JP2001340081A - Human pancreatic cancer antigen - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a pancreatic cancer antigen applicable to diagnosis or treatment of pancreatic cancer, etc., and a gene, etc., capable of encoding the antigen. SOLUTION: This human pancreatic cancer antigen KU-PAN-1 is isolated by preparing a cDNA using an mRNA obtained from a pancreatic cancer cell line according to a reverse transcriptase-polymerase chain reaction (RT-PCR) method, transducing the resultant cDNA into a λ phage vector, infecting Escherichia coli with the prepared pancreatic cancer cell cDNA library comprising the total 1.6×106 λ phage cDNA clones and screening the cDNA library using a serum IgG of a patient suffering from progressive pancreactic cancer. The resultant antigen KU-PAN-1 is reactive with only the serum of the patient suffering from the pancreatic cancer without reacting with normal human serum and selectively expressible in the pancreatic cancer cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to
Human pancreatic cancer antigen isolated using G antibody, DNA encoding the same, method for screening a substance for promoting or suppressing immunity inducing activity using pancreatic cancer antigen, antitumor agent containing pancreatic cancer antigen as active ingredient, pancreatic cancer antigen The present invention relates to a cancer diagnostic probe or the like using an encoding DNA.

[0002]

2. Description of the Related Art The number of deaths from pancreatic cancer in Japan in 1995 was 8965 (14.7 / 100,000) and 70
There are 54 (11.1 / 100,000), accounting for the fifth leading cause of death from cancer in men and the seventh in women (Health Statistics Association: National Health Trends, 1997). In the United States, 25,000 people die from pancreatic cancer each year, and the number is increasing (CA Cancer J Clin 45, 8-30, 1995). Forty percent of pancreatic cancers are locally advanced and difficult to cure and resect; 50% have distant metastases. Therefore, the survival rate at 5 years after surgery is 1
The survival rate of 8.2% and the 5-year survival rate of non-operative cases is 2%, which is considered to be a representative of cancers with poor prognosis (Yoichi Saito: Report of Pancreatic Cancer National Registry Pancreas 11: 479-506, 1996). Surgical resection with enlarged dissection and intraoperative radiation therapy, hyperthermia, chemotherapy, and other multidisciplinary treatments have been performed to improve the outcome of pancreatic cancer, but no satisfactory results have been obtained yet (Masaki Matsuno, Makoto Sunamura, Shinichi Egawa Strategies for Pancreatic Cancer Gastrointestinal Cancer 7: 197-203, 1997),
The development of a treatment based on a different concept from the past is expected.

[0003] Immunotherapy has been tried for a long time as a next-generation treatment, but has not been able to show a sufficient effect so far. Until now, immunotherapy of cancer has been mainly performed by non-specific immunotherapy. However, the present inventors have studied cDN using melanoma tumor-reactive T cells.
A CD8 + T cell recognition antigen was isolated by the A expression cloning method (Proc. Natl. Acad. Sci. USA 91, 3515-3519,
1994, Proc. Natl. Acad. Sci. USA 91, 6458-6462, 19
94, J. Exp. Med. 180, 347-352, 1994, J. Immunol. 1
54, 3961-3968, 1995; Immunologic Res. 16, 313-340,
1997), and reported that specific immunotherapy using this antigen has an antitumor effect on some melanomas (Microbiology Immunology 42, 803-813,
1998, Kawakami, Y., PF Robbins, RF.Wang. Et a
l. Identification of Melanoma antigens by T lympho
cytes and their use in the immunotherapy of cance
r. In Principle and Practice of Oncology. Update.
V. DeVita, S. Hellman, SARosenberg eds. JBLipp
incott Co. Philadelphia, p1-20, 1996, Nature Med.
4, 321, 1998). For pancreatic cancer, it is desired to establish a specific immunotherapy and to identify a target cancer antigen, but it is difficult to establish tumor-reactive T cells like many other cancers.

On the other hand, a group of Pfreundschuh, Old et al. Of Germany screens a protein prepared from mRNA of a tumor cell of a cancer-bearing patient in a patient's autologous serum.
REX method (serological identification of antigens b
y recombinant expression cloning; Proc. Natl. Aca
d. Sci. USA 92, 11810-11813, 1995). In addition, cancer antigens recognized by IgG antibodies in melanoma, renal cancer, esophageal cancer, colorectal cancer, lung cancer, and the like are identified by the SER
There is also a report isolated by the EX method (Int. J. Can.
cer 72, 965-971, 1997, Cancer Res. 58, 1034-1041,
1998, Int. J. Cancer 29, 652-658, 1998, Int. J. On
col. 14, 703-708, 1999, Cancer Res. 56, 4766-4772,
1996, Hum. Mol. Genet 6, 33-39, 1997). Some of these antigens have been reported to be recognized by CD8 + T cells (J. Exp. Med. 187 (2), 265-270, 1998).
It has been shown that the CD8 + T cell recognition antigen can be isolated by the EREX method.

[0005]

At present, cancer is the leading cause of death.
Despite advances in treatment, many advanced cancers cannot yet be treated. To improve this, new early diagnostics and treatments need to be developed. An object of the present invention is to provide a human pancreatic cancer antigen that can be applied to diagnosis and treatment of pancreatic cancer and the like, a gene encoding the same, and the like.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies in order to solve the above-mentioned problems, produced cDNA by RT-PCR using mRNA obtained from a pancreatic cancer cell line, and obtained this cDNA. Pancreatic cancer cell cDNA prepared by infecting Escherichia coli by introducing it into λ phage vector
Library, 1.6 × 10 ⁶ total λ phage cD
The NA clone is screened one by one using the serum of a patient with advanced pancreatic cancer, and reacts only with the serum of the patient with pancreatic cancer, does not react with the serum of a healthy subject, and is selectively expressed on cancer cells including pancreatic cancer, KU-PAN-1. And completed the present invention.

That is, the present invention relates to a DNA encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 9; (b) an amino acid sequence shown in SEQ ID NO: 9; A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity (Claim 1)
It hybridizes under stringent conditions with the nucleotide sequence shown in SEQ ID NO: 8 or a complementary sequence thereof, a DNA containing part or all of these sequences (claim 2), or the DNA of claim 2 under stringent conditions. DNA encoding a protein having an immunity-inducing activity (Claim 3), a protein consisting of the amino acid sequence shown in SEQ ID NO: 9 (Claim 4), or one or a number of amino acids in the amino acid sequence shown in SEQ ID NO: 9 Proteins comprising an amino acid sequence wherein amino acids have been deleted, substituted or added, and having an immunity-inducing activity (claim 5) or a part of the protein according to claim 4 or 5; A peptide (claim 6), a protein according to claim 4 or 5, or a peptide according to claim 6, and a marker protein and / or Fusion protein was bound to and Puchidotagu or fusion peptide related (claim 7).

Further, the present invention provides an antibody that specifically binds to the protein described in claim 4 or 5 or the peptide described in claim 6 (claim 8), and wherein the antibody is a monoclonal antibody. The antibody according to claim 8 (claim 9)
Or a recombinant protein or peptide to which the antibody according to claim 8 or 9 specifically binds (claim 10);
Or a host cell comprising an expression system capable of expressing the protein according to claim 5 (claim 11), or a gene function encoding the protein according to claim 4 or 5 is defective on the chromosome or the gene is excessive. The present invention relates to a non-human animal characterized by expression (claim 12) and the non-human animal according to claim 12, wherein the non-human animal is a mouse or a rat.

Further, the present invention is characterized in that a test substance is brought into contact with the protein according to claim 4 or 5 or the peptide according to claim 6, and the immunity-inducing activity of the protein or peptide is measured and evaluated. Screening method for immunity inducing activity promoting or suppressing substance (Claim 14)
Or a test substance is brought into contact with a cell membrane or a cell expressing the protein according to claim 4 or 5, and the immunity-inducing activity of the protein or peptide is measured and evaluated. Alternatively, a screening method for a suppressor (claim 15), a immunity-inducing activity promoting substance obtained by the screening method according to claim 14 or 15 (claim 16), and an immunity obtained by the screening method according to claim 14 or 15. As an active ingredient, an inducing activity inhibitor (claim 17), the protein according to claim 4 or 5, the peptide according to claim 6, the protein or peptide according to claim 10, or the antibody according to claim 8 or 9 is contained. The antitumor agent (claim 18), the protein according to claim 4 or 5, the peptide according to claim 6, or the claim 10 An activated T cell induced by in vitro stimulation with the protein or peptide described above (Claim 19) or a cancer comprising all or a part of the antisense strand of DNA or RNA encoding the protein of Claim 4 or 5. A diagnostic probe (Claim 20), a cancer diagnostic probe according to Claim 20 and / or a cancer diagnostic agent comprising the antibody according to Claim 8 or 9 (Claim 21). , Cancer diagnostics, pancreatic cancer, esophageal cancer,
The diagnostic agent for cancer according to claim 21, which is a diagnostic agent for one or more cancers selected from colon cancer and breast cancer (claim 22).

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION The target protein of the present invention includes a pancreatic cancer antigen KU- shown in SEQ ID NO: 9 in the sequence listing.
PAN-1 or a protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 9 and having an immunity-inducing activity can be exemplified. The term "immune inducing activity" as used herein refers to an activity of inducing an immune response such as antibody production, cellular immunity, or immune tolerance. Among such immunity inducing activities, the frequency of peripheral blood cytotoxic T cell (CTL) progenitor cells is considered. Those having an activity of inducing T cells to increase are particularly preferred. In addition, the peptide to be an object of the present invention is not particularly limited as long as it is a peptide consisting of a part of the above protein and having immunity-inducing activity. Peptides that constitute a recognition site for CD8 + T cells are preferred. The above-mentioned proteins and peptides to be targeted by the present invention, and recombinant proteins and peptides to which antibodies specifically binding to these proteins and peptides specifically bind, may be hereinafter collectively referred to as “the present pancreatic cancer antigen”. The origin of the present pancreatic cancer antigen is not limited to humans.

The DNA to be used in the present invention includes a protein KU consisting of the amino acid sequence shown in SEQ ID NO: 9.
-A DNA encoding PAN-1, consisting of an amino acid sequence shown in SEQ ID NO: 9 in which one or several amino acids are deleted, substituted or added,
Encoding a protein having immunity-inducing activity
A, a DNA comprising the base sequence shown in SEQ ID NO: 8 or a sequence complementary thereto and a part or all of these sequences, or a protein which hybridizes with the DNA under stringent conditions and has an immunity-inducing activity. Although it is not particularly limited as long as it encodes DNA, a cDNA encoding pancreatic cancer antigen KU-PAN-1 shown in SEQ ID NO: 8 can be more specifically exemplified. The method for preparing the cDNA encoding the pancreatic cancer antigen KU-PAN-1 is not particularly limited. For example, RT-P is prepared by using mRNA obtained from a pancreatic cancer cell line.
A pancreatic cancer cell cDNA library prepared by introducing the cDNA amplified by the CR method into a λ phage vector and infecting Escherichia coli is screened using the serum of a patient with advanced pancreatic cancer, reacting only with the serum of a pancreatic cancer patient, And can be obtained by screening for the present pancreatic cancer antigen which does not react with and is expressed on cancer cells including pancreatic cancer.

Further, using the nucleotide sequence shown in SEQ ID NO: 8 or its complementary sequence, or a part or all of these sequences as a probe, hybridization is carried out under stringent conditions with DNA libraries derived from various pancreatic cancers. By isolating the DNA that hybridizes with the probe, a DNA encoding a protein having the desired immunity-inducing activity, which is as effective as the pancreatic cancer antigen KU-PAN-1, can also be obtained. Hybridization conditions for obtaining such DNA include, for example, hybridization at 42 ° C. and 1 × SS
C, washing treatment at 42 ° C. with a buffer containing 0.1% SDS, hybridization at 65 ° C., and a buffer containing 0.1 × SSC, 0.1% SDS A washing treatment at 65 ° C. can be more preferably mentioned. The factors that affect the stringency of hybridization include various factors other than the above-mentioned temperature conditions, and those skilled in the art can appropriately combine various components and have the same properties as the above-described stringency of hybridization. Stringency can be realized.

The fusion protein or fusion peptide of the present invention may be any fusion protein or fusion peptide as long as it binds the present pancreatic cancer antigen to a marker protein and / or a peptide tag. The marker protein is not particularly limited as long as it is a marker protein, and specific examples thereof include alkaline phosphatase, the Fc region of an antibody, HRP, GFP, and the like.
Conventionally known peptide tags such as c tag, His tag, FLAG tag and GST tag can be specifically exemplified. Such a fusion protein can be prepared by a conventional method, and purifies the pancreatic cancer antigen KU-PAN-1 or the like utilizing the affinity between Ni-NTA and His tag, detects a protein having T cell inducing activity, Antigen KU-P
It is useful as a quantification of an antibody against AN-1, etc., as a diagnostic marker for pancreatic cancer, and as a research reagent in the field.

The antibodies that specifically bind to the protein or peptide of the present invention include immunospecific antibodies such as monoclonal antibodies, polyclonal antibodies, chimeric antibodies, single-chain antibodies, and humanized antibodies. These can be prepared by a conventional method using a protein such as the above-mentioned pancreatic cancer antigen KU-PAN-1 or a part thereof as an antigen. Among them, a monoclonal antibody is more preferable in view of its specificity. Such an antibody such as a monoclonal antibody is useful, for example, in diagnosing pancreatic cancer and the like, treating the missile therapy and the like, and elucidating the onset mechanism of malignant tumors such as pancreatic cancer.

The antibody of the present invention is obtained by administering a fragment containing the present pancreatic cancer antigen or epitope, or a cell expressing the protein on the membrane surface to an animal (preferably other than human) using a conventional protocol. For example, for the preparation of monoclonal antibodies, the hybridoma method (Nature 256, 495-497, 1975), the trioma method, the human B-cell hybridoma method (Immunology Today) provides antibodies produced by continuous cell line cultures.
4, 72, 1983) and the EBV-hybridoma method (MONOCLO
NAL ANTIBODIES AND CANCER THERAPY, pp.77-96, Alan
R.Liss, Inc., 1985) can be used.

In order to produce a single-chain antibody against the pancreatic cancer antigen of the present invention, a method for preparing a single-chain antibody (US Pat.
946,778) can be applied. Further, in order to express a humanized antibody, transgenic mice or other mammals or the like are used, or a clone expressing the present pancreatic cancer antigen is isolated and identified using the above-mentioned antibody, and affinity chromatography is performed. Can be used to purify the polypeptide. Antibodies against the present pancreatic cancer antigen and a peptide containing the antigen epitope may be used for diagnosis and treatment of pancreatic cancer and the like. Recombinant proteins or peptides to which these antibodies specifically bind are also included in the pancreatic cancer antigen of the present invention as described above.

The present invention also relates to a host cell comprising an expression system capable of expressing the present pancreatic cancer antigen. Introduction of the gene encoding the present pancreatic cancer antigen into host cells is described in Davis et al. (BASIC METHODS IN MOLECULAR BIOLOGY, 1
986) and Sambrook et al. (MOLECULAR CLONING: A LABORATO
RY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY, 1989) and methods described in many standard laboratory manuals, eg, calcium phosphate transfection, DEAE
-Dextran mediated transfection, transvection, microinjection,
Cationic lipid-mediated transfection, electroporation, transduction, scraping (sc
rape loading), ballistic introduction,
It can be performed by infection or the like. As host cells, bacterial prokaryotic cells such as Escherichia coli, Streptomyces, Bacillus subtilis, Streptococcus, Staphylococcus, fungal cells such as yeast and Aspergillus, and Drosophila S
2, insect cells such as Spodoptera Sf9, L cells, CH
O cells, COS cells, HeLa cells, C127 cells, B
ALB / c3T3 cells (including mutants lacking dihydrofolate reductase, thymidine kinase, etc.), BHK
Examples include animal cells such as 21 cells, HEK293 cells, Bowes melanoma cells, and plant cells.

The expression system may be any expression system capable of expressing the present pancreatic cancer antigen in host cells, and expression systems derived from chromosomes, episomes and viruses, for example, bacteria Plasmid-derived, yeast plasmid-derived, papovavirus such as SV40,
Vaccinia virus, adenovirus, fowlpox virus,
Pseudorabies virus, retrovirus-derived vector,
Vectors derived from bacteriophages, transposons, and combinations thereof, such as those derived from plasmids such as cosmids and phagemids and genetic elements of bacteriophages, may be mentioned. The expression system may include control sequences that regulate as well as cause expression.

The host cell comprising the above expression system, the cell membrane of such a cell, and the pancreatic cancer antigen obtained by culturing such a cell can be used in the screening method of the present invention as described later. For example, as a method for obtaining a cell membrane, F. Pietri-Rouxel (Eur. J. Biochem., 247, 117)
4-1179, 1997), etc., and such pancreatic cancer antigen can be recovered and purified from a cell culture by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography,
Known methods including phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography, preferably high performance liquid chromatography, are used. In particular, as a column used for affinity chromatography, for example, a column to which an antibody against the present pancreatic cancer antigen is bound, or when a normal peptide tag is added to the present pancreatic cancer antigen, a substance having an affinity for the peptide tag is used. By using the bound column, the present pancreatic cancer antigen can be obtained.

In the present invention, the non-human animal in which the function of the gene encoding the present pancreatic cancer antigen is deficient on the chromosome includes:
A part or all of the gene encoding the present pancreatic cancer antigen on the chromosome is inactivated by genetic mutation such as destruction, deletion, or substitution, and refers to a non-human animal that has lost the function of expressing the present pancreatic cancer antigen, The non-human animal in which the function of the gene encoding the present pancreatic cancer antigen is overexpressed on the chromosome is a non-human animal that produces a larger amount of the present pancreatic cancer antigen than a wild-type non-human animal. Examples of the non-human animal in the present invention include, but are not limited to, non-human animals such as rodents such as mice and rats.

Incidentally, homozygous non-human animals born according to Mendel's law include the present pancreatic cancer antigen-deficient or overexpressed type and its littermate wild type. The simultaneous use of the defective or overexpressed type and its littermate wild type enables accurate comparison experiments at the individual level, so that the function of the gene encoding the wild-type non-human animal, that is, the pancreatic cancer antigen, is It is preferable to use an animal of the same species as the non-human animal deficient or overexpressed at the same time, or an animal of the same litter, in the screening of the present invention described below, for example. A method for producing a non-human animal in which the function of the gene encoding the present pancreatic cancer antigen is deficient or overexpressed on the chromosome will be described below using a knockout mouse and a transgenic mouse of the present pancreatic cancer antigen as examples.

For example, a mouse whose gene function encoding the present pancreatic cancer antigen is deficient on the chromosome, ie, the present pancreatic cancer antigen knockout mouse, is obtained by
Using the gene fragment obtained by a method such as CR, a gene encoding the present pancreatic cancer antigen is screened, the screened gene encoding the present pancreatic cancer antigen is subcloned using a viral vector or the like, and DNA sequencing is performed. Identify. All or part of the gene encoding the present pancreatic cancer antigen of this clone is replaced with a pMC1 neo gene cassette or the like, and diphtheria toxin A is
A targeting vector is prepared by introducing a gene such as a fragment (DT-A) gene or the herpes simplex virus thymidine kinase (HSV-tk) gene.

The thus prepared targeting vector is linearized, introduced into ES cells by electroporation (electroporation) or the like, and subjected to homologous recombination. Among the homologous recombinants, G418 or ganciclovir is obtained. (G
E.A.) which has undergone homologous recombination with an antibiotic such as
Select S cells. In addition, it is preferable to confirm whether or not the selected ES cell is the desired recombinant by Southern blotting or the like. The confirmed ES cell clone is microinjected into a mouse blastocyst, and the blastocyst is returned to a foster parent mouse to produce a chimeric mouse. When the chimeric mouse is intercrossed with a wild-type mouse, a heterozygous mouse can be obtained, and by intercrossing the heterozygous mouse, the pancreatic cancer antigen knockout mouse of the present invention can be produced. Can be. In addition, as a method for confirming whether or not the present pancreatic cancer antigen knockout mouse has occurred, for example, RNA is isolated from the mouse obtained by the above method and examined by Northern blotting or the like. There is a method of examining by Western blotting or the like.

The transgenic mouse of the present pancreatic cancer antigen is obtained by fusing a cDNA encoding the present pancreatic cancer antigen with a promoter such as chicken β-actin, mouse neurofilament, SV40 and the like, and a polyA or intron such as rabbit β-globin and SV40. To construct the transgene,
The transgene is microinjected into the pronucleus of a mouse fertilized egg, and the obtained oocytes are cultured, and then transplanted into an oviduct of a foster mouse, and thereafter, the recipient animal is bred. By selecting a pup mouse, such a transgenic mouse can be created. In addition, selection of a pup mouse having a cDNA includes a dot hybridization method using a gene encoding the present pancreatic cancer antigen by extracting a crude DNA from the tail of the mouse and the like, a PCR method using specific primers, and the like. Can be performed.

Also, the gene or DNA encoding the present pancreatic cancer antigen, the present pancreatic cancer antigen, a fusion protein obtained by binding the present pancreatic cancer antigen to a marker protein and / or a peptide tag, an antibody against the present pancreatic cancer antigen, and expression of the present pancreatic cancer antigen Host cells and the like comprising an expression system that can perform pancreatic cancer, esophageal cancer, colon cancer,
It is useful for the treatment and diagnosis of breast cancer and the like, and can be used not only for screening for substances that promote or suppress immunity inducing activity, but also for activated T cells (CD4 antigen positive T cells, C
D8 antigen-positive T cells, helper T cells, killer T cells,
It can also be used to elucidate the mechanism of the immune response such as induction of all T cells such as suppressor T cells.

As a method for screening a substance for promoting or suppressing immunity inducing activity of the present invention, a method for bringing a test substance into contact with the present pancreatic cancer antigen and measuring / evaluating the immunity inducing activity of the present pancreatic cancer antigen, And the cell membrane or cells expressing the present pancreatic cancer antigen are brought into contact with each other to measure and evaluate the immunity-inducing activity of the present pancreatic cancer antigen. As the cell membrane or cells, cells such as primary cultured cells obtained from a non-human animal or a wild-type non-human animal overexpressing the gene encoding the present pancreatic cancer antigen, or expressing the present pancreatic cancer antigen of the present invention Host cells comprising an expression system that can be used, and cell membranes of these cells and the like can be specifically exemplified.As a method for contacting such a cell membrane or cells with a test substance, a method in the presence of the test substance Examples thereof include a method of culturing a cell membrane or a cell expressing the present pancreatic cancer antigen in vitro, and a method of administering a test substance to a non-human animal overexpressing a gene encoding the present pancreatic cancer antigen.

[0027] The screening method using the test substance and the present pancreatic cancer antigen will be described below with reference to specific examples, but the screening method of the present invention is not limited thereto. As a method of contacting the test substance with the present pancreatic cancer antigen and measuring / evaluating the immunity-inducing activity of the present pancreatic cancer antigen, for example, a large amount of peripheral blood lymphocytes is obtained in vitro using normal interleukin-2. A test substance is brought into contact with the present pancreatic cancer antigen in the presence of expanded tumor-infiltrating T cells, and the increase or decrease of T cell inducing activity such as CTL is measured, and compared with a control in the absence of the test substance. -The method of evaluation can be specifically exemplified. In addition, as a method of contacting the test substance with a cell membrane or cells expressing the present pancreatic cancer antigen and measuring / evaluating the immunity-inducing activity of the present pancreatic cancer antigen, the present pancreatic cancer antigen-expressing cells can be used as a test substance. Culture in the presence of the pancreatic cancer antigen expressed on the cell membrane surface after the culture for a certain period of time was decreased or increased, using an antibody that specifically binds to the pancreatic cancer antigen of the present invention, using an immunochemical method such as ELISA. Specific examples of the method include a method of detecting the expression or evaluating the expression or suppression of mRNA expression as an index. The above mRNA can be detected by a method such as DNA chip, Northern hybridization, or the like, or using a cell into which a reporter gene such as luciferase is linked downstream of the promoter of the gene encoding the present pancreatic cancer antigen. Then, the suppression or promotion of the expression of the gene encoding the present pancreatic cancer antigen by the test substance can be detected using the activity of the reporter gene as an index.

The present invention also relates to a substance for promoting immunity-inducing activity, which is used for the treatment of a patient in need of promoting the immunity-inducing activity obtained by the above screening method, and a method for treating a patient in need of suppression of the immunity-inducing activity. The present invention relates to a substance for suppressing an immunity-inducing activity used in the method. The present invention also relates to an antitumor agent for pancreatic cancer, esophageal cancer, colorectal cancer, breast cancer and the like, which comprises the present pancreatic cancer antigen or an antibody thereto as an active ingredient. For example, when the present pancreatic cancer antigen is administered orally, intravenously, or the like, an antitumor effect due to an increase in T cell inducing activity in vivo can be expected. Further, the above antibody can be used for missile therapy. The present invention also relates to activated T cells induced by in vitro stimulation with the present pancreatic cancer antigen. For example, stimulation of peripheral blood lymphocytes and tumor-infiltrating lymphocytes with the present pancreatic cancer antigen together with IL-2 induces tumor-reactive activated T cells, and the activated T cells can be used effectively for adoptive immunotherapy. it can.

Further, the present invention provides a diagnostic probe for cancer comprising all or a part of the antisense strand of DNA or RNA encoding the present pancreatic cancer antigen, and a probe specifically binding to the diagnostic probe for this cancer or the present pancreatic cancer antigen. The present invention relates to a diagnostic agent for cancer such as pancreatic cancer, esophageal cancer, colorectal cancer, breast cancer and the like, which contains an antibody. Examples of the diagnostic probe include DNA encoding the present pancreatic cancer antigen
(CDNA) or all or part of the antisense strand of RNA (cRNA), preferably those having a length (at least 20 bases or more) that can be established as a probe, for example, a gene obtained from a sample, By comparing with the DNA sequence encoding the present pancreatic cancer antigen, it becomes possible to diagnose diseases such as pancreatic cancer. Samples used for such detection include cells of the subject, such as blood, urine, saliva,
Genomic DNA that can be obtained from biopsies of tissues,
Specific examples of NA or cDNA include, but are not limited to, NA. When such a sample is used, one amplified by PCR or the like may be used.

[0030]

EXAMPLES The present invention will be described more specifically below with reference to examples, but the technical scope of the present invention is not limited to these examples. [Preparation of cDNA library] Literature (Tohoku J. exp.
Med. 143, 33-46, 1984).
1, PK45 and PK59 (provided by Dr. Masao Kobari of Tohoku University) were each cultured to 1 × 10 ⁸ . As a medium, RPMI1640 was added, and 37 ° C, 5% C
What was maintained at O ₂ and 100% humidity was used. After culturing, RNA was extracted from each cell by guanidine-cesium chloride ultracentrifugation, and poly (oligo (dT)) was used.
(A) mRNA was purified by selection. 0.5 μg of mRNA obtained from each of these three cultured cells
And a double-stranded cDNA was synthesized using a ZAP-cDNA Synthesis Kit (Stratagene). The double-stranded cDNA was inserted into a λZAPII vector, and a pancreatic cancer λ phage cDNA consisting of 3.0 × 10 ⁶ clones was synthesized. A library was made.

[Screening of cDNA Library with Serum]
1 × 10 ⁴ clones were seeded on a cmNZY agarose plate, cultured at 42 ° C. for 4 hours, and expressed on Escherichia coli (XL1-Blue). A nitrocellulose filter having IPTG absorbed thereon was placed thereon and cultured at 37 ° C. for 4 hours, and the expressed fusion protein was transferred to the nitrocellulose filter.
TBS containing 0.5% TWIN20 (10 mM Tr
bacteria adsorbed by washing the filter with is-HCl, 150 mM NaCl; pH 7.5),
After removing the phage, non-specific reactions were suppressed with TBS containing 5% skim milk powder. This filter was reacted with a 100-fold diluted patient serum at room temperature for 4 hours.

The serum of the above patients showed stage IV in the pTMN classification in the preoperative and postoperative evaluation of the progress, and no adjuvant chemotherapy and radiotherapy was performed at the time of blood collection, and no infectious disease was observed. Pancreatic cancer patients [Patient A (64-year-old female), Patient B (57-year-old male), Patient C (7
Blood collected from a 0-year-old man), patient D (61-year-old man), and patient E (68-year-old man)] were used. These sera are -8
Store at 0 ° C. and contain 5% by volume skim milk immediately before use
It was finally diluted 100 times with a BS (Tris-buffered saline) solution and used. This diluted serum was mixed with a lysate of E. coli at a ratio of 1: 5, left at 4 ° C. for 8 hours, and
The mixture was centrifuged at 5000 rpm for 20 minutes, and the supernatant was collected. To this supernatant, 7 sheets of nitrocellulose filters adsorbing E. coli and phage-derived proteins were added and shaken at room temperature for 8 hours to adsorb non-specific anti-E. Coli antibodies and anti-phage antibodies in the supernatant. Used from.

The treated serum was allowed to react at room temperature for 4 hours with a nitrocellulose filter on which the fusion protein was blotted, and a colony in which the antibody in the serum reacted was used as a secondary antibody to obtain a 4000-fold diluted anti-human IgG-Fc antibody. (Anti human IgG Fc goat antibody alkaline phospha
te conjugated CAPPEL) and react with Nitro blue
tetrazolium (Boehringer) and 5-Bromo-4-Chloro-3-indo
A colony corresponding to a positive color reaction site was detected from a 15 cm NZY agarose plate and detected in an SM buffer (100 mM NaCl, 10 mM MgSO ₄ , 50 mM Tris).
-HCl, 0.01% gelatin; pH 7.5). Repeat the secondary and tertiary screening in the same manner as above until the color reaction positive colonies are unified,
A phage clone to which IgG in the serum reacted was obtained. 5
A total of 1.6 × 10 ⁶ λ phage clones were screened using human serum. Table 1 shows the results.
Of the 47 positive clones obtained, 13 were from pancreatic cancer patient D and 28 were from pancreatic cancer patient E, and there was a tendency for positive clones to be concentrated in specific patient sera. Was found to be independent of age and progression.

[0034]

[Table 1]

[Search for Homology of Isolated Antigen Gene] From the 47 phages obtained above, insert D was
NA was amplified and used for subsequent analysis. Ex for the reaction enzyme
Using Taq (TAKARA), T3 was used as the sense primer.
(5'-AATTAACCCTCACTAAAGGG-
3 ′; SEQ ID NO: 1), T7
(5'-GTAATACGACTCACATAGGGC
-3 '; SEQ ID NO: 2) was used. The reaction conditions were as follows at 94 ° C. using a thermal cycler (Perkin-Elmer).
Heat denatured at 55 ° C. for 2 minutes,
This was repeated for 35 cycles with a cycle of extension reaction at 2 ° C. for 2 minutes. The resulting PCR product is transferred to Big Dye DN
DNA sequencing was performed using A Sequencing Kit (ABI) and ABI310 autosequencer, and the 5'-side nucleotide sequence was determined to be about 300 to 500 bp. This resulted in 19 different genes.

The nucleotide sequences of the 19 genes determined as described above were respectively entered into the homology search program BLAST (Basi
c Local Alignment Search Tool) was used to compare the gene databases and search for homology with known genes. The results are shown in Table 2 (known antigen gene) and Table 3 (unknown antigen gene). Of the 19 genes, 13 had homology with the known gene, and 6 had homology with the unknown function gene.
Pieces, 4 pieces for DBI related protein, Human DNAJ protei
Three identical clones were detected in n and M-phase phosphoprotein. Only one clone was detected for each of the remaining clones. No oncogene or tumor suppressor gene was found in these, and three types of ribosomal proteins were found.

[0037]

[Table 2]

[0038]

[Table 3]

Of the above-mentioned six genes whose functions are unknown, five are integrated and arranged by UniGene of the United States National Center for Biotechnology Information, and Hs. 1188741, Hs. 12255
5, Hs. 22199, Hs. 4900, Hs. 797
It is presumed to be derived from five molecules of Hs.
4900, Hs. 122555 each contained three isolated genes. National Cancer Institute Cancer Gene An
When the tissue from which the cDNA was obtained was examined using the cDNA library database of the Atomy Project (CGAP), Hs. 122555 has Hs.
118741 was found to be derived from embryonic cells, muscle, ovarian cancer, prostate cancer, gastric cancer, etc., and other genes were derived from various tissues.

[Isolation in Serum of Normal Person and Serum of Pancreatic Cancer Patient]
Detection of IgG Antibody Against Cancer Antigen]
[PT5 (DNAJ protein), PT13 (EST), P
Y2 (EST), PY3 (CyclophilinA), PY7 (ES
T), PY14 (KU-PAN-1), PY19 (M-phase phosp
hoprotein), PY23 (EST), PY34 (KIAA087
1)] and the negative control without insert
And each in a ratio of 1: 5.
5x10 on 9cm NZY agarose plate ^TwoK
Seed with a loan, diluted 100 times that of healthy people and pancreatic cancer patients
Screening was performed with the serum. Sera from healthy individuals
Sometimes healthy, with no history of surgery and no history of autoimmune disease
Blood from 16 volunteers with an average age of 27.8
did. In patients with pancreatic cancer, the serum used for screening
A total of 13 sera were used. Table 4 shows the results. This
From the results, it was confirmed that M-phase phosphoprotein was
No antibody was detected in the serum of healthy individuals, but
The other eight genes did not react with healthy human serum,
It reacted only with serum from cancer patients.

[0041]

[Table 4]

[RT-PCR Method for Detecting mRNA Expression of Isolated Cancer Antigen] Next, clones PY3, PY7, P
Y2, PT13, PY23, PY19, PY14 and P
The expression specificity of the Y34 gene in each tissue was determined by RT-P.
I examined it by CR method. Using 5 μg each of RNA from normal tissue (all purchased from Clontech) and cultured fibroblasts, EB virus infected B cells, tumor infiltrating T cells, and cultured tumor cells, reverse transcriptase AM
A cDNA panel was prepared using V RTase XL (TAKARA) and an oligo (dT) as a primer, and a 200-400 bp PC was obtained from the nucleotide sequence of the obtained clone.
A specific PCR primer is designed so that an R product can be formed. Using EXTaq (TAKARA) as a reaction enzyme, heat denaturation is performed at 94 ° C. for 30 seconds using a thermal cycler (Perkin-Elmer), and at 72 ° C. for 1 minute. The cycle of the extension reaction was repeated 35 times. The annealing temperature was set according to the Tm value of the primer. This PC
The R product was subjected to agarose gel electrophoresis (1.5%),
Stained with ethidium bromide (EtBr),
The band was detected by ultraviolet irradiation of m.

In this experiment, a PY having a difference in expression was observed.
More panels were used for 14 clones (KU-PAN-1), and RT-PCR was performed again. The panels used were 13 normal tissues of brain, heart, kidney, spleen, liver, small intestine, skeletal muscle, lung, testis, placenta, stomach, large intestine, pancreas (all purchased from Clonetech) and fibroblasts ,
EB virus infected B cells, three normal cultured cells of tumor infiltrating T cells, PK1, PK8, PK9, PK45P, PK
59 (pancreatic cancer), Skmel23, 888mel (malignant melanoma), TE8 (esophageal cancer), K1S (lung adenocarcinoma), EB
C1 (lung squamous cell carcinoma), HL60 (acute myeloid leukemia), K562 (chronic myelogenous leukemia), MDA231
A total of 34 kinds of 18 cultured tumor cells of (breast cancer), DLD1 (colorectal cancer), KU7, BC47 (bladder cancer), PC3 (prostate cancer) and RCCS (kidney cancer) were used.

PY14 (KU-PAN-1) has (5'-TGCCCAGCCCAGA) as a sense primer.
GATACAACCCACAAG-3 '; SEQ ID NO: 3)
Is used as an antisense primer (5′-CTGGGC
TAGGAGATGGCTTGGATTTTGG-3 ';
Sequence No. 4) was prepared and subjected to 25 cycles of PCR under the conditions of heat denaturation at 94 ° C. for 30 seconds, annealing at 62 ° C. for 30 seconds and extension reaction at 72 ° C. for 1 minute. As a control, to confirm the expression of β-actin (838 bp),
β-actin-specific sense primer (5′-ATC
TGGCACCACACCTCTCTACAATGGAC
TGCG-3 '; SEQ ID NO: 5) and an antisense primer (5'-CGTCACTACTCCTGCTTGCTG
Using ATCC ACATCTGC-3 '; SEQ ID NO: 6), heat denaturation at 94 ° C for 30 seconds, annealing at 68 ° C for 2 seconds.
PCR was performed for 25 minutes under the conditions of an extension reaction at 72 ° C. for 2 minutes. PCR obtained by these PCR
The product (cDNA) was subjected to agarose gel electrophoresis (3%) and stained with ethidium bromide (EtBr).
Bands were detected by irradiation with 4 nm ultraviolet light. The results are shown in FIG. 1 (PY14).

From the results shown in FIG. 1, KU-PAN-1 was 25
Testis, PK1, PK in cycle PCR reaction
59 (pancreatic cancer), TE8 (esophageal cancer), U-87MO (brain tumor), KIS (lung cancer), MDA231 (breast cancer), DLD
1 (colorectal cancer) was expressed.

[Northern blot method for detecting mRNA expression of isolated cancer antigen] RNA 9 derived from normal tissues (brain, stomach, lung, spleen, kidney, small intestine, pancreas, placenta, testis)
Species, 5 types of RNA extracted from pancreatic cancer (KI, SA, SU, K1M, K2F) tissues, pancreatic cancer cultures (PK1, PK8,
PK9, PK45P, PK59, PC135, PC16
5, 10 RNAs extracted from Miapaka2, Panc1, Aspc1), other cancer cell lines DLD1 (colorectal cancer), U87-MO (brain tumor), MDA231 (breast cancer), HL60 (acute myeloid leukemia), K562 (chronic myeloid) Northern blot for KU-PAN-1 was performed with a total of 30 RNAs, 6 types of RNAs derived from leukemia) and TE8 (esophageal cancer). The RNA (11 μg each) was electrophoresed on an agarose gel containing formamide and formaldehyde, and then subjected to a nylon membrane filter (Hybond XL,
Amersham).

Next, a sense primer specific to KU-PAN-1 (base sequence from position 618 to position 643 of KU-PAN-1 gene: 5'-TGCCCAGCC
AGAGATACAACCCACAAG-3 '; SEQ ID NO: 3) and an antisense primer (nucleotide sequence from position 1825 to position 1848 of the KU-PAN-1 gene:
5'-CACAAAGGGTCTGGATGAGTCG
PCR was performed using GT-3 '; SEQ ID NO: 7) to prepare a 1230 bp long KU-PAN-1 gene fragment. High Prime DNA Labeling
Using a kit (Boehringer) as a probe labeled with ³² P, a nylon membrane filter was immersed using Quick Hyb (Stratagene) as a hybridization buffer, and prehybridization was performed at 68 ° C. for 30 minutes. Then, the Qu to which the probe was added was added.
Hybridization was performed at 68 ° C. for 2 hours in an Ic Hyb. Then, the hybridized nylon membrane filter was washed with washing solution I (2 × SS).
C, 0.1% SDS) twice for 15 minutes at room temperature,
65 with Wash Solution II (0.1 × SSC, 0.1% SDS)
Washed once at 60 ° C for 60 minutes. A radioactive signal was detected from the washed nylon membrane filter using a Molecular Imager (BIORAD). The results are shown in FIG.

As shown in FIG. 2, about 3000 bp
, A band was observed in normal cells, and this band was expressed only in the testis. Among tumor tissues, three types of pancreatic cancer tissues (SU, K1M, K2F), two types of pancreatic cancer cultures (PK59, Panc1), colorectal cancer (DLD1), brain tumor (U87-MO), breast cancer (MDA231) and esophageal cancer (TE8) Were strongly expressed. Thus, KU
From the results of RT-PCR and Northern blot, PAN-1 was slightly expressed in normal tissues, but PAN-1 was considered to be a target for immunotherapy because there was a clear difference in expression level from tumor tissues. And the expression in the testis is a tissue isolated from the immune system,
Testis damage is unlikely to be a problem when KU-PAN-1 is actually used for immunotherapy.

[Nucleotide Sequence and Amino Acid Sequence of KU-PAN-1] The isolated cDNA of KU-PAN-1 is 3035 bp in full length, consisting of the nucleotide sequence shown in SEQ ID NO: 8. As shown in SEQ ID NO: 9, it was found to be composed of 709 amino acid sequences. As a result of homology search based on the base sequence, 12
In a homology search using a sequence of 77 bp or more, Hs. 1 as 257102
There was homology with the group of genes
Since no homologous gene was present on the database up to 1053 bp, KU-PAN-1
Was a novel protein.

[0050]

According to the present invention, physiologically important K
Pancreatic cancer antigens such as U-PAN-1, DNA encoding the same
Can be provided. In addition, those pancreatic cancer antigens and DN
A is useful for treating or diagnosing pancreatic cancer, esophageal cancer, colorectal cancer, breast cancer and the like, and can be used for screening for a substance that promotes or suppresses immunity-inducing activity.

[0051]

[Sequence List] SEQUENCE LISTING <110> KEIO UNIVERSITY <120> Pancreatic Carcinoma Antigens <130> 2000-011 <140> <141> <160> 9 <170> PatentIn Ver. 2.1 <210> 1 <211> 20 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 1 aattaaccct cactaaaggg 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 2 gtaatacgac tcacataggg c 21 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: KU-PAN-1 Sense Primer <400 > 3 tgcccagcca gagatacaac cacaag 26 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: KU-PAN-1 Antisense Primer <400> 4 ctggctagga gatggcttgg atttgg 26 < 210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Beta-Actin Specific Sense Primer <400> 5 atctggcacc acaccttcta caatgagctg cg 32 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Beta-Actin Specifc Antisense Primer <400> 6 cgtcatactc ctgcttgctg atccacatct gc 32 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence : KU-PAN-1 Specific Antisense Primer <400> 7 cacaaagggt ctggatgagt cggt 24 <210> 8 <211> 3035 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (541). 2667) <400> 8 acgggcccgg gctgcggcag cggcggcctc ggctgcctgg ggagctcaaa ctggaggatt 60 ataaggatcg cctgaaaagt ggagagcatc ttaatccaga ccagttggaa gctgtagaga 120 aatatgaaga agtgctacat aatttggaat ttgccaagga gcttcaaaaa accttttctg 180 ggttgagcct agatctacta aaagcgcaaa agaaggccca gagaagggag cacatgctaa 240 aacttgaggc tgagaagaaa aagcttcgaa ctatacttca agttcagtat gtattgcaga 300 acttgacaca ggagcacgta caaaaagact tcaaaggggg tttgaatggt gcagtgtatt 360 tgccttcaaa agaacttgac tacctcatta agttttcaaa actgacctgc cctgaaagaa 420 atgaaagtct gagacaaaca cttgaaggat ctactgtcta aattgctgaa ctcaggctat 480 tttgaaagta tcccagttcc caaaaatgcc aaggaaaagg aagtacca ct ggaggaagaa 540 atg cta ata caa tca gag aaa aaa aca caa tta tcg aag act gaa tct 588 Met Leu Ile Gln Ser Glu Lys Lys Thr Gln Leu Ser Lys Thr Glu Ser 1 5 10 15 gtc aaa gag tca gag tct cta atg gat gcc cag cca gag ata caa 636 Val Lys Glu Ser Glu Ser Leu Met Glu Phe Ala Gln Pro Glu Ile Gln 20 25 30 cca caa gag ttt ctt aac aga cgc tat atg aca gaa gta gat tat tca 684 Pro Gln Glu Phe Leu Asn Arg Arg Tyr Met Thr Glu Val Asp Tyr Ser 35 40 45 aac aaa caa ggc gaa gag caa cct tgg gaa gca gat tat gct aga aaa 732 Asn Lys Gln Gly Glu Glu Gln Pro Trp Glu Ala Asp Tyr Ala Arg Lys 50 55 60 cca aat ctc cca aaa cgt tgg gat atg ctt act gaa cca gat ggt caa 780 Pro Asn Leu Pro Lys Arg Trp Asp Met Leu Thr Glu Pro Asp Gly Gln 65 70 75 80 gag aag aaa cag gag tcc ttt aag tcc tgg gag gct tct ggt aag cac 828 Glu Lys Lys Gln Glu Ser Phe Lys Ser Trp Glu Ala Ser Gly Lys His 85 90 95 cag gag gta tcc aag cct gca gtt tcc tta gaa cag agg aaa caa gac 876 Gln Glu Val Ser Lys Pro Ala Val Ser Leu Glu Gln Arg Lys Gln Asp 100 105 110 acc tca aaa ctc agg tct act ctg ccg gaa gag cag aag aag cag gag 924 Thr Ser Lys Leu Arg Ser Thr Leu Pro Glu Glu Gln Lys Lys Gln Glu 115 120 125 atc tcc aaa tcc aag cca tct cct agc cag tgg aag caa gat aca cct 972 Ile Ser Lys Ser Lys Pro Ser Pro Ser Gln Trp Lys Gln Asp Thr Pro 130 135 140 aaa tcc aaa gca ggg tat gtt caa gag gaa caa aag aaa cag gag aca 1020 Lys Ser Lys Ala Gly Tyr Val Gln Glu Glu Gln Lys Lys Gln Glu Thr 145 150 155 160 cca aag ctg tgg cca gtt cag ctg cag aaa gaa caa gat cca aag aag 1068 Pro Lys Leu Trp Pro Val Gln Leu Gln Lys Glu Gln Asp Pro Lys Lys 165 170 175 caa act cca aag tct tgg aca cct tcc atg cag agc gaa cag aac acc 1116 Gln Thr Pro Lys Ser Trp Thr Pro Ser Met Gln Ser Glu Gln Asn Thr 180 185 190 acc aag tca tgg acc act ccc atg tgt gaa gaa cag gat tca aaa cag 1164 Thr Lys Ser Trp Thr Thr Pro Met Cys Glu Glu Gln Asp Ser Lys Gln 195 200 205 cca gag act cca aaa tcc tgg gaa aac aat gtt gag agt caa aaa cac 1212 Pro Glu Thr Pro Lys Ser Trp Glu Asn Asn Val Gl u Ser Gln Lys His 210 215 220 tct tta aca tca cag tca cag att tct cca aag tcc tgg gga gta gct 1260 Ser Leu Thr Ser Gln Ser Gln Ile Ser Pro Lys Ser Trp Gly Val Ala 225 230 235 240 aca gca agc ctc ata cca aat gac cag ctg ctg ccc agg aag ttg aac 1308 Thr Ala Ser Leu Ile Pro Asn Asp Gln Leu Leu Pro Arg Lys Leu Asn 245 250 255 aca gaa ccc aaa gat gtg cct aag cct gtg cat cag cct gta ggt tct 1356 Thr Pro Lys Asp Val Pro Lys Pro Val His Gln Pro Val Gly Ser 260 265 270 tcc tct acc ctt ccg aag gat cca gta ttg agg aaa gaa aaa ctg cag 1404 Ser Ser Thr Leu Pro Lys Asp Pro Val Leu Arg Lys Glu Lys Leu Gln 275 280 285 gat ctg atg act cag att caa gga act tgt aac ttt atg caa gag tct 1452 Asp Leu Met Thr Gln Ile Gln Gly Thr Cys Asn Phe Met Gln Glu Ser 290 295 300 gtt ctt gac ttt gac aaa cct tca agt gca att cca acg tca caa ccg 1500 Val Leu Asp Phe Asp Lys Pro Ser Ser Ala Ile Pro Thr Ser Gln Pro 305 310 315 320 cct tca gct act cca ggt agc ccc gta gca tct aaa gaa caa aat ctg 1548 Pro Ser Ala Thr Pro Gly Ser Pro Val Ala Ser Lys Glu Gln Asn Leu 325 330 335 tcc agt caa agt gat ttt ctt caa gag ccg tta cag gta ttt aac gtt 1596 Ser Ser Gln Ser Asp Phe Leu Gln Glu Pro Leu Gln Val Phe Asn Val 340 345 350 aat gca cct ctg cct cca cga aaa gaa caa gaa ata aaa gaa tcc cct 1644 Asn Ala Pro Leu Pro Pro Arg Lys Glu Gln Glu Ile Lys Glu Ser Pro 355 360 365 tat tca cct ggc tac aat caa agt ttt acc aca gca agt aca ca aca 1692 Tyr Ser Pro Gly Tyr Asn Gln Ser Phe Thr Thr Ala Ser Thr Gln Thr 370 375 380 cca ccc cag tgc caa ctg cca tct ata cat gta gaa caa act gtc cat 1740 Pro Pro Gln Cys Gln Leu Pro Ser Ile His Val Glu Gln Thr Val His 385 390 395 400 tct caa gag act gca aat tat cat cct gat gga act att caa gta agc 1788 Ser Gln Glu Thr Ala Asn Tyr His Pro Asp Gly Thr Ile Gln Val Ser 405 410 415 aat ggt agc ctt gcc ttt tac cca gca cag acg aat gtg ttt ccc aga 1836 Asn Gly Ser Leu Ala Phe Tyr Pro Ala Gln Thr Asn Val Phe Pro Arg 420 425 430 cct act cag cca ttt gtc aat agc cgg gga tct gtt aga gga tgt act 1884 Pro Thr Gln Pro Phe Val Asn Ser Arg Gly Ser Val Arg Gly Cys Thr 435 440 445 cgt ggt ggg aga tta ata acc aat tcc tat cgg tcc cct ggt ggt tat 1932 Arg Gly Gly Arg Leu Ile Thr Asn Ser Tyr Arg Ser Pro Gly Gly Tyr 450 455 460 aaa ggt ttt gat act tat aga gga ctc cct tca att tcc aat gga aat 1980 Lys Gly Phe Asp Thr Tyr Arg Gly Leu Pro Ser Ile Ser Asn Gly Asn 465 470 475 480 480 tat agc cag ctg cag ttc caa gct gag tat tct gga gca cct tat 2028 Tyr Ser Gln Leu Gln Phe Gln Ala Arg Glu Tyr Ser Gly Ala Pro Tyr 485 490 495 tcc caa agg gat aat ttc cag cag tgt tat aag cga gga ggg aca tct 2076 Ser Gln Arg Asp Asn Phe Gln Gln Cys Tyr Lys Arg Gly Gly Thr Ser 500 505 510 ggt ggt cca cga gca aat tcg aga gca ggg tgg agt gat tct tct cag 2124 Gly Gly Pro Arg Ala Asn Ser Arg Ala Gly Trp Ser Asp Ser Ser Gln 515 520 525 gtg agc agc cca gaa aga gac aac gaa acc ttt aac agt ggt gac tct 2172 Val Ser Ser Pro Glu Arg Asp Asn Glu Thr Phe Asn Ser Gly Asp Ser 530 535 540 gga caa gga gac tcc cgt agc atg acc cct gtg gat gtg c ca gtg aca 2220 Gly Gln Gly Asp Ser Arg Ser Met Thr Pro Val Asp Val Pro Val Thr 545 550 555 560 aat cca gca gcc acc ata ctg cca gta cac gtc tac cct ctg cct cag 2268 Asn Pro Ala Ala Thr Ile Leu Pro Val His Val Tyr Pro Leu Pro Gln 565 570 575 cag atg cga gtt gcc ttc tca gca gcc aga acc tct aat ctg gcc cct 2316 Gln Met Arg Val Ala Phe Ser Ala Ala Arg Thr Ser Asn Leu Ala Pro 580 585 585 590 gga act tta gac caa cct att gtg ttt gat ctt ctt ctg aac aac tta 2364 Gly Thr Leu Asp Gln Pro Ile Val Phe Asp Leu Leu Leu Asn Asn Leu 595 600 605 gga gaa act ttt gat ctt cag ctt ggt aga ttt aat tgc cca gtg aat 24 Glu Thr Phe Asp Leu Gln Leu Gly Arg Phe Asn Cys Pro Val Asn 610 615 620 ggc act tac gtt ttc att ttt cac atg cta aag ctg gca gtg aat gtg 2460 Gly Thr Tyr Val Phe Ile Phe His Met Leu Lys Leu Ala Val Asn Val 625 630 635 640 cca ctg tat gtc aac ctc atg aag aat gaa gag gtc ttg gta tca gcc 2508 Pro Leu Tyr Val Asn Leu Met Lys Asn Glu Glu Val Leu Val Ser Ala 645 650 655 tat gcc aat gat ggt gct cca c cat gaa act gct agc aat cat gca 2556 Tyr Ala Asn Asp Gly Ala Pro Asp His Glu Thr Ala Ser Asn His Ala 660 665 670 att ctt cag ctc ttc cag gga gac cag ata tgg tta cgt ctg cac agg 2604 Ile Leu Gln Leu Phe Gln Gly Asp Gln Ile Trp Leu Arg Leu His Arg 675 680 685 gga gca att tat gga agt agc tgg aaa tat tct acg ttt tca ggc tat 2652 Gly Ala Ile Tyr Gly Ser Ser Trp Lys Tyr Ser Thr Phe Ser Gly Tyr 690 695 700 ctt ctt tat caa gat tgaaagtcag tacagtattg acaataaaag gatggtgttc 2707 Leu Leu Tyr Gln Asp 705 taattagtgg gattgaagga aaagtagtct ttgccctcat gactgattgg tttaggaaaa 2767 tgtttttgtt cctagaggga ggaggtcctt acttttttgt tttccttcct gaggtgaaaa 2827 atcaagctga atgacaatta gcactaatct ggcactttat aaattgtgat gtagcctcgc 2887 tagtcaagct gtgaatgtat attgtttgca cttaatcctt aactgtatta acgttcagct 2947 tactaaactg actgcctcaa gtccaggcaa gttacaatgc cttgttgtgc ctcaataaaa 3007 aagttacatg caaaaaaaaa aaaaaaaa 3035 <210> 9 <211> 709 <212> PRT <213> Homo sapiens <400> 9 Met Leu Ile Gle Ser Glu Lys Lys Thr Gln Leu Ser Lys Thr Glu Ser 1 5 10 15 Val Lys Glu Ser Glu Ser Leu Met Glu Phe Ala Gln Pro Glu Ile Gln 20 25 30 Pro Gln Glu Phe Leu Asn Arg Arg Tyr Met Thr Glu Val Asp Tyr Ser 35 40 45 Asn Lys Gln Gly Glu Glu Gln Pro Trp Glu Ala Asp Tyr Ala Arg Lys 50 55 60 Pro Asn Leu Pro Lys Arg Trp Asp Met Leu Thr Glu Pro Asp Gly Gln 65 70 75 80 Glu Lys Lys Gln Glu Ser Phe Lys Ser Trp Glu Ala Ser Gly Lys His 85 90 95 Gln Glu Val Ser Lys Pro Ala Val Ser Leu Glu Gln Arg Lys Gln Asp 100 105 110 Thr Ser Lys Leu Arg Ser Thr Leu Pro Glu Glu Gln Lys Lys Gln Glu 115 120 125 Ile Ser Lys Ser Lys Pro Ser Pro Ser Gln Trp Lys Gln Asp Thr Pro 130 135 140 Lys Ser Lys Ala Gly Tyr Val Gln Glu Glu Gln Lys Lys Gln Glu Thr 145 150 155 160 Pro Lys Leu Trp Pro Val Gln Leu Gln Lys Glu Gln Asp Pro Lys Lys 165 170 175 Gln Thr Pro Lys Ser Trp Thr Pro Ser Met Gln Ser Glu Gln Asn Thr 180 185 190 Thr Lys Ser Trp Thr Thr Pro Met Cys Glu Glu Gln Asp Ser Lys Gln 195 200 205 Pro Glu Thr Pro Lys Ser Trp Glu Asn Asn Val Glu Ser Gln Lys His 210 215 220 Ser Leu Thr Ser Gln Ser Gln Ile Ser Pro Lys Ser Trp Gly Val Ala 225 230 235 240 Thr Ala Ser Leu Ile Pro Asn Asp Gln Leu Leu Pro Arg Lys Leu Asn 245 250 255 Thr Glu Pro Lys Asp Val Pro Lys Pro Val His Gln Pro Val Gly Ser 260 265 270 Ser Ser Thr Leu Pro Lys Asp Pro Val Leu Arg Lys Glu Lys Leu Gln 275 280 285 Asp Leu Met Thr Gln Ile Gln Gly Thr Cys Asn Phe Met Gln Glu Ser 290 295 300 Val Leu Asp Phe Asp Lys Pro Ser Ser Ala Ile Pro Thr Ser Gln Pro 305 310 315 320 Pro Ser Ala Thr Pro Gly Ser Pro Val Ala Ser Lys Glu Gln Asn Leu 325 330 335 Ser Ser Gln Ser Asp Phe Leu Gln Glu Pro Leu Gln Val Phe Asn Val 340 345 350 Asn Ala Pro Leu Pro Pro Arg Lys Glu Gln Glu Ile Lys Glu Ser Pro 355 360 365 Tyr Ser Pro Gly Tyr Asn Gln Ser Phe Thr Thr Ala Ser Thr Gln Thr 370 375 380 Pro Pro Gln Cys Gln Leu Pro Ser Ile His Val Glu Gln Thr Val His 385 390 395 400 Ser Gln Glu Thr Ala Asn Tyr His Pro Asp Gly Thr Ile Gln Val Ser 405 410 415 Asn Gly Ser Leu Ala Phe Tyr Pro Ala Gln Thr Asn Val Phe Pro Arg 420 425 430Pro Thr Gln Pro Phe Val Asn Ser Arg Gly Ser Val Arg Gly Cys Thr 435 440 445 Arg Gly Gly Arg Leu Ile Thr Asn Ser Tyr Arg Ser Pro Gly Gly Tyr 450 455 460 Lys Gly Phe Asp Thr Tyr Arg Gly Leu Pro Ser Ile Ser Asn Gly Asn 465 470 475 480 480 Tyr Ser Gln Leu Gln Phe Gln Ala Arg Glu Tyr Ser Gly Ala Pro Tyr 485 490 495 Ser Gln Arg Asp Asn Phe Gln Gln Cys Tyr Lys Arg Gly Gly Thr Ser 500 505 510 Gly Gly Pro Arg Ala Asn Ser Arg Ala Gly Trp Ser Asp Ser Ser Gln 515 520 525 Val Ser Ser Pro Glu Arg Asp Asn Glu Thr Phe Asn Ser Gly Asp Ser 530 535 540 Gly Gln Gly Asp Ser Arg Ser Met Thr Pro Val Asp Val Pro Val Thr 545 550 555 560 Asn Pro Ala Ala Thr Ile Leu Pro Val His Val Tyr Pro Leu Pro Gln 565 570 575 Gln Met Arg Val Ala Phe Ser Ala Ala Arg Thr Ser Asn Leu Ala Pro 580 585 590 Gly Thr Leu Asp Gln Pro Ile Val Phe Asp Leu Leu Leu Asn Asn Leu 595 600 605 Gly Glu Thr Phe Asp Leu Gln Leu Gly Arg Phe Asn Cys Pro Val Asn 610 615 620 620 Gly Thr Tyr Val Phe Ile Phe His Met Leu Lys Leu Ala Val Asn Val 625 630 635 640 Pro Leu Tyr Val Asn Leu Met Lys Asn Glu Glu Val Leu Val Ser Ala 645 650 655 Tyr Ala Asn Asp Gly Ala Pro Asp His Glu Thr Ala Ser Asn His Ala 660 665 670 Ile Leu Gln Leu Phe Gln Gly Asp Gln Ile Trp Leu Arg Leu His Arg 675 680 685 Gly Ala Ile Tyr Gly Ser Ser Trp Lys Tyr Ser Thr Phe Ser Gly Tyr 690 695 700 Leu Leu Tyr Gln Asp 705

[Brief description of the drawings]

FIG. 1. Pancreatic cancer antigen KU-PAN-1 by RT-PCR
FIG. 3 is a view showing the results of expression analysis of.

FIG. 2. Pancreatic cancer antigen KU-PA by Northern blotting
It is a figure which shows the result of the expression analysis of N-1.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) A61P 35/00 C07K 14/47 4C084 C07K 14/00 16/18 4C085 14/47 19/00 4H045 16/18 C12N 1 / 15 19/00 1/19 C12N 1/15 1/21 1/19 C12Q 1/02 1/21 1/68 A 5/10 G01N 33/15 Z C12Q 1/02 33/50 Z 1/68 33/53 M G01N 33/15 33/577 A 33/50 C12P 21/02 C 33/53 21/08 33/577 C12R 1:91) // C12P 21/02) 21/08 (C12P 21/02 (C12N 15 / 09 ZNA C12R 1:91) C12R 1:91) C12N 15/00 ZNAA (C12N 5/10 A61K 37/02 C12R 1:91) C12N 5/00 A (C12P 21/02 C12R 1:91) C12R 1:91 ) F term (reference) 2G045 AA34 AA35 BB41 CA26 FB02 FB03 FB05 4B024 AA01 AA11 BA36 BA80 CA04 CA07 CA09 CA11 CA20 DA02 DA06 EA03 FA10 FA20 GA11 GA19 GA27 HA13 HA14 4B063 QA01 QA19 QQ21 QQ41 Q08Q R32. ZB082 ZB092 ZB262 4C085 AA14 AA19 BB36 CC02 DD22 DD33 DD34 EE01 4H045 AA10 AA11 AA30 BA10 BA41 CA41 DA75 DA76 DA80 EA28 EA51 FA74

Claims (22)

[Claims] 1. A DNA encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 9; (b) an amino acid sequence shown in SEQ ID NO: 9 consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and which induces immunity Active protein 2. A DNA comprising the nucleotide sequence shown in SEQ ID NO: 8 or a sequence complementary thereto and a part or all of these sequences. 3. A DNA that hybridizes with the DNA according to claim 2 under stringent conditions and encodes a protein having immunity-inducing activity. 4. A protein comprising the amino acid sequence shown in SEQ ID NO: 9. 5. A protein comprising an amino acid sequence shown in SEQ ID NO: 9 in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. 6. A peptide comprising a part of the protein according to claim 4 and having immunity-inducing activity. 7. A fusion protein or peptide in which the protein according to claim 4 or 5 or the peptide according to claim 6 is linked to a marker protein and / or a peptide tag. 8. An antibody that specifically binds to the protein according to claim 4 or 5 or the peptide according to claim 6. 9. The antibody according to claim 8, wherein the antibody is a monoclonal antibody. 10. A recombinant protein or peptide to which the antibody according to claim 8 or 9 specifically binds. 11. A host cell comprising an expression system capable of expressing the protein according to claim 4 or 5. 12. A non-human animal, wherein the function of a gene encoding the protein according to claim 4 or 5 is deficient on a chromosome or the gene is overexpressed. 13. The non-human animal according to claim 12, wherein the non-human animal is a mouse or a rat. 14. A test substance is brought into contact with the protein according to claim 4 or 5 or the peptide according to claim 6, and the immunity-inducing activity of the protein or peptide is measured.
A method for screening for a substance that promotes or suppresses immunity inducing activity, which is evaluated. 15. A test substance is brought into contact with a cell membrane or a cell expressing the protein according to claim 4 or 5, and the immunity-inducing activity of the protein or peptide is measured.
A method for screening for a substance that promotes or suppresses immunity inducing activity, which is evaluated. A immunity inducing activity promoter obtained by the screening method according to claim 14 or 15. A immunity-inducing activity-suppressing substance obtained by the screening method according to claim 14 or 15. 18. An antitumor agent comprising the protein according to claim 4 or 5, the peptide according to claim 6, the protein or peptide according to claim 10, or the antibody according to claim 8 or 9 as an active ingredient. 19. An activated T cell induced by in vitro stimulation with the protein according to claim 4 or 5, the peptide according to claim 6, or the protein or peptide according to claim 10. 20. A cancer diagnostic probe comprising all or a part of the antisense strand of DNA or RNA encoding the protein according to claim 4 or 5. 21. A diagnostic agent for cancer, which comprises the diagnostic probe for cancer according to claim 20 and / or the antibody according to claim 8 or 9. 22. The diagnostic agent for cancer according to claim 21, wherein the diagnostic agent for cancer is a diagnostic agent for one or more cancers selected from pancreatic cancer, esophageal cancer, colorectal cancer, and breast cancer.