JP2002223765A - Human malignant melanoma antigen - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a malignant melanoma antigen, a gene encoding the same and the like available to diagnosis or treatment of cancer. SOLUTION: A cDNA is produced by using a mRNA obtained from a malignant melanoma cell line, the cDNA is transduced into COS7 cell together with HLA-A1 cDNA, the COS7 cell and a HLA-A1-restricted T-cell are contacted by cocultivation, a new human malignant melanoma antigen MART-2 is isolated by assaying the amount of interferon γ released from the T-cell through a ELISA method, and the T-cell epitope (FLEGNEVGKTY) is identified.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel human malignant melanoma antigen useful for diagnosis and immunotherapy of various cancers including malignant melanoma, more specifically, T cells established from tumor-infiltrating lymphocytes, for example, The present invention relates to a common antigen recognized by HLA-A1-restricted and melanoma-reactive T cells, a DNA encoding the antigen, and use thereof.

[0002]

2. Description of the Related Art Malignant melanoma is a cancer for which immunotherapy using interleukin 2 or the like is relatively effective (JAMA 271,
907, 1994), but it has been shown that cytotoxic T cells (CTLs) that react with tumor cells are important for antitumor effects in vivo (Microbiol. Immunol. 42, 803 1).
998). After immunotherapy, tumor-reactive T cells are activated,
T cell receptor (TCR) on T cells
Recognizes a peptide (tumor antigen) formed by decomposing tumor cell proteins presented on the surface of tumor cells by HLA (human leukocyte antigen) molecules, and damages tumor cells.
Furthermore, it is thought that it secretes various cytokines, induces and activates other immune cells such as macrophages, and causes tumor rejection in vivo. Tumor-reactive T cells recognize not only autologous tumor cells, but also common tumor antigens that respond to tumor cells from other patients sharing HLA, and those that recognize unique antigens that react only to autologous tumor cells May be.

In order to elucidate the immune response mechanism against human tumor cells and to develop a new immunotherapy, it is important to identify tumor antigens recognized by these tumor-reactive T cells. When tumor-reactive T cells have been established, it is possible to isolate a malignant melanoma antigen using a functional cDNA expression cloning method utilizing the reactivity. For example, the use of tumor-reactive cytotoxic T cells from metastatic melanoma patients and tumor cell lines expressing HLA-A2 to prevent, diagnose and treat melanoma or mammals with metastatic melanoma. To isolate human malignant melanoma antigen MART-1 that can be obtained
No. 05481. To date, typical examples are pigment cell (melanocyte) tissue-specific proteins such as MART-1 and gp100, MAGE and BA which are expressed in testes in various tumors and normally
Cancer-Testi such as GE, GAGE and NY-ESO-I
s antigen (CT antigen), β-catenin produced by genetic abnormality of tumor cells, CDK4 (cyclin dependent kinas)
e4), mutant peptide antigens such as p15 and GnT-V have been isolated (Immunol Res 16, 313, 1997). In the United States National Cancer Institute, the melanocyte-specific antigen MART-
Phase I clinical trials of various immune and gene therapies using 1 and gp100 have been performed, and tumor regression has been observed in some patients.

[0004]

At present, cancer is the leading cause of death.
Despite advances in treatment, many advanced cancers cannot yet be treated. To improve this, new early diagnostics and treatments need to be developed. In particular, as a problem in developing immunotherapy,
(1) HLA presenting antigen has diversity, (2)
Tissue-specific antigens and CT antigens are common antigens that are easy to use in the treatment of many patients, but are not essential molecules for tumor cells, so they tend to lose antigen. (3) Tumor-specific mutant peptide antigens , Although tumor-specific and tumor rejection may be strong, it is difficult to treat many patients at present, as custom-made treatment is required for each individual patient. It is said that it is necessary to isolate a strong antigen and to analyze the characteristics of the antigen. An object of the present invention is to provide a malignant melanoma antigen that can be applied to diagnosis and treatment of cancer, a gene encoding the same, and the like.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies in order to solve the above problems, and have prepared cDNA using mRNA obtained from a malignant melanoma cell line,
A was introduced into COS7 cells together with the HLA-A1 cDNA, and the COS7 cells and HLA-A1-restricted T cells (T
IL1362) and co-culture with T.
Interferon γ released from IL1362 (IF
By measuring the amount of N-γ) by the ELISA method,
A novel human melanoma antigen has been found, its T cell epitope has been identified, and the present invention has been completed.

That is, the present invention relates to a protein encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) an amino acid sequence shown in SEQ ID NO: 2; A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity (Claim 1)
It hybridizes under stringent conditions with the nucleotide sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, a DNA containing part or all of these sequences (claim 2), or the DNA of claim 2 under stringent conditions. And DNA encoding a protein having an immunity-inducing activity (Claim 3), a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (Claim 4), or one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2. Proteins comprising an amino acid sequence wherein amino acids have been deleted, substituted or added, and having an immunity-inducing activity (claim 5) or a part of the protein according to claim 4 or 5; The peptide having the amino acid sequence shown in SEQ ID NO: 4 or a peptide having the amino acid sequence shown in SEQ ID NO: 4. Regarding peptide (claim 7).

[0007] The present invention also relates to a protein according to claim 4 or 5, or a peptide according to claim 6 or 7,
A fusion protein or fusion peptide linked to a marker protein and / or a peptide tag (claim 8);
An antibody (Claim 9) which specifically binds to the protein or peptide according to any one of Claims 4 to 8, or an antibody according to Claim 9 (Claim 10), wherein the antibody is a monoclonal antibody. And a recombinant protein or peptide to which the antibody according to claim 9 or 10 specifically binds (claim 11), or any one of claims 4 to 8, or claim 1.
12. A host cell comprising an expression system capable of expressing the protein or peptide according to claim 1 (claim 12), and a gene function encoding the protein or peptide according to any one of claims 4 to 8 or claim 11. Is a non-human animal characterized by having a chromosome defect (Claim 13)
A non-human animal (claim 14) or a non-human animal characterized by overexpressing any one of claims 4 to 8 or the protein or peptide according to claim 11; 14. The method according to claim 14, wherein
A non-human animal according to claim 5 (claim 15).

[0008] The present invention also relates to a test substance, and claims 4 to 8.
A method for screening for a substance that promotes or suppresses immunity-inducing activity, comprising measuring and evaluating the immunity-inducing activity of a T cell, using the protein or peptide according to claim 11 and a T cell. Item 16)
And a test substance, a host cell according to claim 12, and a T cell, wherein the immunity induction activity in the T cell is measured and evaluated. 17) using a host cell transfected with a vector expressing HLA and a vector expressing the test polypeptide, and a T cell;
A method of screening for a substance that promotes or suppresses the immunity inducing activity, which comprises measuring and evaluating the immunity inducing activity in the T cells (Claim 18); A method for screening for a substance that promotes or suppresses immunity-inducing activity, comprising measuring and evaluating immunity-inducing activity in T cells using the host cells having the cells and T cells (claim 1).
9) The method for screening for a substance that promotes or suppresses immunity inducing activity according to claim 18 or 19, wherein the HLA is HLA-A1.
15. A method for screening a substance that promotes or suppresses immunity-inducing activity, comprising administering a test substance to a non-human animal according to any one of (1) to (15), and measuring and evaluating immunity-inducing activity in T cells of the non-human animal (claim) Item 21) or the measurement and evaluation of the immunity inducing activity is the measurement and evaluation of interferon γ activity in T cells.
22. The method for screening a substance for promoting or suppressing immunity-inducing activity according to any one of claims 21 to 21, wherein the T cell is HL.
2. An A-A1-restricted T cell.
A method for screening a substance for promoting or suppressing immunity inducing activity according to any one of claims 6 to 22 (claim 23), and claim 16
24. An immunity-inducing activity promoting substance obtained by the screening method according to any one of claims 23 to 23 (claim 24);
The immunity-inducing activity-suppressing substance (claim 25) obtained by the screening method of any one of claims 6 to 23, the protein or peptide of any of claims 4 to 8, or the claim 11, or the claim 24. An antitumor agent containing a immunity-inducing activity promoting substance as an active ingredient (claim 2)
6), any one of claims 4 to 8, or claim 11
An activated T cell (claim 27) induced by in vitro stimulation with the protein or peptide described in claim 25 or the immunity-inducing activity promoting substance described in claim 25.

[0009] The present invention also provides a method for detecting activated T cells or precursor cells thereof using an HLA molecule and the peptide according to claim 6 or 7 (claim 28).
A method for detecting an activated T cell or a precursor cell thereof comprising using a complex of the A molecule and the peptide according to claim 6 or 7, or a method for detecting an HLA molecule and a precursor cell thereof.
A method for detecting activated T cells or precursor cells thereof, wherein the peptide complex is formed on a cell surface or a carrier surface (claim 30), or the carrier is a fluorescent fine particle. The method for detecting an activated T cell or its precursor cell according to claim 30 (claim 31), and wherein the HLA molecule is HLA class I.
1. The method for detecting an activated T cell or a precursor cell thereof according to any one of (1) to (3), wherein the HLA class I is HLA-A
33. The method for detecting activated T cells or precursor cells thereof according to claim 32, wherein
A reagent for detecting activated T cells or precursor cells thereof comprising the A molecule and the peptide according to claim 6 or 7, or a complex of an HLA molecule and the peptide according to claim 6 or 7. The activated T cell or its progenitor cell according to claim 34 or 35, further comprising a reagent for detecting an activated T cell or its precursor cell characterized by containing a body (claim 35), and further comprising a carrier. Detection reagent (claim 3
(6) The reagent for detecting activated T cells or precursor cells thereof according to (36), wherein the carrier is a fluorescent fine particle (Claim 37), and the HLA molecule is HLA class I. The reagent for detecting the activated T cell or the precursor cell thereof according to any one of claims 34 to 37 (claim 38).
And a reagent for detecting activated T cells or precursor cells thereof according to claim 38, wherein the HLA class I is HLA-A1 (claim 39).

[0010] The present invention further provides a cancer diagnostic probe comprising all or a part of the antisense strand of DNA or RNA encoding the protein or peptide according to any one of claims 4 to 8 or claim 11 (claim Item 40)
A cancer diagnostic agent (Claim 41) or a cancer diagnostic agent comprising the cancer diagnostic probe according to claim 40 and / or the antibody according to claim 10 or 11, wherein the cancer diagnostic agent is malignant black. Claims: A diagnostic agent for one or more cancers selected from tumor, esophageal cancer, bladder cancer, lung cancer, brain tumor, pancreatic cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, leukemia, and Burkitt's lymphoma. Item 41. The diagnostic agent for cancer according to Item 41 (Claim 42).
About.

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION The proteins to be used in the present invention include the malignant melanoma antigen MART-2 derived from malignant melanoma shown in SEQ ID NO: 2 in the sequence listing and the amino acid sequence shown in SEQ ID NO: 2. Consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added,
In addition, a protein having an immunity-inducing activity can be exemplified. Here, the immunity-inducing activity refers to an activity of inducing an immune response such as antibody production, cell-mediated immunity, or immune tolerance. Those having T cell inducing activity to increase the frequency of blood cytotoxic T cell (CTL) precursor cells are particularly preferred.

The peptide to be used in the present invention is not particularly limited as long as it is a peptide consisting of a part of the above-mentioned protein and having immunity-inducing activity. T cells and / or CD
Peptides constituting the recognition site of 8+ T cells are preferable,
A malignant melanoma antigen epitope (FLEGNEVGK) derived from a malignant melanoma consisting of the amino acid sequence shown in SEQ ID NO: 4
TY) can be specifically mentioned. The above-mentioned proteins and peptides of the present invention, and the recombinant proteins and peptides to which antibodies that specifically bind to these proteins and peptides specifically bind, are hereinafter collectively referred to as “the malignant melanoma antigen”. is there. The origin of the present melanoma antigen is not limited to humans.

The DNA to be used in the present invention includes a protein MA consisting of the amino acid sequence shown in SEQ ID NO: 2.
DNA encoding RT-2, a DN consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, and encoding a protein having immunity-inducing activity
A, a nucleotide sequence represented by SEQ ID NO: 1 or a complementary sequence thereof and a DNA containing a part or all of these sequences can be exemplified. And a DNA consisting of the base sequence shown in SEQ ID NO: 3. CDNA encoding such a melanoma antigen MART-2
Although there is no particular limitation on the method for preparing MART-2, for example, cDNA encoding MART-2 is prepared using mRNA obtained from a malignant melanoma cell line, and this cDNA is combined with HLA-A1 cDNA. COS
7 cells, contacted by co-culturing the COS7 cells and HLA-A1 restricted T cells (TIL1362), and screening by measuring the amount of interferon gamma (IFNγ) released from TIL1362 by ELISA. can do.

In addition, a DNA sequence derived from various malignant melanomas is used under stringent conditions by using the nucleotide sequence shown in SEQ ID NO: 1 or its complementary sequence and a part or all of these sequences as probes. Hybridization and hybridizing to the probe
By isolating NA, the melanoma antigen MART-
It is also possible to obtain a DNA encoding a protein having the desired immunity-inducing activity as effective as in 2. The DNA thus obtained is also within the scope of the present invention. Such a D of the present invention
Hybridization conditions for obtaining NA include, for example, hybridization at 42 ° C.
And 1 × SSC, a washing treatment at 42 ° C. with a buffer containing 0.1% SDS, hybridization at 65 ° C., and 0.1 × SSC, 0.1%
Washing at 65 ° C. with a buffer solution containing SDS is more preferable. The factors affecting the stringency of hybridization include various factors other than the above-mentioned temperature conditions, and those skilled in the art can appropriately combine various components and have the same properties as the above-described stringency of hybridization. Stringency can be realized.

The fusion protein or fusion peptide of the present invention may be any one as long as the malignant melanoma antigen is bound to a marker protein and / or a peptide tag. It is not particularly limited as long as it is a known marker protein, and specific examples thereof include alkaline phosphatase, the Fc region of an antibody, HRP, GFP, and the like. Tag, His tag, FLAG tag, GST
Conventionally known peptide tags such as tags can be specifically exemplified. Such a fusion protein or fusion peptide can be produced by a conventional method, and Ni-NTA
Melanoma antigen MAR utilizing affinity of DNA and His tag
Purification of T-2 and the like, detection of a protein having T cell inducing activity, quantification of antibody against malignant melanoma antigen MART-2, etc., as a diagnostic marker for melanoma, and as a research reagent in this field Is also useful.

Specific examples of the antibodies that specifically bind to the protein or peptide of the present invention include immunospecific antibodies such as monoclonal antibodies, polyclonal antibodies, chimeric antibodies, single-chain antibodies, and humanized antibodies. These can be prepared by a conventional method using a protein such as the above malignant melanoma antigen MART-2 or a part thereof as an antigen. Among them, a monoclonal antibody is preferable in terms of its specificity. -2 epitope (F
LEGNEVKTY) or the epitope and HLA
Monoclonal antibodies that specifically recognize the complex with are more preferred. Such an antibody such as a monoclonal antibody is useful, for example, for diagnosing malignant melanoma and the like, treating not only missile therapy and the like, but also elucidating the onset mechanism of malignant tumor such as malignant melanoma.

Further, the antibody of the present invention can be used to prepare an animal (preferably a non-human) melanoma antigen, particularly an epitope (FLEGNEVGKKTY), using an ordinary protocol.
Or a fragment containing the present malignant melanoma antigen, particularly a complex of the epitope (FLEGNEVGKTY) and HLA on the membrane surface. Hybridoma method (Nature 256, 495-497, 1975), trioma method, human B-cell hybridoma method (Immunology Today 4, 72, 19), resulting in antibodies produced by the product.
83) and EBV-hybridoma method (MONOCLONAL ANTIB
ODIES AND CANCER THERAPY, pp.77-96, Alan R.Liss, I
nc., 1985).

To prepare a single-chain antibody against the present melanoma antigen of the present invention, a method for preparing a single-chain antibody (US Pat. No. 4,946,778) can be applied. Also,
In order to express a humanized antibody, transgenic mice or other mammals are used, or a clone expressing the present malignant melanoma antigen is isolated and identified using the above-mentioned antibody, and affinity chromatography is performed. Can be used to purify the polypeptide. The antibody against the present melanoma antigen or a peptide containing the antigen epitope may be used for diagnosis or treatment of melanoma or the like. Recombinant proteins or peptides to which these antibodies specifically bind are also included in the present melanoma antigens of the present invention as described above.

The present invention also relates to a host cell comprising an expression system capable of expressing the malignant melanoma antigen, HLA-A1 comprising an expression system capable of expressing the malignant melanoma antigen, and the like. And a host cell capable of expressing HLA. The introduction of the gene encoding the present malignant melanoma antigen into host cells is described in Davis et al. (BASIC METHODS IN
MOLECULAR BIOLOGY, 1986) and Sambrook et al. (MOLECULAR
CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Sprin
g Harbor Laboratory Press, Cold Spring Harbor, N.
Y., 1989), such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid mediated transfection, Electroporation, transduction, scrape loading, ballisti
cintroduction), infection and the like.

The host cells include E. coli,
Bacterial prokaryotic cells such as Streptomyces, Bacillus subtilis, Streptococcus, and Staphylococcus, yeast, fungal cells such as Aspergillus, insect cells such as Drosophila S2 and Spodoptera Sf9, L cells, CHO cells, COS cells, HeLa cells, C127 cells, BALB / c3T3
Cells (including mutants lacking dihydrofolate reductase, thymidine kinase, etc.), BHK21 cells, HEK
293 cells, Bowes malignant melanoma cells, and other animal cells, and plant cells. In addition, the above HL
Examples of the host cell having the ability to express A include, in addition to cells having the ability to express HLA in nature, cells obtained by transfecting a cell having no ability to express HLA with HLA cDNA. For example, host cells capable of expressing HLA-A1 include 1362mel, SKmel23,
397mel, 888EBV-B, 1088EBV-
B, 1359EBV-B, HLA-A1-positive B cells, and other cells having an ability to express HLA-A1, COS7 cells, 624mel, 526mel, 501Amel, A
Cells which are not originally capable of expressing HLA-A1 such as 375 and 583EBV-B can be exemplified by cells transfected with HLA-A1 cDNA.

The expression system may be any expression system capable of expressing the present malignant melanoma antigen in a host cell, such as expression systems derived from chromosomes, episomes and viruses. A vector derived from a bacterial plasmid, a yeast plasmid, a papovavirus such as SV40, a vaccinia virus, an adenovirus, a fowlpox virus, a pseudorabies virus, a retrovirus-derived vector, a bacteriophage-derived, a transposon-derived or a combination thereof, Examples include those derived from genetic elements of plasmids and bacteriophages such as cosmids and phagemids. The expression system may include control sequences that regulate as well as cause expression.

The host cell comprising the above expression system, the cell membrane of such a cell, and the present malignant melanoma antigen obtained by culturing such a cell can be used in the screening method of the present invention as described later. For example, as a method for obtaining a cell membrane, F. Pietri-Rouxel (Eur. J. Biochem.,
247, 1174-1179, 1997) and the like. In addition, the present malignant melanoma antigen can be recovered and purified from a cell culture by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange. Known methods including chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography, preferably high performance liquid chromatography, are used. In particular, as a column used for affinity chromatography, for example, a column to which an antibody against the present malignant melanoma antigen is bound, or when a normal peptide tag is added to the above-mentioned malignant melanoma antigen, affinity for this peptide tag is The present malignant melanoma antigen can be obtained by using a column to which a certain substance is bound.

In the present invention, the non-human animal in which the function of the gene encoding the present melanoma antigen is deficient on the chromosome is defined as a part of or all of the gene encoding the present melanoma antigen on the chromosome is disrupted. A non-human animal that has been inactivated due to a genetic mutation such as deletion or substitution and has lost the function of expressing the malignant melanoma antigen. A non-human animal that produces such a malignant melanoma antigen in a larger amount than a non-human animal. Examples of the non-human animal in the present invention include, but are not limited to, non-human animals such as rodents such as mice and rats.

Incidentally, the homozygous non-human animals born according to Mendel's law include the present malignant melanoma antigen-deficient or overexpressed type and its homozygous non-human type. By simultaneously using a defective or overexpressed type and its littermate wild type in animals, an accurate comparative experiment can be performed at the individual level,
A wild-type non-human animal, that is, an animal of the same species as a non-human animal whose gene function encoding the present malignant melanoma antigen is deficient or overexpressed on the chromosome, and a littermate animal, for example, the present invention described below. It is preferable to use them together in screening. A method for producing such a non-human animal in which the function of the gene encoding the present melanoma antigen is deficient or overexpressed on the chromosome will be described below using a knockout mouse or a transgenic mouse of the present melanoma antigen as an example.

For example, a mouse lacking the function of the gene encoding the present melanoma antigen on the chromosome, that is, a knockout mouse of the present melanoma antigen is obtained by using a gene fragment obtained from a mouse gene library by PCR or the like. Then, the gene encoding the present melanoma antigen is screened, the screened gene encoding the melanoma antigen is subcloned using a viral vector or the like, and identified by DNA sequencing. All or a part of the gene encoding the present malignant melanoma antigen of this clone is substituted with a pMC1 neo gene cassette or the like, and the diphtheria toxin A fragment (DT-A) gene or the herpes simplex virus thymidine kinase (3 A targeting vector is prepared by introducing a gene such as the HSV-tk) gene.

The thus prepared targeting vector is linearized, introduced into ES cells by electroporation (electroporation) or the like, and subjected to homologous recombination. Among the homologous recombinants, G418 and ganciclovir (G
E.A. which has undergone homologous recombination with an antibiotic such as
Select S cells. It is also preferable to confirm whether the selected ES cells are the desired recombinant cells by Southern blotting or the like. The confirmed ES cell clone is microinjected into a mouse blastocyst, and the blastocyst is returned to a foster parent mouse to produce a chimeric mouse. When this chimeric mouse is intercrossed with a wild-type mouse, a heterozygous mouse can be obtained, and by intercrossing the heterozygous mouse, the present malignant melanoma antigen knockout mouse of the present invention is produced. can do. In addition, as a method for confirming whether or not the malignant melanoma antigen knockout mouse has occurred, for example, RNA is isolated from the mouse obtained by the above method and examined by Northern blotting or the like. There is a method of examining expression by Western blotting or the like.

The transgenic mouse of the present melanoma antigen is obtained by adding chicken β-actin, mouse neurofilament, S
A promoter such as V40, and rabbit β-globin;
A transgene is constructed by fusing a polyA or intron such as SV40, the transgene is microinjected into the pronucleus of a mouse fertilized egg, and the obtained oocytes are cultured, and then transplanted into an oviduct of a foster parent mouse, Thereafter, the transgenic mouse can be created by breeding the recipient animal and selecting a pup mouse having the above-mentioned cDNA from the pup mice born. In addition, selection of offspring mice having cDNA can be carried out by extracting crude DNA from the tail or the like of the mouse, and conducting dot hybridization using a gene encoding the present malignant melanoma antigen as a probe, or PCR using specific primers. It can be performed by a method or the like.

A gene or DNA encoding the melanoma antigen, a melanoma antigen, a fusion peptide or a fusion protein obtained by binding the malignant melanoma antigen to a marker protein and / or a peptide tag;
Antibodies to the present melanoma antigen, host cells comprising an expression system capable of expressing the present melanoma antigen, and the like, as specifically described below, malignant melanoma, esophageal cancer, bladder cancer, It is useful for the treatment and diagnosis of lung cancer, brain tumor, pancreatic cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, leukemia, Burkitt's lymphoma, etc. Activated T cells (including all T cells such as CD4 antigen-positive T cells, CD8 antigen-positive T cells, helper T cells, killer T cells, suppressor T cells, etc.) It can also be used to elucidate the mechanism of the immune response, such as induction of thyroid.

The method of screening for a substance that promotes or suppresses the immunity-inducing activity of the present invention uses a test substance, the present malignant melanoma antigen and T cells such as HLA-A1-restricted T cells to induce immunity in the T cells. A method for measuring / evaluating activity, a method for measuring / evaluating immunity-inducing activity in T cells using a test substance, a cell membrane or a cell expressing the present malignant melanoma antigen and T cells, and a method for measuring HLA- H such as A1
A method for measuring and evaluating immunity-inducing activity in T cells using host cells and T cells transfected with both a vector expressing the LA and a vector expressing the test polypeptide, and expressing the test polypeptide. A method for measuring and evaluating immunity-inducing activity in T cells using a host cell capable of expressing HLA such as HLA-A1 transfected with a vector and T cells, and a method for non-human cells such as the knockout mice and transgenic mice A method of administering a test substance to an animal and measuring / evaluating the immunity-inducing activity on T cells of the non-human animal can be used. Examples of the cell membrane or cells include cells such as primary cultured cells obtained from a non-human animal or a wild-type non-human animal in which the gene encoding the malignant melanoma antigen is overexpressed, and the malignant melanoma of the present invention. Host cells comprising an expression system capable of expressing an antigen, and cell membranes of these cells can be specifically exemplified. Examples of the method of contacting such a cell membrane or cells with a test substance include a test substance A method in which a cell membrane or cell expressing the present malignant melanoma antigen is cultivated in vitro in the presence of T cell and then contacted with T cells.

The screening method using the above-mentioned test substance and T cells will be specifically described below with reference to examples, but the screening method of the present invention is not limited thereto. As a method for measuring and evaluating the immunity inducing activity of the T cell using the test substance, the present melanoma antigen and T cells, for example, the test substance may be used in the presence of HLA-A1-restricted T cells. Specific examples of a method of contacting the present melanoma antigen, measuring the increase or decrease of T cell inducing activity such as CTL, and comparing / evaluating with a control in the absence of a test substance can be specifically exemplified. . In addition, the above HL
Using a host cell transfected with a vector expressing HLA such as A-A1 and a vector expressing a test polypeptide, and a T cell, a method for measuring / evaluating immunity-inducing activity in the T cell includes: After co-culturing HLA-A1-restricted T cells with host cells co-transfected with a vector expressing the HLA-A1 and a vector expressing the test polypeptide for a certain period of time, HLA-A1-restricted expression on the cell membrane surface A specific example of a method for evaluating the decrease or increase of the malignant melanoma antigen of the present invention by using the amount of IFNγ released into the medium from HLA-A1 restricted T cells as an index can be specifically exemplified.

The above-mentioned T cells such as the HLA-A1-restricted T cells used in the screening of the present invention can be obtained by in vitro transfection of lymphocytes infiltrating malignant melanoma tissues isolated from cancer tissues of malignant melanoma patients at a high concentration of interleukin. 2 by culturing and growing in the presence for 30 to 70 days, or by separating malignant melanoma tissue infiltrating lymphocytes or peripheral blood mononuclear cells from malignant melanoma patients,
MART-2 or a peptide consisting of a part of MART-2, or MART-2 cDNA is introduced into MART-2.
Alternatively, those skilled in the art can easily establish tumor-reactive T cells or the like by stimulating the cells with antigen-presenting cells capable of expressing a peptide composed of a part of MART-2.

Further, the present invention provides an immunity-inducing activity-promoting substance used for the treatment of a patient in need of promoting the immunity-inducing activity obtained by the above-mentioned screening method, and the treatment of a patient in need of suppressing the immunity-inducing activity. The present invention relates to a substance for suppressing an immunity-inducing activity, which is used for: The present invention also provides a malignant melanoma containing the present melanoma antigen as an active ingredient,
The present invention relates to an antitumor agent for esophageal cancer, bladder cancer, lung cancer, brain tumor, pancreatic cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, leukemia, Burkitt's lymphoma, and the like. For example, when the malignant melanoma antigen is administered orally, intravenously, intradermally, subcutaneously, or the like, an antitumor effect due to an increase in T cell inducing activity in vivo can be expected. Further, the above antibody can be used for missile therapy. The present invention also relates to activated T cells induced by in vitro stimulation with the present melanoma antigen. For example, peripheral blood lymphocytes and tumor infiltrating lymphocytes
When stimulated with the present melanoma antigen together with L-2, tumor-reactive activated T cells are induced, and the activated T cells can be used effectively for adoptive immunotherapy. In addition, the malignant melanoma antigen can be expressed in vivo or in vitro in dendritic cells which are powerful antigen-presenting cells, and immunity can be induced by administering the antigen-expressing dendritic cells.

The method for detecting the cytotoxic T cells (activated T cells) of the present invention or their precursor cells is not particularly limited as long as the method uses the HLA molecule and the peptide of the present invention. Examples include a method using a complex of an HLA molecule such as an I molecule and the peptide of the present invention, and a method of forming a complex of an HLA molecule such as an HLA class I molecule and the present peptide on a cell surface or a carrier surface such as fluorescent fine particles. For example, in the literature (Science, 274, 94-9
6, 1996), a complex of an HLA class I molecule and the peptide of the present invention is formed on the surface of the fluorescent fine particles, and T lymphocyte cells derived from peripheral blood of a cancer patient are contacted with and bound to the complex. After that, H formed on the surface of the fluorescent fine particles
A method for detecting T cells bound to the LA-peptide complex can be mentioned. The reagent for detecting the cytotoxic T cell (activated T cell) of the present invention or its precursor cell is not particularly limited as long as it contains an HLA molecule and the peptide of the present invention. A reagent containing a complex of an HLA molecule such as a molecule and the peptide of the present invention,
Examples of the reagent include a complex of an HLA molecule such as an HLA class I molecule and the peptide of the present invention, and a carrier such as fluorescent fine particles.

Further, the present invention relates to a diagnostic probe for cancer comprising all or a part of the antisense strand of DNA or RNA encoding the present melanoma antigen, a diagnostic probe for this cancer and the present melanoma antigen. Malignant melanoma, esophageal cancer, bladder cancer, lung cancer, brain tumor,
The present invention relates to a diagnostic agent for cancer such as pancreatic cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, leukemia, and Burkitt's lymphoma. The diagnostic probe includes a DNA encoding the present melanoma antigen.
Preferably, it is the whole or a part of the antisense strand of (cDNA) or RNA (cRNA) and has a length (at least 20 bases or more) that can be established as a probe. By detecting the mRNA of the present melanoma antigen obtained from the above, cancer such as malignant melanoma can be diagnosed. Specific examples of the sample used for such detection include, but are not limited to, genomic DNA, RNA, and cDNA that can be obtained from a biopsy of a subject's cells, such as blood, urine, saliva, and tissue. Instead, when such a sample is used, a sample amplified by PCR or the like may be used.

[0035]

EXAMPLES The present invention will be described more specifically below with reference to examples, but the technical scope of the present invention is not limited to these examples. Example A [Materials and Methods] A-1 (cell line and tissue) Human malignant melanoma cell line (SKmel23, 888me)
1, 1362 mel, A375, 624 mel, 926
mel, 586 mel, 526 mel, 397 mel,
501Amel, 1363mel), human glioma cell line (U87-MO, T98G), lung cancer cell line (K1
S, LU99, LK2, EBC1, SBC2, RERF
-LCMA), esophageal cancer cell lines (TE8, TE10), bladder cancer cell lines (KU7, BC47), kidney cancer cell lines (RC
C6, RCC7, RCC8), prostate cancer cell line (JCA
1, PC3), breast cancer cell lines (MDA231, HS57
8), liver cancer cell line (HepG2), leukemia cell line (HL
60, K562, Molt4) and Burkitt's lymphoma cell line (Daudi), respectively, with penicillin (100
IU / ml) and streptomycin (100 μg / m
l) RPMI1 with 10% fetal bovine serum plus
Cultured at 640. Pancreatic cancer cell lines (PK1, PK59) were penicillin / streptomycin (1%), L
-Glutamine (1%), HEPES (10 mM), EG
The cells were cultured in RPMI1640 containing 10% fetal bovine serum supplemented with F (6 μg / l), insulin (150 U / l), hydrocortisone (0.5 mg / l), and transferrin (10 mg / l). EB virus-infected B cells (1088 EBV-B, 888 EBV-B, 1359
EBV-B, 583EBV-B) was converted to penicillin (100
IU / ml) and streptomycin (100 μg / m
l) RPMI1 with 10% fetal bovine serum plus
Cultured at 640. The human kidney cell line (293UT) and the monkey kidney cell line (COS-7) were cultured in DMEM medium containing 7.5% fetal bovine serum. Normal tissues (brain, lung, heart,
RNA from spleen, liver, small intestine, large intestine, kidney, muscle, placenta, stomach, testis) is from Invitrogen Corporation, Carlsbad, CA
Purchased from.

A-2 (Establishment of Tumor-Reactive Cytotoxic T Cells) A malignant melanoma tissue-infiltrating lymphocyte metastasized to the right flank of a 43-year-old female patient was isolated and described in J. Exp. Med. 2183, 19
88) As described, isolated malignant melanoma tissue-infiltrating lymphocytes were prepared in vitro at a high concentration (6000 IU / ml) of interleukin 2 (Cetus-Oncology Devision, Chiron Corion).
p. Emeryville, CA) and grown by culturing for 30 days in the presence of tumor-reactive cytotoxic T cells (TIL
1362) was established.

A-3 (Determination of HLA restriction and examination of recognition of known antigen) Reference (Kawakami. Y., et al: Cloning of the Gene Cod)
ing for a Shared Human Melanoma Antigen Recognized
by Autologous T cells Infiltrationg intoTumor. Pr
USA 91: 3515-3519, 1994.), a malignant melanoma cell line expressing various HLA (1362mel, SKmel23, 397me).
1, 526melA transfected with HLA-A1 cDNA
1), a malignant melanoma cell line that does not express HLA (624 m
el, 526mel), was HLA-A1cDNA COS7 cells were introduced, and HLA-A1cDNA not introduced COS7 cells each 5 × 10 ⁴ and TIL1362 cells 5 × both 10 ⁴ and 20 hours incubation, the culture The IFNγ released from TIL1362 was recovered as E
HLA restriction was determined by measuring by the LISA method. Also, lipofectamine
Using reagents (BRL, Gaitherburg, MD), 100 ng of known malignant melanoma antigen gene cDNA and / or HLA-A
50 ng of 1 cDNA was introduced into COS7 cells (5 × 10 ⁴ cells), and the presence or absence of recognition of a known antigen by TIL1362 was examined.

A-4 (Preparation of cDNA Library) After extracting total RNA from the autologous tumor cell line 1362 mel using the guanidine-cesium chloride method, poly A + RNA was purified using an oligo dT column. Random primer having HindIII sequence (Novagen), reverse transcriptase (Novagen), T4 DNA synthase (Novagen)
), And EcoRI linker (Novagen, Madison, WI) was added. This DNA was digested with the restriction enzymes EcoRI (5 'end) and HindI.
Cleavage at II (3 'end) and insertion into eukaryotic cell expression plasmid vector VR1012 (gift from Chiron / Viagene, San Diego, CA; Journal of Immunology 161, 6985, 1998) to construct a unidirectional cDNA library did.

A-5 (Screening of tumor antigen cDNA using cytotoxic T cells) [0039] Bacteria of about 100 clones of a plasmid incorporating the cDNA obtained in the above A-4 were used as a pool, cultured overnight and amplified. , Wizard 9600 DNA Extraction System (Pro
mega, Madison, WI) to extract plasmid DNA. 100-200 ng cDNA per pool
Using a Lipofectamine reagent (BRL, Gaitherburg, MD) with 100 ng of HLA-A1 cDNA.
COS7 cells (5 × 10 ⁴ cells) on a microwell plate
DMEM containing 7.5% fetal bovine serum
The cells were cultured at 37 ° C. using a medium (SIGMA, St. Louis, MO). The next day, after replacing the culture supernatant with the fresh medium described above, T
IL1362 cells (5 × 10 ⁴ cells) were added and cultured for 20 hours. Thereafter, the culture supernatant was recovered, and the amount of IFNγ released from TIL1362 was determined according to the literature (Proc. Natl. Acad. Sci. US
A 91, 3515, 1994). Individual cDN from the positive pool in which IFNγ was detected
A plasmid was isolated and HLA-A1cD
Screening for transfection into COS7 cells together with NA was repeated several times, and a plasmid containing cDNA encoding a tumor antigen was isolated. The nucleotide sequence of the cDNA in the obtained plasmid was changed to Big Dye terminater cycle sequence.
ncing kit and ABI PRISM 310 genetic analyzer (Perkin-
Elmer, Foster City, CA).

A-6 (RACE method of full-length cDNA (Rapi
Analysis by d Amplification of cDNA Ends) 1 μg of poly A ⁺ RNA of melanoma cell line SKmel23
Using the Marathon ™ cDNA Amplification Kit (Clon
tech, Palo Alto, CA, USA). For reverse transcription, a slightly modified oligo (dT) primer containing two degenerate nucleotide sequences of the 3 'end and the reverse of avian myeloblastosis virus was added to the second strand cDNA.
E. coli DNA polymerase I, RNase
H and DNA ligase were used. In addition, double-stranded cDNA
Is blunt-ended with T4 DNA polymerase,
Marathon cDNA adapter 1 using DNA ligase
(5'-CTAATACGACTCACTATAGGG
CTCGAGCGGCCGCCCGGGCAGGT-
3 ′: SEQ ID NO: 5) was ligated. In the PCR method in 5'-RACE, adapter primer 1 (5'-CC
ATCCTAATACGACTCACTATAGGGC
-3 ': SEQ ID NO: 6) and Oligo1000M (Beckman Coulte
r, Inc., Fullerton, CA), an 8B6 clone-specific reverse primer (MART-2 cDNA 11).
A nucleotide sequence complementary to the nucleotide sequence from the 37th position to the 1164th position: 5'-GTCGTAGCCGCCATGCCA
GTAGCTCACA-3 ': SEQ ID NO: 7) was used to amplify the 5' end, and in the PCR method in 3'-RACE, the adapter primer 1 and the 8B6 clone-specific forward primer (from the 763-position of the MART-2 cDNA to 788) were used. Up to the base sequence: 5'-CG
CCCTCTTTGCTGGTGGTGGGCTGGC-
3 ': SEQ ID NO: 8) was used to amplify the 3' end. Amplification using these primers was performed at 94 ° C for 30 seconds x 1 cycle, at 94 ° C for 5 seconds, and at 72 ° C for 4 minutes x 5 cycles.
5 cycles at 94 ° C. for 5 seconds, 70 ° C. for 4 minutes, 25 cycles at 94 ° C. for 5 seconds, 68 ° C. for 4 minutes,
PCR was performed at 72 ° C. for 7 minutes × 1 cycle.

5 μl of the amplification product obtained above was added to 1
Electrophoresis was performed using a% agarose gel. The remaining amplification product was diluted 50-fold with Tricine-EDTA buffer, and the second PCR was performed using the first PCR product as a template.
Was done. In the PCR method in 5'-RACE, nested adapter primer 2 (5'-ACTCACT
ATAGGGCTCGAGCGGC-3 ': SEQ ID NO: 9) and a nested 8B6-specific reverse primer (base sequence complementary to the base sequence from position 1459 to position 1486 of MART-2 cDNA: 5'-GTAA
GAAATGCAGAAACACAGGAAGGCC-
3 ': The 5' end was amplified using SEQ ID NO: 10) and 3'-
In the PCR method in RACE, nested adapter primer 2 and nested 8B6-specific forward primer (1259
Base sequence up to position 281: 5'-TGGCCGAT
ACTTCTCCCCACAA-3 ': SEQ ID NO: 11)
Was used to amplify the 3 'end. Amplification using these primers was performed at 94 ° C. for 30 seconds × 1 cycle,
94 ° C for 5 seconds, 72 ° C for 4 minutes x 5 cycles, 94 ° C
For 5 seconds, 70 ° C for 4 minutes x 5 cycles, 94 ° C for 5 seconds, 68 ° C for 4 minutes x 20 cycles, 72 ° C for 7 minutes x
Performed under one cycle of PCR conditions. The final amplification product obtained was subcloned into pGEM-T (promega).

A-7 (MART by RT-PCR method)
2) The total RNA of the tumor cell line and the normal cell line (melanocytes, T cells, fibroblasts) described in A-1 is 5 × 1
From 0 ⁷ ~1 × 10 ⁸ cells, the guanidine - extracted with cesium chloride method. Extracted total RNA or the above normal tissue R
Using 2 μg of NA each, Superscript II RNase H-
A cDNA was prepared by Reverse Transcriptase (GIBCO BRL), and a sense primer specific for MART-2 antigen [5'-CGCCTCTCTTTGCTGGTGGTGG
CTGGC-3 ': SEQ ID NO: 12] and antisense primer [5'-GTCGTAGCCGCCATGCCA]
GTAGCTCACA-3 ': SEQ ID NO: 13] at 94 ° C. for 2 minutes × 1 cycle, 94 ° C. for 30 seconds,
30 cycles of 62 ° C for 30 seconds, 72 ° C for 1 minute x 30 cycles, 7
PCR was performed at 2 ° C. for 7 minutes × 1 cycle. The PCR product (cDNA) obtained by these PCR was subjected to agarose gel electrophoresis (1.5%), stained with ethidium bromide (EtBr), and the band was detected by irradiation with ultraviolet light at 254 nm.

A-8 (MART by Northern blot)
-2 Expression analysis) Total R of tumor cell line and normal cell line extracted as described above
Northern blots for MART-2 were performed with NA or normal tissue RNA. These RNAs (5.5 μg each)
Was electrophoresed on an agarose gel containing formaldehyde, and filtered using a nylon membrane filter (Hybond N +, Amers
ham). Next, PCR was performed using a sense primer (SEQ ID NO: 12) and an antisense primer (SEQ ID NO: 13) specific to the MART-2 antigen, and a length of 40 min.
A 2 bp MART-2 gene fragment was prepared. The prepared gene fragment is used as a High Prime DNA Labeling Kit (Boehrin
ger) to give a probe labeled with ³² P and Qui
Using a ck Hyb solution (Stratagene) as a hybridization buffer, a nylon membrane filter was immersed therein, and prehybridization was performed at 68 ° C. for 20 minutes. Thereafter, hybridization was performed at 68 ° C. for 1 hour in a Quick Hyb solution to which the above probe was added. Then, the hybridized nylon membrane filter was washed with washing solution I (2 ×
The plate was washed twice with SSC (0.1% SDS) at room temperature for 15 minutes, and once with Wash Solution II (0.1 × SSC, 0.1% SDS) at 60 ° C. for 30 minutes. The washed nylon membrane filter was used to detect a radioactive signal using a Molecular Imager (BIORAD).

A-9 (Detection of Mutation by PCR-RFLP) 11 types of malignant melanoma cell lines including autologous tumor cell lines (SKm
el23, 888mel, A375, 1362mel,
1363mel, 928mel, 624mel, 586
mel, 526 mel, 501 mel, 397me
l), autologous T cell lines (1362TIL-1, 1362T)
Gene DNA or 8B6 cDNA of IL-2), human kidney cell line (293UT), monkey kidney cell line (COS-7), etc.
PCR-RFLP using 50 ng and the following primers
(Restriction Fragment Length polymorphism), and a mutant of clone 8B6 was detected.

The 8B6-specific forward primer (SEQ ID NO: 11) and the 8B6-specific reverse primer (base sequence complementary to the base sequence from 1385th to 1359th of MART-2 cDNA: 5'-CAGT
AGGTTTTCCCAACCTCATGGGGCC-
3 ': SEQ ID NO: 14) and 127 bp PCR
The product was amplified. The 8B6-specific reverse primer (SEQ ID NO: 14) was used to convert the G (guanine) at position 1361 of MART-2 cDNA into C By replacing A (adenine) at position 1363 with C (cytosine),
B6 has a mismatch design. 127b amplified from a template whose 1358th is G (guanine)
p product was 104bp and 23bp by ApaI.
Digested into two fragments. In addition, a forward primer (base sequence from position 1334 to position 1357 of MART-2 cDNA: 5'-TCCTGTTCCAACCT)
GGTATTTCTAG-3 ': SEQ ID NO: 15) and a reverse primer (nucleotide sequence complementary to the nucleotide sequence from position 1383 to position 1406 of MART-2 cDNA):
5'-CCTTGTATGAAGATCCTTATTCC
AG-3 ': SEQ ID NO: 16) was synthesized. The forward primer was prepared by substituting T (thymine) at position 1356 with A (adenine) to generate a restriction enzyme XbaI site (TCTA).
GA). 73 bp amplified from a template whose 1356th is A (adenine)
Was cut into two fragments of 20 bp and 53 bp by XbaI. Amplification using these primers was performed at 94 ° C. for 2 minutes × 1 cycle, 94 ° C. for 30 seconds, 62 ° C. for 30 seconds, 72 ° C. for 1 minute × 30 cycles, and 72 ° C. for 7 minutes × 1 cycle. And the resulting PCR product is digested with the restriction enzymes ApaI or XbaI (New England Bi
olabs Inc., Beverly, MA) at 37 ° C for 1 hour,
3% agarose gel (AmpliSize Agarose, Bio Rad,
(Hercules, CA, USA) to detect the mutant strain.

A-10 (SSCP analysis) An 8B6-specific forward primer (SEQ ID NO: 11) labeled at the 5 'end with the fluorescent dye FAM and an 8B6-specific reverse primer (MAR) labeled at the 5' end with HEX
Nucleotide sequence complementary to the nucleotide sequence from position 1379 to position 1406 of T-2 cDNA: 5'-CCTTGTAT
GAAGATCCTATTCCAGTAGG-3 ′: SEQ ID NO: 17) was synthesized, and PC was prepared using these primers.
The 148 bp DNA is amplified by the R method, and the SSCP (Si
ngle Strand Conformational Polymorphism) analysis was performed using various cell lines. 0.5 μl of size standard GS-500 (GeneScan-500; manufactured by PE Allied Biosystems), 0.5 μl of 0.3 N NaOH and 10.5 μl of deionized formamide were mixed with 1 μl of the obtained PCR product, and the mixture was mixed at 95 ° C. with 5 μl.
Heated for minutes and cooled on ice. This treated PCR product was subjected to gel [3% gel scan polymer, 1 × TBE (Trisbor
ate EDTA electrophoresis buffer) and a polymer containing 10% glycerol].
netic Analyzer (PE Applied Biosystems, Forster Cit
y, CA) under the conditions of 317 V / cm, 30 ° C., 30 minutes, and GeneScan software (http: // g).
enes.mit.edu/GENSCAN.html).

[0047] A-11 ⁽³⁵ S-GTPγS binding analysis) vector pcDNA3.1 (-), wild-type MART-2 and mutant MART-2 cDNA and 10μg respectively introduced CO
S-7 cells (1 × 10 ⁶ cells) were mixed with 1 mM DTT and protease inhibitor mixture Complete ™ (Roch
e Molecular Biochemicals) [50 mM Hepes-KOH (pH 7.8), 42
0 mM KCl, 0.1 mM EDTA (pH 8.0
0) Suspended in 1 ml of 5 mM MgCl ₂ ] and dissolved by passing current through a 25-gauge electric needle 10 times. The lysate was centrifuged to remove insolubles. 30 μg of the obtained whole cell extract was added to the reaction mixture [20 mM He
pes-KOH (pH 7.8), 1 mM EDTA, 5
mM MgCl ₂ , 2.5 mM DMPC (L-α-dimyri
stoyl phosphatidylcholine), 0.3% CHAPS
(3-[(3-cholamidopropyl) dimethylammonio] -1-propan
esulfonic acid), ³⁵ S-GTPγS of 1mM] 40μ
and incubated at 30 ° C. for 2 hours. After incubation, stop buffer [25 mM Mg
Cl _2, 100 mM of NaCl, 20 mM of Tris-
HCl (pH 8.0)] was added to stop the reaction. The reaction solution was filtered with a nitrocellulose filter, and the filter was washed 5 times with a stop buffer. Then, the filter was placed in a 10 ml toluene scintillator, and radioactivity was measured.

A-12 (NIH3T3 Transformation Analysis) 10 μg each of HST-1 cDNA and vector pcDNA3.1
(-) Plasmid DNA, wild-type MART-2 cDNA
Alternatively, mutant MART-2 cDNA was mixed with 65 μg of salmon sperm DNA, and the DNA was introduced into 5 × 10 ⁵ NIH3T3 cells on a 10 cm tissue culture dish by the calcium phosphate method (Mol Cell Biol 4, 1695, 1984). .
After culturing for 24 hours, the cells are divided into three 10 cm culture dishes and 5%
Were cultured in a DMEM medium containing calf serum for 3 weeks.

A-13 (Identification of Epitope Peptide Recognized by TIL1362) Eight kinds of cDNAs [8B6 T
1 (base sequence from 1st to 307th of 8B6 cDNA), 8B6 T2 (3rd to 3rd from 8B6 cDNA)
Base sequence up to the 99th position), 8B6 T3 (8B6cD
Base sequence from 1st to 664th of NA), 8B6
T4 (base sequence from 1st to 730th of 8B6 cDNA), 8B6 T5 (base sequence from 1st to 1003th of 8B6 cDNA), 8B6 T6 (8B6
Base sequence from the 1st to the 1341st of 6cDNA), 8B6 T7 (1st to 14th of the 8B6 cDNA)
Base sequence up to the 07th), 8B6 T8 (8B6cD
Base sequence from 1st to 1446th of NA)]. In addition, as a sense primer, 8B6cD
Nucleotide sequence from 1st to 20th of NA: 5'-CG
GCCGCGGTGAACGTTGCC-3 '(SEQ ID NO: 18);
Primers each having a base sequence complementary to the 20 base sequences from the 3 'end of the cDNA whose ends were sequentially deleted were synthesized, and used to amplify the above nine types of cDNA.

The various cDNAs described above were used in the literature (J. Immunol. 15).
4, 3961, 1995) and cloned into pcDNA (manufactured by Invitrogen) and transferred to COS7 cells by HLA.
The gene was introduced and expressed together with -A1 cDNA, the recognition of TIL1362 was examined, and the region where the epitope was present was estimated.
In the estimated region, the HLA-A1 binding motif (9
-12 amino acids in length, the third is a negatively charged amino acid,
The peptide having a C-terminal tyrosine) was subjected to F-m analysis using an AMS222 multiple peptide synthesizer (Gilson).
It was synthesized by the oc method. The synthesized peptide was 0.05
% Of trifluoroacetic acid and acetonitrile using a C8 column (VYDAC, Hesperia, CA; purification rate 9).
R2 reverse phase HPLC column (PerSepti
ve Biosystems, Framingham, MA) and confirmed by mass spectrometry. In addition, the above HLA-A1cDN
The synthesized peptide is added to COS7 cells into which A has been introduced,
The release of INFγ from TIL1362 was measured and the recognition of the peptide by T cells was examined (Kawakami Y., et al.
al: Identification of New Melanoma Epitopes on Mel
anosomal Proteins Recognized by Tumor Infiltrating
T Lymphocytes Restricted by HLA-A1, -A2 and -A3 a
lleles. Journal of Immunology 161: 6985, 1998.).

Example B [Results] B-1 (Recognition of a novel common malignant melanoma antigen by HLA-A1-restricted TIL1362) Determination of HLA-restriction and examination of recognition of known antigen by the method described in Example A-3 Was done. Table 1 shows the results. From these results, TIL1362 was tested for the HLA-A1-positive malignant melanoma cell lines (1362mel, SKmel23,
397 mel), but HLA-A1-negative malignant melanoma cell lines (624 mel, 526 mel) and HLA
-A1 cDNA-introduced COS cells, HLA-A1cDN
A non-transfected COS cells were not recognized. Also, HLA-A1-negative malignant melanoma cells (526 mel)
When HLA-A1 cDNA is introduced into TIL1362, TIL1362 recognizes this cell.
It was thought that A-A1 restriction recognized a common malignant melanoma antigen. In addition, TIL1362 contains five known melanoma antigens (MART-1, gp100, tyrosinase, T
RP1, TRP2) was not recognized, indicating the possibility of recognizing a novel antigen.

[0052]

[Table 1]

B-2 (Isolation of Malignant Melanoma Antigen cDNA Recognized by TIL1362) Autologous tumor cell line 136 by the method described in Example A-4.
A cDNA library was prepared from 2mel and this cD
The NA library was prepared as described in Example A-5 using HLA-
Introduced into COS7 cells together with A1 cDNA,
COS7 cells expressing NA were screened with TIL1362. As a result, four strongly positive cells (7F12, 8A12, 8B6, 8E12) and four weakly positive cells (7A4, 7A11, 7E8, 8A) out of the approximately 800 cDNA pool (approximately 8 × 10 ⁴ cDNA).
6) was identified. Eighty colonies derived from each positive cDNA pool were rescreened with TIL1362 and three positive cells from pool 8B6 were pooled into pool 7F1
Two to five positive cells were identified. These eight positive cells contained a similar 1552 kb cDNA. 1552 believed to encode this tumor antigen
bp cDNA (8B6) was isolated and
COS7 cells into which LA-A1 cDNA has been introduced are
The amount of IFN-γ recognized and released by
It was measured by the SA method. For comparison, the various cell lines shown in Table 2 and the transformed COS7 cells
The amount of FN-γ released was measured. Table 2 shows the results. From Table 2, it was confirmed that this cDNA (8B6) was a cDNA encoding a melanoma antigen.

[0054]

[Table 2]

B-3 (Isolation of full-length cDNA and its structure) To isolate the full-length cDNA of 8B6 obtained above,
Po extracted from 1362mel and SKmel23 cell lines
Using lyA + RNA, 5'-, 3'- described in Example A-6 was used.
The RACE method was performed according to the method described in Example A-6. From the 1362mel strain, a 3587 bp full-length cD
NA was obtained (see FIG. 1). 5 'of the start codon ATG
The presence of the Kozak sequence and the termination codon in the flanking sequence indicated that this cDNA encodes a protein consisting of 453 amino acids. In addition, this protein was converted to MART-2 (Melanoma Antigen Recognize).
d byT cella-2). On the other hand, from the SKmel23 strain, the 1358th base of MART-2 was replaced with A (adenine) to G (guanine), 195 bases were inserted between 483 and 484 bases, and the sequence at the 5 'side from the 167th base was inserted. As a result, a 3728 bp full-length cDNA having an approximately 1.2 kb fragment was obtained (see FIG. 2).
A frame analysis of this cDNA showed the presence of an ORF (Open Reading Frame) of 518 amino acids. The insertion of the above 2195 bases inserted 65 amino acids without causing a frame shift, and the substitution of A (adenine) at position 1358 with G (guanine) caused an amino acid substitution from glutamic acid to glycine.

When a homology search was performed with the Genbank database, a homologous cDCD was obtained from a library prepared from the NT2 teratocarcinoma cell line.
NA (Accession No .: AK001586) was found. In this nucleotide sequence, in addition to the substitution at position 1358, the base at position 1363 was substituted from A (adenine) to G (guanine) (amino acid substitution from asparagine to aspartic acid). ) And 19 between bases 483 and 484.
5 bp was inserted, and 180 bases from the 1407th to the 1586th were deleted (see FIG. 2). Other, first
A nucleotide sequence homologous to the q32 region on the chromosome (AL0
35414, AL034351). Comparison of the two separated cDNAs with the cDNA on the database and genomic DNA (see FIG. 2A) revealed that the 195 bp insertion was due to alternative splicing. Also, differences in the structure between the amino acid sequences of the three identified proteins were confirmed (FIG. 2B;
a is 1362 mel, b is SKmel23, c is NT2
Teratocarcinoma).

B-4 (Expression of MART-2) The expression of the MART-2 gene was examined by the RT-PCR method described in Example A-7 and the Northern blot method described in A-8. The MART-2 gene is a human melanoma cell line (SKmel23, 888mel, 1362m
el, A375, 928mel, 624mel, 586
mel, 526 mel, 397 mel, 1363me
l), human glioma cell line (U87-MO, T98
G), lung cancer cell lines (K1S, LU99, LK2, EBC
1, SBC2, RERF-LCMA), esophageal cancer cell lines (TE8, TE10), bladder cancer cell lines (KU7, BC4
7), kidney cancer cell lines (RCC6, RCC7, RCC
8), prostate cancer cell line (JCA1, PC3), breast cancer cell line (MDA231, HS578), liver cancer cell line (Hep
G2), leukemia cell lines (HL60, K562, Molt
4), in addition to cancer cell lines of Burkitt's lymphoma cell line (Daudi) and pancreatic cancer cell lines (PK1, PK59), normal tissues (brain, lung, heart, spleen, liver, small intestine, large intestine, kidney, muscle, placenta, Stomach, testis) and normal cell lines (melanocytes, T
Cells, fibroblasts). This indicates that the MART-2 antigen is ubiquitously expressed.

B-5 (Detection of Mutation Occurring in Phosphate Binding Motif of MART-2) Whether substitution of A (adenine) at position 1358 with G (guanine) is due to genetic polymorphism, To determine whether the mutation occurred in a tumor, a self-normal cell line (TIL
1362) and 11 malignant melanoma cell lines including an autologous tumor cell line (1362 mel) were subjected to the PCR-RFLP method described in Example A-9 (FIG. 3). from this result,
Even when a restriction enzyme XbaI that cleaves when the 1358th base is A (adenine) or a restriction enzyme ApaI that cleaves when the base is G (guanine) is used, the chromosome DN of the autologous tumor cell can be used.
It was found that the PCR product amplified from A was cleaved, but the PCR products amplified from normal cells and other malignant melanoma cells were cleaved only by ApaI. From these results, the 1358th A (adenine) is 1362 m
It was shown to be a mutation that occurred specifically in the tumor cell of e.

In addition, this tumor-specific mutation causes an amino acid substitution from glycine to glutamic acid.
loop): GXXXXXXGKT; Trends Biochem Sci 15, 4
30, 1990] is believed to be broken. In addition, the NT2 teratocarcinoma cell line cDNA obtained by homology search from the gene database had another mutation with an amino acid substitution in P-loop. Then PART of MART-2
The presence or absence of a mutation in the “op” was screened by the SSCP method described in Example A-10. 11 melanoma cell lines (SKmel23, 888mel, 1362)
mel, A375, 624mel, 926mel, 58
6mel, 526mel, 397mel, 501Ame
1, 1363 mel), 20 kinds of various tumor cell lines (U87
-MO, T98G, TE8, TE10, K1S, LU9
9, LK2, EBC1, SBC2, RERF-LCM
A, KU7, RCC6, RCC7, RCC8, PK1,
PK59, PC3, HS578, MDA231, Hep
G2), three hematopoietic tumor cell lines (HL60, K562,
Molt 4) and two normal cell lines (T cells, melanocytes), a total of 36 cell lines were examined, and a further different mutation (from A base to G
Base, serine from aspartic acid was found (Table 3)
reference). However, NT2 and EBC1 could not be confirmed as tumor-specific mutations because normal patient cells were not available.

[0060]

[Table 3]

B-6 (GTP by mutation of MART-2)
Reduction of binding activity) Non-hydrolyzable radiolabeled GTP ( ³⁵ S-GTPγS)
Was used to measure the GTP binding activity of wild-type and mutant MART-2 by the method described in Example A-11. Fig. 4 shows the results.
Shown in In the whole cell extract prepared from the COS-7 cells into which the mutant MART-2 was introduced, the amount of GTP bound was smaller than that of the wild-type MART-2. It was shown to cause a decrease in binding activity. Also, the ras gene, which is an oncogene, is known to have tumorigenicity by causing mutation in P-loop (Annu R
evBiochem 56, 779, 1987). Then, Example A-12
The wild type and mutant type MART-2 cDNA, the negative control (vector pcDNA3.1), and the positive control (HST-1 cDNA) were used for NIH3
When the cells were introduced into T3 cells and examined for the presence or absence of the transforming activity, no remarkable transforming activity was found in the mutant MART-2. Table 4 shows the results.

[0062]

[Table 4]

B-7 (Identification of Epitope Peptide) In order to estimate the region where the epitope is present on the isolated 8B6 cDNA, an 8B6 cDNA fragment having eight 3'-terminal deletions as described in Example A-13 [5B6 T
1, 5B6 T2, 5B6 T3, 5B6 T4, 5B6
T5, 5B6 T6, 5B6 T7, 5B6 T8] and prepare them together with HLA-A1 cDNA in COS7.
Introduced into cells, and TIL1362 of these COS7 cells
By IFNγ assay. Table 5 shows the results. From this result, 1407 bp cDNA
(5B6 T7) positive, 1341 bp cDN
A (5B6 T6) and all cDNAs that have undergone further deletion [5B6 T1, 5B6 T2, 5B6 T3, 5B6 T
4, 5B6 T5]. In addition, an amino acid sequence compatible with the HLA-A1 binding motif (9 to 12 amino acids, the third being a negatively charged amino acid and the C-terminal amino acid being tyrosine) was searched, and eight types of peptides serving as antigen epitope candidates were synthesized.

[0064]

[Table 5]

The eight candidate peptides synthesized above [NE
VGKTY, GNEVGKTY, EGNEVGKTY,
LEGNEVKKTY, FLEGNEVGKTY, VF
LEGNEVKKTY, LVFLEGNEVGKTY,
TIL136 to NLVFLEGNEVGKTY]
2 was considered (FIG. 5). From these results, the peptide FLEGN consisting of 11 amino acids represented by SEQ ID NO: 4
EVGKTY has the lowest peptide concentration at TIL1362
This peptide chain is recognized by TIL136
2 epitopes. Since this identified epitope peptide contained a tumor-specific mutation, the recognition of TIL1362 for the peptide FLGGNEVGKKTY substituted with a wild-type amino acid was examined (FIG. 6). As a result, TIL1362
Did not recognize the wild-type peptide, so TIL1
362 was suggested to recognize a mutant peptide present only in the self-tumor. However, TIL1362 is H
Since it also recognizes and reacts with heterologous malignant melanoma having LA-A1, it is considered that there is a common antigen that has not been isolated.

It has been known in the past that mutations in molecules that are important for the development and growth of cancer are simultaneously immunogenic, and as described above, specific mutations in one melanoma cell line And the malignant melanoma antigen MART-2, for which the mutation has been shown to be immunogenic,
It is very likely that it is a functional molecule that is involved in the development of cancer. Mutation of MART-2 was suggested at least in other cancer cell lines (lung cancer, teratoma), that it is a GTP-binding protein that is an important component of the intracellular signaling system, and the mutation is signal transduction A possible effect on function may indicate that the gene mutation is common in cancer. Thus, MART-2 can be regarded as an antigen protein that can be expected to be general as a molecule having both functional importance and immunogenicity, and may be a target molecule for cancer diagnostics and therapeutics. Is big.

[0067]

According to the present invention, it is possible to provide peptides or proteins having physiologically important malignant melanoma antigen activity, particularly T cell epitopes, and DNAs encoding them. Further, these malignant melanoma antigens, particularly T cell epitopes and DNAs encoding them are useful for treatment and diagnosis of various cancers, and can be used for screening for substances that promote or suppress immunity-inducing activity.

[0068]

[Sequence List] SEQUENCE LISTING <110> KEIO UNIVERSITY The United States of America <120> Human Malignant Melanoma Antigens <130> 000000099 <140> <141> <160> 18 <170> PatentIn Ver. 2.1 <210> 1 <211 > 4159 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (218) .. (1579) <400> 1 crbbgggctg cgctgctcct ccaaagggca gctccggggg aaagagggtg gcgtgcggg gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcggcgcggcggcggcggcggcgcgcgcgcgcgcgcgcgcgcgcggcgcggcgggcgggcggcggggcgggcgggggggggggggggggggggggggggggg.com. gccgccgccc gggacagccc ggagaaactc 180 tcagcgtagg catcgggaac cttcgtgcca aggagcc atg ctg ccc cga tgg gaa 235 Met Leu Pro Arg Trp Glu 1 5 ctg gca ctt tac cta ctt gcc tca c Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tc Lec Tac Lec Tc Lec Tac Lec Tc Lec Tac Lec Tac Lec Tac Lec Tac Lec Tac Lec Tc Lec Tac Lec Tac Lec Tac Lec Tc Lec Tc Lec Tc Lec Tc Lec Tc Lec Tc Lec Tac Lec Phe His Phe Tyr Ser Phe 10 15 20 tat gaa gtt tac aaa gtc tcc aga gaa cac gaa gag gag ctg gac cag 331 Tyr Glu Val Tyr Lys Val Ser Arg Glu His Glu Glu Glu Leu Asp Gln 25 30 35 gaa ttt gag ctg gag act gac act tta ttt gga gga tta aag aag gat 379 Glu Phe Glu Leu Glu Thr Asp Thr Leu Phe Gly Gly Leu Lys Lys Asp 40 45 50 gcg acc gac ttt gag tgg agc ttc tgg atg gaa tgg ggg aag cag tgg 427 Ala Thr Asp Phe Glu Trp Ser Phe Trp Met Glu Trp Gly Lys Gln Trp 55 60 65 70 ctg gtg tgg ctt ctc ctt ggc catg gta tct caa atg gcc aca 475 Leu Val Trp Leu Leu Leu Gly His Met Val Val Ser Gln Met Ala Thr 75 80 85 ctg ctg gca aga aag aga agg tgg tac aag aca gaa aat gag tac tac 523 Leu Leu Ala Arg Lys Arg Arg Trp Tyr Lys Thr Glu Asn Glu Tyr Tyr 90 95 100 ctg ctg cag ttc acg ctg acc gtt cgc tgc ctc tac tac acc agc ttc 571 Leu Leu Gln Phe Thr Leu Thr Val Arg Cys Leu Tyr Tyr Thr Ser Phe 105 110 115 agc ctg gag ctc cgc tgg cag cag ctg cct gct gca tcg acc tcc tac 619 Ser Leu Glu Leu Arg Trp Gln Gln Leu Pro Ala Ala Ser Thr Ser Tyr 120 125 130 tcc ttt ccc tgg atg ctg gcc tat gtc ttt tat tat cca gtc tta cac Ser Phe Pro Trp Met Leu Ala Tyr Val Phe Tyr Tyr Pro Val Leu His 135 140 145 150 aat ggg ccc atc ctc agc ttc tcg gag ttc atc aaa cag atg cag cag 715 Asn Gly Pro Ile Leu Ser Phe Ser Glu Phe Ile Lys Gln Met Gln Gln 155 160 165 cag gag cat gac tcc ctg aag gcc agc ctg tgt gtc ctg gcc ctg ggg 763 Gln Glu His Asp Ser Leu Lys Ala Ser Leu Cys Val Leu Ala Leu Gly 170 175 180 ctg ggc cgc ctt ctt tgc tgg tgg tgg gag ctg atg gct cac 811 Leu Gly Arg Leu Leu Cys Trp Trp Trp Leu Ala Glu Leu Met Ala His 185 190 195 ctg atg tac atg cat gcc atc tac agc agc atc ccc ctc ctg gag act 859 Leu Met Tyr Metyr Ala Ser Ser Ile Pro Leu Leu Glu Thr 200 205 210 gtc tct tgt tgg acc tta gga gga ctg gcg tta gcc cag gtg ctc ttt 907 Val Ser Cys Trp Thr Leu Gly Gly Leu Ala Leu Ala Gln Val Leu Phe 215 220 225 230 ttc tac gtg aag tac ttg gtg ctc ttt ggc gtg cct gct ctg ctc atg 955 Phe Tyr Val Lys Tyr Leu Val Leu Phe Gly Val Pro Ala Leu Leu Met 235 240 245 cgc ctg gat gga ctc act cca ccc gcc ctc ccc gc ctcgcc 1003 Arg Leu Asp Gly Leu Thr Pro Pro Ala Leu Pro Arg Cys Val Ser Thr 250 255 260 atg ttc agt ttc acc ggg atg tgg agg tat ttt gat gtt gga ctg cat 1051 Met Phe Ser Phe Thr Gly Met Trp Arg Tyr Phe Asp V al Gly Leu His 265 270 275 aat ttc tta atc agg tat gtg tac att cca gtg ggc ggg tcc cag cat 1099 Asn Phe Leu Ile Arg Tyr Val Tyr Ile Pro Val Gly Gly Ser Gln His 280 285 290 ggc ctg ctg ggg acact tcc acg gcg atg aca ttt gca ttt gtg 1147 Gly Leu Leu Gly Thr Leu Phe Ser Thr Ala Met Thr Phe Ala Phe Val 295 300 305 310 agc tac tgg cat ggc ggc tac gac tac ctc tgg tgc tgg gca gcg ctc 1195 Ser His Gly Gly Tyr Asp Tyr Leu Trp Cys Trp Ala Ala Leu 315 320 325 aac tgg ctg gga gtc act gtg gag aat gga gtc cgg agg ctg gtg gag 1243 Asn Trp Leu Gly Val Thr Val Glu Asn Gly Val Arg Arg Leu Val G330 335 340 act ccc tgc atc cag gac agt ctg gcc cga tac ttc tcc cca caa gct 1291 Thr Pro Cys Ile Gln Asp Ser Leu Ala Arg Tyr Phe Ser Pro Gln Ala 345 350 355 cgc cgt cga ttc cac gct gcc ctt gct tct tgt acc tcg atg ctg 1339 Arg Arg Arg Phe His Ala Ala Leu Ala Ser Cys Ser Thr Ser Met Leu 360 365 370 atc ctg tcc aac ctg gta ttt ctt gag ggc aat gag gtt ggg aaa acc 1387 Ile Leu Ser Asn Leu Val Phe Le u Glu Gly Asn Glu Val Gly Lys Thr 375 380 385 390 tac tgg aat agg atc ttc ata caa gga ggt tta ttt tta ttt ttt tta 1435 Tyr Trp Asn Arg Ile Phe Ile Gln Gly Gly Leu Phe Leu Phe Phe Leu 395 400 405ct aat cca tgt tgg gag aca gca ttc cag ggc ttt cct gtg ttt ctg 1483 Leu Asn Pro Cys Trp Glu Thr Ala Phe Gln Gly Phe Pro Val Phe Leu 410 415 420 cat ttc tta caa aca gag gta ctg gct acc ttt gtt ccc aactat ttt 1531 His Phe Leu Gln Thr Glu Val Leu Ala Thr Phe Val Pro Asn Tyr Phe 425 430 435 tcc tgg aat att tgt ata gaa aac acc tcc gaa ttg tcc agc tac taa 1579 Ser Trp Asn Ile Cys Ile Glu Asn Thr Ser Glu Leu Ser Ser Tyr 440 445 450 gcagcaatat caggctggcc ttgggtgacc ctctctgtcc tgggattcct gtactgctac 1639 tcccacgtgg gcattgcctg ggcccagacc tacgccacgg actaatgctg ttgggcccag 1699 gccagtcctt gttgctggcc tccaaggcaa atagtgcttc accctaacct ctcactccag 1759 gacagcctct aagggatttg atctgctcat cttcagttga atgccctcac tccaagactg 1819 gatgctggat ctcatagaaa attcacagcc agacaatctt ctaatctgga gtctttgaga 1879 tcttctaccc caactca tca ttttcctatt gaggaaacgg gtccagggca gtcgtgtgtc 1939 ttacccagtt acacagggtg acattttggt ctagaaccta gtctcatgag ccctttgcat 1999 tctttcccct taagcaagaa tagaatgtag tggaaattta ttgattgaga cacagaaatc 2059 ctgattagtg ataggcctgt cttctgggca atatttctaa aatatttgag tgacattgat 2119 gtttaagtga cctccttcat cacatcctgc agtatctcca gaagcagcac tagggtttga 2179 gtttcatgct tcagcccctc tgtaggaatg agaccaagcc acagctgtct tttgaattac 2239 gtagtcgaag aagacggtag cagccctgta gcattctaag gcatctatac ccaaggagtc 2299 ctgtgatctg agcttcagca gggtgatcta catttgggtg cttgtttctg agatttgcag 2359 agaagtataa catggtagtt cctctacctt acagttaatc gtttcttaat aaagaagcag 2419 aatttagaaa ccacaggata gtgtacccac agatgggtgt tatcaaggcc agtcatgagg 2479 atggtgtcct ggagtcttgt ccaccctctc catacaagtc tcaaaagtca tcctcctact 2539 cagtgattca cgtttagtgg tttatattat taaggtttga ttcaaacaga gccttttctg 2599 tcctgtagat aatctacatg tttgtagaat tattttgaat atgtttgagg aaaatgttta 2659 aaatctaaat atactcacat aacttgatta ttcactcctc tgaaaagatg ctggataggc 2719 taccaaagtt cccaagtggt ag ataattca gaagacttgt ttgaatttgg attttttttt 2779 tttttggagt ggggaagggt ataaaggagg cttaaaattt gaatccataa tatatctaat 2839 tacaggagaa tttacaacat ctcaagtacg taaattaagt tgtcattgag tgaaaggttc 2899 acttggacct agtgctgcct cctgtttatt acatagcatg gcccttatgt cttgagttga 2959 ggttatcatc tcaatgaggc tttagctcct agagtacagg accattttgt tgattgtctt 3019 tcttcatagc ttctctgctt ggcaaagaga tgggaggggg ccagatactg actacctggg 3079 gtaggcacat tatgtgttaa agcaagacag aggccagaga ggggcaggta gacctgcata 3139 gcagcagcct cagcagctgt cttggtaaag gagagagaga gacatggggc cagtaattcc 3199 ggggtgctca gaagttttag gaggggatga gcctcaggga ggagtgagca cctaaatgaa 3259 cgcagtaaac cttcatggac caacagtgat tgaggatttg tgggcagcca gagggagtct 3319 gactgaagtt tacttggaaa gaaagggctt gctaagaaaa aagggagtaa aaatgatgat 3379 agggaagtgt ctaatgtatg tgcacatata agtaatacaa aagttttgag ctcttccaag 3439 tataccattt atatacaaac aaataggttt attcattcat taaactactt tggaagcgtc 3499 agtggatata tttgaaagtg gtaatcctga atctctttta aactattata tgattcataa 3559 tggttctcag gaattaataa atgattac tg tgtttccany ncmhnhakkb gcmvsrcsnc 3619 martmddcwg tmsnwrmans ymbaragcnt ryshacdbct gcgctgctcc tccaaagggc 3679 agctccgggg gaaagagggt ggcgtcccgg ggaagcccgc agccgccgcc gatgtcgctg 3739 ggactcggaa gtgccgaaag aggggtgttg ggaactcgmv srmvsrhdth tctgcgctgc 3799 tcctccaaag ggcagctccg ggggaaagag ggtggcgtcc cggggaagcc cgcagccgcc 3859 gccgatgtcg ctgggactcg gaagtgccga aagaggggtg ttgggaactc gtgcmvsrtc 3919 cmvnrmarmv srtccvmcrs twrdgadhkm srctgcgctg ctcctccaaa gggcagctcc 3979 gggggaaaga gggtggcgtc ccggggaagc ccgcagccgc cgccgatgtc gctgggactc 4039 ggaagtgccg aaagaggggt gttgggaact cgttdgdanc dada * rtntr ytabwrddcm 4099 ntsmmarynr matndcmnts mmarynrmat ncmbbctmcr stwrdmswrd dcwrddsmon2400 <11> Pr <T> Tyr Leu Leu Ala Ser Leu Gly 1 5 10 15 Phe His Phe Tyr Ser Phe Tyr Glu Val Tyr Lys Val Ser Arg Glu His 20 25 30 Glu Glu Glu Leu Asp Gln Glu Phe Glu Leu Glu Thr Asp Thr Leu Phe 35 40 45 Gly Gly Leu Lys Lys Asp Ala Thr Asp Phe Glu Trp Ser Phe Trp Met 50 55 60 Glu Trp Gly Lys Gln Trp Leu Val Trp Leu Leu Leu Gly His Met Val 65 70 75 80 Val Ser Gln Met Ala Thr Leu Leu Ala Arg Lys Arg Arg Trp Tyr Lys 85 90 95 Thr Glu Asn Glu Tyr Tyr Leu Leu Gln Phe Thr Leu Thr Val Arg Cys 100 105 110 Leu Tyr Tyr Thr Ser Phe Ser Leu Glu Leu Arg Trp Gln Gln Leu Pro 115 120 125 Ala Ala Ser Thr Ser Tyr Ser Phe Pro Trp Met Leu Ala Tyr Val Phe 130 135 140 Tyr Tyr Pro Val Leu His Asn Gly Pro Ile Leu Ser Phe Ser Glu Phe 145 150 155 160 Ile Lys Gln Met Gln Gln Gln Glu His Asp Ser Leu Lys Ala Ser Leu 165 170 175 Cys Val Leu Ala Leu Gly Leu Gly Arg Leu Leu Cys Trp Trp Trp Leu 180 185 190 Ala Glu Leu Met Ala His Leu Met Tyr Met His Ala Ile Tyr Ser Ser 195 200 205 Ile Pro Leu Leu Glu Thr Val Ser Cys Trp Thr Leu Gly Gly Leu Ala 210 215 220 Leu Ala Gln Val Leu Phe Phe Tyr Val Lys Tyr Leu Val Leu Phe Gly 225 230 235 240 Val Pro Ala Leu Leu Met Arg Leu Asp Gly Leu Thr Pro Pro Ala Leu 245 250 255 Pro Arg Cys Val Ser Thr Met Phe Ser Phe Thr Gly Met Tr p Arg Tyr 260 265 270 Phe Asp Val Gly Leu His Asn Phe Leu Ile Arg Tyr Val Tyr Ile Pro 275 280 285 Val Gly Gly Ser Gln His Gly Leu Leu Gly Thr Leu Phe Ser Thr Ala 290 295 300 Met Thr Phe Ala Phe Val Ser Tyr Trp His Gly Gly Tyr Asp Tyr Leu 305 310 315 320 Trp Cys Trp Ala Ala Leu Asn Trp Leu Gly Val Thr Val Glu Asn Gly 325 330 335 Val Arg Arg Leu Val Glu Thr Pro Cys Ile Gln Asp Ser Leu Ala Arg 340 345 350 Tyr Phe Ser Pro Gln Ala Arg Arg Arg Phe His Ala Ala Leu Ala Ser 355 360 365 Cys Ser Thr Ser Met Leu Ile Leu Ser Asn Leu Val Phe Leu Glu Gly 370 375 380 Asn Glu Val Gly Lys Thr Tyr Trp Asn Arg Ile Phe Ile Gln Gly Gly 385 390 395 400 400 Leu Phe Leu Phe Phe Leu Leu Asn Pro Cys Trp Glu Thr Ala Phe Gln 405 410 415 Gly Phe Pro Val Phe Leu His Phe Leu Gln Thr Glu Val Leu Ala Thr 420 425 430 Phe Val Pro Asn Tyr Phe Ser Trp Asn Ile Cys Ile Glu Asn Thr Ser 435 440 445 Glu Leu Ser Ser Tyr 450 <210> 3 <211> 33 <212> DNA <213> Homo sapiens <400> 3 tttcttgagg gcaatgaggt tgggaaaacc tac 33 < 210> 4 <211> 1 1 <212> PRT <213> Homo sapiens <400> 4 Phe Leu Glu Gly Asn Glu Val Gly Lys Thr Tyr 1 5 10 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: Marathon cDNA adaptor 1 <400> 5 ctaatacgac tcactatagg gctcgagcgg ccgcccgggc aggt 44 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Adapter Primer 1 <400> 6 ccatcctaat acgactcact atagggc 27 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 8B6 cDNA specific reverse primer <400> 7 gtcgtagccg ccatgccagt agctcaca 28 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 8B6 cDNA specific forward primer <400> 8 cgccttcttt gctggtggtg gctggc 26 <210> 9 <211> 23 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: nested Adapter Primer 2 <400> 9 actcactata gggctcgagc ggc 23 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220 > <223> Description of Artificial Sequence: nested 8B6 cDNA specific reverse primer <400> 10 gtaagaaatg cagaaacaca ggaaggcc 28 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: nested 8B6 cDNA specific forward primer <400> 11 tggcccgata cttctcccca caa 23 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: MART-2 cDNA specific sense primer < 400> 12 cgccttcttt gctggtggtg gctggc 26 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: MART-2 cDNA specific antisense primer <400> 13 gtcgtagccg ccatgccagt agctcaca 28 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 8B6 cDNA specific reverse primer <400> 14 cagtaggttt tcccaacctc atgggcc 27 <210> 15 <211> 24 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: forward primer <400> 15 tcctgtccaa cctggtattt ctag 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: reverse primer <400> 16 ccttgtatga agatcctatt ccag 24 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 8B6 cDNA specific reverse primer <400> 17 ccttgtatga agatcctatt ccagtagg 28 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Sense Primer <400> 18 cggcgcgcgt gaacgttgcc 20

[Brief description of the drawings]

FIG. 1 shows the MART-2 cDNA of the present invention and the amino acid sequence.

FIG. 2 is a diagram showing the gene and protein structure of the MART-2 antigen of the present invention.

[FIG. 3] MART- of the present invention by PCR-RFLP method
FIG. 9 is a diagram showing detection results of mutation 2.

FIG. 4 is a graph showing the results of a decrease in GTP binding activity due to a mutation of MART-2 of the present invention.

FIG. 5 shows the results of identifying MART-2 (epitope) of the present invention using HLA-A1-restricted T cells.

FIG. 6 is a view showing the results of comparison between MART-2 (epitope) of the present invention and wild type using HLA-A1 restricted T cells.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 19/00 C12N 1/15 4C084 C12N 1/15 1/19 4H045 1/19 1/21 1/21 C12P 21/08 5/10 C12Q 1/02 5/06 1/68 A C12P 21/08 G01N 33/15 Z C12Q 1/02 33/50 Z 1/68 33/53 D G01N 33/15 33/566 33 / 50 33/574 A 33/53 33/577 B 33/566 33/68 33/574 C12N 15/00 ZNAA 33/577 5/00 A 33/68 BE (72) Inventor Hiroshi Kawakami Kanagawa, Yokohama, Kanagawa Prefecture 757-120 Katakura-cho, Ward (72) Inventor Rosenberg, Steven A 20854, Maryland, United States, Potomac, Iron Gate Road 10104 F-term (reference) 2G045 AA26 AA29 AA34 AA35 AA40 BB20 CA18 CB01 CB17 DA12 DA13 DA14 DA36 DA78 FB02 FB03 FB07 4B024 AA01 AA11 BA36 CA01 CA04 CA09 CA11 DA02 EA04 GA11 HA01 HA12 4B063 QA01 QA18 QA19 QQ08 QQ13 QQ79 QQ91 QR32. 4C084 AA16 BA44 NA14 ZB031 ZB032 ZB081 ZB082 ZB091 ZB092 ZB211 ZB212 4H045 AA11 BA10 CA41 DA75 DA76 DA86 EA28 EA51 FA72 FA73 FA74 HA05

Claims (42)

[Claims] 1. A DNA encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; Active protein 2. A DNA comprising the base sequence shown in SEQ ID NO: 1 or a sequence complementary thereto and a part or all of these sequences. 3. A DNA that hybridizes with the DNA of claim 2 under stringent conditions and encodes a protein having immunity-inducing activity. 4. A protein comprising the amino acid sequence shown in SEQ ID NO: 2. 5. A protein comprising an amino acid sequence shown in SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. 6. A peptide comprising a part of the protein according to claim 4 and having immunity-inducing activity. 7. The peptide according to claim 6, wherein the peptide has an amino acid sequence represented by SEQ ID NO: 4. 8. A fusion protein or fusion peptide in which the protein according to claim 4 or 5 or the peptide according to claim 6 or 7 is linked to a marker protein and / or a peptide tag. 9. An antibody that specifically binds to the protein or peptide according to any one of claims 4 to 8. 10. The antibody according to claim 9, wherein the antibody is a monoclonal antibody. 11. A recombinant protein or peptide to which the antibody according to claim 9 or 10 specifically binds. A host cell comprising an expression system capable of expressing the protein or peptide according to any one of claims 4 to 8 or claim 11. 13. A non-human animal, wherein the function of a gene encoding the protein or peptide according to any one of claims 4 to 8 or 11 is deficient on a chromosome. 14. A non-human animal, which overexpresses the protein or peptide according to any one of claims 4 to 8 or claim 11. 15. The non-human animal according to claim 14, wherein the non-human animal is a mouse or a rat. 16. Using a test substance, any one of claims 4 to 8 or the protein or peptide according to claim 11, and a T cell, measuring and evaluating the immunity-inducing activity of the T cell. A method for screening for a substance that promotes or suppresses immunity inducing activity. 17. Use of a test substance, the host cell according to claim 12, and a T cell to measure and evaluate the immunity-inducing activity of the T cell. Screening method. 18. A method for measuring and evaluating immunity-inducing activity in a T cell, using a host cell transfected with a vector expressing an HLA and a vector expressing a test polypeptide, and a T cell. A method for screening for a substance that promotes or suppresses immunity inducing activity. 19. An immunological method comprising using a host cell capable of expressing HLA transfected with a vector expressing a test polypeptide and a T cell, and measuring and evaluating the immunity-inducing activity of the T cell. A method for screening a substance that promotes or suppresses inducing activity. 20. The method according to claim 18 or 19, wherein the HLA is HLA-A1. 21. Promotion of immunity-inducing activity, comprising administering a test substance to the non-human animal according to any one of claims 13 to 15, and measuring and evaluating immunity-inducing activity on T cells of said non-human animal. Or a method of screening for an inhibitor. 22. The screening for a substance that promotes or suppresses immunity-inducing activity according to any one of claims 16 to 21, wherein the immunity-inducing activity is measured and evaluated by measuring and evaluating interferon-γ activity in T cells. Method. 23. The method according to claim 16, wherein the T cell is an HLA-A1 restricted T cell. A immunity-inducing activity-enhancing substance obtained by the screening method according to any one of claims 16 to 23. A immunity-inducing activity-suppressing substance obtained by the screening method according to any one of claims 16 to 23. 26. The protein or peptide according to any one of claims 4 to 8, or 11, or 2,
An antitumor agent comprising the immunity-inducing activity promoting substance according to 4, as an active ingredient. 27. The protein or peptide according to any one of claims 4 to 8, or claim 11, or claim 2.
5. An activated T cell induced by in vitro stimulation with the immunity-inducing activity promoting substance according to 5. 28. A method for detecting activated T cells or precursor cells thereof, comprising using an HLA molecule and the peptide according to claim 6 or 7. 29. A method for detecting an activated T cell or its precursor cell, which comprises using a complex of an HLA molecule and the peptide according to claim 6 or 7. 30. A method for detecting activated T cells or precursor cells thereof, comprising forming a complex of an HLA molecule and the peptide according to claim 6 or 7 on a cell surface or a carrier surface. 31. The method for detecting activated T cells or precursor cells thereof according to claim 30, wherein the carrier is fluorescent fine particles. 32. The method for detecting activated T cells or precursor cells thereof according to any one of claims 28 to 31, wherein the HLA molecule is HLA class I. 33. The method for detecting activated T cells or precursor cells thereof according to claim 32, wherein the HLA class I is HLA-A1. 34. A reagent for detecting activated T cells or precursor cells thereof, comprising an HLA molecule and the peptide according to claim 6 or 7. 35. A reagent for detecting activated T cells or precursor cells thereof, comprising a complex of an HLA molecule and the peptide according to claim 6 or 7. 36. The reagent for detecting activated T cells or precursor cells thereof according to claim 34, further comprising a carrier. 37. The reagent for detecting activated T cells or precursor cells thereof according to claim 36, wherein the carrier is fluorescent fine particles. 38. The reagent for detecting activated T cells or precursor cells thereof according to claim 34, wherein the HLA molecule is HLA class I. 39. The reagent for detecting activated T cells or precursor cells thereof according to claim 38, wherein the HLA class I is HLA-A1. 40. A D encoding the protein or peptide according to any one of claims 4 to 8 or 11,
A diagnostic probe for cancer comprising all or a part of the antisense strand of NA or RNA. 41. A diagnostic agent for cancer, comprising the probe for diagnosing cancer according to claim 40 and / or the antibody according to claim 10 or 11. 42. A diagnostic agent for cancer, which is malignant melanoma, esophageal cancer,
1 selected from bladder, lung, brain, pancreatic, prostate, breast, kidney, liver, leukemia, Burkitt's lymphoma
42. The diagnostic agent for cancer according to claim 41, which is a diagnostic agent for two or more cancers.