumes of ethanol at -20°C overnight. After centrifugation DNA pellets were resuspended in 20μl water and 4μl was used as a template for reamplification in a PCR reaction containing lOmM Tris pH 8.3, 50mM KCI, 1.5mM MgCl₂, 200μM dNTPs, 0.2μM mixed anchor primer (T_nM), 0.2μM random internal 10-mer (Operon Technologies), and I U AmpliTaq polymerase (Perkin Elmer). The PCR conditions were exactly as described above for the differential display with the same primer combination. Reamplified products were checked and sized on agarose gels and cloned without purification into the P-Gem T Easy vector (Promega) according to the manufacturers instructions. Cloned cDNAs were sequenced with the dRhodamine cycle sequencing kit on an ABI Prism automated sequencer (Perkin Elmer). The sequences of the resulting 29 clones derived from the differentially displayed bands are set out in SEQ ID Nos: 1-29. Comparison of these sequences with the Genbank/EMBL non-redundant nucleotide (nr) and EST databases with the BLAST algorithm (blastn) available via the world wide web at the NCBI, showed no matches for clones 13, 14, 16 and 22 (SEQ ID NOs: 13, 14, 16 and 22) and partial matches for the remainder.

Table 1 shows a summary of the sequences obtained (giving their corresponding SEQ IDs) and the results of their comparison to the Genbank/EMBLnr and EST databases.

Table I

Summary of initial sequence data from bands differentially displayed in breast tumour cells

Example 3: Secondary screening of candidate tumour markets Semi-quantitative RT-PCR was used as a screen to verify increased expression of candidate genes in tumours.

The following four panels of RNA were prepared against which the sequences obtained by the differential display method (DDPCR) described in Example 2 (which could be potential breast tumour markers) were screened: 1) The same RNA as was used in DDPCR, i.e. 4 normal luminal cell preparations and 4 F19 negative tumour samples; 2) A separate series of RNA preparations from 8 normal luminal cell samples and RNA from 22 breast cancer cell lines;

3) RNA prepared from 8 normal breast tissue preparations and 8 solid breast tumours; and 4) RNA prepared from 8 normal breast tissue samples and 11 human tissues; (liver, colon, spleen, kidney, skin, lymph node, duodenum, muscle, placenta, prostate and testis).

lOμg total RNA was reverse transcribed from an oligo-dT primer under conventional conditions (Superscript II, Life Technologies). The resulting reaction was diluted 10-fold in water and 2μl was used as a template for amplification with primers designed within the DDPCR cloned sequences (SEQ ID NOs: 1-29). Primers were designed to be between 18-22 bases in length, G/C clamped at the 3' end G/C rich (>50%), unique to that sequence (as determined using the BLAST algorithm) and to have a Tm of >60°C. PCR was performed under standard conditions in 50μl; lOmM Tris pH 8.3, 50mM KCI, 1.5mM MgCl₂, 200μM dNTPs, 0.2μM each primer (sense and antisense), and 1 U AmpliTaq polymerase (Perkin Elmer) with PCR cycles of 94°C for 1 minute then 25-40 cycles of 94°C for 30 seconds, 55-60°C for 1 minute and 72°C for 1-2 minutes with a final cycle of 72°C for 5 minutes. Control amplifications were performed with GAPDH (sense- TCCTGCACCACCAACTG (SEQ ID NO: 31) , antisense- GCCTGCTTCACCACCTT (SEQ ID NO:32)) and β-Actin (sense CGGTGGACGATGGAGGGGCCG (SEQ ID NO: 33), antisense- GCCGAGCGGGAAATCGTGCGTG (SEQ ID NO: 34)) specific primers. lOμl of each PCR product was resolved in 1.5% agarose gels after different cycle numbers.

Primers from GAPDH and SEQ ID NOs: 1, 4, 7 and 10 were used for the first of the above RNA panels and the resulting gel (stained with ethidium bromide) is shown in Figure 2. The 4 normal luminal cell samples are shown in Lanes 1-4 and the 4 F19 negative tumour cell samples are shown in Lanes 5-8. These results confirm that each of the sequences set out in SEQ ID NOs: 1, 4, 7 and 10 are over-expressed in the F19 negative tumour cell samples in comparison to the expression detected in the normal luminal cell samples.

Example 4: Quantitation of RT-PCT expression

RNA from normal luminal cells (L) and F19 negative tumour cells (T) was amplified in RT-PCT reactions with conventional PCR primers designed from the sequences for GAPDH, β-Actin, and from the sequences set out in SEQ ID NOs: 1, 4, 7 and 10 in the manner described in Example 3. lOμl samples were taken from each 50μl reaction throughout the amplification process and analysed by agarose gel electrophoresis.

The PCR products were Southern blotted onto Hybond-N nylon membranes which were then hybridised to the cloned differential display bands (corresponding to SEQ ID NOs: 1, 4, 7 and 10) and to clones for GAPDH and β-Actin under standard conditions (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)). Cloned cDNA inserts were labelled with ³²P in a Megaprime random-primed labelling reaction (Amersham) and hybridisations were carried out in 50- 100ml hybridisation buffer (50% formamide, 5xSSPE, 5x Denhardts reagent, 0.5% SDS, 0.1 mg/ml sonicated salmon sperm DNA) overnight at 42 °C. Following hybridisation filters were washed twice in 2xSSPE, 0.1% SDS for 30 minutes and twice in O.lxSSPE, 0.1%SDS for 30 minutes at the same temperature. Blots were autoradiographed for 1-24 hours with intensifying screens. Autoradiography of Southern hybridisations of these PCR products detects products formed early on in the exponential phase of PCR amplification and gives a better semi-quantitative comparison of expression.

Figure 3 shows the results of these Southern hybridisations after the number of PCR cycles indicated using cloned differential display products from the sequences indicated.

The data in Figure 3 confirm that the sequences set out in SEQ ID NOs: I, 4, 7 and 10 are preferentially expressed in the F19 negative tumour cells. Example 5: RT-PCR based expression screening of breast cancer cell lines compared to normal breast organoids and normal human tissues RNA extracted from a series of luminal cell preparations (L) and from 22 breast cancer lines (A-X) is used as a secondary screen for expression of candidate sequences (see RNA panel (2) in Example 3). Figure 4 shows the expression of the estrogen receptor (ER) across this panel of RNAs. Reverse transcribed RNA from each sample was amplified in RT-PCR reactions with primers directed against ER (sense-GGAGACATGAGAGCTGCCAAC (SEQ ID NO: 35), antisense- CCAGCAGCATCTCGAAGATC (SEQ ID NO: 36)) and GAPDH. Standard RT- PCR was performed as described above and lOμl of a 50μl reaction was removed after 25 (GAPDH) and 40 (ER) cycles of PCR and resolved on a 1.5% agarose gel. The gel was Southern blotted and filters hybridised to cDNAs for GAPDH and ER respectively under the conditions described above.

These data show that the ER receptor sequence is detectable in 2/8 of the normal luminal cell samples and 7/22 of the breast cancer cell lines tested. (ER is detectable in all of the samples shown under different conditions)

Screening of the panel of cell lines for ER demonstrates that this method can quickly identify ER-positive and ER-negative lines (and rank the level of expression) and, hence, that it can be used to screen for genes carrying the sequences identified in SEQ ID NOs: 1-30 and others differentially expressed in primary breast tumour cells, in comparison normal luminal cells that have been identified by techniques described herein. The results also demonstrate that this technique can be used to identify sources which contain a high level of expression of differentially displayed/expressed genes for use in the methods described in Example 6.

Example 6: Obtaining full length sequences Full length cDNAs, which contain the differential display sequences whose expression pattern has been confirmed by RT-PCR techniques (such as those set out in Examples 3-5) can be isolated. Breast cancer cell lines and breast tumour RNAs can be screened by RT-PCR (for example, in the manner described in Example 5) to identify an RNA source which contains a high level of expression of the differential display of interest.

The correct size of full length messenger RNAs can be ascertained on Northern blots of l-5μg of polyA + RNA from cell lines and/or tumour samples expressing the gene of interest as confirmed by RT-PCR using standard methods (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)). Poly A+RNA can be prepared from total RNA extracted by standard methods using the Dynabeads mRNA purification system

(Dynal) essentially as described by the manufacturer. Poly A+ RNA expressing the differential display sequence of interest as confirmed by RT-PCR and Northern blotting can then provide the source for cDNA library construction and/or RACE PCR.

cDNA library screening

Several cDNA libraries from breast tumours in lambda ZAP II (Stratagene) have been prepared according to the manufacturers instructions. Each library was characterised as containing at least a million independent clones whose average size was approximately 800bp or greater.

Amplified phage stocks of each library can be PCR screened to confirm the presence of clones matching the differential display sequence. Positive libraries can be screened by conventional library screening techniques (Sambrook J. et al, Molecular Cloning: A Laboratory Manual. Second ed. New York: Cold Spring Harbor Laboratory Press (1989)) to identify clones containing the differential display sequence. Sequencing of each clone can then identify those which contain an exact match to the differential display sequence. Comparison of each clone with polyA+ Northerns and results from RACE PCR (see below) can allow the assignment of clones as full length cDNAs. Once a full length cDNA sequence has been identified a suggested open reading frame can be assigned to each messenger RNA. This open reading frame can be used for subsequent expression studies. RACE PCR

In an alternative strategy for cloning full length cDNAs from differential display sequences RACE-PCR (Rapid Amplification of Cohesive Ends) can be employed. This is a PCR based method for generating full length cDNAs using short pieces of internal sequence information. RACE PCR is performed using a Marathon cDNA synthesis kit (Clontech) essentially as described by the manufacturer. Briefly, lμg poly A+ RNA from a source expressing the sequence of interest (confirmed by RT- PCR for example, in the manner described in Example 5) is reverse transcribed by Superscript II (Life Technologies) under standard conditions. Second strand cDNA is then synthesised with a mixture of E. coli DNA polymerase 1, E. coli DNAligase, E. coli RNAase H and T4 DNA polymerase. Double stranded cDNA is then extracted, precipitated and ligated to synthetic adaptors with Ready-to-go T4 DNA ligase (Pharmacia). The resulting adaptor ligated cDNA is then used as a template for RACE PCR. 5' and 3' RACE products are amplified from primers designed within the differential display sequence used in conjunction with adaptor primers. PCR is performed with tTH polymerase (Perkin Elmer) to minimize PCR mutations. Resulting RACE PCR products can then be cloned into pCR-Script (Stratagene). Sequencing of overlapping 5' and 3' RACE products should then allow reconstruction of the full length cDNA sequence.

Such a technique was used to identify the clone whose sequence is set out in SEQ ID NO. 30, starting from the clone whose sequence is given in SEQ ID NO. 21. Comparison of the sequence set out in SEQ ID NO. 30 with those held in public databases with the BLAST algorithm (blastn), showed partial matches with sequences coding for several human and other kinases. Once the former clone had been identified, the RT-PCR technique described in Example 5 was then employed to screen for expression of a gene carrying the sequence identified in SEQ ID NO. 30. The results of these experiments are set out in Figure 5, which shows an ethidium stained gel of RT-PCR products from primers designed within the differential display sequence SEQ ID NO. 30.

The results RT-PCR reactions from a first panel of RNAs, i.e. 4 from normal luminal cell samples (luminal) and 4 from F19 negative tumour samples (F19-ve tumour), show a strong band at 900bp overexpressed in the tumours (see Figure 5A).

The results of RT-PCR reactions from organoid RNA samples and solid tumour RNAs suggest that SEQ ID NO. 30 is expressed in 8/8 breast tumours and only 1/8 normal organoid RNAs (see Figure 5B).

The results of RT-PCR reactions for SEQ ID NO. 30 from a panel of breast cancer cell lines shows that this gene is overexpressed in approximately 50% of breast cancer cells in vitro and is absent from only 3 (HMT3552, PMC-42 and SKBR-7), whilst under the same PCR conditions only 1/8 normal luminal cell RNAs showed any expression of this gene (see Figure 5C). Figure 5C also shows a comparison between SEQ ID NO.30 expression and expression of ER and c-erb-B2 (the most commonly overexpressed breast tumour markers) which are overexpressed in 1/3 of the cell lines studied and are expressed at significant levels in more than half of the normal luminal RNAs under these conditions.

Example 7: Inducible expression studies Stable cell lines can be created which overexpress candidate genes (e.g. SEQ ID NOS. 1-29) constitutively. However, regulated expression removes the problem of adaption/desensitisation found with continuous expression and permits the study of potentially lethal/toxic genes.

Recently, several approaches have been developed which rely upon the tet rφressor (tetR) derived from transposon-10 tetracycline (Tc) -resistance operon of E. coli. In one of the most successful modifications teiK is fused to the acidic C-terminal domain of the herpes simplex virus protein VP16 (which is essential for the transcription of viral immediate early genes) to produce a tetracycline controlled transactivator (tTA) (M. Gossen and H. Bujard, Tight control of gene expression in mammallian cells by tetracycline-responsive promoters; Proc. Natl Acad. Sci. USA, 89(12), 5547-51 (1992)). In this strategy first stable lines are produced which constitutively express tTA. A second transfection is then performed to introduce a construct containing a novel gene under the control of a minimal CMN promoter which has been fused downstream to heptameric repeats of the tet operon tetO. tTA causes the activation of transcription of the novel gene, while addition of Tc titrates out tTA and transcription is turned off. This system is marketed by Clontech under the name Tet-Off.

Activity can be regulated over a range of 5 orders of magnitude in a Tc concentration-dependent manner. The level of Tc required for full inactivation is very low (0.1 mg/ml), while effects on cell growth and morphology are only seen at very high concentrations (10 mg/ml). Partial induction experiments may allow the study of the quantitative aspects of gene activity.

Generally, cells are cultured routinely in the presence of Tc which is then removed from culture medium to activate the gene of interest. >20% significant induction of gene activity is seen within 12 hours of Tc removal.

When Tc is added gene activity is reduced to <2% after 12 hours. Unfortunately, the complete removal of Tc takes up to 36 hours. This can be reduced by using short-lived Tc derivatives, such as doxycycline (DOX) which are cleared more quickly.

Kinetically a system which uses Tc to activate gene transcription would be preferable. A mutant of tetR (rTetR) has been produced, generated by random mutagenesis, that has reversed DΝA binding properties compared to wildtype tetR / tTA and so requires the Tc derivative doxycycline for specific DΝA binding. rTetR has 4 amino acid changes (one at surface, one connects DΝA reading head to the core of the protein, one involved in a sub unit dimerisation, one adjacent to a contact point with Tc) which result in a major as yet undefined conformational change (M. Gossen et al, Transcriptional activation by tetracyclines in mammalian cells; Science, 268 (5218), 1766-9 (1995)). This system is marketed by Clontech under the name Tet-On, and would be particularly useful invivo, since a gene can remain silent during embryonic development and then be switched on. Initially, the two plasmid Tet-Off system will be used but the Tet-On system will also be examined.

Cell lines which stably express tTA will be produced, ready for subsequent transfection with the inducible construct which contains the gene of interest (X) under the control of tetO. Prior to the generation of stable cell lines, the efficacy of transfection and inducibility will be proven in transient transfection using COS-1 cells. Ultimately, stable tTA expressing variants of both immortalised normal mammary luminal epithelials cells and selected breast cancer lines will be derived.

Expression of tTA will be confirmed by both PCR and western blotting. Tc- inducible expression will be established through the transient transfection of reporter constructs carrying the luciferase gene of Photinus pyralis under the control of the tetO. The assay involved is quick and easy (transfected cells grown, supernatant sampled, supernatant incubated with the substrate luciferin, relative light units (rlu) emitted measured, cells, lysed and protein concentration estimated, values given as rlu/mg of protein). Data will be collected from the luciferase assay using a luminescence plate reader.

Each gene X cDNA will be expressed in either the sense or antisense orientations. Expression of gene X will be identified initially using PCR primers designed to flank the multiple cloning site of construct. In addition, the FLAG epitope will also be included in the cDNA insert. This will effectively tag the gene X product allowing easy visualisation and purification without the need for costly (both in time and money) specific antibody production. Tc-regulation of expression of the gene X product will be determined by Western blotting and localisation will be identified by immunofluoresence.

Stable transfectants showing inducible expression of the gene X product will be fully characterised both biologically and biochemically in the presence and absence of Tc, to determine the exact nature of gene X function and its contribution to tumourigenicity. Functional phototypes can be determined in the appropriate assays and compared to the parent/normal cell lines. Such assays can include the following:

1) Morphology in monolayers or in 3 dimensional cultures (Weaver et al. J. Cell Biol, (1997), 137(1), 231-45).

2) Growth - changes in cell growth or susceptibility to apoptotic signals will be measured (e.g. serum starvation, drug/hormone sensitivity or growth factor responsiveness).

3) Cell mobility (.e.g. time lapse phase contrast microscopy). 4) Adhesion - attachment to plastic coated or to monolayers of endothelial cells as a measure of metastatic invasion.

5) Anchorage independent growth. Growth in soft agar (Freshney (1983), Culture of animal cells, A manual of basic technique) or in or on Matrigel (Kleinmen et al, Biochemistry, (1982), 21(24), 6183-93, Petersen et al., Proc Nat Acad Sci USA, (1992), 89(19), 9064-8).

6) Metastatic potential - as measured by an invasion assay through Matrigel (Albini et al, Cancer Res., (1987), 47(12), 3239-45, Yu et al. Cancer Res (1994), 54(12, 3260-6; Ronnov et al, Physiol. Rev. (1996), 76(1), 69-125).

7) Matrix synthesis or degradation (e.g. expression of metalloproteinases (Vacca et al, Int J Clin Lab Res, (1998), 28(1), 55-68) or their inhibitors

(Valente et al, Int J Cancer, (1998), 75(2), 246-53)). 8} Growth/metastasis as xenografts in nude or SCID mice.

Cells transfected with gene X can also be used in assays for identifying agents, such as small molecule chemical entities, which can modulate the expression or activity of the gene X product and which, thus, could be useful in treating disease associated with the expression product of gene X. For example, the effect of candidate agents upon the expression of the gene X product by such transfectants can be studied and, where the gene X product contributes to tumourigeneicity and the agent is found to inhibit its expression or activity, then that candidate could be useful in pharmaceutical preparations in accordance with the invention.

Claims

1. A method of selecting tumour cells, preferably primary breast tumour cells, 5 comprising exposing a tumour cell containing tissue sample to an agent specific for fibroblast activation protein (FAP), separating cells recognised by said agent from the remaining cells in the sample and harvesting said remaining cells.

2. A method as claimed in claim 1, wherein said agent is an antibody, preferably 10 a monoclonal antibody specific for FAP, or a FAP epitope.

3. A method as claimed in claim 1 or claim 2, wherein the antibody is a monoclonal antibody and, preferably, is specific for an epitope on the FAP α sub- unit.

;

4. A method as claimed in any of claims 1-3, wherein the antibody is monoclonal antibody F19, FB23, FB58, FB52 or C48 and, preferably, is F19.

5. A method as claimed in any of claims 1-4, wherein the monoclonal antibody 20 is labelled and, preferably, labelled with iodine 131.

6. A method for identifying a nucleotide sequence which is differentially expressed in a tumour cell, preferably a primary breast tumour cell, comprising carrying out a method of selecting tumour cells as claimed in any of claims 1-5,

25 deriving expressed nucleic acid sequences from said harvested tumour cells and from a sample of their normal counterparts, and comparing said sequences to identify those which are differentially expressed.

7. A method as claimed in claim 6, wherein said nucleic acid sequence is 0 derived by a process comprising differential display PCR.

8. A method as claimed in claim 6 or claim 7, wherein mRNA from said harvested tumour cells and from normal counterparts is reverse transcribed, and the resulting cDNA is amplified by PCR, the amplification products are compared and those that are differentially displayed are identified.

9. A nucleic acid molecule comprising a nucleotide sequence identified by a method as claimed in any of claims 6-8, a complimentary sequence, a sequence hybridizable under stringent conditions to such a nucleotide sequence or a fragment unique to such nucleic acid sequence.

10. As isolated nucleic acid molecule which is:- (a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence;

(b) hybridizable to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof, and comprises a nucleotide sequence that is at least 66, 70, 75, 80, 85, 90, 95, 97, 98 or 99% homologous to any one of SEQ ID NOs: 1-30 or a complimentary sequence; or

(c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

11. An isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29 or a complimentary sequence, or to a portion thereof; or c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs 13, 14, 16, 22, 26, 27 and 29; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

12. An isolated nucleic acid molecule which comprises a nucleotide sequence coding for a polypeptide or protein coded for by a nucleic acid molecule as claimed in claims 9, 10 or llor a complimentary nucleic acid sequence.

13. An expression vector comprising an isolated nucleic acid molecule as claimed in any of claims 9-12 operably linked to a promoter.

14. A host cell transformed or transfected with an expression vector as claimed in claim 13.

15. An isolated polypeptide encoded by an isolated nucleic acid molecule as claimed in any of claims 9-12.

16. A polypeptide-binding agent which selectively binds or is specific for an isolated polypeptide as claimed in claim 15.

17. A polypeptide-binding agent as claimed in claim 16, comprising an antibody, preferably a monoclonal antibody, or an antibody fragment specific for an isolated polypeptide as claimed in claim 15.

18. A polypeptide-binding agent as claimed in claim 16, comprising an agent capable of occupying or occluding a catalytic site on a polypeptide as claimed in claim 15.

19. A method of diagnosing a disease, preferably breast cancer, comprising contacting a biological sample isolated from a subject with an agent that is specific for an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID

NOs:l-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue, or with an agent that is specific for an expression product of such an isolated nucleic acid molecule, and assaying for interaction between the agent and any of the nucleic acid molecule or expression product in the sample as a determination of the disease.

20. A method as claimed in claim 19, wherein the assay comprises amplification specific for the nucleic acid molecule.

21. A method as claimed in claim 19 wherein the agent comprises an antibody, preferably a monoclonal antibody, or an antibody fragment specific for a polypeptide encoded by the nucleic acid molecule.

22. A method as claimed in claim 19 or claim 20, wherein the agent comprises a nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/ expressed in breast tumour tissue in comparison to normal breast tissue.

23. A method as claimed in any of claims 19 to 22 wherein the biological sample is isolated from breast tissue.

24. A kit for diagnosing a disease, preferably breast cancer, comprising an agent as defined in any of claims 19, 21 and 22, or a polypeptide binding agent as claimed in any of claims 16-18, said kit being for use in a method as claimed in at least one of claims 19-23.

25. A kit for detecting the presence or the expression of an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/ expressed in breast tumour tissue in comparison to normal breast tissue; said kit comprising a pair of isolated nucleic acid molecules each of which comprises a) a 12-32 nucleotide contiguous segment of any of SEQ ID NOs 1-30 or of a nucleic acid molecule as claimed in claim 9, or b) a complement of a), wherein the contiguous segments are non-overlapping.

26. A method of identifying agents for treating a disease, preferably breast cancer, comprising assaying for a capacity to modulate an activity or expression of a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

27. A method as claimed in claim 26, comprising assaying for a capacity to modulate an activity of a polypeptide encoded by the isolated nucleic acid molecule.

28. A method as claimed in claim 27, wherein the assay comprises screening for a capacity to bind to the polypeptide or a receptor for the polypeptide.

29. A method as claimed in claim 26, comprising transforming or transfecting a host cell to express the polypeptide, contacting the host cell with a putative agent for modulating the activity or expression of the polypeptide and assaying for an alteration in a phenotype associated with expression of the polypeptide.

30. A pharmaceutical composition for treating a disease, preferably breast cancer, comprising an agent having the capacity to modulate an activity or expression of a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs:l-30; and which forms at least a portion of a nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

31. A pharmaceutical composition as claimed in claim 30 wherein the agent has the capacity to down regulate or inhibit an activity or expression of a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1,2,4,5 or 7-30 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1,2,4,5 or 7-30 or a complimentary sequence, or to a portion thereof; or c) is a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1, 2, 4, 5 or 7-30.

32. A pharmaceutical composition as claimed in claim 30 or claim 31, wherein the agent is an antisense molecule capable of binding to the isolated nucleic acid molecule, or to an associated promoter region, or is a polypeptide binding agent capable of binding to the polypeptide.

33. A pharmaceutical composition as claimed in claim 32, wherein the polypeptide binding agent comprises an antibody or antibody fragment capable of selectively binding to the polypeptide.

34. A pharmaceutical composition as claimed in claim 30 or 31, wherein said agent comprises an inhibitor, capable of binding to the polypeptide or a receptor for the polypeptide, to thereby inhibit the biological activity of the polypeptide.

35. A pharmaceutical composition as claimed in any of claims 30-34, wherein the agent is an agent identified or identifiable by a method as claimed in any of claims 26-29.

36. A pharmaceutical composition as claimed in claim 30 wherein the agent has the capacity to up regulate or enhance the activity or expression of a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or to a portion thereof; or c) is a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 3 and 6.

37. A pharmaceutical composition as claimed in claim 36, wherein the agent is an agent identified or identifiable by a method as claimed in any of claims 26-29.

38. A pharmaceutical composition for treating disease, preferably breast cancer, comprising a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or a portion thereof; or c) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 3 and 6.

39. A pharmaceutical composition for treating a disease, preferably breast cancer, comprising a nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in any one of SEQ ID NOs: 1-30 or a complimentary sequence, or to a portion thereof; c) a nucleic acid molecule as claimed in claim 9; or d) a fragment unique to one or a combination of the sequences set out in SEQ ID NOs: 1-30; and which forms at least a portion of nucleic acid molecule differentially displayed/expressed in breast tumour tissue in comparison to normal breast tissue.

40. A pharmaceutical composition for treating a disease, preferably breast cancer, comprising an expression vector including a nucleic acid molecule as defined in claim 39, operably linked to a promoter.

41. A pharmaceutical composition for treating a disease, preferably breast cancer, comprising a host cell transformed or transfected with an expression vector as defined in claim 40.

42. A pharmaceutical composition for treating a disease, preferably breast cancer, comprising an expression vector as claimed in claim 40, or a host cell as claimed in claim 41, wherein said expression vector or host cell is capable of expressing in vivo a polypeptide encoded by an isolated nucleic acid molecule which is:- a) a DNA molecule comprising a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, of a portion of such a sequence; b) hybridizable under stringent conditions to a DNA molecule having a nucleotide sequence as set out in either of SEQ ID NOs: 3 and 6 or a complimentary sequence, or to a portion thereof; or c) a fragment unique to a combination of the sequences set out in SEQ ID NOs: 3 and 6.

43. A method of treating disease, preferably breast cancer, comprising administering a pharmaceutical composition as claimed in any of claims 30-42 to a patient.

44. A method as claimed in claim 31, wherein said method is one of prophylaxis.